Wollaeger 1
Genetic Variability in Magnolia acuminata (L.) Populations in the Eastern United States 1,2,3
1Heidi Wollaeger, Wittenberg University, NHRE Intern with The National Museum of Natural History at Smithsonian Institution, Washington D.C. 2Under the direction of Dr. Elizabeth Zimmer, Botany Curator, National Museum of Natural History, Washington D.C. 3Under guidance of Dr. Matthew Collier, Dr. Michelle McWhorter, and Dr. John Ritter, Wittenberg University, Springfield, OH ______
Abstract
The goal of this study was to use nuclear (ITS1, microsatellites) and chloroplast (psbK-psbI; atpF-atpH; and ndhf-rpl32) regions to determine the population genetics of Magnolia acuminata, commonly known as the cucumber tree, in the eastern United States and to correlate morphological variation with these genetic markers. DNA was extracted with Qiagen DNeasy® kits from samples of M. acuminata provided by the Magnolia Society from populations in the eastern United States. Polymerase chain reactions were performed according to the optimal temperature as determined by the touchdown PCR. The PCR product was electrophoresed in a 1.5% agarose gel stained with ethidium bromide in order to assess DNA sequence size and quality after the amplification. The PCR products for the chloroplast spacer regions (psbK-psbI; atpF-atpH; and ndhf-F-rpl32-R) were Exo-Sapped and cycle sequenced. This product was run through hydrated sephadex plates to purify the sample and was sequenced on a 3730xl DNA Analyzer. The sequences were aligned with Geneious® software. For microsatellite regions stm200 and stm49, the PCR product was diluted 1:10 with Dnase free water and was added to Rox diluted 1:10 with formamide. These products were submitted for fragment analysis and assessed on GeneMapper® software. No sequences were derived from the nuclear region, ITS1. No significant variation was detected in the chloroplast spacers but some preliminary geographical variation was shown through microsatellites stm200 and stm49. Interbreeding between close geographical populations was observed, however distinctive alleles were present across large distances. In order for conclusive evidence for the population genetics to be determined, more microsatellite markers would have to be assessed. ______
Introduction
Magnoliaceae, a family of shrubs and ecosystems. Magnolias are commercially trees, contains approximately 230 species important for the production of greenery for (Kim et al. 2001). Charles Plumier coined the the floral industry as well as for cut flowers, name "Magnolia" as a patronym in honor of a using its wood for a small percentage of fellow botanist, Pierre Magnol, in 1703. American timber production, and also to Linnaeus, famous for the binomial extract compounds to be used medicinally to nomenclature system, examined the Magnolia relieve headaches, feminine ailments, family and re-established its common name of allergies, and fever (Callaway 1994). Magnolia which is still used today (Treseder Ecologically, Magnolias are thought to have 1978). Currently, Magnolias have many co-evolved with beetles from the time of their practical and aesthetic uses in addition to first existence, but are pollinated and provide playing important ecological roles in various nectar for many other species of insects today. Wollaeger 2
This plant group is also an important nutrient of the 'Slope Magnolia' were the most similar source for migratory birds and some small to Magnolia acuminata distinguishable by the and large mammals (Treseder 1978). venation of the leaf. Magnolia acuminata The Magnolias are thought to be one of the usually has 10 to 14 secondary veins and an first angiosperms to evolve and therefore are angle from the midrib to the edge of the leaf classified as "primitive plants" (Thien 1974). of 45 to 65 degrees. The fossil leaf was most Scientists have disputed the family's specific closely identified as a direct relative of age. According to Kim et al. (2001), Magnolia acuminata due to its similarities in Magnolia broke off from its evolutionary measurements (Figlar 1993). While ancestors around 100 million years ago, but morphology of these genera seems to be Nie et al. (2008) argues that Magnolias relatively unaltered over millions of years, the specified around 93.5 million years ago taxonomy within the Magnolias is particularly (Treseder 1978). It is generally agreed upon complex. Finding a genetic basis for the Magnolias were abundant during the Neogene complexity and variability in these taxa, time. The Paleogene and Neogene are parts of specifically of the species M. acuminata, is the Cenozoic Era, encompassing the Pliocene, the focus of this investigation. Miocene, Oligocene, Eocene, and Paleocene This study focuses on Magnolia acuminata epochs Figure 1. This time period was an (Figure 3). ideal time for the uprising of many southern species.
Figure 1. A time line of the Cenozoic era, containing the Neogene and Paleogene periods, the periods of increasing prevalence of the Magnolia (Eon, Epochs, Etc. 2010).
The Atlantic Coastal Plain emerged from Figure 2. A comparison of the fossil 'Slope Magnolia' below water and many of these eroded rock and a living Magnolia acuminata (Figlar 1993). layers are easily accessible today. The Appalachian Mountains were present but only a couple thousand meters high. Many of the species, particularly ones that had East Asian relatives (such as Magnolia acuminata, commonly known as the cucumber tree), spread easily through the coastal plain beginning at the lower latitudes and moving north (Braun 1955). Amazingly, the Magnolia species found today are quite similar to those living millions of years ago. Fossil fruits of a relative of the Magnolias, found in a Miocene Figure 3. Magnolia acuminata (Arboretum Freiburg- fossil bed in Idaho, appear remarkably similar Günterstal. Accessed July 23, 2010.
Wollaeger 3
The family Magnoliaceae is comprised of the flower color and petiole anatomy, and sub-family known as Magnoliodeae that pubescence was observed, Figure 4. Leaf contains one genus, Magnolia (Figlar and shape, however, is the most variable character Nooteboom 2004). Magnolia acuminata of all the different phenotypes (Hardin 1954). belongs to that genus and subgenus Yulania, On the broader scope, in order to evaluate section Tulipastrum (Treseder 1978; Kim et the lineage of Magnoliaceae in comparison al. 2001). Plants assigned to the species M. with similar morphological families, Canright acuminata are most commonly deciduous (1960) examined floral characteristics, such trees or shrubs approximately 30 meters tall, as carpels and stamens, in a series of papers. with straight bark, often light brown to gray. Previous to molecular techniques, for Leaves are elliptical, oblong, or ovate to example, the carpels were examined obvate 4-16 centimeters long and 2-8 microscopically, by gross view, and also by centimeters wide. M. acuminata belongs to taking cross sections of the tissue for the anatomical group within the genus where distinguishing characters. The results from the the flowers close at night with papillose anatomical study for the Magnolias were very (textured) stigmata around the other female inconclusive, due to large variation in number floral parts (Thien 1974). The flowers have and style of carpels and the amount of fusion six petals and have a radius of 2-5 cm from among them (Canright 1960). the center of the flower (Thien 1974). The flower color and pubescence of the twigs help to define the varieties within the species acuminata. Yellow-green flowers and glabrous twigs characterize Magnolia acuminata var. acuminata. Magnolia acuminata var. subcordata often has yellow flowers and pubescent twigs. Additionally, four other varieties exist: ludoviciana, ozarkensis, aurea, and albamensis. Furthermore, there are dozens of cultivars and hybrids within M. acuminata due to its showy and fairly hardy characteristics (Callaway 1994). Observation of extremely variable morphological characteristics in M. acuminata spurred a series of studies on the species and its relationship to other genera in Figure 4. The range of morphological variation in the family Magnoliaceae. Early studies by leaf base (left), pubescence level (top), and the Whittaker (1933) compared the venation of respective characters by variety (bottom). Solid the leaves, the presence of vessels, and their Line: M. ozarkensis, Dashes: M. cordata, Dots: M. structure. Whittaker (1933) examined species acuminata (Hardin 1954). in the genus Magnolia and found that they had pinnate leaf venation and the presence of sclariform tracheids and vessels. Hardin Through this lineage study, Canright similarly (1954) was the first to examine extensively observed the variance in the Magnolia family. the varying characters in M. acuminata and Perhaps the complexity and variation within group them according to those characters. the family and genera arise from the Differing pubescence on the lower leaf origination of the species from the North surface, petal length and width, base structure, American and Asian continents cross- Wollaeger 4 pollinated over the land bridge many years acuminata. A small sample of individuals ago (Treseder 1978). This conclusion has among different populations throughout M. been backed up only in more recent studies acuminata's present range within the eastern utilizing the sequencing of the ndhF United States are compared with sample intergenic spacer region. Kim et al. (2001) locations given in Table 1. published a phylogeny (evolutionary history tree) comparing the ndhF sequences among Table 1. The 22 population localities sampled 99 taxa within the Magnolia family and did by the Magnolia Society with corresponding find some unifying morphological sample numbers. characteristics distinctive of the subgenus, Sample Number Locality of Population Yulania, but not within the sections, 1-5 Patrick County, VA Tulipastrum, Yulania, and Buergeria. 6-10 Hocking County, OH Notably, M. acuminata was the only North 11-13 Florida American species of Magnolia belonging to 14-16 Colbert County, AL the subgenus Yulania (Kim et al. 2001). 17 Tuscaloosa County, AL Again, the intercontinental interactions among Magnolias emphasize its importance as an 18-22 Pocahontas County, WV example of evolutionary relationships. 23 Stoddard County, MO Through using modern molecular 24 Clarks Hill, SC techniques, precise phylogenies can be 25-29 Pickens County, SC produced without meticulous morphological 30-32 Cultivar evaluations, which tended to be inconclusive, 33-35 Newberry, SC in hopes of resolving the variation and lineage 36-37 Little Mountain, SC questions. The lineage of the Magnolia family 38-42 Baldwinsville, NY has been disputed throughout generations of 43-46 Sky Valley, Rabun scientists via different studies. Dandy (1927), County, GA Law (1984,1996), Nooteboom (1985), and 47-48 Macon County, NC Chen and Nooteboom (1993) have published 49-53 Swain Country, NC papers disputing which subgenera were 54-58 Atlantic Watershed, rightly included in the genus, Magnolia (Kim Rabun County, GA et al. 2001). The disputes arisen due to a 59-63 Jackson County, AL relatively homogeneous family and have 64-68 Saline, AR been, yet again, resolved by Kim et al. (2001), 69-73 Polk, AR by the analysis of ndhF sequences. However, 74-78 Newton, AR these molecular methods are not perfect since 79-83 Columbia, LA Hughes et al. (2006) demonstrated that many published phylogenies contain a large amount of extrapolation thereby ignoring important Comparing genetic information among details such as evolutionary history, populations of the same species can give biogeography, hybridization, and polyploidy. insight about interbreeding, population Made possible by the internship program, specification, and can identify genetic Natural History Research Experience, at the markers for particular morphological Smithsonian, the following research was characteristics. Genetic markers have become conducted at the Laboratories of Analytical very important in showing the extent of Biology at the Museum Support Center in population interaction or isolation (Hamza Suitland, Maryland. Molecular techniques 2010). The genetic markers are revolutionary were used to examine the genetic variability because very specific conclusions can be and diversity within the species M. Wollaeger 5 made concerning how the DNA has been Ehrendorfer et al. 1968). Importantly, Thein mutated, in all types of markers - coding and (1974) confirmed that M. acuminata is a non-coding - and in plants with all methods of tetraploid containing 76 chromosomes (4n). inheritance (Wagner 1992). The knowledge to Tetraploidy is a type of polyploidy that has what extent M. acuminata shares genetic four genomes in the nucleus and four copies information would be significant for of every chromosome (Encyclopedia of mediating the spread of a disease through a Molecular Biology 1999). The knowledge of population in addition to understanding ploidy is critically important to be able to further the ecology of the species. Moreover, sequence nuclear regions and to understand the correlation of alleles with particular the heterogeneity of the populations. phenotypes can help the practical application Polyploid individuals may yield messy of biologically engineering marketable sequences due to the amplification of multiple cultivars with specific traits that would be regions of DNA. The mode of inheritance ideal for certain growing conditions. For also has been disputed. One theory states that example, Mitchell et al. (2001) identified the exchange of genetic material in M. different hybrids of the Magnolia (not clearly acuminata occurs through the spread of different from each other during all parts of pollen, particularly by beetles. The paternal the year) through molecular markers in order only inheritance pattern, via the spread of to distinguish stronger breeds and the place of pollen, would imply that seeds do not have a origin of each of the cultivars. This particular large role in plastid, such as the chloroplast, study aided in assessing the cross breeding of genome inheritance. Beetles allow the flowers M. acuminata with hopes of understanding to breed through typical pollination in which the variation in anatomy between the different the insects pick up pollen on one set of sub-species and varieties. Another practical stigmas and deposit it on a different application of the genetic data could be used gynoecium, female structure, in order to to understand the evolutionary history such as fertilize the ovule (Thien 1974). There are, changes due to genetic drift, founder effects, however, anti-hybridization mechanisms and and bottleneck effects impacting current mechanisms that prevent self-pollination, populations through habitat loss or disease thought to be the flavonoid compounds in the (Pautasso 2009). While the research pollen (Thien 1974). Therefore, fertilization is performed in this study aims in identifying a limited by some genetic and chemical means. genetic basis for morphology for the The Magnolias are cross-pollinated by previously mentioned advantageous reasons, beetles, facilitated by the plants' ability to it is possible however that the variation in close its petals into tight buds only accessible morphology has arisen from adaptation to to beetles at night. According to this theory, environmental conditions with no genetic beetles almost exclusively access the nutrient basis. In order to investigate the population reserve from the flower before other genetics, some fundamental information has pollinators have the opportunity to approach to be understood about the species' genetic the flower (Thien 1974). The movement of characteristics. genetic material among the population Whitaker (1933) performed early genetic thereby relies on the movement of the beetles analyses of the Magnoliaceae. Through the within and among populations. This theory separation of chromosomes, both of the two supports paternal-only plastid DNA known varieties of M. acuminata were found inheritance. to have 38 chromosomes (2n; tetraploid) There are also scientists that believe that while the other species of Magnolias Magnolia plastid DNA is only maternally (virginiana, tripetala, etc.) had 19 inherited. Hu et al. (2008) noted that 81.1 chromosomes (1n) (Whitaker 1933; percent of angiosperms have maternal plastid Wollaeger 6
DNA inheritance while only 18.9 percent may It is necessary to consider a variety of genetic be biparentally inherited. The ancient factors in order to try to get the most angiosperms, such as Magnolia, are thought comprehensive view of the genetic variation. to be fundamentally only maternally inherited Each of the nuclear DNA, organelle DNA, because of their evolutionary history. Because and microsatellite markers has advantages the angiosperms were believed to have when comparing genetically related evolved from algae, the inheritance pattern of organisms. Nuclear DNA was the first to be it has been of interest to scientists. The alga, assessed for variability. The prevalence of Chlamydomonas, was found to have only one knowledge about nuclear modes of genetic predecessor, implying uni-parental inheritance and methods of nuclear inheritance. The gymnosperms are sequencing has sparked the whole genome additionally the same. As stated above, the sequencing in today's science. However, it is lineage of angiosperms derives out of the more common now to examine spacer regions photosynthetic alga, later branching off into of nuclear DNA for variation, but the the gymnosperms, and finally lead to the evolution of genes can be still be informative. origin of the angiosperms. Scientists conclude Previously in the genus Magnolia, the that the very early angiosperms would also analyses of genes have shown phylogenetic have uni-parental inheritance and that bi- evidence to the evolutionary branching off of parental inheritance may not have evolved the primitive angiosperms. As formerly yet. The mode of paternal inheritance occurs mentioned, Magnoliaceae is an interesting through the degeneration of the plastid DNA family due to its presence on the American in the sperm cell within the pollen (Hu et al. continents and in Asia. M. acuminata has 2008). Therefore, an early angiosperm such proved to be difficult to include phylogenies as the Magnolia would follow uni-parental because the nuclear and chloroplast data inheritance, which in turn would be maternal suggest differing lineages. Therefore, it is only inheritance. The inheritance pattern is important to point out that supporting critical for understanding a phylogeny derived evidence between the nuclear and chloroplast from chloroplast sequences and to understand DNA elements can vary with the species of how chloroplast DNA is transmitted the plant and includes many factors of generation to generation. unreliability (Nie et al. 2008). For reasons Three components, chloroplast spacer such as contradictory results, it is ideal to regions, microsatellite fragments, and a examine as many factors as possible nuclear spacer, ITS1 (Internal Transcribed determine an accurate conclusion. Spacer 1), are analyzed in order to obtain an The nuclear DNA examined are the ITS1 initial understanding of the population region, a region in the ribosomal DNA, genetics for M. acuminata throughout the depicted in Figure 5 with two regions eastern United States. amplified by the two sets of primers (used in this study). This region is between the 18s and 5.8s ribosomal regions. ITS1 ITS2
26s 18s 5.8s 26s 18s 5.8s
1. ITS5a ITS2
2. ITS5a ITSc5.8s Figure 5. A depiction of ribosomal DNA with the intergenic spacer 1 (ITS1) and intergenic spacer 2 (ITS2) with the first and second set of primers used in the study to amplify the region. Wollaeger 7
This region has been shown to be quite The chloroplast genome consists of three promising in other studies such as a components: protein-coding genes, introns, phylogeny study performed by Doi et al. in and intergenic spacers (Shaw et al. 2007). 2002. The study showed that (in a similar These chloroplast spacer regions and introns number of base pairs - a similar size strand of are non-coding regions in the genome of the DNA) the ITS region had more variation than chloroplast. Since spacer regions have no the chloroplast genome. In fact, the ITS known function, they often exemplify region had 170% more varied sites than the evolution and can show how populations are chloroplast atpB-rbcL intergenic spacer (Doi related. A series of papers (Shaw et al. 2005; et al. 2002). Once again, the level of variation Shaw and Small 2005; and Shaw et al. 2007) in non-coding nuclear and organelle DNA examined the feasibility of many previously regions can vary depending on the species. unexplored chloroplast intergenic spacer More recently, organelle DNA from the regions. Many of the regions being utilized mitochondria (mDNA) and the chloroplast for phylenogenetic studies, such as trnL-trnF (cDNA), having separate circular genomes, and trnK-matK were not the most variable also gives insight to genetic variability and regions, therefore not being the most their relative importance varies by organism. indicative of markers. Shaw et al. (2007) The chloroplast, more variable than nuclear or suggested thirteen different regions that may mitochondrial DNA, is the most important set be variable between populations and worth of DNA to assess in plants. Nicotiana exploring in future studies, one of which was tabacum, the cultivated tobacco species, was ndhF-rpL32. This region had a higher level of the first species of plant to have the entire PIC's (potentially informative characters e.g. chloroplast genome sequenced. Forty-two number of nucleotide substitutions, indels, percent of the genome were found to be and inversions) than many other regions and comprised of non-coding DNA regions. These they recommended the sequencing of the regions likely show variation, population intergenic spacer for low-level (highly divergence, and evolution because their genetically similar) molecular work, possibly conservation from generation to generation is in conjunction with rpL32-trnL(UAG). At the not necessary for the plants' survival (Hamza recommendation of Shaw et al. (2007) of 2010). In addition, the regions of the possibly providing indicative characters, chloroplast have been shown to be ndhf/rpL32 spacer is chosen to be assessed heterogeneous and produce fairly predictable here. Three chloroplast spacer regions: psbK- outcomes (Shaw and Small 2005). The psbI, atpF-atpH, and ndhf-rpL32 (identified organelle DNA has become exceedingly in Figure 6) were sequenced and evaluated for important for analysis because this DNA has a variation between the populations. uni-parental mode of inheritance as opposed The third components to be assessed are to nuclear DNA, which undergoes crossing microsatellite data. Microsatellites, also over and other genetic recombination thereby known as single sequence repeats, are small expressing the lineage of the male and the regions with repeating nucleotide bases female plants. By studying the uni-parental (ATATATAT…) with simple repeat motifs DNA, much of the ambiguity associated with (Encyclopedia of Molecular Biology 1999). hybrids, polyploidy, and other sequencing They are found in all eukaryotic organisms issues can be avoided. However, many studies and are in both the chloroplast and nuclear (eg. Tesfaye et al. 2007, Billotte et al. 2004) genomes of plants. These repeats often show have shown that the third method, examining high variability because they are easily single sequence repeats or microsatellites (to mutated during DNA replication, more be addressed later), might be even more specifically reverse transcription. Because accurate. Wollaeger 8
and minisatellite fingerprinting from which to choose when designing the study. The markers differ in cost, quality, and purpose as seen in Table 2. Microsatellites are ideal for gene flow studies within and between populations as well as in dispersal studies, but are not as accurate with phylogenetic studies. Only RFLP and microsatellites are ideal for estimating allele frequency in a population because they show codominant alleles, unlike many of the other markers (Ouborg et al. 1999). Similar to microsatellites, restriction fragment length polymorphisms (RFLP's) show extensively more than other genomic DNAs (Hamza 2010). Again, it is also important to stress the mode of inheritance because the different methods of analysis cater to the different modes of inheritance. According to Ouborg et al. (1999), nuclear DNA is bi-parentally inherited (via seeds and Figure 6. The chloroplast genome of Citrus pollen) while organelle DNA is only usually sinensis with markers at the three DNA regions inherited uni-parentally, as seen over and over sequenced in Magnolia acuminata: ndhf-rpl32, again. Microsatellites are also ideal to psbK -psbI, and atpF-atpH (Bausher et al. 2006). measure gene flow in that they account for bi- parental modes of inheritance and are these regions are easy mutated, the length of exceedingly precise (Ouborg et al. 1999). the fragment can often be qualified as an Particularly because M. acuminata is a allele (Encyclopedia of Molecular Biology tetraploid, the microsatellite markers are very 1999). Therefore, microsatellites often show important to the overall result. However, it is the relationship of individuals within a important to remember that no marker is population or between populations, as perfect. Microsatellite analysis is very evaluated here. expensive and there are still levels of bias or There are many different techniques uncertainty because the species of interest similar to microsatellites including RFLP may be evolving too quickly to detect (restriction fragment length polymorphism), differences or have parallel evolution AFLP (amplified fragment length (homoplasy - different genetic history to get polymorphism) the same allele).
Table 2. Advantages and disadvantages of molecular markers (Ouborg et al. 1999). Wollaeger 9
While the genetic markers are very alluring in should be sufficient to examine the difference that they attempt to recreate a dispersal path between populations and allele spread. and suggest modes of interbreeding, The historical distribution of Magnolia ecological analysis can never be replaced. The relatives relate to the current distribution of microsatellite data only augment and M. acuminata. In the Miocene period, M. reinforce the measurement of pollen and seed acuminata was likely found in similar dispersal (Ouborg et al. 1999). Despite the locations as its ancestor, the slope magnolia, few shortcomings microsatellite markers, it is which flourished in much of the United the best measure of dispersal rates, thereby States, southern Canada, and throughout making it an ideal marker to use to measure Mexico. By the end of that period, the the distribution and population genetics of M. geographical range of the slope Magnolia acuminata to be examined via this research narrowed and, due to climate change as little project . as a few thousand years ago, shrank to its As a basis for designing primers for M. current prevalence (Figlar 1993). Today, the acuminata, the literature was reviewed for distribution and range vary with each species other microsatellite work in the Magnolia and are dependent on their cold tolerance and family. Previously, Setsuko et al. (2005) hardiness. Even varieties within the species developed a series of primers for M. stellata M. acuminata vary in habitat locality, as seen and examined the number of alleles evident in in Figure 7 with M. ozarkensis, M. acuminata, this species at each marker. In this study, they and M. cordata. Ecological surveys still located 30 polymorphic microsatellite record the prevalence of species such as M. markers for genomic DNA. The primer pair acuminata for population study. One such stm200 amplifies a region that repeats: study examined the number of M. acuminata (CT)13(TC)11 with sizes ranging from 167 to individuals present in one of the localities 211 base pairs in M. stellata. Eleven alleles examined through this research, Rabun were found at marker stm200 in this species County GA. While the Magnolias were not of Magnolia. Primer pair stm49 amplifies a prevalent in comparison with some of the region: (AC)16(CT)13 which ranged between other 813 species, they are undeniably 190 and 229 base pairs long. Five alleles were integral to the ecosystem (Stiles and Howel found in M. stellata for this primer set 1996). (Setsuko et al. 2005). In addition to type of DNA region, sample size and method of sampling the population can also be important when analyzing the markers. If the organism inherits multiple alleles on the same or different locus, a haplotype, then only a couple of individuals per population are essential to assess the variation among them. To determine the haplotypes within population, sample sizes should be quite large (as much as 22-35 individuals as examined in the Salix population performed by Hamza in 2005) (Hamza 2010). For the purposes of my research project, first mentioned option (only sampling a few individuals per population) Figure 7. Distribution of three varieties of Magnolia acuminata: solid circles: var. ozarkensis, open circles: var. acuminata, triangles: var. cordata (Hardin 1954). Wollaeger 10
Population gene flow has been examined polymerase chain reaction, only one strand is in other species of plants. A prime example of copied, yielding only one band on the a population genetics study was performed by electrophoresis gel at the corresponding size Powell et al. (1995) using single sequence range as expected which ultimately produces repeats on a few species of Pinus. The clean sequences. Polymerase chain reactions maternal or paternal mode of inheritance in using NH4 10x buffer, MgCl2 buffer, dNTPs, the chloroplast is critical for understanding forward and reverse primers, Biolase TAQ®, the variation between and among these and BSA were performed as listed in Table 4 populations and the pines belong to the for the thermocycler setting as in Table 5. gymnosperms and fall under the category of After the PCR had been performed, 3 µl of paternal inheritance. As previously stated, the 3x loading dye were mixed with 2 µl of DNA DNA in the chloroplast in the angiosperms, template from the PCR product. To assess flower-bearing, covered seed plants, are DNA sequence size and quality, these usually maternally inherited (Powell et al. products were run on a 1.5% aragose gel 1995). M. acuminata is likely maternally stained with ethidium bromide. In the inherited so the method of study might be chloroplast spacer regions (psbK-psbI; atpF- slightly different. atpH; and ndhf-rpl32), the products were Exo- Ideally, it would be the most advantageous Sapped in order to eliminate primers, the to have data from nuclear and organelle non- single stranded DNAs used to initiate coding regions in addition to microsatellite replication. In order to carry out this step, the data. As previously mentioned, each of these Exo-Sap reagent was diluted to a 1:5 ratio and components differ in genetic inheritance, then 4 µl of the solution were allocated to a variability, size, and each have their own new plate. Then, 10 µl of PCR product were advantages that they would bring to the data added to the Exo-Sap diluted solution. This set as a whole. The nuclear region, ITS1, the plate was run on the Exo-Sap program on the chloroplast regions ndhf-rpl32, psbK-psbI, thermocycler for all markers where the plate and atpF-atpH, and six microsatellites were was held at 37°C for 30 minutes, at 80°C for screened to understand gene flow and 15 minutes, and 10°C until the plate was population variation in M. acuminata. Finally, removed from the thermocycler and placed in the genetic variability could be paralleled a freezer. After the frozen Exo-Sap product with the large amounts of morphological was thawed and spun in the centrifuge up to variation. 2000 rpm's to ensure homogeneity, a cycle sequencing reaction was performed. The Methods and Materials cycle sequencing reaction replicates the DNA in only one direction through the use of a Previously, Magnolia Society members single primer with each DNA template strand collected 84 individual samples from by using 0.5 µl ABI Big Dye®, 1.0 µM locations as listed in Table 1. The DNA was forward or reverse primer, 1.75 µl 5x ® extracted with Qiagen DNeasy kits, ready- sequencing buffer, and 3.75 µl of Dnase free made materials with easy step-by-step water. This recipe was added to the new plate protocols to eliminate the membranes, etc. for with 4.0 µl of the Exo-Sap product and run on simplified DNA extraction. Primers were first differing thermocycler settings shown in optimized to obtain a functional annealing Table 4. This product was run through temperature. The primers used to amplify hydrated sephadex plates to purify the sample. each region and the approximate segment These sephadex plates were prepared by lengths are listed in Table 3. Furthermore, cleaning the recycled plates twice with only one product is desirable so that when the deionized water, adding an unspecified small DNA is amplified in the next step, the Wollaeger 11 quantity of sephadex to each well and and 10 µl of this mixture were added to 1.0 µl hydrating it with 300 µl of deionized water. of the diluted PCR product. The plate was The sephadex was left to hydrate either three then submitted for fragment analysis. The hours at room temperature or overnight in the chromatograms were analyzed with refrigerator. The cycle sequenced product was GeneMapper® software. Two PCR products spun through the sephadex for five minutes at were examined for both stm49 and stm200 in 2100 rpms in the centrifuge. This plate was order to verify the location and strength of the sequenced on a 3730xl DNA Analyzer. The peaks in GeneMapper® and to prevent stutter, sequences were aligned with Geneious® a result of the fragment analysis process, from software, a highly specific software using being counted as alleles. The peaks were advanced algorithms in order to test recorded for each sample and pie charts were statistically the accuracy of the sequencing made to show allele frequencies for each results (Muse and Gaut 1994). population. The graphs were then placed on a For microsatellite regions stm200, the PCR map to better visualize gene flow. product was diluted 1:10 with Dnase free water. Rox was diluted 1:10 with formamide
Table 3. Primers for each forward and reverse reaction for each marker and the approximate length of DNA (in base pairs) that they amplify (1Stanford et al. 2000; 2KJ Kim unpublished; 3Shaw et al. 2007; 4Setsuko et al. 2005). Marker Primer Sequence Fragment Length (base pairs) ITS1_1 F CTTATCATTTAGAGGAAGGAG1 ~1000 (ITS5a) (ITS2) R GCTGCGTTCTTCATCGATGC1 ITS1_2 F CTTATCATTTAGAGGAAGGAG1 ~1000 (ITS5a) (ITSc5.8s) R TGCGTTCAAAGACTCGAT1
psbK-psbI F TTAGCCTTTGTTTGGCAAG2 ~400 R AGAGTTTGAGAGTAAGCAT2 ndhF F GAAAGGTATKATCCAYGMATATT3 768 rpL32 R CCAATATCCCTTYYTTTTCCAA3 atpF-atpH F ACTCGCACACACTCCCTTTCC2 ~600 R GCTTTTATGGAAGCTTTAACAAT2 stm002 F ATGTCCTAGGGCTAGTATCTC4 M. stellata 280-299 R GGCCATTCACTGTTACAAA4 stm049 F GCCCAACTCGATGTTAGC4 190-229 R GTTGAGCTCGCATGAGTCC4 stm163 F GGGGATTTGGTGGCTACCT4 233-278 R ACTGGCATGTCGGTTCCTATT4 stm191 F TTCAATGGTGGAGTTCTAGT4 257-278 R CACTACCCAAACCTAATCTAAA4 stm200 F GCAAGCTACCAGGTTACTC4 167-211 R AGCCATCTGATGTTTTGATAC4 stm214 F GAACCTGATGACTGATATGTG4 121-143 R AAGCTGGCCTAGTAGGTG4 Wollaeger 12
Table 4. The thermocycler incubation and time settings for the polymerase chain reactions and cycle sequencing reactions for each region as amplified by a primer pair. Marker/Region Thermocycler Setting for Reaction PCR Cycle-Sequencing ITS2 and ITS5a 2x 94°C :45 1x 95°C :30
58°C :45 50°C :30 72°C 1:20 60°C 1:30 3x 94°C :45 ∞ 10°C ∞ 55°C :45 72°C 1:20 30x 94°C :45 52°C :45 72°C 1:20 72°C 8:00 ∞ 10°C ∞ ITSC5.8 and ITS5a 1x 95°C 3:00 1x 95°C :30 34x 94°C :45 1x 50°C :30 57.3°C :50 29x 60°C 4:00 72°C 1:20 ∞ 10°C ∞ 1x 72°C 8:00 ∞ 10°C ∞ atpF-atpH, 1x 94°C 4:00 1x 95°C :30 ndhF/rpL32 4x 94°C :30 1x 50°C :30 55°C :45 29x 60°C 4:00 72°C :45 ∞ 10°C ∞ 39x 94°C :30 54°C :45 72°C :45 72°C 10:00 ∞ 10°C ∞ psbK-psbI 1x 95°C 4:00 1x 95°C :30 5x 94°C :30 50°C :30 55°C :45 60°C 1:30 72°C :45 ∞ 10°C ∞ 30x 94°C :30 54°C :45 72°C :45 1x 72°C 10:00 ∞ 10°C ∞ stm (microsatellites) 1x 94°C 5:00 NA 30x 94°C :30 Wollaeger 13
58°C :45 72°C :45 8x 94°C :30 53°C :45 72°C :45 1x 72°C 10:00 ∞ 10°C ∞
Table 5. The components of the recipes for the polymerase chain reactions for the amplification of the chloroplast spacer regions and the microsatellites.
Component Internal Transcribed Chloroplast Spacer Microsatellite Spacer -ITS1 Regions (psbK-psbI; stm200/stm49 atpF-atpH; ndhf-F, (µL) 5a and 2 5a and rpl32-R) primers C5.8 (µL) 10x Bioline® 2.5 2.0 2.0 1.0 ammonium buffer 10x dNTP’s (10 µM) 2 0.8 0.8 0.5 MgCl2 (25 µM) 2.5 1.0 1.0 0.5 Forward Primer 1.0 1.0 1.0 0.04 Reverse Primer 1.0 1.0 1.0 0.4 BSA 0.5 0.0 0.0 0.5 Dnase free sterile water 12.9 14.8 14.8 6.84 TAQ® Enzyme 0.1 0.2 0.2 0.02 M13 Labeled Primer 0.0 0.0 0.0 0.4 Template DNA 2.5 2.0 2.0 1.0
Results
The nuclear region, ITS1, was first to be product) using the primers ITS5a and ITS2 attempted according to the master mix recipe are shown in the top row whereas the gels as listed in Table 5. The electrophoresis gels used with ITS5a and ITSC5.8 shown in the (used to see quality, quantity, and size of PCR bottom row in Figure 8.
Wollaeger 14
Figure 8. Electrophoresis gels for ITS1 spacer region. The first column of each gel is a ladder (Hi-Lo ladder in row 1 and 1KB ladder in row 2) that allows for the assessment of size of each DNA fragment. Then each row on each individual represents columns 1-11 of the DNA: ex. Row 1 on gel: Column 1 on plate, 2:2 etc.
Top row: Gels for ITS5a and ITS2 primer pair. Bottom row: Gels for ITS5a and ITSc5.8 primer pair.
All samples in the PCR product did not Therefore, a new set of primers: ITS5a and amplify by using the primer set: ITS5a and ITSc5.8 were used with more success, ITS2. Therefore a 'cherry-picked', customized producing quality PCR product from all plate was made to be Exo-Sapped, Cycle samples. (Note: Gel number 3 in row 2 was sequenced, and purified by sephadex. poor quality due to the gel being made However, despite quality PCR product in improperly.) Despite the better amplification about half of the samples, no sequences were with 5a and C5.8, the sequences were still salvageable due to low Geneious® quality messy despite rerunning the plates through scores and messy sequences. After attempting the sequencer. the Exo-Sap, cycle sequencing, and sephadex Similarly, polymerase chain reactions were steps again, no sequences were attained performed on the chloroplast spacer regions: successfully. ndhf-rpL32, atpF-atpH, and psbK-psbI as indicated in Table 5. The PCR product from each of these regions was also electrophoresed in 1.5% TBE buffer. The gel images can be seen in Figure 9.
Wollaeger 15
Figure 9. Gel images for ndhf-rpL32 (top row), atpF-atpH (second row), and psbK-psbI (third row). With exception of gel #4 row #3, the ladder is in the first column and samples follow in the rows: columns as mentioned previously.
Upon obtaining the amplified product for nucleotide, the only discrepancies were likely each of the chloroplast regions, each series of due to random error on the sequencer known plates was Exo-Sapped, cycle sequenced, and as 'stutter' or anomalies. There was no evident run through a sephadex plate. The product, variability in the three chloroplast spacer frozen until it was analyzed on the sequencer, regions, ndhf-rpL32, atpF-atpH, and psbK- yielded sequences that were imported into psbI. The consensus sequences for the regions Geneious®. After an extensive amount of are shown in Table 6. verifying peaks to the corresponding
Wollaeger 16
Table 6. Consensus sequences of chloroplast spacers as shown. Chloroplast Consensus Sequence Spacer Region
ndhf/rpL32 AACTTTTTTTATTCTTATTAATTGTTTCCGATTCACCAGCTCTTCTCTCTTTCGGAAGTCAAATAAATAAATAAA AATCAAGATAGAAAAGAACTCAAATAAGATTTTTAATTCTTAATTATTCCGATTCTTTCCCAAATATCGTATTG AATAAAAAGAAATTTAAATCAAGAAGTTACAATTGTTTAAATGACCAAGTCACTGGTTAAAACTGACCATTTA GTTATTAACTAAGATATTTATTAAGATAAAGAAAGAATATGAGATTTTCAATCATTCCACTATTACGGCGATT GATATCCATATAGTAAATAGTAAGGAAAAGGAATGACACCAAAAAAAGGTAAAAGTACTCTATTGGGATATG GATCATAGAATCCGCCAATAACTCGACCCCAATAAAATACTAGTTATTTTCGTTAGTTTATTCGGAGTCATTAA TTAATTCATTGTAGAACTGATTGATTGGCTTCTATTCCAATAAAACAAACTTATGTTTATAGGAAATCCTATGA TACTCGTCACTTCGCATAGAACTGAAATAAGAGATTACTAAAATTACCTTTATCAAGTAATGTATGGTTTAAC AGATTAACTACCAATCTCATTTTCATTTAAATTATGAGTACTCTATCCTCGAGCTTGATCAATTAATAGAAAAA TTTTAAATTATTATTTTCTTAAATTAGGTAAGGATTCTTAAGCTTTTCGATTTATTCAATGTAAGACGACGAGA TATAAATAGACTGAGATTGAGATATGAATTGGAACCCTTTTTGATTCTTATCAACAACAACCGGTTCGATTTCT ATGGTAGCGGACCTCATAGACATAGATCGGAATGAAGATATGAAGGTACAAATTAGTACGAATTCTTCTTTCT TCGGGCATTGTATGTAATAGAGATGTGGAACAAAAAAAAATTCCTTTGAAAATAACATCGTTTTTCTTTTTTCT ATTTCTTTTTTTATCCCTAGTGTACTCTATGTGATGCGCACGTATCTATATTTTTGTATGTTATGAAGGAAGTAT CCGCTATGGAATAAATATAGATAATGAATAGCAAGAACGATCTATTTTGAACAATACATGTCTTTCACATCCA ACTATAAAAGTAACTTCTTTATTTTCAAATGGCGGTTCCAAAGAAAC atpF-atpH ATTTATTAGATTTGTTGCTAAAATATCGGTATTCAACCCGAAACTCCCGGCGGATGGCCAGTAACCCAAGGAA ACGAAAGAATCGGTTACATTTTTCATATGCTCTCCTCTTATAGATAGGACTAACAAAATCGAACAGAGTTCTT TTTGTATCACTTCGTACCGTTTTTTTATTATTGATTTCTTTTTTTTTTTATTAATGACTTATTTTAAATATGAATA TATTCATTTCATTTGAAATCATTTTCAAATTTCAAAAATGGATTCTTTATTATTATTTTATTTCAATTGAAGTTC CCAATAAGATACTTATTAGGTCCCCGGTTTCATGTCAATTGCGAAATACCTGCAACGCTTCCTAAAAGTCAAA AGGGGTTTCCATTAAATTAAGGACGGGAAGTGAGAAAGCGAGTGGATCTACTAATTCCTCATCCTCAAATCA GGCCTTCCCCGGAGTATTGTCTCAACGAAGAAGTGGAGTGAAGTTTTGATATAATTCGAAGAAGCAAGCGGT AAGTCGACGGCAATAAAATAAGAAAAGAAGTACGTATTTTCACGTTTATAGAATAGGATTAAACAAAAGGAT psbK-psbI AGTTTGAGAGTAAGCATTACACAATCTCCAAGATCATTTTTGGGGGAAATAAGGGAATAGATTCTCTATTTTT GTACCACATATCCCATTTTGACACCAAGAAATGGAGTGGTTTCTAGAAAAGAAAGGAATTTGCAGGAATTCAT TTGTAATAAGATTCTGATTCCTTCGTTACCAAAATGATCTTTCATACCCACAATTAGGTATTGTGAGGGACCAT ACATAAGGTCTTTGACCTCCGGAAAGTCAGAATGAGAAAATGAGGTGATCCAGATTCATCGCGGCTATCCAA AAGAATTTCAATGTTTGAATCGAGAGTTCATAATGTAAGATTTATCTGATCTTATCAATTGTTAGAATAGAATT TTTCCTTTTTTAGCGAATCAATCATGAATGTTTCTAGGACAGTATT .
The third genetic component that was some gels received an additional post-stain in examined were the microsatellites with the order to see more clearly the faint bands of hope that they will give insight to the the product. The PCR products are visible in population genetics of Magnolia acuminata. Figure 10 for stm002, Figure 11 for stm49, Polymerase chain reactions were performed Figure 12 for stm163, Figure 13 for stm191, with primer pairs: stm002, stm049, stm163, Figure 14 for stm200, and Figure 15 for stm191, and stm214 as shown in Table 5. The stm214. gels were run as previously mentioned and
Figure 10. Gel images for stm002. The first column of each row is the ladder and the samples are in series of eight within each row. Wollaeger 17
Figure 11. The gel images of the PCR product of the amplification of region stm49. Top Row: First trial. Bottom Row: Second Trial. Columns: Two trials for the same corresponding template DNA.
Figure 12. The gel images showing only primer dimer and no PCR product for stm163. Row and columns as mentioned previously.
Figure 13. Gel image for a representative sample (first 4 columns of PCR and negative control) for stm191. Not all PCR products were visualized due to time constraints. Wollaeger 18
Figure 14. The gel images of the PCR product of the amplification of region stm200. Top Row: First trial. Bottom Row: Second Trial.
Figure 15. The gel images for stm214 showing positive negative controls and heavy contamination visible by multiple bands indicating multiple products.
Initially, all the primers were tested and imported into GeneMapper®, a program for all found to be contaminated, showing microsatellite (and related markers) analysis. positive negative controls and multiple One exemplary graph can be seen in Figure bands in the samples. The only 16. Peaks at differing lengths (in base pairs uncontaminated primers were of the on the x axis) distinguish alleles of the successful stm49 and stm200. The other individual. Each of these graphs for every primers had to be reordered and all trials marker, totaling 652, were first analyzed on were reperformed. Upon successful PCR the computer and reanalyzed by hand. The products the plates were turned in for peaks of the graphs were placed into 'bins', fragment length analysis on the sequencer. groups to organize each allele two base pairs The FSA files from the sequencer were apart (148,150,152…), because the repeats Wollaeger 19
in the amplified fragments simply alternated fragment length according to the peaks from by two base pairs. The two trials per the graphical analysis for each sample of fragment were compared to eliminate any stm49. The allele frequencies per population false positives in the chromatographs. were calculated (homozygous alleles are Markers stm002 yielded undistinguishable counted twice in calculating the population peaks, stm163 yielded no data from a lack of allele frequencies) and are shown in Figure PCR product, stm191 yielded peaks one 17. Marker stm49 contained 9 alleles. Table base pair apart (invalidates the data), and 8 shows the alleles for each sample of stm214 had huge amounts of stutter. The stm200 and the population frequencies can two successful trials, stm49 and stm200 be seen in Figure 18. Marker stm200 were further analyzed. Table 7 shows the showed 18 alleles.
Figure 16. An ideal example of graphical peaks of alleles seen in marker stm49, sample 17. Note: the peaks in orange appear gray, not black, on the graph and the orange is solely to make the graph clearer.
Table 7. The corresponding alleles (length of fragment in base pairs) of each sample of microsatellite marker, stm49. Samples with no data entered had unclear or unreadable graphs. Peak 1 Peak 2 Peak 3 Peak 4 Locality Sample (bp) (bp) (bp) (bp) 1Ma1_ 183 183 183 183 3Ma2_ 191 191 191 191 Patrick Co, VA 5Ma3_ 193 195 197 199 6Ma4_ 183 189 193 195 7Ma5_ 183 183 191 195
Hocking, OH 8Ma6_ 183 183 189 189 10Ma7_ 183 183 191 191 11Ma8_ 183 183 189 191 13Ma9_ 183 183 191 191 14Ma10_ 183 183 189 189 Wollaeger 20
FL 15Ma11_ 183 183 185 193 17Ma12_ 183 183 191 193 19Ma13_ 183 183 191 193
21Ma14_ 183 183 185 185 Colbert Co, AL 23Ma15_ 191 191 191 191 25Ma16_ 183 183 193 193
Tuscaloosa Co, AL 26Ma17_ 183 191 193 195
N. Pocahontas Co, WV 28Ma18_ 183 183 191 191 30Ma19_ 189 191 191 193 31Ma20_ 189 189 191 191 32Ma21_ 183 183 191 191 34Ma22_ -
Stoddard County, MO 35Ma23_ 191 191 199 199
Clarks Hill, SC 37Ma24_ 183 183 191 191
Pickens County, SC 39Ma25_ 183 183 191 197 40Ma26_ 183 189 191 193 42Ma27_ 183 189 193 197 44Ma28_ 183 183 191 193 45Ma29_ 191 191 193 193
Cultivars, SC 46Ma30_ 191 193 197 199 48Ma31_ 191 193 197 199 50Ma32_ 183 183 189 189
Newberry, SC 52Ma33_ 183 183 189 193 54Ma34_ 183 183 193 197 55Ma35_ 183 189 193 197
Little Mountain, SC 56Ma36_ 183 183 193 199 58Ma37_ 191 193 197 199
Baldwinsville, NY 59Ma38_ 191 193 197 199 61Ma39_ 183 183 189 191 63Ma40_ 183 183 191 199 64Ma41_ 183 189 191 191 65Ma42_ 183 183 189 189
Sky Valley, Rabun Co., GA 67Ma43_ 189 191 191 193 69Ma44_ 189 189 191 191 70Ma45_ 189 189 191 191 71Ma46_ 183 183 191 191
Macon County, NC 72Ma47_ 183 183 193 193 73Ma47_ 183 183 193 193 74Ma48_ 183 183 191 193
Swain County, NC 76Ma49_ 183 183 189 191 Wollaeger 21
78Ma50_ 189 191 191 193 80Ma51_ 189 189 191 191 81Ma52_ 183 183 193 197 82Ma53_ 183 183 185 191
Atlantic Watershed, 83Ma54_ 183 189 191 193 Rabun County, GA 85Ma55_ 189 189 189 189 86Ma56_ 183 183 189 191 88Ma57_ 189 191 191 193 89Ma58_ 187 189 191 193
Jackson County, AL 90Ma59_ 183 183 189 189 92Ma60_ 183 183 191 195 93Ma61_ 195 195 195 195 94Ma62_ 183 191 193 195 96Ma63_ 189 191 193 195
Saline, AR 97Ma64_ 183 183 191 191 99Ma65_ 183 183 191 193 101Ma66_ 183 183 191 191 103Ma67_ 183 183 191 191 104Ma68_ 183 183 191 191
Polk, AR 105Ma69_ 183 183 191 193 107Ma70_ 183 189 191 193 109Ma71_ 185 185 191 191 111Ma72_ 183 183 191 191 112Ma73_ 191 191 185 193
Newton, AR 113Ma74_ 183 183 191 191 115Ma75_ 189 189 191 191 117Ma76_ 189 189 191 191 119Ma77_ 183 183 191 191 120Ma78_ 183 183 189 191
Columbia, LA 121Ma79_ 183 183 191 191 123Ma80_ 183 183 191 191 125Ma81_ - 127Ma82_ 183 183 191 191 128Ma83_ 183 183 191 193
Wollaeger 22
Figure 17. Relative allele frequencies in populations across the United States for marker stm49. (map from: mapssite.blogspot.com).
Wollaeger 23
Table 8. The corresponding alleles (length of fragment in base pairs) of each sample of microsatellite marker, stm200. Samples with no data entered had unclear or unreadable graphs. Locality Peak 1 Sample (bp) Peak 2(bp) Peak 3 (bp) Peak 4 (bp) Patrick Co, VA 1Ma1_ 169 187 189 191 3Ma2_ 169 169 181 187 5Ma3_ 179 183 185 185 6Ma4_ 169.02 169 185.28 191 7Ma5_ 181 185.28 185.28 191
Hocking, OH 8Ma6_ 168.94 169 171 183.4 10Ma7_ 11Ma8_ 169 183.31 185 187 13Ma9_ 185 187 189 191 14Ma10_
FL 15Ma11_ 175 179 183 185 17Ma12_ 177 177 185 193 19Ma13_ 177 177 185 193
21Ma14_ 167 169 181 183 Colbert Co, AL 23Ma15_ 169.02 169 181 195 25Ma16_ 181 183 185 195
Tuscaloosa Co, AL 26Ma17_ 189 191 193 193
N. Pocahontas Co, WV 28Ma18_ 179 181 183 185 30Ma19_ 187 189 191 191 31Ma20_ 181 183 185 185 32Ma21_ 179 183 185 185 34Ma22_
Stoddard County, MO 35Ma23_ 171 171 183 183
Clarks Hill, SC 37Ma24_ 185 187 187 189
Pickens County, SC 39Ma25_ 175 177 183 185 40Ma26_ 42Ma27_ 44Ma28_ 175 177 183 185 45Ma29_ 173 181 183 185
Cultivars, SC 46Ma30_ 48Ma31_ 197 197 199 199 50Ma32_ 169 169 181 183
Newberry, SC 52Ma33_ 173 185 187 189 54Ma34_ 173 187 189 191 55Ma35_ 173 187 189 191
Little Mountain, SC 56Ma36_ 173.05 173 187 189 Wollaeger 24
58Ma37_
Baldwinsville, NY 59Ma38_ 61Ma39_ 181 183 185 187 63Ma40_ 169 183.14 185 187 64Ma41_ 167 169 181 183 65Ma42_ 179 181 185 187
Sky Valley, Rabun Co., GA 67Ma43_ 181 183 197 199 69Ma44_ 181 183 185 185 70Ma45_ 195 195 197 197 71Ma46_ 183 183 183 183
Macon County, NC 72Ma47_ 172.97 173 181 181 73Ma47_ 74Ma48_ 169 169 173 177
Swain County, NC 76Ma49_ 177 177 179 179 78Ma50_ 168.98 169 173 183 80Ma51_ 179 181 183 185 81Ma52_ 168.91 169 173.05 189 82Ma53_ 173.05 173 185.25 185
Atlantic Watershed, 83Ma54_ Rabun County, GA 85Ma55_ 167 181 183 185 86Ma56_ 175.02 175 177 191.36 88Ma57_ 168.94 169 181 185.28 89Ma58_ 168.93 175 177.15 177
Jackson County, AL 90Ma59_ 185 187 189 191 92Ma60_ 169.02 169 195.55 195 93Ma61_ 164.88 165 169 169 94Ma62_ 185 187 189 195 96Ma63_ 164.83 165 179.12 179
Saline, AR 97Ma64_ 181 181 199 199 99Ma65_ 181.11 181 193.46 193 101Ma66_ 181 199 181 199 103Ma67_ 181 199 181 199 104Ma68_ 181 187 199 199
Polk, AR 105Ma69_ 181 183 185 187 107Ma70_ 179 181.11 179 181 109Ma71_ 111Ma72_ 167 169 169 169 112Ma73_ 181 183 185 185
Newton, AR 113Ma74_ 183 185 187 189 115Ma75_ Wollaeger 25
117Ma76_ 181 183 185 187 119Ma77_ 169 169 169 169 120Ma78_ 181 183 185 189
Columbia, LA 121Ma79_ 169 171 169 171 123Ma80_ 125Ma81_ 171 183 171 183 127Ma82_
Figure 18. Relative allele frequencies in populations across the United States for marker stm200. (map from: mapssite.blogspot.com).
Wollaeger 26
Discussion
Successfully attaining a variety of Unfortunately, the three regions examined in markers (nuclear, cDNA, and this study, ndhF-rpL32, atpF-atpH, and microsatellites) would have provided the psbK-psbI, were not varied enough between broadest scope of study. The nuclear spacer all the populations to lead to any gene-flow region, ITS1, was the first to be repeatedly conclusions. The consensus sequences can attempted and would likely have been be seen in Table 6. There were some slight variable as shown in the Doi et al. (2002) differences (a base pair or two) but were study. The first primer pair, ITS5a and ITS2, found to be a product of slipping while only amplified about half of the samples as sequencing the strands or anomalies. The seen in Row 1 of Figure 8. After repeated lack of geographical variability in the attempts at sequencing with a new primer chloroplast spacers is unexpected because set, IT5a and ITSc5.8s, was thought to be variation can be found within these common more successful because it amplified a markers in many other genera and species. I longer strand of DNA and started slightly may hypothesize, however, that there is a farther out from the ITS1 region. Again, slow rate of evolution in these regions of the even with all samples successfully amplified genome or that they are commonly shared (Row 2, Figure 8), the sequences were too between all the populations, making them messy and unreadable. Prior to finishing the non-divergent. As pointed out by Nie et al. experiment, it was not known M. acuminata (2008), nuclear or chloroplast DNA can be is a rare exception from the typical diploid unreliable and the variability can differ chromosome set, in the Magnolia family. M. among species. Evidence from the nuclear acuminata is actually a tetraploid, marker was unattainable due to polyploidy (containing four sets of chromosomes), and the chloroplast DNA was not variable thereby explaining the poor results of the among populations. These findings nuclear regions, despite many fastidious emphasize once again that the region attempts. There are a few other exceptions to examined for population genetics or the common diploidy of Magnolias phylogeny studies are critical to the success including M. grandiflora which is thought to of the findings. It was necessary to be hexaploid (Thien 1974). Because the gels investigate these cDNA and nuclear spacer for the ITS polymerase chain reaction did regions because it allowed further not show multiple bands, we may conclude knowledge and understanding of molecular that the polymerase chain reactions likely work with M. acuminata. In addition, these replicated multiple strands all of the same regions were quite large (400-1000+ bp's) size on the four sets of chromosomes. which could be the reason for their Furthermore, the nuclear regions of conservation. Smaller regions, such as the polyploid specimens will yield messy next marker analyzed, would allow for more sequences because of the sequencer reading mistakes in replication and therefore show multiple products. more geographical variability. Furthermore, The chloroplast spacer regions were also the microsatellites, more rapidly evolving important for the data set. Shaw et al. (2007) regions, were used to provide insight to the identified numerous ultra-variable population genetics of M. acuminata. chloroplast spacer regions. The The six microsatellite regions were amplifications of ndhF-rpL32, atpF-atpH, analyzed by performing polymerase chain and psbK-psbI can be seen in Figure 9. reactions with the primer pairs used with M. Wollaeger 27 stellata by Setsuko et al. (2005) seen in ploidy and how many peaks "should" appear Table 3. The microsatellites initially proved in the graph. Often, for example, if there difficult due to widespread contamination of was a small fifth peak and four larger ones the primers. After multiple primers were the fifth would be disregarded as 'stutter,' attempted with a small quantity of PCR but true confidence in these decisions can product, the gels showed positive negative only be made after becoming familiar with controls and numerous multiple bands as each marker and running multiple trials. seen in Figure 15 with stm214. After a Marker stm49 showed some diversity complete purge of all reagents, sterilization with the appearance of nine alleles, more of the work area with bleach, a shift in than found in M. stellata (5) (Setsuko et al. methodology (using parafilm to move PCR 2005). Alleles 183, 189, and 191 were found product to the gel room as opposed to in almost every population tested and had a recycled and cleaned plates), and the wide range as demonstrated in Figure 17. acquisition of new primers, the Allele 191 tended to be in the largest microsatellites began to yield promising proportion of the populations in the western results. Region stm163 (Figure 12) did not states: Louisiana, Arkansas, and Missouri. produce any successful amplification, However, allele 191 also was suggesting an annealing temperature that proportionately half of the population in was too high despite the successful Georgia and West Virginia. Allele 185 was optimization earlier. Almost all samples present in Arkansas, Alabama, Florida, and amplified in the polymerase chain reactions in North Carolina. The movement of allele in markers: stm002, stm049, stm191, and 185 is perplexing because it is not existent in stm200 visualized in Figures 10, 11, 13 and the populations sampled in South Carolina 14. All samples of these markers were and Georgia. Another interesting allele is prepared for fragment analysis on the 195, present in Alabama and Virginia. This sequencer and imported into GeneMapper. allele may be slightly more explainable in The analysis also proved difficult that the seeds and pollen could have been because the exceedingly expensive and transferred via waterway among these highly specialized software was difficult to populations. Figure 21 shows the major use and required very subjective analyses. waterways of the continental United States. Each marker requires multiple trials to It could be suggested that there may be some verify that the alleles found are indeed spread of seeds via the Alabama River, correct and present. For example, in Figure causing similar alleles between Virginia and 19 the upper graph displaying trial one of Alabama. A similar hypothesis could be sample 48 on marker stm200 shows more drawn with allele 199, present in the stutter than in trial 2 below. The allele peaks populations in Virginia, Missouri, and New are most distinguishable when the stutter York. The populations could be peaks are low. Markers stm002 and stm214 interbreeding through the spread of seeds via had less distinguishable peaks and enough the Ohio and Mississippi rivers. If the stutter to call their results into question as movement of the seeds via water were a seen in a sample from stm200 in Figure 20. plausible hypothesis then the populations However, the majority of markers stm049 bordering the waterways should and stm200 were clearer and contained less theoretically be quite similar. However, the ambiguity. Also, another bias that made the populations, in Arkansas and Louisiana analysis difficult was the prior knowledge of which are along the Mississippi River, for Wollaeger 28
Figure 19. The two trials of sample 48 of marker stm200. The larger display of the peaks with stutter peaks make it difficult to justify the "real" alleles and the sequencer slippage. The smaller peaks with small stutter in trial 2 allow for a more confident distinguishable allele.
Figure 20. The undistinguishable peaks of sample 65 in marker stm200.
Wollaeger 29
Figure 21. The important waterways of the continental United States (USDA 2002).
example, are not that similar. Further stm49 tended to be more homozygous per analysis of this theory may be explored with chromosome set than stm200. For the most the next marker, stm200 because it is largely part, stm200 shows four different alleles on more varied than stm49. the four different chromosomes. There is some level of coastal Stm200 is a complex marker showing interbreeding as observed through alleles interesting allele frequencies and sharing of 193 and 197. Allele 193 has the largest alleles between populations as shown in proportion of the population in North Figure 18. Some alleles such as 169, 183, Carolina, South Carolina, Georgia, and 179, 181, 185, and 189 are present in almost Florida. Likewise, allele 197 is present every sampled population and do not mainly in South Carolina, Virginia, and New discriminate geographically. Allele 171 York. These alleles may be shared via the supports the "transference by waterway more traditional direct interbreeding due to hypothesis" being present in Ohio, Missouri, geographical closeness. and Louisiana, all on the Ohio and An initial comparison between stm49 and Mississippi rivers. Other alleles even show a stm200 shows that stm200 is largely more latitudinal trend such as allele 165 that is variable, containing 18 alleles as opposed to present in South Carolina, Georgia, and in eight. In addition, the alleles of the population in Saline, AR. This Wollaeger 30 connection between South Carolina and introduced varieties, waterway dispersal of Arkansas can be seen with allele 197 and seeds and pollen, and more traditional again in allele 199. Allele 199 may provide interbreeding via close proximity. Markers insight to how these populations are stm49 and stm200 both show evidence of interbreeding. Allele 199 is present in the predicable allele flow between close cultivated population in South Carolina populations such as North and South when the allele only occurs in the natural Carolina, for example. Additionally, they population out west, mainly in Arkansas. both show jump dispersals and alleles in This trend may bring up another hypothesis non-neighboring populations, states away that cultivated Magnolias may affect gene from each other. More markers would need flow. Furthermore, it is possible that the to be assessed to understand further the cultivars being shipped from state to state population genetics of Magnolia acuminata. may be causing the jump dispersal of alleles over multiple states. One bizarre allele is Future Work 187, which seems to be present in many populations but skips the states in between. In future work, more microsatellite It occurs in Arkansas, Alabama, South (stm#) primers, derived from Magnolia Carolina, Ohio, Virginia, North Carolina, stellata, need to be optimized and tested on and New York. In the same way, allele 167 the population samples for M. acuminata. Of is present in New York, Georgia, and the markers examined in this study already, I Arkansas. Like alleles 195 and 199 for would highly advise re-running stm002 and marker stm49, the gene flow is difficult to stm214 at higher annealing temperatures explain in these markers. than previously performed (slightly above Stm200 also shows some straightforward 58°C and 60°C, respectively). Optimizing geographical tendencies too. Alleles 175 and each marker for the fragment analysis would 177 tend to be present in the coastal also be important. Marker stm002 was populations of South Carolina, Georgia, and almost good enough to use in this analysis Florida (additionally in North Carolina for but still had a little too much stutter to be allele 177). Allele 173 is only found in certain that the final results are correct. A North Carolina and South Carolina, larger subset of regions would add more suggesting strong interbreeding between support for population genetics hypotheses these two states. Marker stm49 also shows a about gene flow and geographic structuring. strong connection between these The current successful markers stm200 and populations. However, it must be noted that stm49 will need to be analyzed for statistical these states had the largest number of significance in addition to the remaining sampled populations, which may bias the eight markers in order for the paper to be data to some extent. Finally, allele 191 a published. widespread eastern allele present in Also, while the chloroplast regions (atpF- populations in West Virginia, Ohio, atpH, psbK-psbI, and ndhF-rpL32) showed Virginia, South Carolina, Georgia, and insignificant variation it may be worth while Alabama while allele 193 could be trying to sequence the chloroplast spacer considered a southwestern allele only being region atpB-rbcL which was found to be the present in Arkansas and Alabama. most informative character in the study As evident, the geographical sharing of performed by Azuma, Thein, and Kawano alleles is very complex and may vary with (1999) (Doi et al. 2002). many factors: possibly with cultivated Wollaeger 31
Another approach to understanding the Elizabeth Zimmer for her guidance and intermingling of this species of Magnolia is support. I would like to thank Gabriel through a pollen and seed dispersal study. Johnson for his insights, technical expertise, Though requiring an extensive level of patience, and for sending me the graphs of mathematics, statistics, and ecology, the the microsatellites. I sincerely appreciate the study of forest trees in this manner has been Magnolia Society's partial funding for this conducted previously on six species of project and Richard Figlar for orchestrating gymnosperms (conifers) for both maternally the collection of the plant samples. In and paternally inherited markers (Ennos addition, many thanks are extended to 1994). Such a study would allow testing the Virginia Power, Gene Hunt, and Liz Cottrell former hypothesis that Magnolia for their guidance and supervision over the acuminata's wide ranging alleles is the result NHRE program. of water-transmitted seeds/pollen. Likewise, I appreciate the time and dedication of wind dispersal would be important to Dr. Matthew Collier, Dr. John Ritter, and investigate as being another possible mode Dr. Michelle McWhorter for helping me of interbreeding. with the overall process and for serving as Most importantly, after approximately advisors on my senior Honors Thesis ten microsatellites have been assessed, a committee and for proofreading this paper. collaborative sampling with the Magnolia Finally, I would like to thank Dr. Horton Society of the M. acuminata individuals Hobbs for proofreading this thesis. used in representing their populations in this study needs to be performed. The correlation References of the microsatellite alleles could then be Arboretum Freiburg-Günterstal. Accessed July 23, assessed in relation to morphological 2010.
I would like to thank Cristián Samper for the funding for the NHRE program and Dr.
Wollaeger 32
Braun, E.L. 1955. The phytogeography of Hardin, J. W. 1954. An Analysis of Variation within unglaciated eastern Unites States and its Magnolia Acuminata L. Journal of the Mitchell interpretation. The Botanical Review, 21(6):297- Society, 298-312. 374. Hu, Y., Zhang, Q., Rao, G., and Sodmergen. 2008. Callaway, D.J. 1994. The World of Magnolias. Occurrence of plastids in the sperm cells of Portland, OR: Timber Press Inc. Caprifoliaceae: Biparental plastid inheritance in angiosperms is unilaterally derived from maternal Canright, J. E. 1960. The comparative morphology inheritance. Plant Cell Physiology, 49(6):958-968. and relationships of the Magoliaceae: III: Carpels. American Journal of Botany, 47:145-156. Hughes, C.E., Eastwood, R.J., and C.D. Bailey. 2006. From famine to feast? Selecting nuclear DNA Chen, B. and H. Nooteboom. 1993. Notes on sequence loci for plant species-level phylogeny Magnoliaceae III: the Magnoliaceae of China. reconstruction. Philosophical Transactions of the Annals of the Missouri Botanical Garden, 80:999- Royal Society of London, Biological Sciences, 1104. 361:211-225.
Dandy, J. 1927. The genera of Magnoliaceae. The Kim, S., Park, C., Kim, Y., and Y. Suh. 2001. Kew Bulletin, 1927:275-264. Phylogenetic relationships in family Magnoliaceae inferred from NDHF sequences. American Journal Doi, K., Kaga, A., Tomooka, N., and D.A. Vaughan. of Botany 88(4):717-728. 2002. Molecular phylogeny of genus Vigna subgenus Ceratotropis based on rDNA ITS and Law, Y. 1984. A preliminary study on the taxonomy atpB-rbcL intergenetic spacer of cpDNA of the family Magnoliaceae. Acta sequences. Genetics, 114:129-145. Phytotaxonomica Sinica, 22:80-109.
Ehrendorfer, F., Krendl, F., Habeler, E., and W. Law, Y. 1996. Magnoliaceae. In Flora Reipublicae Sauer. 1968. Chromosome numbers and evolution Popularis Sinicae, vol. 30(1). Science Press, in primitive angiosperms. Taxon, 17(4):337-353. Beijing, China.
Encyclopedia of Molecular Biology: Vol. 2 and Vol. Map of the United States. Accessed July 29, 2010. 3. 1999. Ed. T.E. Creighton. Wiley Biotechnology
Wollaeger 33
Nie, Z., Wen, J., Azuma, H., Qui, Y., Sun, H., Meng, Stiles, B.J. and C.L. Howel. 1996. Preliminary results Y., Sun, W., and E. Zimmer. 2008. Phylogenetic of a floristic survey of Rabun county, Georgia. and biogeographic complexity of Magnoliaceae in Castanea, 61(1):62-85. the Northern Hemisphere inferred from three nuclear data sets. Molecular Phylogenetics and Tesfaye, K., Borsch, T., Govers, K., and E. Bekele. Evolution, 48:1027-1040. 2007. Characterization of Coffea chloroplast microstellites and evidence for the recent Ouborg, N.J., Piquot, Y., and J.M.Van Groenendael. divergence of C. Arabica and D. eugenioides 1999. Population genetics, molecular markers and chloroplast genomes. Genome, 50:1112-1129. the study of dispersal in plants. Journal of Ecology Thien, L. 1974. Floral biology of Magnolia. 87:551-568. American Journal of Botany 61(10):1037-1045.
Pautasso, M. 2009. Geographical genetics and the Treseder, N.G. 1978. Magnolias. Great Britain: Faber conservation of forest trees. Perspectives in Plant and Faber. Ecology, Evolution and Systematics 11:157-189. USDA. Economic Research Service. 2002. Accessed Powell, W., Morgante, M., McDevitt, R., Vendramin, February 6, 2011.
Shaw, J., Lickey, E.B., Schilling, E.E., and R.L. Small. 2007. Comparison of whole chloroplast genome sequences to choose noncoding regions for phylogenetic studies in angiosperms: the tortoise and the hare III. American Journal of Botany, 94(3):275-288.
Shaw, J. and R.L. Small. 2005. Chloroplast DNA phylogeny and phylogeography of the North American plums (Prunus subgenus Prunus section Prunocerasus, Rosaceae). American Journal of Botany, 92(12):2011-2030.
Stanford, A., Harden R., and C. Parks. 2000. Phylogeny and biogeography of Juglans (Juglandaceae) based on matK and ITS sequence data. American Journal of Botany, 87:872-882.