DOCSLIB.ORG

An Intron Within the 16S Ribosomal RNA Gene of the Archaeon Pyrobaculum Aerophilum (Phylogeny/Crenarchaeota/Pyrobaculum Islanicum/Open Reading Frame) S

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
An Intron Within the 16S Ribosomal RNA Gene of the Archaeon Pyrobaculum Aerophilum (Phylogeny/Crenarchaeota/Pyrobaculum Islanicum/Open Reading Frame) S Proc. Natl. Acad. Sci. USA Vol. 90, pp. 2547-2550, March 1993 Evolution An intron within the 16S ribosomal RNA gene of the archaeon Pyrobaculum aerophilum (phylogeny/Crenarchaeota/Pyrobaculum islanicum/open reading frame) S. BURGGRAF*t, N. LARSENt, C. R. WOESEt, AND K. 0. STETTER* *Lehrstuhl fOr Mikrobiologie, Universitat Regensburg, 8400 Regensburg, Germany; and tDepartment of Microbiology, University of Illinois, 131 Burrill Hall, Urbana, IL 61801 Contributed by C. R. Woese, December Is, 1992 ABSTRACT The 16S rRNA genes of Pyrobaculum aero- Isolation of Nucleic Acids and Gene Amplification Proce- philum and Pyrobaculum islandicum were amplified by the dures. DNA and RNA were extracted and purified by stan- polymerase chain reaction, and the resulting products were dard procedures (14-16). The 16S rRNA gene was amplified sequenced directly. The two organisms are closely related by by the polymerase chain reaction (PCR) (17, 18). Amplifica- this measure (over 98% similar). However, they differ in that tion and purification of PCR products were performed as the (lone) 16S rRNA gene ofPyrobaculum aerophilum contains described earlier (19). a 713-bp intron not seen in the corresponding gene of Pyro- Sequencing. The dideoxynucleotide chain-termination baculum islandicum. To our knowledge, this is the only intron method was used to sequence both PCR-amplified DNA and so far reported in the small subunit rRNA gene ofa prokaryote. RNA (20-22). A set of standard archaeal "forward" and Upon excision the intron is circularized. A secondary structure "reverse" primers was used to sequence the 16S rRNAs (or model of the intron-containing rRNA suggests a splicing mech- their genes). Sequencing the insert in the Pb. aerophilum anism of the same type as that invoked for the tRNA introns of intron required two additional primers complementary to the Archaea and Eucarya and 23S rRNAs of the Archaea. The each strand at the middle of the insert: P-forward, 5'- intron contains an open reading frame whose protein transla- GGTTTTCCTATAGGCACCAG-3', and P-reverse, 5'- tion shows no certain homology with any known protein CTGGTGCCTATAGGAAAACC-3'. This regime allowed sequence. the complete sequencing of both strands of the intron.* Data Analyses. The sequences were aligned (23) against a Within the Archaea (1) introns have been detected in a representative collection of archaeal 16S rRNA sequences number of tRNA genes (2-6) and in the 23S rRNA genes of [Ribosomal Database Project (RDP), University of Illinois Desulfurococcus mobilis (7), Staphylothermus marinus (8), (24)]. Pairwise evolutionary distances (expressed as esti- and Pyrobaculum organotrophum (9). None have so far been mated changes per 100 nucleotides) were computed from reported in archaeal (or bacterial) 16S rRNA genes. Archaeal percent similarities, using the Jukes/Cantor correction (25) intron-containing precursor RNAs are characterized by a as modified by G. J. Olsen, described in ref. 26. Dendro- secondary structural motif (the so-called bulge-helix-bulge grams were constructed from evolutionary distance matrices structure) at the exon-intron boundaries, which is recognized by the method of De Soete (27). by the splicing enzyme (8). The splicing mechanism appears similar to that reported for eukaryotic tRNAs. After initial excision, the intron in the 23S rRNA of D. mobilis forms a RESULTS AND DISCUSSION stable circular RNA (10). Table 1 and Fig. 1 present the distance matrix analysis of an Recently, a hyperthermophilic rod-shaped marine ar- alignment of crenarchaeal species, using several euryar- chaeon has been isolated, whose morphology and growth chaeal species as outgroups. It can be seen that the two temperature suggest it might be related to the strictly anaer- species of Pyrobaculum are closely related to one another, obic sulfur-metabolizing archaea of the genus Pyrobaculum, their sequences being over 98% similar. Within the Crenar- organisms that have been isolated from continental solfataras chaeota Pyrobaculum is a member of the Thermoproteales, (11). However, the new marine isolate differs from known as phenotypic characterizations suggested; within that order Pyrobaculum species in growing either microaerophilically Pyrobaculum shows a specific and relatively close relation- or strictly anaerobically by denitrification. Because of its ship to the genus Thermoproteus, significantly closer than microaerophilic growth, it will be described as the new either genus is to Thermofilum (also a member of the order). species Pyrobaculum aerophilum (P. Volkl and K.O.S., Despite a close genotypic relationship, Pb. aerophilum unpublished results). Here we present a phylogenetic anal- exhibits a number ofphenotypic features that clearly separate ysis ofthe two Pyrobaculum species, Pb. aerophilum and Pb. it from both Pb. islandicum and Pb. organotrophum (ref. 9; islandicum, and characterize the intron found in the 16S P. Volkl and K.O.S., unpublished results): (i) Of the three rRNA gene of the former. species, only Pb. aerophilum is capable of growth at salt concentrations above 0.6%, which is that organism's optimal METHODS salt concentration; Pb. aerophilum will grow at salt concen- MATERIALS AND trations as high as 2.7%. (ii) Pb. aerophilum can respire either Organisms. Pb. aerophilum strain im2, Pb. islandicum aerobically or anaerobically, using oxygen or nitrate, respec- strain geo3, P. organotrophum, Pyrodictium occultum, and tively, as its electron acceptor. Elemental sulfur, which is Methanopyrus kandleri were grown in batch cultures as used as an electron acceptor by the strictly anaerobic Pb. described (refs. 11-13; P. Volkl and K.O.S., unpublished islandicum and Pb. organotrophum, serves only to inhibit the results). growth of Pb. aerophilum. The publication costs of this article were defrayed in part by page charge VThe sequences reported in this paper have been deposited in the payment. This article must therefore be hereby marked "advertisement" GenBank data base (accession nos. L07510 for Pb. aerophilum and in accordance with 18 U.S.C. §1734 solely to indicate this fact. L07511 for Pb. islandicum). 2547 Downloaded by guest on September 29, 2021 2548 Evolution: Burggraf et al. Proc. Natl. Acad. Sci. USA 90 (1993) Table 1. Evolutionary distances between various archaeal 16S rRNA sequences Evolutionary distance Species 1 2 3 4 5 6 7 8 1. Pb. aerophilum 2. Pb. islandicum 1.6 3. Thp. tenax 4.0 4.6 4. Tmf. pendens 12.9 12.3 13.0 5. D. mobilis 15.3 14.5 14.4 14.1 6. Pyr. occultum 13.4 13.0 12.3 12.4 7.5 7. S. solfataricus 17.4 16.9 17.6 17.4 13.4 12.7 8. Tc. celer 21.0 19.9 21.2 19.1 19.6 18.7 25.4 9. M. vannielii 29.8 29.9 29.9 28.4 26.6 26.1 29.7 21.7 Only those positions in which a known nucleotide is present in all species are used in the calculation. The sequences used have these GenBank accession numbers: D. mobilis, M36474; Methanococcus vannielii, M36507; Pb. aerophilum, L07510; Pb. islandicum, L07511; Pyr. occultum, M21087; Sulfolobus solfataricus, X03235; Thermococcus celer, M21529; Ther- mofilum pendens, X14835; and Thermoproteus tenax, M35966. Perhaps the most striking difference between Pb. aero- Pb. organotrophum (7, 9). And, like these 23S rDNA introns, philum and the other two Pyrobaculum species, at least from the Pb. aerophilum insertion also contains an open reading a genetic perspective, is the presence of an intron in the 16S frame. rRNA gene only in the former. The PCR primers employed To verify that the insertion was indeed an intron, a reverse in this study-7-23 and 1539-1524 in the 16S rRNA (Esche- primer complementary to a region in the 16S rRNA down- richia coli numbering)-yield a nearly full-length gene-i.e., stream of the insert was used to sequence through the region a product that runs as a 1.5-kb band on agarose gel electro- in a total cellular RNA preparation. The resulting sequence phoresis. A product of normal size was given by Pb. island- corresponded to a normal version ofthe (Pb. aerophilum) 16S icum, Pb. organotrophum, Pyr. occultum, and M. kandleri. rRNA sequence, demonstrating that the insertion had indeed However, in the same experiment Pb. aerophilum yielded an been removed and the rRNA religated during processing of unexpectedly large, 2.2-kb, band as the only amplification the rRNA transcript. product. Direct sequencing of this band revealed an insertion To determine whether the excised intron is circularized, a of713 bp after position 373 (or alternatively, 372 or 374) ofthe reverse primer complementary to a region within the intron 16S rRNA (E. coli numbering); see Fig. 2. This insertion is in and close to its 5' end was used to prime a sequencing the same size range (actually about 15-20% larger) as those reaction from total cellular RNA. The resulting (reverse) reported for the introns in the 23S rDNA of D. mobilis and sequence continued beyond the 5' terminus ofthe intron into Pyrobaculum aerophilum Pyrobaculum islandicum I Thermoproteus tenax Thermofilum pendens occultum ,mobilis 10% FIG. 1. Phylogenetic tree for seven crenarchaeal species, derived from the evolutionary distances of Table 1. Several euryarchaeal species have been used as outgroups, to establish the root. Scale bar indicates 10 changes per 100 residues. Downloaded by guest on September 29, 2021 Evolution: Burggraf et al. Proc. Natl. Acad. Sci. USA 90 (1993) 2549 390 AAUDG.GGAAGGCCGGCUCCUCAUGACGGAGGAAUUUAACCUAAAUGAAGUCAAAUAUUCG M T E E F N L N E V K Y S A [CCGCGI CGG Gl AAAUUUGACAAGAAACGUAACAUCAGAGUGCCGGACAAGCCAACAGAACUUCUAGCAGAG 11 , 111 16S R V P D K P
Load more

Recommended publications
  • Diversity of Understudied Archaeal and Bacterial Populations of Yellowstone National Park: from Genes to Genomes Daniel Colman
    University of New Mexico UNM Digital Repository Biology ETDs Electronic Theses and Dissertations 7-1-2015 Diversity of understudied archaeal and bacterial populations of Yellowstone National Park: from genes to genomes Daniel Colman Follow this and additional works at: https://digitalrepository.unm.edu/biol_etds Recommended Citation Colman, Daniel. "Diversity of understudied archaeal and bacterial populations of Yellowstone National Park: from genes to genomes." (2015). https://digitalrepository.unm.edu/biol_etds/18 This Dissertation is brought to you for free and open access by the Electronic Theses and Dissertations at UNM Digital Repository. It has been accepted for inclusion in Biology ETDs by an authorized administrator of UNM Digital Repository. For more information, please contact [email protected]. Daniel Robert Colman Candidate Biology Department This dissertation is approved, and it is acceptable in quality and form for publication: Approved by the Dissertation Committee: Cristina Takacs-Vesbach , Chairperson Robert Sinsabaugh Laura Crossey Diana Northup i Diversity of understudied archaeal and bacterial populations from Yellowstone National Park: from genes to genomes by Daniel Robert Colman B.S. Biology, University of New Mexico, 2009 DISSERTATION Submitted in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy Biology The University of New Mexico Albuquerque, New Mexico July 2015 ii DEDICATION I would like to dedicate this dissertation to my late grandfather, Kenneth Leo Colman, associate professor of Animal Science in the Wool laboratory at Montana State University, who even very near the end of his earthly tenure, thought it pertinent to quiz my knowledge of oxidized nitrogen compounds. He was a man of great curiosity about the natural world, and to whom I owe an acknowledgement for his legacy of intellectual (and actual) wanderlust.
    [Show full text]
  • Marsarchaeota Are an Aerobic Archaeal Lineage Abundant in Geothermal Iron Oxide Microbial Mats
    Marsarchaeota are an aerobic archaeal lineage abundant in geothermal iron oxide microbial mats Authors: Zackary J. Jay, Jacob P. Beam, Mansur Dlakic, Douglas B. Rusch, Mark A. Kozubal, and William P. Inskeep This is a postprint of an article that originally appeared in Nature Microbiology on May 14, 2018. The final version can be found at https://dx.doi.org/10.1038/s41564-018-0163-1. Jay, Zackary J. , Jacob P. Beam, Mensur Dlakic, Douglas B. Rusch, Mark A. Kozubal, and William P. Inskeep. "Marsarchaeota are an aerobic archaeal lineage abundant in geothermal iron oxide microbial mats." Nature Microbiology 3, no. 6 (May 2018): 732-740. DOI: 10.1038/ s41564-018-0163-1. Made available through Montana State University’s ScholarWorks scholarworks.montana.edu Marsarchaeota are an aerobic archaeal lineage abundant in geothermal iron oxide microbial mats Zackary J. Jay1,4,7, Jacob P. Beam1,5,7, Mensur Dlakić2, Douglas B. Rusch3, Mark A. Kozubal1,6 and William P. Inskeep 1* The discovery of archaeal lineages is critical to our understanding of the universal tree of life and evolutionary history of the Earth. Geochemically diverse thermal environments in Yellowstone National Park provide unprecedented opportunities for studying archaea in habitats that may represent analogues of early Earth. Here, we report the discovery and character- ization of a phylum-level archaeal lineage proposed and herein referred to as the ‘Marsarchaeota’, after the red planet. The Marsarchaeota contains at least two major subgroups prevalent in acidic, microaerobic geothermal Fe(III) oxide microbial mats across a temperature range from ~50–80 °C. Metagenomics, single-cell sequencing, enrichment culturing and in situ transcrip- tional analyses reveal their biogeochemical role as facultative aerobic chemoorganotrophs that may also mediate the reduction of Fe(III).
    [Show full text]
  • Large-Scale Trna Intron Transposition in The
    Large-Scale tRNA Intron Transposition in the Archaeal Order Thermoproteales Represents a Novel Mechanism of Intron Gain Kosuke Fujishima,1,2 Junichi Sugahara,1,3 Masaru Tomita,1,2,3 and Akio Kanai*,1,2,3 1Institute for Advanced Biosciences, Keio University, Tsuruoka, Japan 2Department of Environmental Information, Keio University, Fujisawa, Japan 3Systems Biology Program, Graduate School of Media and Governance, Keio University, Fujisawa, Japan *Corresponding author: E-mail: [email protected]. Associate editor: Martin Embley Abstract Research article Recently, diverse arrangements of transfer RNA (tRNA) genes have been found in the domain Archaea, in which the tRNA is interrupted by a maximum of three introns or is even fragmented into two or three genes. Whereas most of the eukaryotic tRNA introns are inserted strictly at the canonical nucleotide position (37/38), archaeal intron-containing tRNAs have a wide diversity of small tRNA introns, which differ in their numbers and locations. This feature is especially pronounced in the archaeal order Thermoproteales. In this study, we performed a comprehensive sequence comparison of 286 tRNA introns and their genes in seven Thermoproteales species to clarify how these introns have emerged and diversified during tRNA gene evolution. We identified 46 intron groups containing sets of highly similar sequences (.70%) and showed that 16 of them contain sequences from evolutionarily distinct tRNA genes. The phylogeny of these 16 intron groups indicates that transposition events have occurred at least seven times throughout the evolution of Thermoproteales. These findings suggest that frequent intron transposition occurs among the tRNA genes of Thermoproteales. Further computational analysis revealed limited insertion positions and corresponding amino acid types of tRNA genes.
    [Show full text]
  • Phylogenetics of Archaeal Lipids Amy Kelly 9/27/2006 Outline
    Phylogenetics of Archaeal Lipids Amy Kelly 9/27/2006 Outline • Phlogenetics of Archaea • Phlogenetics of archaeal lipids • Papers Phyla • Two? main phyla – Euryarchaeota • Methanogens • Extreme halophiles • Extreme thermophiles • Sulfate-reducing – Crenarchaeota • Extreme thermophiles – Korarchaeota? • Hyperthermophiles • indicated only by environmental DNA sequences – Nanoarchaeum? • N. equitans a fast evolving euryarchaeal lineage, not novel, early diverging archaeal phylum – Ancient archael group? • In deepest brances of Crenarchaea? Euryarchaea? Archaeal Lipids • Methanogens – Di- and tetra-ethers of glycerol and isoprenoid alcohols – Core mostly archaeol or caldarchaeol – Core sometimes sn-2- or Images removed due to sn-3-hydroxyarchaeol or copyright considerations. macrocyclic archaeol –PMI • Halophiles – Similar to methanogens – Exclusively synthesize bacterioruberin • Marine Crenarchaea Depositional Archaeal Lipids Biological Origin Environment Crocetane methanotrophs? methane seeps? methanogens, PMI (2,6,10,15,19-pentamethylicosane) methanotrophs hypersaline, anoxic Squalane hypersaline? C31-C40 head-to-head isoprenoids Smit & Mushegian • “Lost” enzymes of MVA pathway must exist – Phosphomevalonate kinase (PMK) – Diphosphomevalonate decarboxylase – Isopentenyl diphosphate isomerase (IPPI) Kaneda et al. 2001 Rohdich et al. 2001 Boucher et al. • Isoprenoid biosynthesis of archaea evolved through a combination of processes – Co-option of ancestral enzymes – Modification of enzymatic specificity – Orthologous and non-orthologous gene
    [Show full text]
  • Displacement of the Canonical Single-Stranded DNA-Binding Protein in the Thermoproteales
    Displacement of the canonical single-stranded DNA-binding protein in the Thermoproteales Sonia Paytubia,1,2, Stephen A. McMahona,2, Shirley Grahama, Huanting Liua, Catherine H. Bottinga, Kira S. Makarovab, Eugene V. Kooninb, James H. Naismitha,3, and Malcolm F. Whitea,3 aBiomedical Sciences Research Complex, University of St Andrews, Fife KY16 9ST, United Kingdom; and bNational Center for Biotechnology Information, National Library of Medicine, National Institutes of Health, Bethesda, MD 20894 AUTHOR SUMMARY Proteins are the major structural and biochemical route involved direct puri- operational components of cells. Even fication and identification of proteins the simplest organisms possess hundreds thatcouldbindtossDNAinoneofthe of different proteins, and more complex Thermoproteales, Thermoproteus tenax. organisms typically have many thou- This approach resulted in the identifi- sands. Because all living beings, from cation of the product of the gene ttx1576 microbes to humans, are related by as a candidate for the missing SSB. evolution, they share a core set of pro- We proceeded to characterize the teins in common. Proteins perform properties of the Ttx1576 protein, (which fundamental roles in key metabolic we renamed “ThermoDBP” for Ther- processes and in the processing of in- moproteales DNA-binding protein), formation from DNA via RNA to pro- showing that it has all the biochemical teins. A notable example is the ssDNA- properties consistent with a role as a binding protein, SSB, which is essential functional SSB, including a clear prefer- for DNA replication and repair and is ence for ssDNA binding and low se- widely considered to be one of the quence specificity. Using crystallographic few core universal proteins shared by analysis, we solved the structure of the alllifeforms.Herewedemonstrate Fig.
    [Show full text]
  • Ep 1734129 B1
    (19) TZZ_¥_ _T (11) EP 1 734 129 B1 (12) EUROPEAN PATENT SPECIFICATION (45) Date of publication and mention (51) Int Cl.: of the grant of the patent: C12P 7/24 (2006.01) C12P 17/06 (2006.01) 24.02.2016 Bulletin 2016/08 (86) International application number: (21) Application number: 05727417.7 PCT/JP2005/005719 (22) Date of filing: 28.03.2005 (87) International publication number: WO 2005/098012 (20.10.2005 Gazette 2005/42) (54) PROCESS FOR PRODUCTION OF CHIRAL HYDROXYALDEHYDES VERFAHREN ZUR HERSTELLUNG CHIRALER HYDROXYALDEHYDE PROCÉDÉ DE FABRICATION D’HYDROXYALDÉHYDES CHIRALES (84) Designated Contracting States: (56) References cited: AT BE BG CH CY CZ DE DK EE ES FI FR GB GR WO-A2-03/006656 HU IE IS IT LI LT LU MC NL PL PT RO SE SI SK TR • SAKURABA, H. ET AL.: "The First Crystal (30) Priority: 29.03.2004 JP 2004095263 Structure of Archaeal Aldolase. unique tetrameric structure of (43) Date of publication of application: 2-deoxy-D-ribose-5-phosphate aldolase from the 20.12.2006 Bulletin 2006/51 hyperthermophilic Archaea Aeropyrum pernix" JOURNAL OF BIOLOGICAL CHEMISTRY, vol. (73) Proprietor: Mitsui Chemicals, Inc. 278, no. 12, 21 March 2003 (2003-03-21), pages Tokyo 105-7117 (JP) 10799-10806, XP002596667 • SAKURABA, H. ET AL.: "Sequential Aldol (72) Inventors: Condensation Catalyzed by Hyperthermophilic • MATSUMOTO, Kazuya, 2-Deoxy-D-Ribose-5-Phosphate Aldolase" c/o Mitsui Chemicals, Inc. APPLIED AND ENVIRONMENTAL Mobara-shi, Chiba 2970017 (JP) MICROBIOLOGY, vol. 73, no. 22, November 2007 • KAZUNO, Yasushi, (2007-11), pages 7427-7434, XP002596660 c/o Mitsui Chemicals, Inc.
    [Show full text]
  • Archaeology of Eukaryotic DNA Replication
    Downloaded from http://cshperspectives.cshlp.org/ on September 25, 2021 - Published by Cold Spring Harbor Laboratory Press Archaeology of Eukaryotic DNA Replication Kira S. Makarova and Eugene V. Koonin National Center for Biotechnology Information, National Library of Medicine, National Institutes of Health, Bethesda, Maryland 20894 Correspondence: [email protected] Recent advances in the characterization of the archaeal DNA replication system together with comparative genomic analysis have led to the identification of several previously un- characterized archaeal proteins involved in replication and currently reveal a nearly com- plete correspondence between the components of the archaeal and eukaryotic replication machineries. It can be inferred that the archaeal ancestor of eukaryotes and even the last common ancestor of all extant archaea possessed replication machineries that were compa- rable in complexity to the eukaryotic replication system. The eukaryotic replication system encompasses multiple paralogs of ancestral components such that heteromeric complexes in eukaryotes replace archaeal homomeric complexes, apparently along with subfunctionali- zation of the eukaryotic complex subunits. In the archaea, parallel, lineage-specific dupli- cations of many genes encoding replication machinery components are detectable as well; most of these archaeal paralogs remain to be functionally characterized. The archaeal rep- lication system shows remarkable plasticity whereby even some essential components such as DNA polymerase and single-stranded DNA-binding protein are displaced by unrelated proteins with analogous activities in some lineages. ouble-stranded DNA is the molecule that Okazaki fragments (Kornberg and Baker 2005; Dcarries genetic information in all cellular Barry and Bell 2006; Hamdan and Richardson life-forms; thus, replication of this genetic ma- 2009; Hamdan and van Oijen 2010).
    [Show full text]
  • Pyrobaculum Igneiluti Sp. Nov., a Novel Anaerobic Hyperthermophilic Archaeon That Reduces Thiosulfate and Ferric Iron
    TAXONOMIC DESCRIPTION Lee et al., Int J Syst Evol Microbiol 2017;67:1714–1719 DOI 10.1099/ijsem.0.001850 Pyrobaculum igneiluti sp. nov., a novel anaerobic hyperthermophilic archaeon that reduces thiosulfate and ferric iron Jerry Y. Lee, Brenda Iglesias, Caleb E. Chu, Daniel J. P. Lawrence and Edward Jerome Crane III* Abstract A novel anaerobic, hyperthermophilic archaeon was isolated from a mud volcano in the Salton Sea geothermal system in southern California, USA. The isolate, named strain 521T, grew optimally at 90 C, at pH 5.5–7.3 and with 0–2.0 % (w/v) NaCl, with a generation time of 10 h under optimal conditions. Cells were rod-shaped and non-motile, ranging from 2 to 7 μm in length. Strain 521T grew only in the presence of thiosulfate and/or Fe(III) (ferrihydrite) as terminal electron acceptors under strictly anaerobic conditions, and preferred protein-rich compounds as energy sources, although the isolate was capable of chemolithoautotrophic growth. 16S rRNA gene sequence analysis places this isolate within the crenarchaeal genus Pyrobaculum. To our knowledge, this is the first Pyrobaculum strain to be isolated from an anaerobic mud volcano and to reduce only either thiosulfate or ferric iron. An in silico genome-to-genome distance calculator reported <25 % DNA–DNA hybridization between strain 521T and eight other Pyrobaculum species. Due to its genotypic and phenotypic differences, we conclude that strain 521T represents a novel species, for which the name Pyrobaculum igneiluti sp. nov. is proposed. The type strain is 521T (=DSM 103086T=ATCC TSD-56T). Anaerobic respiratory processes based on the reduction of recently revealed by the receding of the Salton Sea, ejects sulfur compounds or Fe(III) have been proposed to be fluid of a similar composition at 90–95 C.
    [Show full text]
  • Orthologs of the Small RPB8 Subunit of the Eukaryotic RNA Polymerases
    Biology Direct BioMed Central Discovery notes Open Access Orthologs of the small RPB8 subunit of the eukaryotic RNA polymerases are conserved in hyperthermophilic Crenarchaeota and "Korarchaeota" Eugene V Koonin*1, Kira S Makarova1 and James G Elkins2 Address: 1National Center for Biotechnology Information, National Library of Medicine, National Institutes of Health, Bethesda, MD 20894, USA and 2Microbial Ecology and Physiology Group, Biosciences Division, Oak Ridge National Laboratory, Oak Ridge, TN 37831, USA Email: Eugene V Koonin* - [email protected]; Kira S Makarova - [email protected]; James G Elkins - [email protected] * Corresponding author Published: 14 December 2007 Received: 13 December 2007 Accepted: 14 December 2007 Biology Direct 2007, 2:38 doi:10.1186/1745-6150-2-38 This article is available from: http://www.biology-direct.com/content/2/1/38 © 2007 Koonin et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Abstract : Although most of the key components of the transcription apparatus, and in particular, RNA polymerase (RNAP) subunits, are conserved between archaea and eukaryotes, no archaeal homologs of the small RPB8 subunit of eukaryotic RNAP have been detected. We report that orthologs of RPB8 are encoded in all sequenced genomes of hyperthermophilic Crenarchaeota and a recently sequenced "korarchaeal" genome, but not in Euryarchaeota or the mesophilic crenarchaeon Cenarchaeum symbiosum. These findings suggest that all 12 core subunits of eukaryotic RNAPs were already present in the last common ancestor of the extant archaea.
    [Show full text]
  • A Survey of Carbon Fixation Pathways Through a Quantitative Lens
    Journal of Experimental Botany, Vol. 63, No. 6, pp. 2325–2342, 2012 doi:10.1093/jxb/err417 Advance Access publication 26 December, 2011 REVIEW PAPER A survey of carbon fixation pathways through a quantitative lens Arren Bar-Even, Elad Noor and Ron Milo* Department of Plant Sciences, The Weizmann Institute of Science, Rehovot 76100, Israel * To whom correspondence should be addressed. E-mail: [email protected] Received 15 August 2011; Revised 4 November 2011; Accepted 8 November 2011 Downloaded from Abstract While the reductive pentose phosphate cycle is responsible for the fixation of most of the carbon in the biosphere, it http://jxb.oxfordjournals.org/ has several natural substitutes. In fact, due to the characterization of three new carbon fixation pathways in the last decade, the diversity of known metabolic solutions for autotrophic growth has doubled. In this review, the different pathways are analysed and compared according to various criteria, trying to connect each of the different metabolic alternatives to suitable environments or metabolic goals. The different roles of carbon fixation are discussed; in addition to sustaining autotrophic growth it can also be used for energy conservation and as an electron sink for the recycling of reduced electron carriers. Our main focus in this review is on thermodynamic and kinetic aspects, including thermodynamically challenging reactions, the ATP requirement of each pathway, energetic constraints on carbon fixation, and factors that are expected to limit the rate of the pathways. Finally, possible metabolic structures at Weizmann Institute of Science on July 3, 2016 of yet unknown carbon fixation pathways are suggested and discussed.
    [Show full text]
  • A Virus of Hyperthermophilic Archaea with a Unique Architecture Among DNA Viruses
    A virus of hyperthermophilic archaea with a unique architecture among DNA viruses Elena Ilka Rensena,1, Tomohiro Mochizukia,b,1, Emmanuelle Quemina, Stefan Schoutenc, Mart Krupovica,2, and David Prangishvilia,2 aDepartment of Microbiology, Institut Pasteur, 75015 Paris, France; bEarth-Life Science Institute, Tokyo Institute of Technology, Tokyo 152-8550, Japan; and cDepartment of Marine Organic Biogeochemistry, Royal Netherlands Institute for Sea Research, 1790 AB Den Burg, The Netherlands Edited by James L. Van Etten, University of Nebraska-Lincoln, Lincoln, NE, and approved January 19, 2016 (received for review September 23, 2015) Viruses package their genetic material in diverse ways. Most known shell consisting of two protein layers and an external envelope. strategies include encapsulation of nucleic acids into spherical or Our results provide new insights into the diversity of architec- filamentous virions with icosahedral or helical symmetry, respec- tural solutions used by filamentous viruses. tively. Filamentous viruses with dsDNA genomes are currently as- sociated exclusively with Archaea. Here, we describe a filamentous Results hyperthermophilic archaeal virus, Pyrobaculum filamentous virus 1 Virus and Host Isolation. From the environmental sample collected (PFV1), with a type of virion organization not previously observed at the Pozzuoli Solfatara, Italy, enrichment cultures were estab- in DNA viruses. The PFV1 virion, 400 ± 20 × 32 ± 3 nm, contains an lished in conditions known to favor the growth of aerobic mem- envelope and an inner core consisting of two structural units: a rod- bers of the archaeal genus Pyrobaculum (14). The virus-like particles shaped helical nucleocapsid formed of two 14-kDa major virion pro- (VLPs) were detected in the enrichment culture by transmission teins and a nucleocapsid-encompassing protein sheath composed electron microscopy (TEM).
    [Show full text]
  • Different Proteins Mediate Step-Wise Chromosome Architectures in 2 Thermoplasma Acidophilum and Pyrobaculum Calidifontis
    bioRxiv preprint doi: https://doi.org/10.1101/2020.03.13.982959; this version posted May 4, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. 1 Different Proteins Mediate Step-wise Chromosome Architectures in 2 Thermoplasma acidophilum and Pyrobaculum calidifontis 3 4 5 Hugo Maruyama1†*, Eloise I. Prieto2†, Takayuki Nambu1, Chiho Mashimo1, Kosuke 6 Kashiwagi3, Toshinori Okinaga1, Haruyuki Atomi4, Kunio Takeyasu5 7 8 1 Department of Bacteriology, Osaka Dental University, Hirakata, Japan 9 2 National Institute of Molecular Biology and Biotechnology, University of the Philippines 10 Diliman, Quezon City, Philippines 11 3 Department of Fixed Prosthodontics, Osaka Dental University, Hirakata, Japan 12 4 Department of Synthetic Chemistry and Biological Chemistry, Graduate School of Engineering, 13 Kyoto University, Kyoto, Japan 14 5 Graduate School of Biostudies, Kyoto University, Kyoto, Japan 15 † These authors have contributed equally to this work 16 17 * Correspondence: 18 Hugo Maruyama 19 [email protected]; [email protected] 20 21 Keywords: archaea, higher-order chromosome structure, nucleoid, chromatin, HTa, histone, 22 transcriptional regulator, horizontal gene transfer 23 Running Title: Step-wise chromosome architecture in Archaea 24 Manuscript length: 6955 words 25 Number of Figures: 7 26 Number of Tables: 3 bioRxiv preprint doi: https://doi.org/10.1101/2020.03.13.982959; this version posted May 4, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity.
    [Show full text]