Proc. Natl. Acad. Sci. USA Vol. 90, pp. 2547-2550, March 1993 Evolution An intron within the 16S ribosomal RNA gene of the archaeon Pyrobaculum aerophilum (phylogeny/Crenarchaeota/Pyrobaculum islanicum/open reading frame) S. BURGGRAF*t, N. LARSENt, C. R. WOESEt, AND K. 0. STETTER* *Lehrstuhl fOr Mikrobiologie, Universitat Regensburg, 8400 Regensburg, Germany; and tDepartment of Microbiology, University of Illinois, 131 Burrill Hall, Urbana, IL 61801 Contributed by C. R. Woese, December Is, 1992

ABSTRACT The 16S rRNA genes of Pyrobaculum aero- Isolation of Nucleic Acids and Gene Amplification Proce- philum and Pyrobaculum islandicum were amplified by the dures. DNA and RNA were extracted and purified by stan- polymerase chain reaction, and the resulting products were dard procedures (14-16). The 16S rRNA gene was amplified sequenced directly. The two organisms are closely related by by the polymerase chain reaction (PCR) (17, 18). Amplifica- this measure (over 98% similar). However, they differ in that tion and purification of PCR products were performed as the (lone) 16S rRNA gene ofPyrobaculum aerophilum contains described earlier (19). a 713-bp intron not seen in the corresponding gene of Pyro- Sequencing. The dideoxynucleotide chain-termination baculum islandicum. To our knowledge, this is the only intron method was used to sequence both PCR-amplified DNA and so far reported in the small subunit rRNA gene ofa prokaryote. RNA (20-22). A set of standard archaeal "forward" and Upon excision the intron is circularized. A secondary structure "reverse" primers was used to sequence the 16S rRNAs (or model of the intron-containing rRNA suggests a splicing mech- their genes). Sequencing the insert in the Pb. aerophilum anism of the same type as that invoked for the tRNA introns of intron required two additional primers complementary to the Archaea and Eucarya and 23S rRNAs of the Archaea. The each strand at the middle of the insert: P-forward, 5'- intron contains an open reading frame whose protein transla- GGTTTTCCTATAGGCACCAG-3', and P-reverse, 5'- tion shows no certain homology with any known protein CTGGTGCCTATAGGAAAACC-3'. This regime allowed sequence. the complete sequencing of both strands of the intron.* Data Analyses. The sequences were aligned (23) against a Within the Archaea (1) introns have been detected in a representative collection of archaeal 16S rRNA sequences number of tRNA genes (2-6) and in the 23S rRNA genes of [Ribosomal Database Project (RDP), University of Illinois Desulfurococcus mobilis (7), Staphylothermus marinus (8), (24)]. Pairwise evolutionary distances (expressed as esti- and Pyrobaculum organotrophum (9). None have so far been mated changes per 100 nucleotides) were computed from reported in archaeal (or bacterial) 16S rRNA genes. Archaeal percent similarities, using the Jukes/Cantor correction (25) intron-containing precursor RNAs are characterized by a as modified by G. J. Olsen, described in ref. 26. Dendro- secondary structural motif (the so-called bulge-helix-bulge grams were constructed from evolutionary distance matrices structure) at the exon-intron boundaries, which is recognized by the method of De Soete (27). by the splicing enzyme (8). The splicing mechanism appears similar to that reported for eukaryotic tRNAs. After initial excision, the intron in the 23S rRNA of D. mobilis forms a RESULTS AND DISCUSSION stable circular RNA (10). Table 1 and Fig. 1 present the distance matrix analysis of an Recently, a hyperthermophilic rod-shaped marine ar- alignment of crenarchaeal species, using several euryar- chaeon has been isolated, whose morphology and growth chaeal species as outgroups. It can be seen that the two temperature suggest it might be related to the strictly anaer- species of Pyrobaculum are closely related to one another, obic sulfur-metabolizing archaea of the genus Pyrobaculum, their sequences being over 98% similar. Within the Crenar- organisms that have been isolated from continental solfataras chaeota Pyrobaculum is a member of the Thermoproteales, (11). However, the new marine isolate differs from known as phenotypic characterizations suggested; within that order Pyrobaculum species in growing either microaerophilically Pyrobaculum shows a specific and relatively close relation- or strictly anaerobically by denitrification. Because of its ship to the genus Thermoproteus, significantly closer than microaerophilic growth, it will be described as the new either genus is to Thermofilum (also a member of the order). species Pyrobaculum aerophilum (P. Volkl and K.O.S., Despite a close genotypic relationship, Pb. aerophilum unpublished results). Here we present a phylogenetic anal- exhibits a number ofphenotypic features that clearly separate ysis ofthe two Pyrobaculum species, Pb. aerophilum and Pb. it from both Pb. islandicum and Pb. organotrophum (ref. 9; islandicum, and characterize the intron found in the 16S P. Volkl and K.O.S., unpublished results): (i) Of the three rRNA gene of the former. species, only Pb. aerophilum is capable of growth at salt concentrations above 0.6%, which is that organism's optimal METHODS salt concentration; Pb. aerophilum will grow at salt concen- MATERIALS AND trations as high as 2.7%. (ii) Pb. aerophilum can respire either Organisms. Pb. aerophilum strain im2, Pb. islandicum aerobically or anaerobically, using oxygen or nitrate, respec- strain geo3, P. organotrophum, Pyrodictium occultum, and tively, as its electron acceptor. Elemental sulfur, which is Methanopyrus kandleri were grown in batch cultures as used as an electron acceptor by the strictly anaerobic Pb. described (refs. 11-13; P. Volkl and K.O.S., unpublished islandicum and Pb. organotrophum, serves only to inhibit the results). growth of Pb. aerophilum.

The publication costs of this article were defrayed in part by page charge VThe sequences reported in this paper have been deposited in the payment. This article must therefore be hereby marked "advertisement" GenBank data base (accession nos. L07510 for Pb. aerophilum and in accordance with 18 U.S.C. §1734 solely to indicate this fact. L07511 for Pb. islandicum). 2547 Downloaded by guest on September 29, 2021 2548 Evolution: Burggraf et al. Proc. Natl. Acad. Sci. USA 90 (1993) Table 1. Evolutionary distances between various archaeal 16S rRNA sequences Evolutionary distance Species 1 2 3 4 5 6 7 8 1. Pb. aerophilum 2. Pb. islandicum 1.6 3. Thp. tenax 4.0 4.6 4. Tmf. pendens 12.9 12.3 13.0 5. D. mobilis 15.3 14.5 14.4 14.1 6. Pyr. occultum 13.4 13.0 12.3 12.4 7.5 7. S. solfataricus 17.4 16.9 17.6 17.4 13.4 12.7 8. Tc. celer 21.0 19.9 21.2 19.1 19.6 18.7 25.4 9. M. vannielii 29.8 29.9 29.9 28.4 26.6 26.1 29.7 21.7 Only those positions in which a known nucleotide is present in all species are used in the calculation. The sequences used have these GenBank accession numbers: D. mobilis, M36474; Methanococcus vannielii, M36507; Pb. aerophilum, L07510; Pb. islandicum, L07511; Pyr. occultum, M21087; Sulfolobus solfataricus, X03235; Thermococcus celer, M21529; Ther- mofilum pendens, X14835; and Thermoproteus tenax, M35966. Perhaps the most striking difference between Pb. aero- Pb. organotrophum (7, 9). And, like these 23S rDNA introns, philum and the other two Pyrobaculum species, at least from the Pb. aerophilum insertion also contains an open reading a genetic perspective, is the presence of an intron in the 16S frame. rRNA gene only in the former. The PCR primers employed To verify that the insertion was indeed an intron, a reverse in this study-7-23 and 1539-1524 in the 16S rRNA (Esche- primer complementary to a region in the 16S rRNA down- richia coli numbering)-yield a nearly full-length gene-i.e., stream of the insert was used to sequence through the region a product that runs as a 1.5-kb band on agarose gel electro- in a total cellular RNA preparation. The resulting sequence phoresis. A product of normal size was given by Pb. island- corresponded to a normal version ofthe (Pb. aerophilum) 16S icum, Pb. organotrophum, Pyr. occultum, and M. kandleri. rRNA sequence, demonstrating that the insertion had indeed However, in the same experiment Pb. aerophilum yielded an been removed and the rRNA religated during processing of unexpectedly large, 2.2-kb, band as the only amplification the rRNA transcript. product. Direct sequencing of this band revealed an insertion To determine whether the excised intron is circularized, a of713 bp after position 373 (or alternatively, 372 or 374) ofthe reverse primer complementary to a region within the intron 16S rRNA (E. coli numbering); see Fig. 2. This insertion is in and close to its 5' end was used to prime a sequencing the same size range (actually about 15-20% larger) as those reaction from total cellular RNA. The resulting (reverse) reported for the introns in the 23S rDNA of D. mobilis and sequence continued beyond the 5' terminus ofthe intron into Pyrobaculum aerophilum

Pyrobaculum islandicum

I Thermoproteus tenax

Thermofilum pendens

occultum

,mobilis

10%

FIG. 1. Phylogenetic tree for seven crenarchaeal species, derived from the evolutionary distances of Table 1. Several euryarchaeal species have been used as outgroups, to establish the root. Scale bar indicates 10 changes per 100 residues. Downloaded by guest on September 29, 2021 Evolution: Burggraf et al. Proc. Natl. Acad. Sci. USA 90 (1993) 2549

390 AAUDG.GGAAGGCCGGCUCCUCAUGACGGAGGAAUUUAACCUAAAUGAAGUCAAAUAUUCG M T E E F N L N E V K Y S A [CCGCGI CGG Gl AAAUUUGACAAGAAACGUAACAUCAGAGUGCCGGACAAGCCAACAGAACUUCUAGCAGAG 11 , 111 16S R V P D K P T E L L A E A A GC 35 K F D K K RN I CGIGCGU -5- GAGAUAGCAAUACACUUAGGAGACGGCUACCUUUUUUACGACGAAGAGGAUAAUAGCUAU E I A I H L G D G Y LF YD EE D N S Y 380U G A 370 G ,tA C, A R Y G V G L N P K T E V E Y A Y A V A E GA-U C-G L I G E V YG Y K P P V R K A R I ElI M C-G UCCCUAGCGAUAGGGACGUUUAAACACAAAGUGCUCGGUUUUCCUAUAGGCACCAGGACG U*G A I G T F K H K V L G F P I G T R T C-G S L GGAAACGAGAAGAUGCCUCGGAUAGGCCGGAUAUUACAAGAUGAGAAAUUCGCCACGGCG C-G G N E K M P R I G R I L Q D E K F A T A U-A AUCAUAAGAGGGCUUUUAGAUACCGAAGGAUCGGUGAAAAAGAUAUCUAGGACUUUGGGG C-G I I R G L L D T E G S V K K I S R T L G C-G AUUGUUGUGAAGCAGAGAAACAAGGAUAUCGCUAUGUUCUACGCCCAGUGUAUUUCUCUA G-C I S L G-C I V V K Q R N K D I AM FY A Q C C-G UUGGGUUUCACUCCACGAAUAUACCAAUGGAACGAAAAGAACAAGCCUAUCUACGCCGUC C-G L G F T P R I Y Q W N E K N K P I Y A V G-C GUGGUACUCGGCAAGGAUGUGGUAGAAGACUUCCUCCGGACUAUAAAACCCAGAAAUCCC V V L G K D V V E D F L R T I K P RN P UCUAAGACCCCCUCUUUUUAGUCUUCCUCUCACGCCGGCCUCCUCCAGCGGA 677 n S K T P S F * FIG. 4. Nucleotide sequence of the Pb. aerophilum intron, show- ing the amino acid translation of the major open reading frame. FIG. 2. Site of insertion of the intron in Pb. aerophilum small Regions of the nucleotide sequence that form a helical stalk in Fig. subunit rRNA gene. The area of the 16S rRNA from positions 367 to 393 (E. coli numbering) is shown. The normal 16S rRNA secondary 2 are underlined. structure is boxed. Arrows indicate possible junctions between the In the present case one of the reading frames extends from mature n, nucleotides. intron and rRNA; the beginning of the intron up to position 680 before a the intron's 3' terminal portion, a result that could have termination codon occurs. (The other five frames each con- occurred only were the excised intron circular (10). Circu- tain 8-19 termination codons, more or less randomly distrib- larization of the intron does not involve any truncation, as uted.) The initial codon in the large open reading frame is circularization of type I self-splicing introns does (28). In this AUG. However, if one requires that a Shine-Delgarno se- respect too the present intron resembles the introns found in quence precede an initial methionine codon, then a second the DNA encoding D. mobilis and Pb. organotrophum 23S AUG codon in the same reading frame, at position 23 of the intron, can function as the true start codon; in this case the rRNA (7, 9, 10). preceding GGGGG stretch (beginning at position 4; see Fig. a representation in Fig. 3 shows secondary structural 2) might serve as the Shine-Delgarno sequence. Using this which the Pb. aerophilum intron and surrounding rRNA are AUG start codon, the resulting protein would be 219 amino folded so as to conform (as far as possible) to the bulge- acids in length. The full intron sequence and the amino acid helix-bulge structure typical of archaeal introns (1-9). translation of its open reading frame are shown in Fig. 4. A computer search of the National Center for Biotechnology 380-G CA A Information data base has failed to turn up a clear homolog 390 for the inferred protein sequence. All six possible intron c reading frames were searched with BLAST (30) against the _GACG GenBank, EMBL, and SwissProt data bases. U G On an evolutionary time scale at least, introns are transient A entities. The presence vs. absence of an intron in 16S rRNA of Pb. aerophilum vs. Pb. islandicum is merely one example G-C of this instability; among archaeal 23S rRNAs several others C -5-G370 G - CA *- were already known-i.e., the intron-containing species D. A mobilis and Pb. organotrophum vs. their intron-free close A relatives Desulfurococcus mucosus and Pb. islandicum, re- A-U C-G spectively (7, 9). C-G So far, the instances of introns in rRNA genes among the U-G C-G archaea have been confined to (hyperthermophilic) crenar- C-G chaeal species. Although a few tRNA introns are known A tRNA U-A among the euryarchaeota, the number of introns C-G reported among the crenarchaeota is far larger (1-6). And so C-G in rRNA and tRNA G-C far, archaeal introns have been seen only G-C genes, although an intervening sequence that may be a C-G protein intron(s) has been reported in the DNA polymerase C-G G-C gene from the euryarchaeote Thermococcus litoralis (29). We thank P. Volkl and R. Huber for providing cells of the 677 n Pyrobaculum species. We are grateful to Prof. Roger Garrett for stimulating discussion. Also, we thank Dr. A. Lindauer for assis- tance with the computer searches. FIG. 3. Pb. aerophilum intron and surrounding sequence folded into a configuration resembling the bulge-helix-bulge motif common 1. Woese, C. R., Kandler, 0. & Wheelis, M. L. (1990) Proc. Natl. among archaeal tRNA and rRNA introns (1-9). Those features of the Acad. Sci. USA 87, 4576-4579. normal 16S rRNA secondary structure retained in this configuration 2. Kaine, B. P., Gupta, R. & Woese, C. R. (1983) Proc. Natl. are boxed (cf. Fig. 2). Acad. Sci. USA 80, 3309-3312. Downloaded by guest on September 29, 2021 2550 Evolution: Burggraf et al. Proc. Natl. Acad. Sci. USA 90 (1993) 3. Daniels, C. J., Gupta, R. & Doolittle, W. F. (1985) J. Biol. 19. Burggraf, S., Stetter, K. O., Rouviere, P. & Woese, C. R. Chem. 260, 3132-3134. (1991) Syst. Appl. Microbiol. 14, 346-351. 4. Kaine, B. P. (1987) J. Mol. Evol. 25, 248-254. 20. Biggin, M. D., Gibson, T. J. & Hong, G. F. (1983) Proc. Natl. 5. Kjems, J., Leffers, H., Olesen, T. & Garrett, R. A. (1989) J. Acad. Sci. USA 80, 3963-3965. Biol. Chem. 264, 17834-17837. 21. Sanger, F., Nicklen, S. & Coulson, A. R. (1977) Proc. Natl. 6. Wich, G., Leinfelder, W. & Bock, A. (1987) EMBO J. 6, Acad. Sci. USA 74, 5463-5467. 523-528. 22. Lane, D. J., Pace, B., Olsen, G. J., Stahl, D. A., Sogin, M. L. 7. Kjems, J. & Garrett, R. A. (1985) Nature (London) 318, 675- & Pace, N. R. (1985) Proc. Natl. Acad. Sci. USA 82, 6955- 677. 6959. 8. Kjems, J. & Garrett, R. A. (1991) Proc. Natl. Acad. Sci. USA 23. Woese, C. R., Gutell, R., Gupta, R. & Noller, H. F. (1983) 88, 439-443. Microbiol. Rev. 47, 621-669. 9. Kjems, J., Larsen, N., Dalgaard, J. Z. & Garrett, R. A. (1992) 24. Olsen, G. J., Overbeek, R., Larsen, N., Marsh, T. L., Mc- Syst. Appl. Microbiol. 15, 203-208. Caughey, M. J., Maciukenas, M. A., Kuan, W.-M., Macke, 10. Kjems, J. & Garrett, R. A. (1988) Cell 54, 693-703. T. J., Xing, Y. & Woese, C. R. (1992) Nucleic Acids Res. 11. Huber, R., Kristjansson, J. K. & Stetter, K. 0. (1987) Arch. Suppl. 20, 2199-2200. Microbiol. 149, 95-101. 25. Jukes, T. H. & Cantor, C. R. (1969) in Mammalian Protein 12. Stetter, K. O., Konig, H. & Stackebrandt, E. (1983) Syst. Appl. Metabolism, ed. Munro, H. N. (Academic, New York), pp. Microbiol. 4, 535-551. 21-132. 13. Huber, R., Kurr, M., Jannasch, H. W. & Stetter, K. 0. (1989) 26. Weisburg, W. G., Tully, J. G., Rose, D. L., Petzel, J. P., Nature (London) 342, 833-834. Oyaizu, H., Yang, D., Mandelco, L., Sechrest, J., Lawrence, 14. Marmur, J. (1961) J. Mol. Biol. 3, 208-218. T. G., Van Etten, J., Maniloff, J. & Woese, C. R. (1989) J. 15. Woese, C. R., Sogin, M., Stahl, D. A., Lewis, B. J. & Bonen, Bacteriol. 171, 6455-6467. L. (1976) J. Mol. Evol. 7, 197-213. 27. De Soete, G. (1983) Psychometrika 48, 621-626. 16. Yang, D., Oyaizu, Y., Oyaizu, H., Olsen, G. J. & Woese, C. R. 28. Kruger, K., Grabowski, P. J., Zaug, A. J., Sands, J., (1985) Proc. Natl. Acad. Sci. USA 82, 4443-4447. Gottschling, D. E. & Cech, T. R. (1982) Cell 31, 147-157. 17. Saiki, R. K., Gelfand, D. H., Stoffel, S., Scharf, S. J., Higuchi, 29. Perler, F. B., Comb, D. G., Jack, W. E., Moran, L. S., Qiang, R., Horn, G. T., Mullis, K. B. & Erlich, H. A. (1988) Science B., Kucera, R. B., Benner, J., Slatko, B. E., Nwankwo, D. 0., 239, 487-491. Hempstead, S. K., Carlow, C. K. S. & Jannasch, H. (1992) 18. Saiki, R. K., Scharf, S. J., Faloona, F., Mullis, K. B., Horn, Proc. Natl. Acad. Sci. USA 89, 5577-5581. G. T., Erlich, H. A. & Arnheim, N. (1985) Science 230, 1350- 30. Altschul, S. F., Gish, W., Miller, W., Myers, E. W. & Lipman, 1354. D. J. (1990) J. Mol. Biol. 215, 403-410. Downloaded by guest on September 29, 2021