GENOMICS-BASED CHARACTERIZATION OF TUMOR SUPPRESSOR GENES IN THE CARDIOVASCULAR SYSTEM: A ROLE FOR ADENOMATOSIS POLYPOSIS COLI GENE IN HUMAN CARDIOVASCULAR DEVELOPMENT AND DISEASE
Mojgan Rezvani
A thesis submitted in conforrnity with the requirements for the degree of Doctor of Philosophy Graduate lnstitute of Medical Sciences University of Toronto
8 Copyright by Mojgan Rezvani (2001)
1 National Library Bibliotheque nationale du Canada Acquisitions and Acquisitions et Bibtiogtaphic Services services bibtiographiques 395 Wellington Street 395, rue Wellington Ottawa ON K1A ON4 OttawaON K1AON4 Canada Canada
The author has granted a non- L'auteur a accordé une licence non exclusive licence allowing the exclusive permettant à la National Library of Canada to Bibliothèque nationale du Canada de reproduce, loan, distribute or sel1 reproduire, prêter, distribuer ou copies of this thesis in microform, vendre des copies de cette thèse sous paper or electronic formats. la forme de microfiche/nlm, de reproduction sur papier ou sur format électronique.
The author retains ownership of the L'auteur conserve la propriété du copyright in this thesis. Neither the droit d'auteur qui protège cette thèse. thesis nor substantial extracts fiom it Ni la thèse ni des extraits substantiels may be printed or otherwise de celle-ci ne doivent être imprimés reproduced without the author's ou autrement reproduits sans son permission. antorisation. GENOMICS-BASED CHARACTERIZATION OF TUMOR SUPPRESSOR GENES IN THE CARDIOVASCULAR SYSTEM: A ROLE FOR ADENOMATOSIS P9LYPOSIS COLI GENE IN HUMAN CARDIOVASCULAR DEVELOPMENT AND DISEASE
Mojgan Rezvani, Ph.D. (2001) Graduate lnstitute of Medical Sciences University of Toronto CANADA
ABST RACT
Advances in sequence-based genome research using expressed sequence tag (EST) technology offers the opportunity for large-scale gene discovery. Complernenting the EST technology, the rapidly developing area of bioinformatics devoted to the collection, organization and analysis of DNA and protein sequences has advanced significantly our understanding of gene regulation during development and in disease states.
The EST data can be analyzed in silico (cornputer based) to establish expression prof iles of cDNA libraries derived f rom specific tissues or organs.
Expression profiles of different cDNA libraries can be compared by in silico
Northern analysis as a tool to identify differentially expressed genes and to predict their functional roles in regulation of biological processes. In the current study, in silico Northem analysis of cardiac-derived EST's was employed to identify differentially expressed genes during cardiac development and in disease. Large scale expression profiling of EST's from cDNA libraries created from human fetal, normal adult and adult hypertrophie hearts revealed developrnentalfy and disease-dependent differentiat expression of severat genes
involved in regulation of cell number and growth, including tumor suppressor and
apoptosis-related genes, leading to the hypothesis that temporal changes in
expression of these growth regulating genes may underlie developmental- and
disease-specific alterations in cardiac growth phenotype. The tumor suppressor
adenomatosis polyposis coli (APC) and its interacting protein P-catenin were
found to be differentially expressed during cardiac development and in
hypertrophic disease, resulting in higher abundance of APC in normal adult heart
relative to hypertrophied and fetal heatts, and in reciprocal changes in p-catenin
protein levels. Loss of function studies using antisense inhibition of APC
translation in murine CzCi2 myoblasts inhibited cell proliferation and myotube
formation and led to an increase in cell death, in parallel with an increase in basal
p-catenin protein levels. Three novel APC protein isofoms were found to be
expressed in the heart in a developmental- and disease-specific manner, and cornmensurate with this, expression levels of altematively spliced brain-specific
(BS)- and exon-l containing APC gene isoforms were also found to Vary in developmental- and disease-specific manner. We conclude that APC plays a direct role in cardiac myocyte growth and differentiation and that differential and switching of altematively spliced and/or post-translationally modified APC isofoms may underlie, at least in part, some of the developmental- and disease- dependent alterations in cardiac growth phenotype.
iii ACKNOWLEDGEMENTS
1 would like to thank my melitor, Dr. CC. Liew, for outstanding supervision through out the course of this degree, and Dr. M. Rabinovitch and Dr. Peter Liu for their excellent guidance and encouragement as members of my supervisory cornmittee.
Thanks to IMS for their generous support of University of Toronto Open scholarship for the first year of my Ph.D. program as well as the yearly Merit Awards to date.
Thanks to Heart and Stroke Foundation of Canada for awarding a research traineeship for the past four years.
I would also like to thank my colleagues, David Hwang, Adam Dempsey,
David Barrans, Ken Shaw, Christopher Ton and Dimitri Stamatiou and express my special gratitude to Eva Cukennan and Jack Liew for their helpful insights.
Also. special thanks to Dr. V. Dzau and Dr. R. Pratts group, at the Brigham and women's hospital, Harvard Medical School in Boston for the opportunity of experiencing further scientific interaction as a exchange visiting scientist in the last year of my Ph.D. degree. I would like to specially thank Dr. L. G. Mello for his helpful comments and for sharing his extensive experience to prepare this thesis.
I would like to specially thank my parents, Ahmad Rezvani and Fateme Haji and rny sisters Nooshin and Rashin for their unconditional love and support.
Finally, I would like to express my eternal gratitude to the love of my life, rny husband, Günay Mete without whom none of this would have been possible. His undying support, inspiration, motivation and love have been the force to get me through it all. This Ph.D. degree belongs to hirn just as much as it belongs to me. TABLE Of CONTENTS
Title Page i Abstract ii Acknowledgement iv Table of Contents v List of Abreviations viii List of Figures and tables ix
CHAPTER 1: Introduction Preamble Hurnan Genome Project Expressed Sequence Tag (EST) Technology In Silico Northern Analysis EST Technology and Cardiovascular Genomics Genes lnvoived in Regulation of Growth in the Heart Tumor Suppressors, Cell Cycle and Cardiac Growth Suppressor Genes in Myocardium Tumor Suppressor APC in Cardiac Development and Disease A. Biochemistry and molecular biology of the APC gene B. Physiology and Pathophysiology of the APC gene Wingless 1 wnt Signaling Pathway p-Catenin Rationale, Hypothesis and Overview of Current Study A. Rationale B. Specific Hypotheses C. Experimental approach D. Significance
CHAPTER 2: Apoptosis-related Genes Expressed in Cardiovascular ûevetoptnent and Disease: An EST Approach Abst ract lntroduction Genes lnvolved in Apoptosis - A Cardiovascular Perspective Interfeukin-converting enzyme (ICE) family: Caspases Bcl-2 Family Apoptosis-related Genes ldentified in the Cardiovascular System a) Effectors MA-3 Nip Family Stannin b) Suppressors DAD-1 Apoptosis Inhibifory Protein 47 c) Intemidiate Regulators 47 Tumor Necrosis Factor (TNF) and Fas Receptor Systems47 p38 Family Member p38-2G4 49 Apoptotic Genes Studied in Our Laboratory 49 Zinc Finger Proteins 49 ~53 50 APC 51 Summary and Future Directions 51 Acknowledgment 53 Refe rences 54
CHAPTER 3: Role of Adenornatous Polyposis Coli in Human Cardiac Development and Disease Abstract 63 Introduction 64 Experimental Procedures Total RNA extraction frorn Tissue and Cell Culture 67 cDNA Library Construction and LargeScale Sequencing 67 of cDNA Libraries Sequence and Digital Northern Analysis 67 Reverse Transcription Polymerase Chain Reaction (RT-PCR) 68 Quantification of RT-PCR Results 69 lmmunoblotting Analysis 69 Ceil Culture 70 Antisense and Uptake Study 70 Cellular Proliferation Assay 71 Cellular Differentiation Assay 71 Statistics 72 Results Sequence and Computer-based Digital Northern Analysis 73 In Vitro Gene Expression Analysis (RT-PCR) 73 Protein Expression Level (Western Blot) 78 Cellular Growth and Differentiation Assay 78 Discussion 87 Acknowledgment 92 References 93
CHAPTER 4: Characterization of APC lsoforms in Caidiovascular System During Development and Disease Overview 97 Methods 1. Clones from human cDNA libraries 101 1 .l Isolation of cDNA clones cDNA clones 1 O1 1.2. Full Length AB1 Sequencing 1 O1 2. 5' Rapid Arnpllication of cDNA Ends (RACE) 101 2.t . RNA tsotation 2.2. Gene Specific Primer Design 2.3. PCR Amplification 2.4. Sequencing and Sequence Analysis of PCR Fragments 3. Sequencing of RT-PCR Products Arnplified with Prirnen Encompassing Exons 1 to 15 and Exon BS to 15 3.1 . Total RNA Extraction frorn Tissue 3.2. Primer Design 3.3. Reverse Transcription Polymerase Chain Reaction 3.4. Quantification of RT-PCR Results 3.5. Sequencing 3.6. Sequence Alignment and Analysis Results 1. Clones from human cDNA libraries 2. 5' RACE 2.1. PCR and Re-PCR 2.2. Sequencing of 5' RACE Products 2.3. Sequence Analysis 3. RT-PCR products amplified with primers spanning exons 1 to 15 and exons BS to 15 3.1. Differential Expression and Isofom Switching of APC in Myocardial Development and Disease 3.2. Sequence and BLAST Results Discussion
CHAPTER 5: General Discussion, Conclusion and Future Directions 1. Synthesis of major findings 2. Surnmary 3. Conclusions 4. Overall significance of the findings 5. Future Directions
REFERENCES
Appendix A
vii AAP Abridged anchor primer APC Adenornatosis polyposis coli ARD Amadillo repeat domains Bcl 8 cell lymphoma BLAST Basic Local Alignment Search Tool BS Brain specific Cdk Cyclic dependent kinase cDNA Cornplementary DNA CHRPE Congenital hypertrophy of the retinal pigment epithelium cv Cardiovascular CVbEST Cardiovascular based Expressed sequence tag Dsh Disheveled EST Expressed sequence tag FAP Familial adenomatous polyposis Fz Frizzled GSK3 Glycogen synthase kinase 3 HAH Human adult heart HDH Human diseased heart HFH Human fetal heart HGP Human genome project HHYH Human hypertrophie heart MAH Mouse adult heart MCR Mutation cluster region MFH Mouse fetal heart PCR Polyrnerase chain reaction RT-PCR Reverse transcriptase polymerase chain reaction SEM Standard error of mean TCF T cell specific factor TNF Tumor necrosis factor TNFR Tumor necrosis factor receptor
viii LtST ot FIGURES AND TABLES:
Chapter 1:
Figure 1. EST data collection for gene expression analysis
Figure 2. Eukaryotic cell cycle
Figure 3. Cell cycle check points
Figure 4. An ovewiew of apoptosis
Figure 5. Human APC chromosomal location
Figure 6. Mouse APC chrornosomal location
Figure 7. Functional domains of APC protein
Figure 8. Wnt signaling pathway
Chapter 3:
Figure 1. Differential expression of human APC and f3-catenin at the mRNA level
Figure 2. Differential expression of mouse APC and p-catenin at the mRNA level
Figure 3. Developmental expression of APC
Figure 4. Protein expression of p-catenin during development and diçease
Figure 5. Differential expression of APC isoforms
Figure 6. Effect of antisense on myotube differentiation
Figure 7. Effect of antisense on myotube morphology
Figure 8. Effect of antisense on protein translation
Figure 9. Effect of antisense on proliferation
Chapter 4:
Figure 1. APC gene structure Figure 2. OveMew of 5' RACE procedure
Figure 3. APC gene specific primers (GSPs)
Figure 4. APC cDNA clones insert size
Figure 5. Position of BLAST matches of APC cDNA clones
Figure 6. An overview of 5' RACE of control RNA
Figurel. 5' RACE products frorn mouse RNA
Figure 8. Re-amplification of 5' RACE products
Figure 9. 5' RACE products from various RNA samples
Figure 10. Isofomic expression of APC
Figurel 1. Human APC exon sizes
Tables:
Chapter 1 :
Table 1. In silico Northem analysis of tumor suppressors 20
Table 2. Tumor suppressor genes description according to literature 22
Chapter 2:
Table 1. In silico Northem analysis of apoptotic genes in CV system 39
Chapter 3:
Table 1. Digital Northem analysis of APC and p-catenin 74
Chapter 4:
Table 1. Human APC pnmer sequences for RT-PCR and sequencing 107
Table 2. Primers used for RT-PCR and sequencing 108 CHAPTER 1:
INTRODUCTION Preambte
In mammalian ernbryonic development, the heart is the first organ to fom for the obvious purpose of supporting later organs. In human, a primitive yet functional heart tube appears as early as three weeks following conception
(Moore, 1998). Interestlngly, the committed cardiac muscle progenitor cells in this primordial heart tube are capable of differentiating into contracting cardiac muscle ceiis at this time without converting to a post mitotic state through permanent exit from the cell cycle. Indeed, the increase in cardiac tissue mass in the fetal stage is predominantly due to myoblast hyperplasia, whereas cardiac growth in the adult is determined exclusively by myocyte hypertrophy
(Rumyantsev, 1991). The permanent withdrawal from the ceIl cycle by adulthood removes the ability of the myocardium to regenerate after injury such as myocardial infarction, thereby leading to increased mortality (Brodskey V et.
1980; Clubb F.J et al, 1984; Rumyantsev, P.P, 1991; Rumyantsev, P., 1977;
Claycomb, W.C. et al, 1992; Levey et al. 1996). This developrnentally programmed withdrawal from cell cycle progression is associated with numerous molecular factors. Despite signifiant advances in elucidating the factors that regulate cardiovascular (CV) development and growth, the underlying mechanisms are poorly understood. Thus the identification and characterization of the molecular regulators of cardiac muscle growth are essential for understanding the mechanisms of cardiac development in health and disease.
Observations made in other organs and cell types indicate a central role of molecular mediators of proliferation, differentiation and programmed cell death in regulating organ morphogenesis and cell number homeostasis (Saffar et al.,
1999). This complexity poses several problems such as identification of key gene(s) regulating these pathways that may be crucial targets for more effective therapeutic approaches. Recent advances in sequence-based-genome research using expressed sequence tag (EST) technology provides the opportunity for large-scale screening and discovery of genes and proteins in the context of their informational pathways or networks as opposed to study single genes or proteins. In addition, the EST data can be analyzed in silico (cornputer based) to establish expression profiles of individual cDNA libraries derived from specific tissues or organs (Hwang and Dempsey et al, 1997; Rezvani et al. 1998).
Expression profiles of different cDNA libraries can be compared by in silico
Northem analysis as a tool to identify differentially expressed genes. which may reveal functional interrelationships in the context of a particular biological process, such as organ development and remodeling or the pathophysiology of a specific disease.
This study applies EST technology to identify differentially expressed tumor suppressor genes with a potential role in cardiovascular development and disease. The functional significance of the tumor suppressor gene adenornatosis polyposis coli (APC) in cardiac development was further investigated.
Human Genome Project
The estimated total size of the human genome is 3.2Gb, of which only
1.1%-1.4% are protein-coding genes (Baitimore, 2001 ) and approximately 30,000-40,000 unique genes (infemationaf Human Gene Sequenchg
Consortium, 2001). This is in contrast with an earlier estimation of 60,000-
120,000 genes (Fields et al., 1994; Cohen 1997). The functional differences amongst various cell types, organs and organ systems of the body are detenined by their specific genetic profiles. This profile determines how the multiple cell types constituting the various tissues and organs and systems interact to generate cornplex integrated functions leading to homeostasis. Thus, the identification and characterization of al1 the genes constituting the human genome will provide valuable insight on the role of genes in normal and pathological states.
The human genome project (HGP) was established in the mid 1980's for the purpose of sequencing the entire human genome. This project is generally viewed as the most significant collective research enterprise in biology and medicine with the potential to lead to molecular diagnosis of various diseases and development of novel therapeutic approaches. The entire human genome
DNA sequence was expected to be completed by year 2003. However, with the technological advances in the field of biology, bioinfonatics and an extensive international collaboration network, a draft sequence of the hurnan genome was published early this year (International Human Gene Sequencing Consortium,
2001). Although, much work remains to be done in order to complete the entire human genome sequence, the preliminary sequence has already accelerated the discovery of candidate genes susceptible ?O causing diseases. Expressed Sequence Tag (EST) Technotogy
In the context of functional genomics, the identification of protein-encoding genes is imperative for detemination of function, as opposed to the large portion of non-coding DNA region in the human genome. A rapid growth in sequence- based genome research using Expressed Sequence Tags (ESTs) has led not only to the discovery of novel transcripts with unknown functions but also to the identification of genes that are expressed at very low levels in specific cell or tissue types (Hwang and Dempsey et al., 1997). ESTs are short single-pass
DNA sequences obtained from either 5' or 3' end of complementary DNA (cDNA) clones. ESTs are derived from a variety of cDNA libraries constructed by using mRNA as a template for reverse transcription into cDNA that corresponds to the coding sequence of gene. Normally, the collection of ESTs in a specific library leads to a complete gene expression profile of the tissue under study (Hwang et al., 2000). Thus, the EST approach is a highly efficient technique for large-sale gene identification. The first application of high-throughput sequencing of cDNA clones from human brain using the EST approach was described by Adams et al
(1991 ).
Sequence homology search of al1 ESTs against the non-redundant publicly available databases (GenebanWEMBUDDBJ and dbEST) are performed with the Basic Logarithrnic alignment search tool (BLAST). The ESTs are then annotated according to the corresponding match to other ESTs, and further categorized as "known" if they match other functionally known or, "EST" if they match other uncategorized ESTs, or as "novel" if no other EST matches are found (Figure t). Since severat ESTs coutd represent the same gene, due to random fragmentation of larger DNA fragments, a non-redundant set of sequences is necessary. Contiges (computerized assembly of overlapping
ESTs) has been used to generate the full coding region of cardiac troponin T
(Liew et al.. 1994). The non-redundant data can then be organized into functional categories for further analysis.
In Silico Northern Analysis
Data compiled from EST sequences from a representative non-normalized
(random) library generates a population of sequences that corresponds to the levels of gene expression in the tissue under study. In agreement with this. the expression profiles of different cDNA libraries can be compared to determine the presence or the absence as well as changes in expression levels (up-regulation or down-regulation) of specific genes. Such profiles are useful for cornpanson of gene expression profiles at different developmental stages or to identify alterations in gene expression during the progression of a pathological state.
Such large-scale identlication of differentially expressed genes enables the isolation of candidate genes responsible for specific phenotypic differences (for a review refer to reference Hwang and Dempsey et al, 1997).
Differentially expressed genes are identified by comparing EST frequencies from two independent cDNA libraries with expected frequencies on the basis of observed frequencies in other cDNA libraries used in a particular study. This technique is called in silico Northem analysis. The terni in silico is mfWA isolation from tissue
cDNA library construction
Library plating
Random bacteriophage ~laaueselection
PCR (Bacteriophage DNA used as template) I Automated DNA sequencing (PCR product used as template)
Partial cDNA sequencing (EST)
Nucleotide database search (BLAST)
EST anftation
Matched to other ESTS Matched to other known genes Unmatched (Novel) "EST" "Knownn -(CVbEST)
Non-redundant set qeneration
Functional categorization
Data analysis
Figure 1. Sequence of events in EST data collection for gene expression analysis. coined since the analysis is perfomed by cornputen (BioBfomatics). With this technique, the relative frequencies of known ESTs for each gene can be represented by differing intensities to generate an in silico Northem blot. As in conventional Northem blot, higher frequencies are represented by darker density and lower frequencies by lighter density, allowing for simultaneous visual assessrnent of the relative abundance of large numbers of transcripts. Poisson probabilities are calculated for the observed nurnber of ESTs in each library.
Combined Poisson probabilities for observed frequencies of each gene in both libraries are calculated by multiplying individual probabilities. Genes with single and combined values of Pc 0.1 0 and Pc 0.01, respectively are considered to be strong candidates for differential expression. The efficiency of this technique has been demonstrated by several investigators by comparing the expression profiles of different tissues (Adams et al., 1993, 1995; Liew et al., 1994; Hwang et al,
1995, 1997), as well as between different developmental and disease States
(Hwang et al., 1995, 1997; Ji et al., 1997).
The advantage of in house EST in silico analysis is its representation of the abundance of each gene in the library. As the number of randomly selected clones sequenced from a specific library increases, a plateau is reached in finding new functionally known genes, signaling that a sufficient number of representative clones from that library have been sequenced. This allows for cornputer-based analysis of the expression profile.
The rapid expansion of sequence-based genome research using the EST approach has allowed the formulation of profiles of expressed genes in the devetoping and hypertmphic human heart. Expression profites of each cDNA library were compared by in silico Northem analysis as a means of identifying differentially expressed genes (Hwang and Dempsey et al., 1997; Rezvani et al.,
1998). The emergent profiles revealed potential functional interactions.
EST Technology and Cardiovascular Genomics
Proliferation of cardiac rnyoblasts is responsible for most of the growth in fetal hearts. However. this ceases soon (1 day) after birth. Further increase in organ mass from this point onward is due exclusively to cell hypertrophy
(Brodskey et al., 1980). lnjury such as myocardial infarction, in which prolonged deprivation of oxygen leads to myocyte necrosis severely impairs cardiac function, because of the inability of adult cardiac myocytes to proliferate, thereby preventing replacement of lost tissue. Instead, the damage is "pîtched upn with non-contractile fibroblasts that form a fibrous scar. ln contrast, skeletal muscle tissue does retain some capacity for tissue regeneration. This, however, is achieved through hyperplasia of resident satellite cells that have the ability to differentiate into fully functional myocytes (Langer 1997). The molecular events surrounding cardiac development rernain largely unknown. The intensive effort by the Liew's laboratory in establishing cardiovascular-based ESTs (Cvbest). has provided a catalogue of genes expressed in human CV systern at different stages of development and in disease (Appendix A). ESTs generated from eleven-heart cDNA libraries representing different developmental and pathological stages were used for cornparison with several public databases for identification of candidate genes that exhibit devefopmentally- and pathorogically-
dependent differential expression patterns. This catalogue of genes serves as
the foundation for this thesis.
Genes lnvolved in Regulation of Growth in the Heart
In silico Northern analysis of data obtained from cDNA libraries derived
from fetal, adult and hypertrophie hearts revealed differential expression of
several genetic factors involved in regulation of cell number homeostasis.
Specifically, factors regulating apoptosis as well as several tumor suppressor
genes were found to be differentially expressed during cardiac development and
in diseased states (Hwang and Dempsey et al, 1997). Interestingly, many tumor
suppressors such as c-rnyc and APC have recently been reported to interact with
apoptotic pathways (Lotem et al, 1993; He et al. 1998), suggesting a novel role of these proteins, in addition to their direct role in regulating cell proliferation. The differential expression of these genes du ring cardiac development and in disease suggests that temporal differences in the expression level of these genes may participate in the regulation of growth in cardiac muscle. Thus, the role of genes such as tumor suppressors that are involved in regulation of cell cycle arrest becomes of interest, given the fact that mammalian cardiac myocytes perrnanently withdraw from the cell cycle by adulthood.
Tumor Suppressors, Cell Cycle and Cardiac Growth Progression through the rnarnmaiian ceIf cycle is a highly regulated event
involving multiple checkpoint proteins that ensure genetic stability of the host cell
DNA (Lodish et al., 1999). These proteins can be positive or negative regulators
of cell growth. When, the balance of stimulatory and inhibitory activities is
disturbed, it can result in unrestrained cell cycling and proliferative growth,
leading to cancer.
Cancer is a disease that sparks fear in the mindç of many people
throughout the world. However, discoveries in cancer studies have contributed
significantly to the understanding of the basic mechanisms involved in cell, tissue
and organ development. The function of most genes is similar among different
cell types. Their physiological role can usually be deduced from alterations in the
level of biological activity leading to a pathological condition.
Unlike cancerous cells which have unlimited proliferative potential, normal,
non-transfomed cells possess several fail-safe mechanisms encompassing the
cell-cycle that are involved in the prevention of proliferation and in repair of
defective DNA. The cell cycle leading to cell division progresses in a precise and timely fashion. The cycle begins with gap 1 (G1) phase, during which the cell
grows but does not replicate its DNA content. G1 is then followed by S phase, during which DNA replication takes place. The cell continues to grow and synthesizes proteins during the subsequent Gap 2 (G2) phase in preparation for
mitosis. Mitosis, the last step in the cell cycle, is the process that separates
replicated chromosomes equally into two daughter cells (Lodish et al., 1999)
(Figure 2). The error-free transmission of genetic material into each daughter Figure 2. Eukaryotic cell cycle. The cell cycle starts with G1 phase leading to S phase, where DNA replication takes place. During G2 phase cells continue to grow and synthesize proteins in preparation for mitosis. During mitosis replicated chromosomes are equally divided into two daughter cells. R is the restriction point where mammalian cells must pass before commiting to enter the Sphase and duplicate their entire DNA. Many positive and negative signais (e.g. DNA damage) determines whether a cell is allowed past this checkpoint in G1 phase. celt requires foolproof accuracy in DNA replication, chromosome segregation and
the ability to survive DNA damages.
Regulatory pathways known as checkpoints monitor the timely
progression through the cell cycle. Checkpoints also respond to cellular damage
by slowing the cell cycle to provide time for damage repair. Loss of checkpoint
function can lead to cancer through an increase transition of mutations.
Checkpoint effectors include both positive and negative signals. Positive signals
include growth factors, oncogenes, cyclins and cyclin dependent kinases (cdk).
Negative signals include cdk-inhibitors and tumor suppressors (Johnson et al..
1999). These signals detemine whether or not the cell is allowed progression
into the next phase beyond the checkpoints. Sequential activation and
inactivation of cdk by cyclins provides a mechanism for cell cycle regulation
(Evans et al., 1983) (Figure 3).
The first checkpoint is at late G1, after which cells are committed to continue through the remainder of cell cycle (Pardee, 1989; Sherr, 1994).
Activated D-type cyclins (cyclin-D) form a complex with which in tum activates cdk4 and cdk6. The tumor suppressor retinoblastoma (pRb) controls progression through the G1 checkpoint and is the primary target for cyclin-O/ cdk complexes
(Johnson et al., 1998). A second checkpoint retards progression through G2 to allow time for DNA repair before mitosis (Evans et al., 1983). This checkpoint is also regulated by complexes between cdk and cyclins (cyclin Ai cdkl) (Evans et al, 1983). Tumor suppressors
Onoogene - Cyclin Bi Cdk2 (cdkl )
Cyclin
Cyclin A/
\ Cyclin UCdk2 GO Cyclins Dl-031 CdK1,G
Turnor Suppressors
Figure 3. Transition via the cell cycle is determined by sequential activation of various cyclinl cdk complexes. Most of them are targets of the activating effect of oncogenes or inhibotory effect of tumor suppressors. Tumor suppressors normaily function to inhibit cell growth (d~sioncycle)
in response to some negative stimulus. The very existence of these genes
becornes evident only when they are lost, most commonly through mutations.
The occurrence of mutations in such genes produces a dysfunctional gene
product (protein), which is unable to cany out its nomal function and the result of
thiç is most frequently the formation of tumon. Because of the diploidy of the
mammalian genome, the loss of one allele coding for a specific tumor suppressor
is not always a big threat. In most cases, in order ior serious consequences,
such as cancer, to anse, both copies of the gene must be lost or mutated.
Losses of genes through somatic cell mutations have a frequency of occurrence
of less than 1u9th per cell generation (Weinberg, 1993).
In the absence of mutations, tumor suppressors also paiticipate in the
regulation of cell cycle progression through the checkpoints in the cell cycle.
Some tumor suppressors play a major role in detecting DNA damage and in deciding the progression of the ce11 through the cell cycle (Agarwal et al., 1995), others act as transcriptional factors (Dulic et al., 1994) that regulate the transcriptional activity of certain genes. One of the responses to conditions such as DNA damage is the arrest of the cell cycle at the GO stage until the damage is repaired (Lodish et al, 1999). Another response rnay be apoptosis (programmed cell death) (Rich et al., 2000). For example, tumor suppressor p53, which can cause cell cycle anest at both G1 and G2 checkpoints (Agarwal et al., 1995), acts as a transcriptional factor. In G1, it prevents chromosomal replication if
DNA damage is detected by transcriptional activation of cdk inhibitor p21 (Dulic et al., 1994). p53 can atso induce apoptosis in response to DNA damage
(Schwartz et al., 1998; for an overview of apoptosis pathways refer to figure 4).
With the use of these mechanisms, the cell is able to escape the proliferation of its defective genetic material.
In the event that a mutation occurs in tumor suppressor genes, the respective proteins coded by these genes will not be able to exert their normal restraining effect on the cell cycle, thereby allowing progression through the cell cycle. This may result ultimately in the replication of defective DNA and transformation of the replicating cells into a pro-oncogenic state (Zhou et al.,
2000).
The poor ability of adult cardiomyocytes to regenerate has lead to an interest in investigating the genes that are responsible for cell cycle regulation in the heart. In this context, tumor suppressor genes could assume a prominent status, given their role in promoting cell cycle anest. In an effort to obtain a developmental and pathophysiological profile of suppressor genes expressed in the heart, large-scale analysis of expressed sequence tags (ESTs) from several human cDNA libraries was perfonned. To date, our laboratory has generated more than 51, 000 cardiac-based ESTs from which a catalogue of more than
5000 known genes have been published (Hwang et al, 1997). Comparison of expression profiles of different cDNA libraries denved from human fetal, adult and hypertrophie hearts revealed the differentiai expression of many tumor suppressor genes (Table 1 ) .
Figure 4. An oveMew of apoptosis. Apopotosis can be induced via signaihg
through death receptors such as TNF and Fas receptors. Signaling through
these receptors results in a sequential activation of one caspase by another
leading to a cascade of proteolytic activity which in turn leads to digestion of
structural proteins in the cytoplasm and degradation of chromosomal DNA an
ultimately cell death. TNF can also inhibit apoptosis by activating NF-KB, which
induces the expression of IAP, leading to the inhibition of caspases 3, 7, and 9
and thus inhibiting apoptosis. Apoptosis is also inhibited by the survival pathway.
Survival factors such as growth factors and cytokines bind to their receptors, which initiate signaling through induction of anti-apoptotic Bcl-XL and Bcl-2 family
members. These mernbers inhibit the release of cytochrome C from
mitochondria and the subsequent activation of caspase 9 by cytochrom C. The
inhibition of caspase 9 activity in tum will lead to inhibition of apoptosis through
inhibition of caspases 3, 6, 7 activity by caspase 9 (Modified from Cell Signaling
Technology. Catalogue and Technical references. New England Biolabs. 2000; p 1 59-1 62). Suppressor Genes in Myocardtum
Each large-scale analysis can be dissected down to specific functional groups, gene families or categories (Hwang and Dempsey et al, 1997). Frorn our data, we have extracted a specific functional subset of genes identified in the heart. Application of these large-scale approaches revealed the differential expression of many tumor suppressor genes during cardiovascular development and disease, including APC, BRCA1. BRCA2, C-MYC, L-MYC, N-MYC. NFI.
NF2, p53, and WT1 (Table 1). In the heart, the alteration in the expression of these genes leads to growth induction in terminally differentiated cells that have lost the ability to undergo DNA replication. The more commonly studied tumor suppressors identified in our database are surnrnarized in Table 2 according to their functional classification.
Large-scale gene profiling can lead to the identification of pathways. where a putative functional role can be subsequently tested in vitro and/or in vivo. In this study, using the in silico approach, we determined the differential expression of the tumor suppressor adenomatosis polyposis coli gene and its interacting protein B-catenin, known to be involved in the wnt signaling pathway suggesting that this tumor suppressor system may play a role in cardiac development. TABLE t: In Sifico Northern anafysis of known twmor suppressor gem expressed in the human cardiovascular system
Accession numbers listed correspond to the putatively identified gene. In the event that an EST matched to more than one entry, the entry with the greatest number of EST hi!s was chosen. ESTs matching significantly to GenBank databaçe entries (Pd0 -Io) but exhibiting cg536 sequence identity were designated as homologs of the most significant match. ESTs matching significantly only to non-human GenBank database entries were designated as isologs of those genes. lntensities reflect the frequency of a given EST in a particular library, as a percentage of total ESTs in that library. Intensities are defined as follow:
1 EST
Modified from Hwang and Dempsey et al., Circulation 1997;96:4146-4203 URL: http://americanheart.orglScientific/pub~enome.html
* lndicates genes identified in an endothelial cDNA library (results not shown) " lndicates genes identified in an aorta cDNA library (results not shown) Each column represents a distinct cDNA library. F = Human fetal heart cDNA libraries (8-10, 10-12, 19 and 25 week old) Total: 34 973 ESTs A = Human normal adult heart cDNA libraries (four libraries) Total: 6 749 ESTs H = Human hypertrophie heait cDNA libraries (two libraries) Total: 1 563 ESTs
TABLE 2: Tumor suppressor genes description according to titerature.
Tumor 1 Chromosomal 1 Associated Disease Function Suppressor Location (Phenotype) BRCAI 17q21 Breast & ovarian -Transcriptional activator l 1 cancer (Anderson et al, 1998) -Repair of DNA damage (Zhong et al, 1999) Zinc finger & RING motif (Zheng et al, 2000) Breast & pancreatic -CeIl proliferation & cancer differentiation (Rajanet al, 1996) DCC 18q21.3 Colorectal cancer Regulator of apoptosis (Mehlen et al, 1998) C-Myc 8q24.12-q24.13 Burkitt lymphoma -Transcription factor -repressor of target genes expression (Lee et al, 1997) L-Myc 1 1p34.3 1 Lung carcinoma Contains DNA binding Domain N-Myc 2p24.1 Neuroblastoma -Contains DNA binding de rived Domain NF1 17q11 Neurofibromatosis, œnegative regulator of ras type 1 protein (basu et al, 1992) NF2 22q12.2 -Neurofibromatosis, Cell adhesion.Merlin, type 2 Shwanornin (Stokowski et al, -Melignant 2000) mesotheliorna P53 17q13.1 -Colorectal cancer -CeIl cycle regulation -Li-Fraumeni (transition from Go to Gi) (Lee syndrom et al, 1 993) -DNA-binding protein (Vogelstein et al, 1994) WT1 11~13 Willms tumor, type 1 Normal genitourinary -Denys-Drash development, organ-specific differentiation ?~~~~syndmrnKoziell et al., 2000; Barbaux et al., 1997; Lee et al., 2001 APC 5q21 -q22 -Adenornatous -CeII adhesion (Su et al, polyposis coli 1993) Colorectal cancer -Binds P-catenin (WNT =Turcotsyndrom signaling pathway) (Rubinfield -0esmoid disease et al, 1993) Tumor Suppressor APC in Cardlac bevelopment and Disease
Detailed analysis of the cardiovascular EST database revealed that the
APC gene and its interacting protein p-catenin are differentially expressed during
cardiac development and in the progression of disease, suggesting that this
tumor suppressor may play a functional role in these processes.
A. Biochemistry and molecular biology of the APC gene
APC is a 310 Kda protein encoded by a complex gene consisting of 15
exons. The coding region of human APC gene is greatly conserved and highly
homologous to mouse APC gene. The human APC gene locus is localized in the
long anof chromosome 5 in the regions behiveen q21-q22 (Figure 5). In the
mouse, the multiple intestinal neoplasia (Min) gene mapping to chromosome 18
(Figure 6) corresponds to the human APC gene due to the extensive homology
of synteny between mouse chromosome 18 and human chromosome 5 (Luongo
et al., 1993).
Several APC isoforms resulting from differential splicing and alternative in- frame translation initiation codons have been identified (Horii et al., 1993:
Thliveris et al., 1994). The native form of the APC gene contains exon 1 with the initiating methionine codon. Thliveris et al. (1994) and Horii et al. (1993) independently identified 4 exons 5' of exon 1, designated as .3,.2, -1 and BS
(brain specific). Sequence analysis indicated that these exons contain initiation codons that are in frame with exon 2 with an ORF. It has been suggested that these exons are altematively spliced. However, the presence of a stop codon in Chromosome 5
APC
Figure 5. Hurnan APC chromosamal location, 5q2f -5q22. exon t upstrearn of its initiation codon, suggests that the transcripts mntaining exons .3, .l,.2, and BS would lack exon 1. The splicing mechanisrn appears to be regulated in a tissue-çpecific fashion. Pyles et al. (1998) dernonstrated that
BS-containing isofons lacking exon 1, are highly expressed in terminally differentiated tissues. Thus, transcripts lacking exon 1 appear to be enriched in non-dividing cells (brain and neurons). The absence of exon 1 may produce protein isofoms that are unable to homodimerize. This homodimerization of APC monomen may be essential for suppression of proliferation.
The APC protein consists of 2843 arninoacids. Sequence analysis of the
APC protein identified several functional domains. The N-terminal dornain contains heptad repeats that can fom homo- and/or heterodimers. APC association with itself (homodimerization) was reported by Su et al (1 993) using irnmunoprecipitation. In this study the coimmunoprecipitation of wild type and mutant APC (C-terminal truncated) with C-terminus specific antibody suggested the interaction of wild type and mutant APC through N-teminus region. The heptad repeat encoded by exon 1 has been shown to support protein homodimerization (Su et al.. 1993). The middle domain contains several repeat motifs. The Drosophila p-catenin homologue AnnadilIo repeats are known to represent sites of protein-protein interaction. Although, their specific functions are still unknown they have been reported to be involved in activities such as cell adhesion, cell cycle control and microtubule stability (Hinchl et al., 1996). There are also three repeats of 15 amino acids, which are specific for binding to P- catenin (Su et al., 1993). In addition, the central dornain of APC protein contains 7 repeats of 20 amino acids wittr some sequence identity to the B-catenin binding sites (Groden et al., 1991). This sequence identity suggests that the 20 amino acid repeats also bind p-catenin. This was dernonstrated by the ability of APC lacking the 15 amino acid motifs to bind to p-catenin provided that at least one of the conserved 20 amino acid repeats have been retained intact. (Stappert et al.,
1994; Jou et al., 1995). The carboxyl-terminal domain has been shown to play a structural role by binding with microtubules (Deka et al., 1998). The C-terminal domain also binds to human disc large (hdlg), homologue of Drosophila disc large turnor suppressor, as revealed by yeast two hybrid screening and deletion analysis (Matsumine et al., 1996). king a similar technique Su et al identified another protein, named €61 that interacts with the C-terminal domain (Su et al
1995) (Figure 7).
B. Physiology and Pathophysiology of the APC gene
Although the exact role of APC is still unknown, the identification of proteins it interacts with has provided some dues to its functional role. APC interacts with a large number of other proteins such as E-cadherin, the human homologue of Dnsophila disc large turnor suppressor protein (DLG), axin and P- catenin.
It has been suggested that APC may be involved in the process of epithelial cell migration. Nathke et al (1996) localized APC to the actively migrating regions of the cell membranes, along with the microtubular network. It was also demonstrated that induction of cell migration resulted in further clustering of APC to the migrating edge of the celt membrane. The C-terminat dornain is the site for microtubule binding by APC and is almost always deleted in
APC mutations associated with colorectal cancer (Smith et la., 1994; Munemitsu et al., 1994).
APC is also involved in cell adhesion by interacting with catenins and cadherins. p-catenin directly binds to APC which serves as a bridge for its association to a-catenin (Huisken et al., 1994; Rubenfield et al., 1995; Funayarna et al., 1995). Cadherins are transmembrane proteins responsible for horneotypic calcium dependent cell-cell interactions prominent at the apical lateral boundary of epithelial cells and their interaction with p-catenin is essential for their nomal function in cell adhesion (Kemler 1993; Takeichi et al., 1993).
It has also been suggested that APC is involved in the regulation of cytoplasmic p-catenin through wingless/ wnt signaling pathway, which appears to be the dominant intracellular pathway by means of which APC exerts its modulatory actions (Bienz, 1999).
Mutations of the APC gene have been shown to be associated with colorectal cancer (Pyles et al., 1998; Santoro et al., 1997; Groden et al., 1991), commonly found in familial adenornatous polyposis (FAP) (Kinzler et al.. 1991;
Joslyn et al.. 1991). FAP is an autosomal dominant trait. Most of the mutations occur in the central region of the APC gene, designated as mutation cluster region (MGR) (Miyoshi et al., 1992). Mutations in MGR results in C-terminus truncated protein expression leading to rampant polyposis at a young age
(Kinzier et al., 1996). Mutations in other regions of the APC gene lead to less delayed and less aggressive polyposis (Spirio et ai., 1993; van der tuijt et ai.,
1996; Friedle et al., 1996). In some cases of congenital colorectal cancer, the
pathology also includes patches of congenital hypertrophy of the retinal pigment epitheliurn (CHRPE). Olshwang et al. (1993) demonstrated that the CHRPE lesions occur with greater prevalence if the protein-truncating mutations in the
APC gene occurs after exon 9, but are generally absent if the mutations occur upstrearn of exon 9. Most mutations in the APC gene in colorectal tumors resuit in a truncated APC protein due to either frame shift or nonsense mutations
(Beroud et al., 1996). Mutations in the Min gene lead to a phenotype resernbling that caused by mutations in the human APC gene (Fodde et al., 1994).
Wingless / wnt Signaling Pathway
The winglesdwnt intracellular signaling pathway is involved in the destabilization of cytoplasmic P-catenin through the formation of a quatemary protein complex with APC, axin. glycogen synthase kinase 3 (GSK3) and P- catenin. In this signaling pathway the absence of wnt ligand, which usually binds to its seven transmembrane receptor Friuled (Fz), stimulates quatemary complex formation where it earmarks P-catenin for degradation (Figure 8A). In the presence of wnt another cytoplasmic protein, Disheveled, binds to axin and leads to disruption of the quatemary protein complex resulting in the accumulation of unphosphorylated p-catenin which can be translocated into the nucleus, where it binds to transcription factor TCF and induces the transcription of wnt target genes (Bienz, 1999) (Figure 88).
&Cafenin
Sirnilar to APC, B-catenin plays dual functions in cells. Its association with
E-cadherin and a-catenin mediates cellular adhesion. In addition, p-catenin is the most important protein involved in wnt signaling as its free cytoplasmic level influences wnt target genes transcription. p-Catenin is composed of several binding domains. The N-terminus contains several GSK3 phosphorylation sites required for degradation. It has been shown that if one of these sites is mutated, p-catenin wiii not be earrnarked for degradation (Morin et al., 1997; Rubinfeld et al., 1997; Pai et al., 1997). Although, GSK3 phosphorylation of B-catenin is crucial in this patkway its efficient phosphorylation is dependent on the binding of the other proteins of the quatemary complex. Yost et al (1996) has shown that P- catenin cannot be efficiently phosphorylated by GSK3 in vitro obviating its need for another protein. Axin was discovered by yeast two hybrid screening as a protein binding to GSK3 (Yamamoto et al.. 1998; Sakanaka et al., 1998; Ikeda et al., 1998) and P-catenin (Behrens et al., 1998; Nakamura et al., 1998; Hamada et al., 1999). Also, several studies demonstrated the reduction of free cytoplasmic
Pcatenin by the introduction of axin into rnamrnafian cetfs (Behrens et al., 1998;
Nakarnura et al., 1998; Sakanaka et al., 1998; Hart et al., 1998; Kishida et al.,
1999). Axin also facilitates GSK3 phosphorylation of APC (Hart et al., 1998), suggesting that axin may serve as a scaffold for GSK3, B-catenin and APC, thus promoting their efficient phosphorylation. Axin itself becomes phosphorylated by
GSK3 which increases axin's stability (Yamamoto et al., 1999). The central domain of p-catenin consists of several Arrnadillo repeat domains (ARD). These ARD have been shown to interact with axin (Behrens et at., 1998: Nakamura et
al., 1998; Hamada et al., 1999), TCF (van de Wetering et al., 1997; Riese et al.,
1997; Behrens et al., 1996) and APC (Hulsken et al., 1994; Rubenfeld et al.,
1995; Yu et al., 1999; Hamada et al., 1999), al1 of which are involved in the wnt
signaling pathway.
Rationale, Hypothesis and Overview of Current Study
A. Rationale
In the context of cardiovascular development and pathophysiology, the
EST and h silico approach holds great potential for identification and characterization of key regulatory genes. The availability of cardiacovascular- based ESTs (Cvbest) derived from different stages of development and disease provides a readily accessible catalogue of genes from which temporal changes in gene expression can be examined over the course of heart development and pathogenesis.
In silico Northern analysis of the Cvbest database revealed the differential expression of tumor suppressor APC gene and its interacting protein $-catenin during different stages of development and disease in the heart. Given the quiescence of post fetal myocardium, it is possible that the differential expression
APCIP-catenin (wnt) signaling pathway may, at least in part, underlie the differentiation from the hyperplastic phenotype characteristic of fetal and neonatal myocardium into the normally quiescent or hypertrophie postnatal cardiac phenotypes. The downstream transcriptional targets of the APCIj3- cateninlwnt pathway include c-myc and cyciin Df, suggesting that interactions of this pathway with cell cycle regulatory proteins may play an essential role in regulation of cardiac development and growth. This is further supported by recent findings that mutations in the APC lead to colon cancer and hypertrophy of retinal pigment epithelium. On this premise, I suggest that the differential expression of gene(s) relevant to growth and cell cycle arrest, specifically the tumor suppressor
APC, plays an essential role in rnyocardial development and differentiation. This thesis examines the following specific hypotheses:
B. Specific Hypotheses:
1) Utilizing EST. in silico and bioinformatic technology will allow us to identify and characterize, in large-scale key gene(s) that are potentially involved in the regulation of processes involved in cardiovascular growth and pathological states.
2) APC plays an essential role in myocardial developrnent and differentiation.
C. Experimental approach
In silico Northem analysis of data obtained frorn fetal, adult and hypertrophic cDNA libraries was utilized to select candidate genes that are differentially expressed during cardiac development and in progression of disease. Reverse transcription polymerase chain reaction (RT-PCR) were performed on total RNA extracts from fetal. adult and hypertrophic hearts to demonstrate and quantrfy the dmerentiat expression of candidate genes.
Antisense oligonucleotide technology was applied to investigate the role of a candidate gene (APC) on differentiation and development using C2CI2cell line as an in vitro model of cardiac myocyte development and differentiation.
D. Significance
These studies will provide further elucidation of the molecular mechanisms involved in regulation of cardiac growth, and will establish whether the tumor suppressor gene product APC plays a functional role in determination of cardiomyocyte development and differentiation. The large-scale identification of key genes involved in regulation of cardiac development can potentially lead to novel targets for therapeutic intervention in the treatment of myocardial disease. CHAPTER 2:
Apoptosis-related Genes Expressed in Cardiovascular Development and Disease: An EST Approach
(M Rezvani et al., Cardiovascular Research 2000,45:621 -629) ABSTRACT Apoptosis (programrned cell death) is an important process, which, in conjunction with cell proliferation, maintains cell number homeostasis. Although
apoptosis has been more extensively investigated in other tissues [1,2], only recently has this process been suspected as a significant contributor to both disease and nomal development of the cardiovascular system [3,4,5,6]. Grasping a comprehension of the underlying genetic mechanisms of apoptosis is especially crucial considering that cardiac myocytes irreversibly exit the cell cycle and thus fail to proliferate during pathological conditions. Despite great strides in understanding the molecular pathways of apoptosis, there still remain numerous questions to be answered. identifying key genes that are involved in the regulatory process of apoptosis in the cardiovascular system will serve as a basis for creating more effective therapeutic treatments in cardiovascular disease and provide an understanding of how cardiac development is rnodulated. This review provides a brief summary of recent data implicating genes that may be involved in apoptosis in the cardiovascular system. It also outlines the continued usefulness of large-scale generation of expressed sequence tags (ESTs) to establish expression profites from the cardiovascular system and as a means of identifying potentially significant apoptotic regulators previously characterized in other tissues but not as yet in the cardiovascuiar system.
INTRODUCTiON Cell death can occur either by necrosis or apoptosis. Apoptotic and necrotic cells are generally different in morphology and in the sequence of events surrounding their demise. Morphologically, necrosis is characterized by cell lysis and organelle destruction whereas apoptosis results in cell shrinkage, blebbing, chromatin condensation and DNA fragmentation [q. The major difference between necrosis and apoptosis is the inflarnmatory response: cellular debris is accumulated in necrotic cells whereas in apoptotic cells, there exists an efficient degradation and disposal process through phagocytosis by neighbouring cells. Apoptosis is essential for normal development through its involvement in controlling cell number homeostasis in conjunction with cell proliferation. However, this balance can be petturbed leading to abnonal, often fatal conditions (such as embryonic lethality) [8,9];recent studies have sought to identify modulators of apoptosis in an attempt to decipher how the process can be positively or negatively regulated. Early work in the nematode C. elegans [10,11; for reviews see 12.1 31 has provided significant preliminary data in understanding the more complex regulation in higher organisms, such as in mammalian systems. Apoptosis can be initiated or controlled by developmental and environmental factors such as DNA damage. viral infection. cellular damage and loss of celltell or cell-substrate contact; it is also under the regulation of a number of genes. These regdatory genes can be classified into 3 categories: 1. Effectors of apoptosis (e.g., interleukin-1-beta converting enzyme (CE) family) which are implicated in the onset of apoptosis. 2. Suppressors of apoptosis (e.g., Bcl-2) which are very important for the regulation of apoptosis and are invoived in pathogenesis of many diseases such as lymphomas and leukemia [14,15]. 3. Intermediate regulators of apoptosis (e.g., Fas/Fas iigand, p53 and c-myc) which can interact with receptor complexes and other apoptotic regulators to induce or suppress apoptosis. To obtain a profile of genes expressed in the cardiovascular system from a developmental (fetal versus adult heart) and disease (normal adult versus hypertrophic heart) perspective, large-scale sequencing of expressed sequence tags (ESTs) from human cardiovascular cDNA libraries has been investigated. To date, our laboratory has sequenced over 51,000 ESTs from these libraries, and a catalogue of over 5,000 genes from the cardiovascular system and a profile of their differential expression has been published [16]. From this, genes that are known to be involved in apoptotic pathways - either as effectors, suppressors or intermediate regulators -- can be identified in the cardiovascular system and further characterized.
GENES INVOLVED IN APOPTOSIS - A CARDIOVASCULAR PERSPECTIVE The control of apoptosis has been linked to a vanety of genes and gene families. Differential expression of these genes between tissues, developmental and disease states and, indeed, between organisrns, has been studied to establish pathway(s) of apoptotic regulation. From our data, we have extracted and modified two specific functional subsets of genes identified in the cardiovascular systern [16], namely "apoptosis" (Table 1a) and 'DNA synthesis/replication" (Table 1b). In Table la, the genes were further characterized based on their mode of apoptotic regulation as described previously in the literature, namely 'effectors", "suppressors" or "intermediate regulators" of apoptosis. The two subsets were selected since both apoptosis and DNA synthesis/replication are involved in controlling cell number homeostasis. TABLE 1: In Silico Northern analysis of known genes expressed in the human cardiovascular systern: a) genes involved in apoptosis, and b) genes involved in cell division (DNA synthesis/replication). Modified from Hwang and Dempsey et al., Circulation 1997;96:4146-4203 URL: http:l/americanheart.org/Scientifidpu bdscipub/genome.html
Accession numbers listed correspond to the putatively identified gene. In the event that an EST matched to more than one entry, the entry with the greatest number of EST hits was chosen. ESTs matching significantly to GenBank database entries (Pd0''O ) but exhibiting ~95% sequence identity were designated as homotogs of the most significant match. ESTs matching significantiy only to non-human GenBank database entries were designated as isologs of those genes. Intensities reflect the frequency of a given EST in a particular Iibrary, as a percentage of total ESTs in that library. lntensities are defined as follows:
Intensity Frequency
O. 1O-0.49%
0.02-0.09°h
1 EST
* lndicates genes identified in an endothelial cDNA library (results not shown) " Indicates genes identified in an aorta cDNA library (results not shown) Each column represents a distinct cDNA library. F = Human fetal heart cDNA libraries (&IO, 10-12, 19 and 25 week old) Total: 34 973 ESTs k = Human normal adult heart cDNA libraries (four libraries) Total: 6 749 ESTs H = Human hypertrophie heart cDNA libraries (two tibraries) Total: 1 563 ESTs -- TNH~-TRAFsignaliing complex protein" L49431 1 1 p38-2G4 isotog X84789 - -) . 1 ~53activated fragment-1 U03106 1 b) Genes involved in cell division:DNA svnthesidreplication Accessio A H activator-1, 37 kDa subunit M87339 cell cycle gene RCCl X06130 DNA helicase QI 037984 1 DNA polymerase delta catalytic subunit M80397 1 DNA polyrnerase gamma, mitochondrial D84103 I
replication protein A 14kDa subunit (RPA) L07493 replication protein A 32-kda subunit JO5249 replication protein A 70 kDa subunit M63488 1 SCll isolog X80792 1 1 single stranded DNA bindinq protein, mitochondrial specific Mg4556 The genes and gene families identified in Our database are described . here, including recent data from those characterized further in our laboratory. Individual genes are classified according to their function as described in the Iiterature.
Interleukin-convertinci enzyme (ICE) family: caspases The discovery of death effector genes in C. elegans, namely ced-3 and ced-4 [17,18], provided an important foundation for understanding how apoptosis could be carried out in higher organisms. The ced-3 protein was found to be homologous to a mammalian cysteine protease known as interleukin-1beta- converting enzyme (ICE), now considered a prototype of the caspase (ICWCed- 3) family of proteins. To date there are at least 14 known human rnernbers of this family [19], and studies have shown that caspases are primary death effectors that can be inhibited to block apoptosis [20]. Consequent to cellular apoptotic inducement, caspase profomis are proteolytically cleaved to generate activated foms of the enzyme. Typically, these enzymes are activated by other memben of the ICE family, such as the positive regulator caspase-2 (ICH- 1INEDD-2) whose proform is cleaved by a caspase-3 (CPP32)-likeprotease [21]. Recently, caspases have been found to play an important role in regulating apoptosis in the cardiovascular system (for a review, see ref. 22), particularly in vascular srnooth muscle cells [23] and cardiac cells. In vitro, apoptosis induced in cultured rat myocytes was attenuated with ZVAD-fmk, a caspase-specific inhibitor [24]; caspase-3 was found to be present in staurosporine-induced apoptotic cells, implicating this family member as an effector of apoptosis. Two mernbers of the ICE family may provide further insight into a link between apoptosis regulation and cardiac development. Ich-1L and Ich-1S. also known as caspase-2, has been uncovered through random sequencing of a heart cDNA library [16]. These genes represent two Ich-1 mRNA species that have been reported through alternative splicing: Ich-IL, a gene encoding a 435 amino acid protein that induces programrned cell death; and Ich-1s. a truncated version of Ich-1L whose overexpression suppresses apoptosis [25].
Bcl-2 Family Spawning from previous work in the nematode C. elegans, a homologue to the death suppressor gene ced-9 was identified in mammals which was found to be significant in maintaining cell survival in human B-celi lymphoma [14,26,27]. Named Bcl-2, this gene served as a prototype for a large family of related apoptotic regulators. including various isoforms and homologues (e.g., Bcl-xUBcl-xS, Bax, Bad, Bak, Bik, etc.) which function to promote death or, like Bcl-2, possess anti-apoptotic activity. A striking feature of the Bcl-2 family (and one that has helped pave the way for the discovery of novel family members) is the ability for the rnolecules to fon hornodimers and heterodimers, a trait that appears to play a significant role in controlling apoptosis [28,29].ldentifying the differential expression of these genes is crucial in understanding how cell number balance is upset in cardiovascular development and/or disease. The involvement of Bcl-2 family mernbers in ischemia and oxidative stress is significant [30,31] although the exact mechanism by which apoptosis is signalled remains a mystery. Eariy work reported that Bcl-2 may play an important role in preventing cell death through the scavenging of free radicals, but a direct involvement in myocardial ischemia may not be as significant as suggested previously, considering that it also functions to attenuate apoptosis under anaerobic conditions [29]. Consequently, alternative mechanisms of apoptosis in this condition have been investigated. 60th H202 and 02-were found to induce apoptosis in isolated cardiac cells but without a concomitant increase in Bcl-2 or Bax protein levels; furthenore, HzOa induces an upregulation of Bad protein, following which, Bad and Bax fom heterodimers with Bcl-2 [32). It appears, however, that this pathway is independent from those triggered by free radicals (e.g., 02-)and suggests a more complex underlying mechanisrn of apoptotic response. Support for this lies in the findings that Bcl-2 and NFkappaB are differentially regulated in response to ischemia and reperfusion. During repeated cyclic episodes of short-ten ischemia followed by a short period of reperfusion, cardiomyocyte apoptosis and DNA fragmentation were reduced, associated with increased expression of Bcl-2 mRNA and activation of NFkappaB [33]. Thus, Bcl-2 and its family memben appear to have crucial roles in the progression of apoptosis during ischemia, although the involvement of each component remains to be fully elucidated. Consistent with these data, we have identified several Bcl-2 family members in Our heart databases. In addition to Bcl-2 itself and related proteins, other genes that have been found to be expressed in the cardiovascular system (Table la) include bcl-2-binding component 6, Bak, Bcl-x, and BID (identified in a human endothelial cell library; data not shown). Bak and Bcl-x have recently been implicated in cytokine-induced cardiac myocyte apoptosis [34]. BID, a BH3 domain-containing death agonist protein [35], binds to other family member proteins (especially Bax and Bcl-2) to induce apoptosis 136).
Apoptosis-nlated genes identified in the cardiovascular systern Through the course of cDNA library sequencing, we have identified apoptosis-related genes (Table 1) previously charactenzed in other tissues or organisms, but whose role in the cardiovascular system is either newly-emerging or poorly recognized at this time. With further study, these genes may provide significant insight into the mechanisms and pathways of apoptosis in cardiac tissue
a) Effectors -MA33 MA-3 is a novel mouse gene whose level was found to be induced in apoptosis-induced mouse cell lines (including thymocytes, T cells, 8 cells and pheochromocytoma) [37. The MA-3 mRNA was expressed throughout mouse adult tissues, especially in the thymus. The MA-3 gene appears to be highly conserved dunng evolution in vertebrates and in Drosophila.
Nip family The Nip family of proteins were identified using a yeast-two hybrid screen which sought to identify factors interacting with adenovirus El B 19 kDa protein and its functional substitute, Bcl-2 [38]. Thus, interaction of Nip with these two proteins appears to contribute to cell survival [38]. However, Nip 3 (nineteen kDa interacting protein-3) is a homodimerizing Bcl-2 binding protein [39]and a potent mitochondrial membrane-bound pro-apoptotic regulator found to overcome suppressor effects of Bcl-2 [40].
Stannin Stannin is a protein involved in the neurotoxicity of trimethylin, a potent chernical that damages nerve cells 1411. Stannin is highly expressed in apoptotic neuronal cells, implying a role for this protein in neurovascular pathology. Although Northem blot failed to detect any appreciable levels of stannin mRNA in rat heart [42], the finding of a stannin isolog in a human fetal heart cDNA library reveals the benefits of large-scale sequencing in discovering low-expressed genes, as stannin may be expressed at a level below the detection limit of Northern blot.
DAD-1 In hamster cell lines, a mutant form of DAD-1 was found to induce apoptosis, suggesting a role for this protein as an apoptotic suppressor [43]. In silico analysis has shown that DAD-1 is more highly expressed in cardiac hypertrophy compared to normal adult heart, and thus may play a role in controlling cell number during disease. In fact, of the apoptotic regulators identified in Our database, DAD-1 was the only gene found to be expressed in a hypertrophic heart library (Table 1).
Apoptosis inhibitorv Protein Neuronal apoptosis inhibitory protein (NAIP) appears to play a key role in spinal muscular atrophy. In individuals suffering from this disease, a deletion in the NAIP gene -- homologous to baculoviral apoptosis inhibitor -- has been linked to increased apoptosis in neuronal cells [44].
C) ln termediate regulators Tumor necrosis factor (TNF) and Fas rece~torsvstems Whereas effectors and suppressors act intracellularly to modulate apoptosis directly, receptor-associated proteins and signal transducen work in concert to regulate cell death initiated by extracellular agonists. Two receptor systems involved in this network are the tumor necrosis factor receptor (TNFRI) and FasIAPO-1 which, after stimulation from receptor ligands, signal activation of apoptosis (for review see ref. 45). Recent receptor-binding studies have identified a family of ligands, which interact with an 80 amino acid region on the receptor known as the "death domain," that trigger the pro-apoptotic response: TNF-alpha, Fasl, Apo-2 [46], FADDlMORTl (which is recruited to Fas upon binding and interacts with FLICEIMACH/MchS; see refs. 47,48.49,50.51). RIP and TRADD. The Fas/TNF receptor system is rapidly becoming well understood and recent studies have implicated members of this protein family in a variety of cardiovascular diseases: a) dilated cardiomyopathy was found to have a significant positive correlation with Fas expression and apoptosis from the myocytes of patients with this condition [52]; b) increased FasL expression in inflammatory disease, reflecting the role of apoptosis in autoimmune myocarditis [53,54,55]; c) Fas was found to be expressed in a fetal heart cONA library [16]. Within the complex of the Fas receptor system, FAFl associates with the cytoplasmic domain of FAS and has been found to potentiate apoptosis in mice
[56]. TDAG51 (see Table 1a; identified in a human aorta cDNA library, results not shown) also interacts with Fas to induce apoptosis in T-lymphocytes [57. Further studies will confirm their involvement in cardiovascular apoptosis. The TNF-alpha receptor system is especially intensting for modulating apoptosis as it appears to serve a dual function: not only does it induce apoptosis thmugh mediators such as FADD. it also can act as an apoptotic suppressor via the activation of NFkappaB. Originally identified in baculoviruses, homologous mammalian inhibitory apoptotic proteins (IAPs) have been identified and characterized. lAPl and IAP2 interact with a heterocomplex formed from TNFR2 signal transducers and TNF-receptor associated factors TRAFl and TRAF2 [58]. The duality of TNFR apoptotic modulation is apparent in T- lymphocyte death from aging: increased expression of TNFRl and TRADD coupled with activation of caspases 3 and 8, and a decreased expression of TNFR2 and TRAF2 was observed in cells from lymphocytes taken from aged humans where there exists increased apoptosis (591. p38 familv member p38-2G4 Members of the p38 family have been shown to play significant roles in regulating apoptosis in cardiovascular disease. Expression of p38 mitogen- activated protein kinase (MAPK) was found to be higher in cardiac hypertrophy [60] and during ischemia [61].lnhibitiny p38 MAPK during ischemia significantly reduces apoptosis and injury following reperfusion [62]. We have identified in Our database a clone representing p38-2G4, a mammalian proliferation- associated nuclear protein which is modified during the cell cycle and was previously observed in murine macrophages [63]. Although not a MAPK, this gene represents an interesting novel member of the p38 family with regard to cell regulation.
Aooptotic qenes studied in Our laboratory Zinc fincier proteins Recent studies have implicated members of the zinc finger protein (ZFP) family of transcription factors in the positive or negative regulation of apoptosis. For example, extensive apoptosis has been reported in cells a) lacking GATA-1 function [64], and b) overexpressing PAG608 [65], Spl [66],ZK1 [671, Requiem [68] and WT1 [69]. Although several ZFPs have been functionally linked to apoptosis, the precise regulatory networks of apoptotic pathways are still not well understood. To understand the pathological mechanisms of heart failure and the involvement of apoptosis, extensive studies of cardiovascular ZFP regulatory networks are required. As an initial step toward this goal, a recently established profile of ZFPs from heart cDNA libraries could be used as a significant resource of ZFP expression data [70].Elucidating the function of these and other genes identified in the profile may pave the way in understanding the role of ZFPs in apoptotic regulatory pathways of the heart and will help clarify the pathogenesis of cardiovascular disease.
The tumor suppressor DNA-binding protein p53 is widely known as an intemediate effector of apoptosis. It is involved in rnechanisms of growth arrest and apoptosis, and rnay stimulate cell death in response to DNA damage [71,72]; conversely, p53-induced apoptosis can be inhibited by mernbers of the Bcl-2 family [73]. Exposure of myocytes to H202and 02--- and thus stimulating apoptosis -- has resulted in increased levels of p53 protein [32]. p53 activates Bax and represses bcl-2, and may work to induce apoptosis through upregulation of the renin-angiotensin systern, as observed in rat cardiomyocytes which showed increased levels of angiotensinogen and angiotensin II AT1 receptor, and a consequent 14-fold increase in angiotensin-Il expression [74]. Our preliminary RT-PCR results have indicated a differential expression of p53 mRNA during human heart development as well as in cardiac hypertrophy (unpublished data; results not shown). Finding therapeutic agents that rnay control the level of p53-induced apoptosis may be very important in reducing the consequences of cardiac injury (for review see ref. 75). In silico Northem analysis has identified a gene, WAFI, which is directly induced by p53. It contains a p53-binding site in its promoter region and was shown to reduce human tumors in culture [76].
-APC The tumor suppressor protein adenomatosis polyposis coli (APC) was first identified in the cardiovascular system in Apnl, 1996, [accession nurnber N85172; ref. 161 and its expression confimed by RT-PCR [77,78]. In an attempt to characterize the role of APC in the cardiovascular system, we have generated preliminary data from a recent study that indicates a possible involvement of APC in the apoptotic process in vitro (manuscript submitted for publication). Inhibition of APC expression by antisense oligonucleotides drastically altered the cellular proliferation rate, reducing the number of cells during the course of the experiment. In addition, there appeared to be higher cell death in antisense treatment by virtue of a greater number of detached cells. This suggests that APC may also be involved in programmed cell death (i.e., apoptosis) sirnilar to what has been previously observed with many other tumor suppressors. For example, transcription factors such as c-myc are intimately associated with cellular proliferation as its constitutive expression increases the susceptibility of cells to apoptosis a9]. Interestingly, a recent study has shown that APC is involved in the c-myc pathway [80], providing fuither evidence for a possible link between APC and apoptotic regulation.
SUMMARY AND FUTURE DIRECTIONS Large-scale EST sequencing of heart cDNA libraries has proven to be a successful means of identifying key regulatory genes involved in cardiovascular development and disease [16,81,82]. This method has allowed us to compare expression patterns of cardiovascular genes from different categories within the database, such as in this review where we compare genes involved in apoptosis and DNA synthesis/cell division. As with other well-docurnented apoptotic regulatory proteins, understanding the involvernent of novel cardiac cell modulators is a critical undertaking, considering that in hurnans, myocytes irreversibly exit the cell cycle just before birth. Cardiomyocytes are especially prone to irnbalances in cell number, such as the case in myocardial infarction, in which prolonged deprivation of oxygen leads to local necrosis of cardiomyocytes. This is particularly damaging to the health of the organism because of the inahility of cardiomyocytes to re-enter a proliferating rnitotic cell cycle thus preventing replacement of lost tissue. Instead, the damage is patched up with non- contractile fibroblasts that form fibrous scar tissue. In North America, where cardiovascular disease represents the prime cause of death, cardiac research at the molecular level has been focused on elucidating mechanisrns underlying cardiomyoctye re-entry into the cell cycle. Since proliferation and apoptosis work in concert to balance cell number, the focus of investigations should also be directed toward understanding mechanisms regulating apoptosis and the manner in which these mechanisms intertwine with those rnodulating cell cycle re-entry. This is supported by the observation that the general expression pattern of genes regulating DNA synthesis and replication mirror those that are involved in apoptotic pathways (Tables 1 and 2). How these cells reach a state of apoptotic inducement, and thus upsetting the inherent balance, may provide significant evidence of regulatory effects in cell number homeostasis. By establishing a profile of cardiovascular gene expression, and identifying those genes involved in modulating this balance, gaining insight into the mechanisrns of apoptosis becomes a much simpler task. The use of bioinformatics has provided important preliminary data for studying at the bench level the effects of these candidate genes in a more convenient fashion. One limitation to this approach is the amount of data needed to accurately arrive at conclusions of differential gene expression. Indeed, large-scale sequencing offen the ability to establish a trend of expression patterns between libraries if the number of ESTs generated is significant enough; careful statistical analysis of individual gene expression (e.g., detemining Poisson probabilities; see ref. 16) and supplementary confirmatory work at the bench level (such as with RT- PCR on more interesting clones; ref. 78) can contribute to a more robust result. Gene expression profiles will no doubt lead to a better understanding and further hypotheses into the regulatory pathways of apoptosis and disease. Further investigation into novel genes may reveal previously unknown apoptotic regulators. In the future, this groundwork will be increasingly beneficial for designing more effective therapeutic interventions in counteracting apoptosis with the hopes of successfully treating cardiovascular disease.
ACKNOWLEDGEMENTS
The Cardiac Gene Unit (URL: http://www.tcgu.med.utoronto.ca) was established in memory of Nigel M. S. Martin. This work was supported by the Heart and Stroke Foundation of Ontario, the Medical Research Councii of Canada and Spectral Diagnostics. Inc. MR and K-SD were recipients of Heart and Stroke Foundation Traineeships. MR and JDB were recipients of University of Toronto Open Fellowships. We would also like to thank Mr. Adam Dempsey and Dr. Noel Pabalan for their critical comments and suggestions in the preparation of this manuscript. REFERENCES
Jacobson MD. Weil M, Raff MC. Proçrammed cell death in animal development. Cell. 1997;88:347-354.
Nagata S. Apoptosis by death factor. Cell 1997;88:355-365.
Cheng W, Li B. Kajstura J, et al. Stretch-induced programmed myocyte cell death. J Clin Invest. 1995;96:2247-2259.
Colucci WS. Apoptosis in the heart. N Engl J Med 1996;335:1224-26.
Narula J, Haider N, Virmani R, et al. Programmed myocyte death in end- stage heart failure. N Engl J Med 1996;335: 1 182-89.
Olivetti O, Abbi R, Quaini FI et al. kpoptosis in the failing human heart. N Engl J Med 1997;336: 1 131 -41.
Reutelingsperger, C. Molecular biology of apoptosis. Impact of apoptosis (programmed cell death) for clinical laboratory sciences. 50th Annual AACC Meeting, Chicago, 1998. (http://web.apoptosis. net/-apoptosis/mol biolindex.html)
Chester N, Kuo F, Kozak C, O'Hara CD, Leder P. Stagespecific apoptosis, developmental delay, and embryonic lethality in rnice homozygous for a targeted disruption in the murine Bloom's syndrome gene. Genes Dev 1998; 12(21):3382-93.
Laytragoon-Lewin N. Programmed cell death: the influence of CD40, CD95 (Fas or Apo-1) and their ligands. Med Oncol 1998; 15(l): 1 5-9.
Miura M, Zhu HlRotello R, Hartwieg EA, Yuan J. Induction of apoptosis in fibroblasts by IL4 beta-converting enzyme, a mammalian hornolog of the C. elegans cell death gene ced-3. Cell 1993;75(4):653-60.
Xue D, Horvitz HR. Inhibition of the Caenorhabditis elegans cell-death protease CED-3 by a CED-3 cleavage site in baculovirus p35 protein. Nature 1995;377(6546):248-51.
Hengartner MO and Horvitz HR. Programmed cell death in Caenorhabditis elegans. Curr Opin Genet Dev 1994;4(4):581-6.
Horvitz HR. Genetic control of programmed cell death in the nematode Caenorhabditis elegans. Cancer Res 1999;59(7 Suppl):1701S-1706s. [14] Kusenda J. Bcl-2 family proteins and leukemia. Neoplasma 1998;45(3): 11 7-22.
Bruckheimer EM, Cho SH, Sarkiss M, Hermann J, McDonnell TJ. The Bcl-2 gene farnily and apoptosis. Adv Biochem Eng Biotechnol 1998;62:75-105.
Hwang DM, Dempsey AA, Wang RX, et al. A Genome-based Resource for Molecular Cardiovascular Medicine: Toward a Compendium of Cardiovascular Genes. Circulation 1997;96:4146-4203.
Yuan JY, Howitz HR. The Caenorhabditis elegans genes ceci-3 and ced- 4 act cell autonomously to cause programmed cell death. Dev Biol 1990;138(1):33-41.
Yuan J, Horvitz HR. The Caenorhabditis elegans cell death gene ced-4 encodes a novel protein and is expressed dunng the period of extensive programmed cell death. Development 1992; 1 16(2):309-20.
Davis D, Wells S. Caspase 3-like activity appean in buffer containing live intact cells. BioRadiations 1999; 103:42-43.
Fraser A, McCarthy N and Evan GI. Biochemistry of ce11 death. Curr Opin Neurobiol 1996;6(1 ):il-80
Li H, Bergeron L, Cryns V, et al. Activation of caspase-2 in apoptosis. J Biol Chem 1997;272(34):21010-7.
Loppnow H, Werdan K, Reuter G, Flad HD. The interleukin-1 and interleukin-1 converting enzyme families in the cardiovascular system. Eur Cytokine Netw 1998;9(4):675-80.
Horiuchi M,Yarnada H,Akishita M, Ito M, Tamura K, Dzau V3. Interferon regulatory factors regulate interleukin-1betatonverting enzyme expression and apoptosis in vascular srnooth muscle cells. Hypertension 1999;33(1):162-6.
Yue TL, Wang C, Rornanic AM, et al. Staurosporine-induced apoptosis in cardiomyocytes: A potential role of caspase3. J Mol Cell Cardiol 1998;30(3):495-507
Wang L, Miura M, Bergeron L, Zhu H, Yuan J. Ich-1, an Icelced-3-related gene. encodes both positive and negative regulaton of programmed cell death. Cell 1994;78(5):739-50. [26] Hockenberry DM, Oltvai ZN, Yin XM, Milliman CL, Korsmeyer SJ. Bcl-2 functions in an antioxidant pathway to prevent apoptosis. Cell 1993;75:241-251.
Hengartner MO and Hoivitz HR. C. elegans cell suivival gene ced-9 encodes a functional homolog of the mammalian proto-oncogene bcl-2. Cell 1994;76(4):665-76.
Kroemer G. The proto-oncogene Bcl-2 and its role in regulating apoptosis. Nat Med 1997;3(6):614-20.
MacLellan WR and Schneider MD. Death by design: Programrned cell death in cardiovascular biology and disease. Circ Res. 1997;81:137-144.
Saikumar P. Dong Z, Weinberg JM, Venkatachalam MA. Mechanisms of cell death in hypoxia/reoxygenation injury. Oncogene 1998;l 7(25):3341œ 9.
Park JR, Hockenbeny DM. BCLP, a novel regulator of apoptosis. J Cell Biochem 1996;6O(l): 12-7
von Harsdorf R, Li PF, Dietz R. Signaling pathways in reactive oxygen species-induced cardiomyocyte apoptosis. Circulation 1 999;99(22):2934- 41
Maulik N, Goswami S, Galang N, Das DK. Differential regulation of Bcl-2, AP-1 and NF-kappaB on cardiomyocyte apoptosis du ring myocardial ischemic stress adaptation. FEBS Lett 1999;443(3):331-6
Ing DJ, Zang J, Dzau VJ, Webster KA, Bishopric NH. Modulation of cytokine-induced cardiac myocyte apoptosis by nitric oxide, Bak, and Bcl- x. Circ Res ?999;84(1):2?-33
Wang K. Yin XM, Chao Di, Milliman CL, Konmeyer SJ. BID: a novel BH3 domain-only death agonist. Genes Dev 1996;10(22):2859-69.
Wang K. Yin XM, Copeland NG, et al. BID, a proapoptotic BCL-2 family member, is localized to mouse chromosome 6 and human chromosome 22ql1. Genomics 1998;53(2):235-8.
Shibahara K, Asano M, Ishida Y, Aoki T, Koike T, Honjo T. Isolation of a novel mouse gene MA-3 that is induced upon programmed cell death. Gene 1995;166(2):297-301. Boyd JM, Malstrom S, Subrarnanian T, et al. Adenovirus El6 19 kDa and Bcl-2 proteins interact with a common set of cellular proteins. Cell 1994;79(2):341-51.
Chen G, Ray R, Dubik D, et al. The ElB 19WBcl-2-binding protein Nip3 is a dimeric rnitochondrial protetn that activates apoptosis. J Exp Med 1997; 186(12): 1975-83.
Chen G, Cizeau J, Vande Velde C, et al. Nix and Nip3 fom a subfarnily of pro-apoptotic mitochondrial proteins. J Biol Chem 1999;274(1):7-10.
Toggas SM, Krady JK, Billingsley ML. Molecular neurotoxicology of trimethyltin: identification of stannin, a novel protein expressed in trimethyltin-sensitive cells. Mol Pharmacol 1992;42(1):4I-S6.
Dejneka NS, Patanow CM, Polavarapu R, Toggas SM, Krady JK, Billingsley ML. Localization and characterization of stannin: relationship to cellular sensitivity to organotin compounds. Neurochern Int 1997;31(6):801-15.
Nakashirna T, Sekiguchi T, Kuraoka A, et al. Molecular cloning of a human cDNA encoding a novel protein, DAD1, whose defect causes apoptotic cell death in hamster BHK21 cells. Mol Cell Biol 1993; 13(10):6367-74.
Roy N, Mahadevan MS, McLean M, et al. The gene for neuronal apoptosis inhibitory protein is partially deleted in individuals with spinal muscular atrophy. Cell 1995;80(1):167-78.
Gruss HJ. Molecular, structural, and biological characteristics of the tumor necrosis factor ligand superfamily. Int J Clin Lab Res ?996;26(3):t 43-59.
Pitti RM, Marsters SA, Ruppert S. Donahue CJ,Moore A, Ashkenazi. Induction of apoptosis by Apo-2 ligand, a new member of the tumor necrosis factor cytokine family. J Biol Chem 1996;271(22): 12687-90.
[471 Boldin MP, Goncharov TM, Goltsev W and Wallach D. Involvement of MACH, a novel MORT1IFADD-interacting protease, in Fas/APO-1-and TNF receptor-induced cell death. Cell 1996;85(6):803-15.
[48] Chinnaiyan AM, O'Rourke K, Tewari M. Dixit VM. FADD, a novel death domain-containing protein, interacts with the death domain of Fas and initiates apoptosis. Cell 1995;81(4):505-12.
Chinnaiyan AM, Tepper CG, Seldin MF, et al. FADDIMORTI is a common mediator of CD95 (Fas/APO-1) and tumor necrosis factor receptor-induced apoptosis. J Biol Chem 1996;271(9):4961-5.
Muzio M, Chinnaiyan AM, Kischkel FC, et al. FLICE, a novel FADD- homologous ICEICED-3-like protease, is recruited to the CD95 (Fas/APO- 1) death--inducing signaling complex. Cell 1996;85(6):817-27.
Fernandes-Alnemri T, Armstrong RC, Krebs J, et al. In vitro activation of CPP32 and Mch3 by Mch4, a novel human apoptotic cysteine protease containing two FADD-like domains. Proc Natl Acad Sci U S A 1996;93(15):7464-9.
Yamamura T, Nakamura H, Yamamoto T, et al. Fas expression and apoptosis correlate with cardiac dysfunction in patients with dilated cardiomyopathy. Jpn Circ J 1999;63(3): 149-54.
Ishiyama S, Hiroe M, Nishikawa T, et al. The FadFas ligand system is involved in the pathogenesis of autoimmune myocarditis in rats. J lmmunol 1998; 161(9):4695-701.
Colston JT, Chandrasekar 8,Freeman GL. Expression of apoptosis- related proteins in experirnental coxsackievinis myocarditis. Cardiovasc Res 1998;38(1): 158-68.
Toyozaki T, Hiroe Ml Tanaka Ml Nagata S, Ohwada H, Manimo F. Levels of soluble Fas ligand in myocarditis. Am J Cardiol 1998;82(2):246-48.
Chu K, Niu X, Williams LT. A Fas-associated protein factor, FAF1, potentiates Fas-mediatecf apoptosis. Pmc Natt Acad Sci U S A 1995;92(25):11894-8.
Park CG, Lee SY, Kandala G, Lee SY, Choi Y. A novel gene product that couples TCR signaling to Fas(CD95) expression in activation-induced cell death. Immunity 1996;4(6):583-91.
Rothe M, Pan MG, Henzel WJ, Ayres TM, Goeddel DV. The TNFR2- TRAF signaling corn plex contains two novel proteins related to baculoviral inhibitor of apoptosis proteins. Cell 1995;83(7):1243-52.
Aggarwal S, Gollapudi S. Gupta S. lncreased TNF-alpha-induced apoptosis in lymphocytes from aged humans: changes in TNF-alpha receptor expression and activation of caspases. J lmmunol 1999; 162(4):2154-61.
[60] Wang Y, Huang S. Sah VP, et al. Cardiac muscle cell hypertrophy and apoptosis induced by distinct members of the p38 mit~gen-activated protein kinase family. J Biol Chem 1998;273(4):2161-8.
[61] Mackay K. Mochly-Rosen D. An inhibitor of p38 mitogen-activated protein kinase protects neonatal cardiac myocytes from ischemia. J Biol Chem 1999;274(lO):6272-9.
(621 Ma XL, Kumar S, Gao F, et al. Inhibition of p38 mitogen- activated protein kinase decreases cardiomyocyte apoptosis and irnproves cardiac function after myocardial ischemia and reperfusion. Circulation 1999;99(13): 1685-9 1 .
[63] Radomski N, Jost E. Molecular cloning of a murine cDNA encoding a novel protein, p38-2G4, which varies with the cell cycle. Exp Cell Res 1995;220(2):434-45.
[64] Weiss MJ, Orkin SH. Transcription factor GATA-1 permits survival and maturation of erythroid precurson by preventing apoptosis. Proc Natl Acad Sci U.S.A. 1995;92(21):9623-27.
[65] lsraeli 0,Tessier E, Haupt Y, et al. A novel p53-inducible gene, PAG608, encodes a nuclear zinc finger protein whose overexpression prornotes apoptosis. EMBO J 1997; 16(14):4384-92.
[66] McClure RF, Hepperlmann CJ. Paya CV. Constitutive Fas ligand gene transcription in Sertoli cells is regulated by Spl. J Biol Chem 1999;274(12):7756-62. f677 Katoh O, Oguri T, Takahashi T, Takai S, Fujiwara Y, W atanabe H. ZK?. a novel Kruppel-type zinc finger gene, is induced following exposure to ionizing radiation and enhances apoptotic cell death on hematopoietic cells. Biochern Biophys Res Comm 1998;249(3):595-600.
[68] Gabig TG. Mantel PL, Rosli R, Crean CD. Requiem: a novel zinc finger gene essential for apoptosis in myeloid cells. J Biol Chem 1994;269(47):29515-9.
[69] English MA, Licht JD. Tumor-associated WT1 missense mutants indicate that transcriptionai activation by WTt is criticat for growth controi. J Biol Chem 1999;274(19): 13258-63.
[70] Dai K-S, Liew CC. Chromosomal, in silico and in vitro expression analysis of cardiovascular-based genes encoding zinc finger proteins. J Mol Cell Cardiol (in press) pl] Clarke AR, Purdie CA, Harrison DJ, et al. Thymocyte apoptosis induced by p53-dependent and independent pathways. Nature 1993;362:786- 787.
[72] Dulic V, Kaufrnann WK, Wilson SJ, et al. p53-dependent inhibition of cyclin-dependent kinase activities in human fibroblasts during radiation- induced G1 arrest. Ce11 1994;76:1013-1023.
[73] Kirshenbaum LA, de Moissac D. The bcl-2 gene product prevents programmed cell death of ventricular myocytes. Circulation 1997;96(5): 1580-5.
[74] Pierzchalski P, Reiss K, Cheng W, et al. p53 Induces myocyte apoptosis via the activation of the renin-angiotensin system. Exp Cell Res 1997;234(1) :57-65.
[75] Kirshenbaum LA. Regulators of apoptosis in the heart: a matter of life and death. Can J Cardiol 1998; 14(3):457-60.
[76] el-Deiry WS, Tokino T. Velculescu VE, et al. WAF1, a potential mediator of p53 tumor suppression. Cell 1993;75(4):817-25.
[77l Santoro IM, Groden J. Alternative splicing of the APC gene and its association with terminal differentiation. Cancer Res 1997;57:488-94.
[783 Remni, M. and Liew CC. "Identification of APC gene in hurnan heart and its involvement in myocardial development and diseasen. Genome Mapping, Sequencing and Biology. Cold Spring Harbor, New York, 1998. (Abstract)
[79] Lotem J, Sachs L. Hematopoietic cells from mice deficient in wild-type p53 are more resistant to induction of apoptosis by some agents. Blood 1993;82(4): 1092-6
[80] He TC, Sparks AB, Rago C, et al. Identification of c-MYC as a target of the APC pathway. Science 1998;281(5382):1509-12. [81] Dempsey, AA and Liew. CC. Genes involved in normal cardiac development. In: Sheridan DJ, ed. Left Ventricular Hypertrophy. London: Churchill Livingstone, 1 998;61-70.
[82] Tan, KT, Dempsey, AA. Liew, CC. Cardiac genes and gene databases for cardiovascular disease genetics. Curr Hypertension Rep 1 999; 1 :SI- 58. CHAPTER 3:
ROLE OF THE OF ADENOMATOUS POLYPOSIS COLI GENE PRODUCT IN HUMAN CARDIAC DEVELOPMENT AND DISEASE
(M Rezvani and CC Liew. JBC 2000,275(24): 18470-18475) ABSTRACT a
Expressed sequence tag (EST) and digital Northem analysis of human fetal,
adult, and hypertrophic heart cDNA libranes revealed ESTs with high homology
to adenomatosis polyposis coli (APC) and its associated protein, ptatenin as
well as their differential expression. Thus, we hypothesize that APC/P-catenin
pathway may play a role in cardiac development and disease. Reverse
transcriptase polymerase chain reaction analysis exhibited a higher APC
expression in adult compared with fetal and hypertrophic heart but no significant
difference in p-catenin mRNA level. However, p-catenin protein level was higher
in fetal and hypertrophic heart compared with adult heart, suggesting the post-
translational regulation of p-catenin by APC in the cardiovascular system. In vitro
antisense inhibition of APC resulted a higher p-catenin protein expression
leading to an incomplete myotube formation, suggesting APCiB-catenin pathway
involvement in myotube development. Western blot analysis further reveals three novel isofoms, APC-F, APC-A. and APC-D, ubiquitously expressed in fetal, adult, and hypertrophic heart, respectively. lsofon switching during
development and disease pathogenesis suggests functionally distinct roles for each isoform. These data i) demonstrate the usefulness of genome-based expression analysis for rapid discovery of differentially expressed genes, ii)
implicate APCIP-catenin pathway in the cardiovascular development, and iii) demonstrate APC isofom switching during cardiac development and disease. MTRODUCflON
In marnmalian hearts, cardiomyocytes withdraw permanently from the cell cycle by adulthood. losing the ability to regenarate after injuries such as myocardial infarction (1-5). This phenomenon, leading to an increased risk in mortality (6) has been associated with numerous molecular factors. Although significant strides have been made toward elucidating these factors that regulate the permanent withdrawal of cardiornyocytes from the cell cycle, the underlying mechanisms are poorly understood. Thus, the identification and characterization of key regulatory genes of the cardiovascular system are necessary in understanding the underlying mechanisms of cardiac development and disease.
Conventional approaches, which focus on identifying single genes, are lengthy and tedious processes. However, the combination of technological advances in bioinformatics and rnolecular biology has given investigators the opportunity of large-scale gene discovery. An explosion of sequence-based genome research using expreçsed sequence tags (ESTs) has not only lead to the discovery of novel transcripts with unknown functions, but also to the identification of genes that are expressed in very low levels that were not previously reported in the cardiovascular system. The EST approach has been established as a highly efficient technique for large-scale gene identification. In Our laboratory alone, we have generated over 50,000 ESTs from 11 cDNA libraries representing different cardiac developmental and diseased States. Sequence analysis of these ESTs from the libraries found several cDNA clones with significant sequence similarities to adenomatosis polyposis coli (APC) and its interacting protein, P- catenin (7,B). Further, cornpufer-based digitaf Northem analysis of data from
fetal, adult and hypertrophic cDNA libraries suggested differential expressions of the aforementioned genes during cardiac development and disease.
APC is conventionally known as a 310 kDa protein encoded by 15 exons of the APC gene. The coding region of the human APC gene is highly conserved in mouse APC gene, mutations of which lead to colorectal cancer (9-Il), commonly found in familial adenoma tous poiyposis (FAP) (12,13). In some cases of congenital colorectal cancer, the pathology also includes patches of hypertrophy of the retinal pigment epithelium (14). Although the role of APC is unknown, its association with a large array of other proteins (15,16) implicates
APC in several cellular regulatory and signaling processes. For instance, the interaction of APC with B-catenin recruits the GSK-3P kinase, which in tum phosphorylates p-catenin and marks it for destruction (17). This regulates the nuclear accumulation of p-catenin, which forms a complex with the LEF/TCF family of transcription factors (which have now been implicated in a variety of developmental processes), and in tum directly effects gene expression (15-18).
Recently, several isoforms of APC have been reported in brain (non-dividing tissue), suggesting additional or novel functional roles in the control of growth and/or differentiation (9,lO). This evidence along with our identification of differential expression of APC during cardiac development and disease led us to speculate an involvement of APC in these processes.
In this report, the differential expression of APC and its interacting protein
(p-catenin) in fetal, adult and hypertrophic hearts was investigated using reverse franscripfase polymerase chain reaction (RT-PCR). These proteins were further characterized by Western blot to determine their status during post-translational regulation. In an effort to ascertain the function of APC, a cell culture model of cardiomyocytes was set up using the C2CI2 cell line. C2Ciacells are often utilized to simulate cardiomyocytes because of their ability to differentiate into contracting myotubes and to express cardiac-specific genes (19). Antisense oligonucleotide specifically designed for APC was then used to examine the effect of translational blockage of APC on the proliferation and differentiation in vitro. This study provides significant data supporting the involvement of the
APCl p-catenin pathway in cardiac development and disease. EXPERtMENTAL PROCEDURES
Total RNA extraction from tissue and cell culture.
BALWC mice were ordered at mid-gestation, late-gestation, neonate, 1-,
5-, IO-, 20-day old and adults from Jackson laboratory (Bar Harbor, ME).
Animals were sacrificed by instant decapitation as an approved method in
accordance with the Animal Welfare Act. Hearts were quickly removed, freeze-
clamped, and stored in liquid nitrogen. Human fetal. adult and hypertrophie
hearts were obtained frorn pooled pathological specimens and were also stored
in liquid nitrogen. The tissues were subsequently powdered using a stainless
steel mortar precooled to the temperature of liquid nitrogen prior to RNA
isolation. Tissue cultures were washed twice with 1X PBS before RNA extraction.
Total RNA from samples was extracted using Trizol reagent (Gibco BRL) according to the manufacturer's protocol. The quantity and the purity of each
sample were detemined by spectrophotometery at 260 and 280 nm. lntegrity of
RNA was examined on a 1O/O formaldehyde agarose RNA gel.
cDNA library construction and large-scak sequencing of &NA libraries.
Poly(A') enriched RNA was isolated using oligo-dT cellulose chromatography according to the manufacturer's protocol (Pharmacia, Uppsala,
Sweden). The concentration and purity of the mRNA were examined in a similar
manner as with total RNA. mRNA was then used to construct the cDNA libraries and large-scale sequencing was performed in our laboratory according to protocols descrîbed previously (7.20-23).
Sequence and digital Northern analysis. ESTs sequences were compared agahst the non-redundant public databases, GenBanMEMBUDDBJ and dbEST, for sequence similarity using basic local alignment search tool (BLAST). ESTs were considered to be a match to a known gene if ~~10''~.Computer based "Digital" Northem analysis was carried out to measure the frequency of a gene "tagged" in a specific library.
Frequencies were estimated as a ratio of the number of times a gene is tagged per total number of cDNA clones sequenced from each library.
Reverse transcription polymerase chain reaction (RT-PCR).
RT-PCR was carried out to compare the mRNA level of APC and its interacting proteins at different developmental and diseased stages of cardiac tissue. RT-PCR was perforrned using the ~itan~~one tube RT-PCR system
(Boehringer Mannheim) according to manufacturer's protocol in a total volume of
50p1 containing 0.1 pg RNA in the presence of primer pairs for the following: human APC: forward 5'TCATGATAAGGATGATATGTCGC3' and
reverse S'AATTCTGCAATGGCCTGTAGTC3'; human P-catenin: forward S'ACTCTAGGAATGAAGGTGTGGC3' and
reverse S'AGTGTGTCAGGCACTTTCTGAG3'; human GAPDH: forward S1TGGGTGTGAACCATGAGAAG3'and
reverse S'TCTACATGGCAACTGTGAGG3'; mouse APC: forward S'GAAGTCAGTCGGCATCTAAAGGA3' and
reverse S'TCTCCAAGTACTCACTCGAGG3';
forward S1AGAGCAAGAGAGGTATCCTGAC3'and
reverse fi'GGACTCATCGTACTCCTGCTTG3' RT-PCR was carried ouf under the following conditions: 1 cycle of WCfor 30
min; 1 cycle of 94°C for 2 min; 40 cycles of 94*C, 60% and 68°C for 2 min each;
1 cycle of 68°C for 5 min.
Quantification of RT-PCR results.
Six microliters of RT-PCR products was electrophoresed on a 1O/O agarose
gel. The bands were then quantified using a Gel Documentation System
(BioRad) as counts~mrn2.All results were normalized as a ratio to the level of the
GAPDH and fbactin.
lmmunoblotting analysis.
lmmunoblot analysis was carried out to determine the protein expression
levels and to examine the differential expression levels at the protein level. Total
protein was extracted from tissues or cells using sample buffer containing
62.5mM Tris, 2.3% SDS, 5% P-mercaptoethanol and 10% glycerol at pH 6.8.
Fifty micrograms of protein were electrophoresed on a 3-12O/0 gradient and 8%
polyacrylamide gel. Proteins were then electroblotted to PVDF membrane
(MiIlipore) using a semidry transfer (BUCHLER instruments). The efficiency of
transfer was tested by Ponceau Red staining of the membrane and Coomassie
blue staining of the gel after transfer. The membranes were then incubated with
polyclonal antibodies (Santa Cruz) diluted 1 :200 for APC (N-terminus), 1 :200 for
APC (C-terminus) and 1:IO00 for p-catenin for 60 min at room temperature.
Subsequently, the membranes were incubated with horseradish peroxidase
(HRP)-conjugated secondary antibody, diluted 1:5000 for 30 min at room temperature. Each membrane was stripped pnor to reprobing, with polycional actin antibody seMng as a housekeeping internat controt. Proteins were
detected using €CL and ECL+PLUS Western blotting detection system
(Amersham Life Sciences). To eliminate the likelihood of non specific binding or
degradation only those bands that appear in both N-terminus and C-terminus
blots are analyzed as possible isoforms. lmaging Densitometry (Biorad) was
used to quantify the intensity of each band in counts*mm2. The values were
then normalized as a ratio to corresponding p-actin. The up-regulation or down-
regulation was expressed as percentage.
Ce11 culture.
Murine C2CI2myoblasts (ATCC) were cultured in high glucose Dulbecco's
modified Eagle's medium (HG-DMEM) containing 10% fetal calf serum (G IBCO-
BRL) and penicillin/streptomycin (1 :100)antibiotic (GIBCO-BRL). Differentiation
was induced by switching the medium to HG-DMEM containing 2% horse serum
(GIBCO-6 RL) and antibiotic. Cultures were maintained in appropriate medium in
an incubator containing 95% O2and 5% COnat 37%.
Antisense and uptake study.
Antisense and random missense oligonucleotides were custom designed
by Chemicon International spanning between nucleotide positions of 3000-3050
of constitutively expressed exon 15 to inhibit APC protein translation.
Fluorescein-labeled phosphorothioate oligonucleotides were used for uptake
study to establish the time required for the uptake of the antisense-
oligonucleotides according to manufacturer protocol. Time points are the span between the addition of the oligonucleotide and termination of the incubation at 48, 24, 8, 4,2 and 1 hr. Two thousand ceits in 150 pI of media were seeded one
hr. prior to the addition of 3 pl (100 pM stock) FITC-labeled oligonucleotides in
cell culture slide wells to allow adhesion to occur. Slides were processed in 4%
paraformaldehyde/minimal medium to fix the cells. Subsequently. the slides
were photographed using a Nikon fluorescent microscope.
Cellular proliferation assay.
The effect of antisense oligonucleotides on cellular proliferation was
detenined by the rate of proliferation using direct cell counts in a period of 10
days. Cells were grown in 3.5% fetal bovine serurn to ensure sub maximal
growth. Ten thousand cells per well were seeded in 24-well tissue culture plates
(Coming) to achieve near confluence in 48 hrs. Each well was labeled as @, C,
or A for no treatrnent, random oligonucleotides, or antisense oligonucleotides
treatment, respectively. Cultures were passaged every two days at 10,000 cells
per well with replenishment of oligonucleotides. Oligonucleotides were added at
2 pM concentration two hrs. after seeding of the cells to allow proper attachment.
Detached cells were also counted to monitor apoptotic response to antisense
oligonucleotides. Cells were counted by the addition of tryphan blue 1:1 (vlv)
uçing a hemacytometer.
Ce//ular differentia tion assay.
The effect of antisense-oligonucleotides on cellular differentiation was determined by obsenhg changes in the morphology of myotube formation and by direct measurement of myotube density under the microscope as "counts per field". Counts were taken from 9 fields to obtain the average myotube counts for each individual experimenfs. Antisense-otigonucleotideç were added 48 hrs. prior to induction of differentiation by switching to medium containing 2% horse serum. Antisense-oligonucleotides were added every 48 hrs. with a f resh change of media at 2 pM concentration. Cultures were maintained for 10 days after induction of differentiation. In addition, the blockade of APC gene by antisense was deterrnined by Western blotting with APC's c-terminal and N-terminal antibodies. Furthemore, the membranes were stripped and followed by B- catenin antibody treatment to determine the effect of APC expression blockade on the level of P-catenin.
Statisfics.
Differences between groups were tested using unpaired Student's t-test.
All values are reported as mean +SEM. RESULTS
Sequence and cornputer-based digital Northern analysis.
Sequence analysis of over 50,000 ESTs generated from 11 cDNA heart libraries revealed several cDNA clones significantly rnatching (PC~O-'~)to APC and its interacting proteins, a-catenin, p-catenin and E-cadherin. Digital Northern analysis indicated a differential expression of these genes during cardiac development and disease as they were tagged at different frequencies in fetal, adult and hypertrophic heart libraries as shown in table 1.
In vitro gene expression analysis (RT-PCR).
The expression of APC mRNA is significantly upregulated in adult heart compared to fetal heart in both human (P<0.05,Figure 1A) and mouse (Pc0.001,
Figure 2A). In contrast, its expression in hypertrophic heart is downregulated
(Pc0.05, Figure IA). There was no significant difference in the mRNA expression level of p-catenin between adult and fetal heart of both species
(Figure 1B and 28); however, it is significantly (Pc0.05) downregulated in the hypertrophic heart compared to normal adult heart (Figure 1B). To determine the stage of development at which upregulation occurs. mouse tissues from several developmental stages were used. The APC expression was shown to be the highest in neonate and especially in the one-day old heart. Following this, there is a progressive increase in the APC mRNA level from 5-, 10- and 20-day old heart with higher expression level in adult heart compared to fetal stages
(PeU.05, Figure 3). Table 1. Digital Norfhern analysk of APC and Patenin in human heaR Absolute numbers represent the number of tirnes an EST with a significant similarity (PclO -'O) to the respective gene was found in a given library plating procedure. Percentages represent total number of expressed sequence tags (ESTs) in each categoty divided by the total number of ESTs in al1 categones. ND = not detected since it has not yet been detected by random clone selection from library plating.
Gene Fetal Adult Hypertrophie
APC 3 ND ND (0.013%) P-catenin 5 -7 ND (0.021 % ) ( 0.030% )
Total cDNA clones 23,609 6743 4528 A APC expression In human fetal, adult and B pcatenin expression in human fetal. adult and hypertrophic heart
Figure 1. Differential erpression of human APC and Bcatenin at the mRNA level normalized to GAPDH. RT-PCR results on human fetal heart (HFH), human adult heart (HAH) and human hypertrophic heart (HHYH) was carried out using specific primers for A) APC, B) fi-catenin. Each gene was tested at least three tirnes and normalized against GAPDH. A APC expression in mouse fetal and p. catenin expression in mouse fetal adult heart
12000 E ioooo E 'r, 8000 C 3 -t 6000
4000 2000 -- MFH MAH MAH
Figure 2. Differential expression of rnouse APC and p-catenin at the mRNA level normalized to GAPDH. Cornparison of RT-PCR amplification of APC (A) and p-catenin (6) normalized to actin between mouse fetal heart (MFH) and mouse adult heart (MAH). Results shown are representative of RNA samples prepared from three fetal and three adult hearts. Developemental Expression of APC
I I 1 I I 1 1 - MG LG NE0 ?DAY SDAY 1ODAY 2ODAY ADULT
Figure 3. Developmental expression of APC. RT-PCR amplification of APC normalized to p-actin during development of mouse heart at rnld-gestation (MG), late gestation (LG). neonate (NEO), one-day (1 D), five- day (50),ten-day (IOD), twenty-day (20D) and adult (A) heart. Results shown are representative of three samples in each category. Protein expression kvel (Western &lot).
Western blot analysis indicated a 46% (human, Figure 4A) and 30% (mouse,
Figure 48) down-regulation of B-catenin in adult heart compared to fetal heart.
Hypertrophie heart however, exhibited a 46% up-regulation compared to normal adult heart (Figure 4A). Further analysis of P-catenin protein level in APC antisense treated cells demonstrated a 30% higher expression of p-catenin in these treated cells (Figure 6).
Western blot analysis of APC using antibodies against the last nineteen amino acids of the C-terminus and the first 20 amino acids of the N-terminus revealed 3 novel isoforms of APC and their switching during hurnan cardiovascular development and disease (Figure 5A). Further analysis exhibited similar isofom expression patterns in the heart of both human and mouse during cardiac development. An 85 kDa APC isoform was identified to be ubiquitously expressed in fetal heart of both mouse and human hence designated as APC-F for fetal isofom. Another isofom was ubiquitously expressed in normal adult heart at 60 kDa. This isoform was further upregulated in hypertrophie hearts hence was called APC-D for diseased fom. The 45kDa isoform is exclusively expressed in normal adult heart (not expressed in diseased adult heart). This isofom was designated as APC-A for adult isoform (Figure 58).
Cellular growth and differentiation assay.
To ensure the success of the antisense-oligonucleotides to block the translation of APC, 24-hn uptake time was allowed pnor to initiation of any experiments even though cellular uptake of antisense-oligonucleotides reaches HFH HAH HHYH
6-catenin
Act in
Figure 4. Proteln expression of p-catenin during development and disease. Western blot analysis comparing the protein expression level amongst human fetal heart (HFH), human adult heart (HAH), human hypertrophic heart (HHYH), mouse fetal heart (MFH) and mouse adult (MAH). HAH was found to be down regulated by 54% compared to HFH whereas the HHYH was up regulated by 46%. MAH was similarly down regulated compared to MFH by 30%. n = 3 in each case with 'p< 0.05. w rnal cn 'a, an experhentally competent lever after 8 hrs. of incubation (resutts not shown).
To reveal the effect of antisense on cellular differentiation, a cornparison of myotube counts and morphological features was made amongst cells treated with APC-antisense oligonucleotide and cells receiving no or random oligonucleotide treatrnent. Myotube counts were significantly (Pe0.05) reduced in antisense treated cells for the entire duration of the experiment (Figure 6).
Morphologically, antisense-treated cells form shorter and rounder myotubes in larger proportion compared to and C in the first few days after the onset of differentiation. Nuclei in these cells tend to aggregate in the center of the cell rather than being evenly dispersed along the long axis as obsewed in normal myotubes. In addition, the onset of contractile activity was approximately 1 day later than normal in antisense treated cells. The mode of contraction also differed in antisense-treated cells as they showed weaker contraction without noticeable rhythm. Detectable contraction in cells with no treatment penisted from the onset on day 4 to the end of the experimental period, while in antisense- treated cells they ceased on day 8. The length of myotubes in the antisense treated population was unable to achieve a length consistent with mature myotubes, leaving a significantly shorter myotube population compared to O and
C. In addition, these cells were not able to fuse in the later stage of differentiation (Figure 7). Westem blot analysis was also carried out on the protein extract of @, C and A from 10-day differentiated cells indicating a complete inhibition of the conventional 310 kDa APC in A compared to @ and C.
The follow up Westem blot analysis of p-catenin demonstrated a higher fffect of antisense on differentiation
Davs Days
Figure 6. Effect of antisense on myotube differentiation. Comparison of myotube counts between non- treated (1 I), control treated (mi) and antisense treated (B) cells. DAY O
DAY 2
DAY 4
DAY 6
DAY 8
Figure 7. Effect of antisense oligonucleotide on myotubes morphology. The cells were untreated (@, left panels), control oligonucleotide treated (C, center panels), and antisense oligonucleotide treated (A, right panels). Cell morphology was analyzed at O-day (A, 6, C),2-day (D,E, F), 4-day (G, H, 1), G-days (J, K, L), 8-days (M, N, O) and 10-day (P. O, R). The bar at bottom right hand corner represents 300 ym. expression lever of p-catenin in A compareci to @ and C (Figure 9A.B). Effect of Antisense on proliferation Day2 Day4 Day6 Days fffect of Antisense on Cell Death during Proliferatfon * X Days Figure 9. Effect of antisense on proliferation. A) Cornparison of viable cell counts and 6) dead cell counts between non-treated (a), control treated (mi) and antisense treated (i)cells. Results shown are representative of three independent experiments. DISCUSSION During the course of random sequencing of cDNA clones from a human fetal heart cDNA library, we discovered several ESTs with significant sequence similarity to APC gene (7,8). Our digital Northern analysis suggested a possible differential expression of APC during cardiovascular development and disease. In this report we have shown transcripts encoding APC are expressed at a higher level in adult heart compared to fetal heart in human and mouse. Furtherrnore, RT-PCR for APC expression in different developrnental stages of mouse heart from mid-gestation to adult indicated a very low expression level in fetal stages compared to ail postnatal stages. A gradua1 increase in APC expression was seen from 5- to 20-day old hearts, leveling off in adults, correlating with the observation that by day 15 of postnatal rodent development al1 cardiomyocytes have exited the cell cycle (4,24). Up-regulation of APC thus appears to play an important role in the cardiomyocytes withdrawai from the cell cycle. This is further supported by the decrease of APC expression level in hypertrophie heart compared to adult heart. The unexpected high expression in neo-natal and 1 day-old heart is likely a result of transition from fetal (minimal pulmonary flow) to neonatal (high pulmonary flow) circulation (25) causing reactivation of gene expression, which gradually adjusts itself during the first days of extrauterine life (26)- Aithough a similar mRNA expression level of p-catenin was observed in fetal and adult heart its expression at the protein level was lower in adult heat This cm be explained by the higher APC expression level in the adult and hence P-catenin post-translation regulation by APC through APC/P-cafenin pathway. in addition, our RT-PCR indicates a lower expression level of P-catenin in the hypertrophie heart compared to adult. The follow up Western blot analysis reveals a higher level of protein expression which is consistent with the regulatory role APC plays on p-catenin, further supporting post-translational regulation event, very possibly by the reduced levels of APC. Analysis of the effect of antisense oligonucleotide inhibition of APC expression in differentiating cells demonstrated significant morphological and molecular changes. Morphologically, from day 4 onward, the antisense-treated cells show less myotube formation than that of non-treated and control antisense-treated cells. The Western blot analysis on the 1May differentiating cells indicated complete inhibition of the 310 kDa APC. It has been suggested that proteins that associate with the cytoskeleton may have a regulatory function directly related to cell proliferation and carcinogenicity (27). In previous studies, it was suggested that cell-to-cell contact through various types of junctions might be the main method by which our body regulates cell growth. Signals received this way are often passed on to the nucleus by means of cytoçkeletal-associated proteins such as APC (28). The inability of antisense-treated cells to develop into fully differentiated myotubes with respect to their length and width may be attributed to lowered APC concentration. At the molecular level the P-catenin protein expression is effected by APC antisense treatrnent. The p-catenin is expressed at a higher level in antisense treated cells which can be explained by the well established fact that APC regulates the cytoplasmic level of p-catenin, a signaling molecure (17). Translocation of Pcatenin from cytoplasm to nucleus results in the formation of a complex with LEFfrCF transcription factors in the nucleus, which directly changes the pattern of gene expression (15-1 8). Inhibition of APC expression by antisense oligonucleotides affected the cellular proliferation rate as it drastically reduced the number of cells from Day 4 onward in the antisense-treated cells compared to 0 and C. In addition. there appears to be higher cell death in antisense treatment by virtue of a greater number of detached cells. This suggests that APC may also be involved in programmed cell death (i.e., apoptosis) as seen with many other tumor suppressors. For example, transcription factors such as c-myc are intimately associated with cellular proliferation and its constitutive expression increases the susceptibility of cells to apoptosis (29). Interestingly, a recent study has shown that APC is involved in the c-myc pathway (30). Further insight into the direct involvement of APC in the c-myc/ apoptosis cascade is required. The recent discovery of 16 APC transcripts and their differential expression in several mamrnalian tissues (10) suggests multiple functional and tissue-specific rotes for APC isofons, making APC a very interesting regulatory gene to study. Our Western blots analysis using APC antibody against the C- terminus and N-terminus, cross-reactive with both human and mouse APC, revealed similar expression patterns in the heart of both species during development. To eliminate the possibility of wrong isoform selection (due to non specific binding or degradation of larger foms) only the bands that appeared with both C- and N-terminus antibodies and in both species were analyzed. In the context of this assmption, an isoform switchhg event seems to take place during cardiovascular development and disease. Isofom switching is most apparent between a cardiovascular fetal enriched isofom, which is identified at the 85kDa (APC-F), an adult enriched isofom at 6OkDa (APC-D), which is upregulated in diseased heart, and a 45 kDa (APC-A), which is only expressed in normal adult heart. These results suggests that the APC-D may play a role in the maintenance of ceIl cycle exit and APC-A may be involved in regulating and maintaining myocyte enlargement. As hypertrophy, an adaptive response to pressure overioad, is characterized by the enlargement of existing myocytes rather than an increase in ce11 nurnber (31.32). The possibility of APC-d 's involvement in enlargement of rnyocytes can be ~ledout since its also ubiquitously expressed in normal adult heart. These results further suggest isofom switching of these alternative APC transcripts during cardiac developrnent and disease, and consequently, their functional significance in cardiovascular developrnent and disease. The presence of one fom in fetal and the others in adult heart as well as up-regulation of one in hypertrophic heart provides important dues for their specific roles. However, further studies are required to establish their role in cardiovascular system. In addition to the functional analysis of the conventional APC protein in cardiovascular system, this study has shown the important role publicly available databases play in finding key genes involved in regulation of cardiac development and disease. Furthemore, Our study demonstrated the use of cornputer-based "digital Northemn analysis as a valuable tool for rapid identification of differentiaiiy expressed genes whîch can be further charactetized by RT-PCR, Northern blot ancilor Western blot. This report also demonstrates the involvement of APC@-catenin pathway in cardiovascular developrnent and process of disease. We have also utilized antisense technology to obtain conclusive confirmation that the APC mediated down-regulation of p-catenin does in fact play important roles in cellular growth and differentiation. This report also illustrates isoform switching and substantiates the involvement of APC proteins in cardiac muscle as potential regulators of cardiac gene expression du ring cardiac developrnent and hypertrophy. These findings contribute to a better understanding of molecular rnechanisms that regulate cardiac development and differentiation in normal and diseased heart. ACKNOWLEDGEMENT This work was suppotted by the Heart and Stroke Foundation of Canada, The Medical Research Council of Canada and the Canadian Genome Analysis and Technology Program. Mojgan Rezvani is a recipient of Heart and Stoke Foundation of Canada Traineeship. We also like to thank David Barrans for his editorial input. REFERENCES Brodskey V., Arefyeva A.M., Uryvaeva I.V. (1980). Ce11 Tissue Res. 21 0: 133- 144 Clubb F.J. JR., Bishop S.P. (1984). Lab Invest. 50: 571 -577 Rumyantsev, P.P. (1991). Growth and hyperplasia of Cardiac Muscle Cells, In: Rumyantsev pp (ed.)., Harwood Academic Publisher, London, 70-157 Rumyantsev, P.P. (1977). Int. Rev. Cytol. 51 :186-273 Claycornb, W.C. (1992). Trends Cardiovasc. Med. 2:231-236 Levy D, Larson M.G., Vasan R.S., Kannel W.B., Ho K.K. (1996) JAMA 275(2O): 1557-1 562 Hwang D.M., Dempsey A.A., Wang R.X., Rezvani M., Barrans J.D., Dai K.S., Wang H.Y., Ma H., Cukemian E., Liu Y.Q., Gu J.R., Zhang J.H., Tsui S.K.W., Waye M.M.Y., Fung K.P., Lee C.Y., Liew C.C. (1997). Circulation 96: 41 46- 4203 Rezvani. M. and Liew CC.(1 998). "Identification of APC gene in human heart and its involvement in myocardial development and disease". Genome Mapping, Sequencing and Biology". Pl98. Pyles RB., Santoro LM., Groden J., Parysek LM. (1998). Oncogene. 16: 77- 82 10. Santoro I.M., Groden J. (1997). Cancer Res. 57: 488-4940 11Groden J., Thliveris A., Samowitz W., Carlson M., Gelbert L., Albertsen H., Josylyn G.,Stevens J., Spirio L., Roberson M., Sargeant L., Krapcho K., Wolff E., Burt R., Hughes J.P., Wamngtorn J., McPherson J., Wasrnuth J., Le Paslier D., Abderrahim H., Cohan D., Leppert M., White R. (1991 ). Ce11 66: 589-600 Vishisho I., Nakamura Y., Miki Y., Ando H., Hom A., Koyama K., Jtssunomiya J., Baba S., Hedge P., Markham A., Kmsh A., Petersen G., iamilton S., Nilbett M., Levy D., Bryan T., Preisinger A.. Smith K., Su L.K., Gnzler K., Vogelstein B. (1991). Science 253(5020): 665-669 13. Joslyn J., Carlson M., Thliveris A., Albertsen H., Gelbert L., Samowitz W., Groden J., Stevens J., Spirio L., Robertson M. Krapcho K., Sargeant L., Wolff E., Burt R., Hughes J.P., Warrington J., McPherson J., Wasmuth J., Le Paslier D., Abderrahim H., Cohen D., tepperf M., White R. (1991).Ce1166(3): 601-613 14.0lschwang S., Tiret A., Laurent-Puig P., Martine M., Rolland P., Gilles T. (1993). Cell. 75:959-968 15. Peifer M., (1997). Science 275(5307): 1752-17530 16. Maon R.T., Miller J.R. (1 997). Trends in Genetic. 13(7): 256-258 17. Hart M.J., de los Santos R., Albert I.N., Rubinfeld B., Polakis P. (1998). Curr Biol. 8(1 O): 573-581 1 8. Sheng H., Shao J., Williams C.S., Pereira M.A., Taketo M.M., Oshima M., Reynolds A.B., Washinton M.K., DuBois R.N., Beauchamp RD. (1998). Carcinogenesis. 19(4):543-549 19. McMahon D.K., Anderson P.A.W., Nassar R., Bunting J.B., Saba Z., Oakeley A.E., Malouf N.N. (1994). Am. J. Physiol. 266: (ce11 Physiol.35): Cl795-Cl 802 20. Hwang D.M., Hwang W.S., Liew CC.(1 994). J. Mol. Ce11 Cardiol. 26: 1329- 1333 21. Hwang D.M., Fung Y.W., Wang R.X., Laurenssen C.M., Ng S.H., Lam W.Y., Tsui K.W., Fung K.P., Waye M., Lee C.Y., Liew C.C. (1 995). Genomics 30: 293-298 22. Liew C.C. (1 993). J. Mol. Ce11 Cardiol. 25: 891 -894 23. Liew C.C., Hwang D.M., Fung Y.W., Laurenssen C., Cukerman E., Tsui S., Lee C.Y. (1994). Proc. Natl. Acad. Sci. 91 : 1 0645-1 0649 24. Gruver C.L., George S.E., Means A. R. (1992). Trends Cardiovasc. Med. 2Z6-231 25. Sansoucie D.A., Cavaliere T.A. (1997). Neonatal Netw. l6(2): 5-1 2 26. Ilyas M., Tomlinson 1. P. (1997). J. Pathol. 182(2): 1 28-1 37 27. Ben-Ze'ev A. (1997). Curr. Opin. Cell Bol. 9: 99-1 08 28. Hulsken J., Birchmeier W., Behrens J. (1994). J. Ce11 Biol. 127: 2061 -2069 29. Lotem J., Sachs L. (1 993). Blood 82: 1092-1096 30. He T., Sparks AB., Rago C.,Hernieking H., Zawet t., Da Costa L.T., Morin P.J., Vogelstein B., Kinzler K.W. (1 998). Science 281 :1509-1512 31. Grossman W. (1980). Am J Med. 69:576-584 32. McKee P.A., Castelli W .P., McNamara P.M., Kannel W.b. (1 971 ). N Engl J Med. 285: 1441-1 446 CHAPTER 4: CHARACTERIZATION OF APC ISOFORMS IN CARDIOVASCULAR SYSTEM DURING DEVELOPMENT AND DISEASE The tumor suppressor adenomatosis polyposis coli (APC) is a 310 kD protein encoded by a cornplex gene consisting of 15 exons. Although mutations in the APC gene are associated with familial and sporadic human colon cancer, the physiological and pathophysiological roles of the APC protein are not known. The protein contains three functional domains. The carboxyl-terminal domain associates with tubulin (Munemitsu et al., 1994). the middle domain interacts with p-catenin (Rubinfeld et al, 1995; Stappert et al., 1994: Jou et al., 1995) and the amino-terminal domain contains heptad repeats (Cohen et al., 1994). The heptad repeat encoded by exon 1 has been shown to support protein homo/hetrodimerization. Several APC variants have been identified to derive from differential splicing and alternative in-frame translation initiation codons (Thliveris et al., 1994; Horii et al, 1993). In addition to the methionine initation codon in exon 1, at least four other initiation codons have been identified upstream of this exon, and designated as .3, .l,.2 and BS (brain specific) (Thliveris et al., 1994; Horii et al, 1993). The initiation codons in these exons are in frame with exon 2 with an ORF, but the presence of a stop codon in exon 1, upstream of the methionine initiation codon suggests that the transcripts containing exons .3, .1, .2, and BS would lack exon 1. Indeed, Pyles et al (1998) demonstrated that BS-containing isofons, lack exon 1. These tanscripts are highly expressed in non-dividing, terminally differentiated tissues. From a structural standpoint, these alternative spliced isofoms may give rise to proteins that are unabfe to dimerize, which may be cruciat for suppression of proliferation. In contrast, alternative splicing of the constitutively expressing exons 5, 6, 7, 8, 10 and 15 (Santoro et al., 1997; Figure 1) has not yet been reported. We have recently reported several APC protein isofoms and their switching during human cardiac development and disease (Rezvani et al., 2000, Chapter 4). In the cuvent study, we identify and characterize APC isofonn genes during cardiac development and disease. We will interchangeably use the ternis BS-APC isoforms and exonl-APC isoforms for splice variants containing exon BS as therir first exon and spiice variants containing exonl as their first exon, respectively. Given the abundance of BS-APC isofoms in terminally differentiated tissues such as the brain and neurons (Pyies et al., 1998), we investigated the expression pattern of BS-APC versus exonl-APC isoforms in the heart (non-dividing, terminally-differentiated tissue) in both human and mouse during development and process of disease. The examination of BS-APC isoform expression in the mouse is of significance, given the relevance of this species in the investigation of cardiac development and disease, and in light of the fact that this exon has not yet been identified in this species. In order to characterize cardiac APC isoforms, we employed the following the approaches: 1. Full sequencing of cDNA clones in our existing fetal, normal and diseased heart cDNA libraries. 2. 5' RACE to identify unknown 5' ends in mouse cardiac tissue. 3. Sequencing of RT-PCR products amplified with specific prirners encompassing exons 1 to 15 and exon BS to 15. Methods 1. Clones from human cDNA libraries 1.1. Isolation of cDNA clones cDNA clones cONA clones were excised in vivo from the )rZAP Express vector using the ExAssisVXLOLR helper phage system (Stratagene). Briefly, phagemid particles were exised by coinfecting XL-BLUE MRF cells with ExAssist helper phage. The exiced pBluescript phagemids were used to infect E. coli XLOLR cells, which lack the amber suppressor necessary for ExAssist phage replication. lnfected XLOLR cells were selected using kanamycin resistance. Resultant colonies contained the double stranded phagemid vector with the cloned cDNA insert. A single colony was grown ovemight in LB-kanamycin, and DNA was purified using a plasmid purification kit (Qiagen). 1.2. Full Length AB1 Sequencing Phagemid DNA was sequenced using the Taq Deoxy Tenninator Cycle Sequencing Kit for Applied Biosysterns 377 sequencing system (Perkin Elmer). Full-length sequence was obtained and was BLASTed against the NCBl nonredundent database. 2. 5' Rapid Amplification of cDNA Ends (RACE) 5' RACE is a procedure for amplification of mRNA template with unknown 5' end (Frohman et al., 1998). The power of 5' RACE lies in that only one gene specific primer is required. The use of terminal deoxynucleotidyl transferase VdT) allows the addition of homopolyrneric tail to the 3' end of the cDNA (corresponding to the 5' end of the mRNA), which wilf be complementary to a universal primer for subsequent PCR amplifications (Figure 2). 2.1. RNA Isolation Total RNA was isolated from tissues and cells using TRIZOL reagent (GIBCO) according to manufacture's instruction. RNA concentration and purity was detemiined by UV spectrophotometry at and Obeonm. The quality of the isolated RNA was evaluated in 1*/O agarose formaldehyde denaturing gel. 2.2. Gene Specific Primer Design For 5' RACE amplification of unknown APC 5' ends in mouse heart. specific primers (GSPI) were designed at 300bp from the mRNA's 5' end so that the cDNA could be purified using GLASSMAX spin cartridge. This primer was designed to anneal at 42°C-50°C to coincide with the temperature required for first strand cDNA synthesis. Two other nested APC specific primers (GSPP and GSP3) were designed adjacent to GSPI (Figure 3). These primers were designed to anneal under the temperature conditions set for the universal anchor primer in the subsequent PCR amplifications. 2.3. PCR Amplification First strand cDNA is synthesized using the GSPI, which is followed by homopolymeric tailing of cDNA using TdT. Amplification of APC is then camed out using GSP2 or GSP3 and abridged anchor primer, which anneals to the homopolymeric tail. PCR was camed out under the following conditions: 1 cycle of 94°C for 2 min; 35 cycles of 94°C' 63°C for 30 sec, 72°C for 2 min; 1 cycle of 72°C for 10 min. 1'[ ATGGCTGCAG CTTCATATGA TCAGTTGTTA AAGCAAGTTC AGGCACTGAA GATGGAGAAC TCAAATCTTC AGAAGATAAT TCCAATCATC TTACAAAACT GGAAACTGAG GCATCTAATA ACTTCTGGAC AGATTGACTT CCCGGAGTGA AAAAATGTCC CTITGCTCCT ACGGAAGTCC GGAAG~ ATGCAGTCCT GTCCCCATGG GGTCATTCCC AAGAAGAACA TAAATG GA AGCAGAGA GAGTACTGGG TATCTAGAHG AGCTTGAAAA AGAA Ji ATCA TTACTCCTTG CTGATCTTGA CAAAGAAGAG AAGGAAAAGG ACTGGTATTA TGCTCAACTT CAGAACCTCA CAAAAAGAAT AGATAGCCTG CC'MTAACTG CTTACAGACA [ Start of an exon GSPI anealing site GSPP annealing site GSP3 annealing site Figure 3. The gene specific primers (GSP) were designed in exon 3 of mouse APC gene. The highlighted areas are the regions were GSP primers anneal to. 2.4. Sequendng and Sequence Anaîysis of PCR Fragments 5' RACE products were purified using GeneClean kit (810101) according to the manufacturer's protocol. 500 ng of purified PCR products were mixed with 5 pmole of GSP2 or GSP3 primers and sequenced using automated AB1 sequencer (Perkin Elmer). The obtained nucleotide sequences were then, blasted against the publicly available database for sequence identity. 3. Sequencing of RT-PCR Products Amplified with Primers Encompassing Exons 1 to 15 and Exon BS to 15 APC transcripts ars predicted to have either exon 1 or exon BS as their first exon since they each contain an initiation codon. Exon 15 is predicted to be the last exon in any isoform since it is reported to be constitutively expressed. Therefore, RT-PCR products spanning between exon 1 or BS and exon 15 should either contain the full length APC containing al1 the exons or smaller APC transcript containing some of the exons. 3.1. Total RNA Extraction from Tissue. Human fetal, adult and hypertrophic hearts were obtained from pooled pathological specirnens and were stored in liquid nitrogen. The tissues were subsequently powdered using a stainless steel mortar precooled to the temperature of liquid nitrogen prior to RNA isolation. Total RNA from sarnples was extracted using Trizol reagent (Gibco BRL) according to the manufacturer's protocol. The quantity and the purity of each sample were determined as specified in section 2.1. 3.2. Primer Design. Two pairs of primers were designed to encompass either exon 1 to 15 or exon BS to 15. Several other primers were designed for nested PCRs and subsequent sequencing of PCR fragments (Table 1). Al1 primers were BLASTED to ensure specificity and were analyzed to avoid the formation of secondary structures, dimerization and self-annealing. 3.3. Reverse Transcription Polymerase Chain Reaction (RT-PCR). RT-PCR was carried out to compare the mRNA level of APC isofoms dunng cardiac development and disease. RT-PCR was performed using the One-Step RT-PCR for long template system (GIBCO) according to manufacturer's protocol. O.lpg RNA was mixed with 20 pmole of each sense and antisense primers in a total volume of 50~1. RT-PCR was carried out under the following conditions: 1 cycle of 55°C for 30 min; 1 cycle of 94°C for 2 min; 35 cycles of 94°C. 58°C and 68°C for 2 min each; 1 cycle of 72°C for 10 min. 3.4. Quantification of RT-PCR Results. Six microliters of RT-PCR products was electrophoresed on a 1O/O agarose gel. The bands were then quantified using a Gel Documentation System (BioRad) as counts~mrn2.All results were normalized as a ratio to the level of the GAPDH. 3.5. Sequencing. Sequencing of PCR products was camed out using several different primers including both sense and antisense primers that were originally used to ?CR the fragment as weil as nested pfirners with respect to the sense and antisense prirners (Table 2). Forward Primers Sequence EX1 5' GCT GCA GCT TCA TAT GAT CAG TT 3' Ex5-6 5' GCA CAG CGA AGA ATA GCC AG 3' EXBS 5' GCT CTA CCC CAT TGA AAG C 3' Reverse Pnmers Sequence EX2 S'CAA TCT GTC CAG AAG AAG CCA TA 3' Ex3 5' CAG AAC GGC l'TG ATA CAG ATC C 3' EX8 5' CTA GAA CTC AAA ACA CTG GCT GAA AC 3' EX15 5' CCA CAT GCA TTA CTG ACT ATT GTC A 3' Table 1. Human APC primer sequences used for RTPCR and sequencing. RT-PCR SEOUENCING EX1 &EX15 EX 1, EX2, EX3, EX5-6, EX8, EX 15 EXBS & EX15 EXBS, EX2, EX3, EX5-6, EX8, EX 15 EX1 & EX2 EX 1, EX2 EXBS & EX2 EXBS, EX2 EX1 & EX3 EX 1, Ex2, EX3 EXBS & EX3 EXBS, EX2, EX3 EX 1 &EX8 EXI, EX2, EX3, EX5-6, EX8 EXBS & EX8 EXBS, EX2, EX3, EX5-6, EX8 Table 2. Several primers were used to sequence the RT-PCR products. 3.6. Sequence Alignment and Analysis. Al1 sequences were blasted against publicly available database GenBanW dbest for sequence identification. Results 1. Clones from human cDNA libraries Two cDNA clones (KI 09 and LI109) exhibiting nucleotide and amino acid sequence similarities to APC were identified during the course of our EST generation from human heart cDNA libraries. KI09 is 3054 bp and LI 109 is 2036 bp (Figure 4). We were hoping that theses cDNA clones would span the region between exon 1 and the beginning of exon 15 leading to determination of exon compositions of cardiac APC. However, BlAST sequence matching reveeled that both clones were fragments of exon 15 (Figure 5). 2. 5' RACE 2.1. PCR and Re-PCR The PCR amplification of APC using GSP1, GSP2 or GSP3 with anchor primer is predicted to produce product sizes that are based on human APC sequence. In the absence of exon 1, the predicted sizes of the PCR products for transcripts containing exon BS for the sequence between GSP2 and anchor primer would be 470 bp. The hornopolymeric tail is 36 bp, exon BS is 224 bp, exon 2 is 84 bp and the GSPP primer amplifies 126 bp of exon3 moving in the 5' Figure 4. APC cDNA clones insert size. Lane 1 : Molecular marker hHindttt; Lnae 2: APC cMJA clone KI09 (3054 bp); tane 3: APC cDNA clone 1 109 (2036 bp); Lane 4: Molecular marker 1 Kb DNA ladder. to 3' direction (36 c 224 + 84 + f 26 = 470). In contrast, amplification of exon 1- containing transcripts would be expected to produce a 381 bp amplicon. The prevalent product after two rounds of amplification using 5' RACE was 600 bp in length, which is 130 bp larger than the predicted size. We tested the 5' RACE system using the control RNA and DNA that was provided with the kit. As expected a 500 bp product was observed when control RNA was amplified with control GSPP and GSP3 and a 71 1 bp product was seen when control RNA was amplified with abridged anchor primer and GSPP (Figure 6). No PCR product was obsewed from mouse fetal heart RNA amplification by GSP2 or GSP3 and anchor primer when GSPI was used for first strand cDNA synthesis (Figure 6)' whereas the use of GSPP or GSP3 for first strand cDNA synthesis resulted in a PCR product of about 600 bp (Figure 7). A product of approxirnately 470 bp is expected to be amplified. A faint band of 470 bp (labeled as C, lane 4, Figure 7) was obsewed. The 381 bp product labeled as D in lane 1 may correspond to the amplification of isoforms containing exon 1. Faint PCR products were re-PCRed for further product amplification (Figure 8). 2.2. Sequencing of 5' RACE Products PCR products were purified using QlAquick PCR purification kit (QIAGEN) or Geneclean (810101) according to manufacturer's protocol. Purified products were subjected to a second round of PCR. Selected samples were sequenced. A 891-base control RNA 5' (A).,,, 3' GSPl -5' 702 bp cDNA 71 1 bp 5' RACE products -500 bp RT-PCR products Figure 6. A) An overview of S'RACE of control RNA. B) 5'RACE products. a) cDNA from lsI strand synthesis: checks the efficiency of cDNA synthesis, b) GlassMax eluted sample: checks the recovery of cDNA, c) Tailed cDNA: checks the efficiency of tailing, d) No TdT control (no tailing): checks the specificity of the amplification, e) Control DNA: checks PCR A with both primer sets. Lane 1,9: 100 bp DNA ladder. Lane 2: Mouse fetal heart (MFH) 5'RACE with GSP2 and AAP. Lane 3, 11: Empty. Lane 4-7: control samples, as specified above, amplified with control GSP2 and GSP3. Lane 10: MFH amplified with GSP3 and AAP. Lane 12-16: control samples, as specified above, amplified with GSP2 and AAP. 1si strand cDNA synthesis 2ndstrand synthesis 5' RACE with GSP & AAP GSP2 GSP3 GSP3 GSP3 Figure 7. S'RACE products obtained from several combinations of primers used for 1si and 2nd strand synthesis as well as for the subsequent S'RACE amplificalon. The use of GSP3 for 1" strand cDNA synthesis provides a stronger product at 600 bp (lane 5) compared with GSP2 (lane 2-4). Figure 8. Re-amplification of S'RACE products. Lane 1 : 100 bp DNA ladder. Lane 2: Re-amplification of products from lane 2 of figure 7 with GSPP and AAP. Lane 3: Same as lane 2 except amplified with GSP3 and AAP. Lane 4: Re- amplification of product from lane 5 of figurs 7. Lane 5-6:Repeat of lane 2 and 5 in figure 7. 2.3. Sequence Analysis Sequencing results were analyzed and matched with the publicly available non-redundant database. The raw sequences were messy and ambiguous. After sequences were edited to remove the ambiguities, they were blasted again. The blast results retrieved no match to any known genes or ESTs. This procedure was repeated many times also with other RNA samples such as mouse fetal and adult heart and RNA extracted from C2C12cell line at O day and 12 day after induction of differentiation (Figure 9). 3. RT-PCR products amplified with primers spanning exons 1 to 15 and exons BS to 15 3.1. Differential Expression and lsoform Switching of APC in Myocardial Devalopment and Disease APC transcripts are predicted to have either exon 1 or exon BS as their first exon since both contain an initiation codon. Exon 15 is predicted to be the last exon in any isoform since it is reported to be constitutively expressed. Therefore, RT-PCR products spanning between exon 1 or BS and exon 15 should either contain the full length APC or abbreviated transcripts with fewer exons when amplified with prirners in these exons. We designed a reverse primer in exon 15 and two forward primers; one in exon 1 and one in exon BS. The predicted product sites for these primer sets were observed with some exceptions. Exon 1 and 15 primers produced 2 PCR products at about 2 Kb. Exon Bs and 15 created a smaller fragment then expected. Nested primer sets formed products of predicted size (Figure 10). CA2 C2CI 2 MFH MAH Od 12d Figure 9. S'RACE products using RNA extracts from mouse fetal heart (MFH), mouse adult heart (MAH)and C,C,, cells at O day (Od) and 12 days after induction of differentiation (12d). RT-?CR with these primer sets revealed that the alternative splicing of APC is developmentally and pathologically dependent. BS containing isofoms are highly abundant in fetal heart tissue relative to adult and hypertrophie heart. In contrast, exon 1-containing isofoms are highly expressed in adult and hypettrophic heart compared to fetal heart (Figure 10). Similar expression patterns were obsewed using other primer combinations. All combinations indicated higher BS containing isoform expression in fetal heart. 3.2. Sequence and BLAST Results. Blast results of sequences derived from sequencing of RT-PCR products using several pHmers (Table 2) revealed matches to APC gene with the exception of sequences obtained from sequencing of fragments amplified with exon BS and 15 primers. The BLAST results of these fragments revealed matches to human peroxiredoxin and not to APC. Discussion The physiological and pathophysiological roles of APC are primarily studied in gut epitheliurn, merely due to the fact that the loss of its function leads to the colorectal cancer, However, the localization of native APC and alternative splice isoforms such as BS-APC in tenninally differentiated tissues such as brain and neuronal tissues (Pyles et al., 1998), suggest that this tumor suppressor may play a role in maintenance in cell cycle arrest and quiescence in these tissues. Given the relative quiescence of adult myocardium, we hypothesized that temporal alterations in APC gene expression andhor alternative splice isoform switching may underlie developmentally-regulated and pathologically-induced alterations in the growth phenotype of the myocardium. In order to characterize different APC isoforms in CV system we utilized several approaches. First, we sequenced the cDNA clones available in our heart cDNA libraries in the hope of elucidating the exon composition of APC mRNA in the heart. We found two cDNA clones named KI09 and LI 109. Sequence matching of these clones revealed that both sequences correspond to a fragment of exon 15 (Figure 5). the terminal and largest exon of the APC gene (77% of entire full length mRNA) (Figure 11). Primer walking was not an applicable approach, since the entire insert was sequenced indicating that this clone was not full-length. This is not surprising since Our ESTs are obtained from 3' end and reverse transcriptase superscript has a limited ability to continuously synthesize very long templates. Aithough the APC sequence is very conserved between human and mouse, exon BS has not yet been found in mouse. Given the preeminence and widespread use of mouse rnodels in studies of mammalian cardiac development and disease, it is essential to determine whether this exon and related APC isofoms are also present in this species, and what role they rnay play in mufine cardiac develoment and disease. Using the 5' -RACE approach for rapid ampllication of mRNA templates with unknown ends, we were unable to detect a PCR product corresponding to the BS exon, on the basis of the size predicted from the human APC gene, using mouse-specific primers. However, the 5' RACE approach has several technicaf limitations. For example, the technique is non- specific, since only one gene specific primer is designed. In addition, the physical properties of each mRNA species may influence the efficacy of the procedure. Furthemore, the abridged anchor primer, specific for oligo dC tail, may anneal with certain gene-specific sequences (Martin et al.. 1985). The correct amplification of control RNA and DNA provided with the kit, indicates that the procedure was carried out appropriately. Furthemore, several primers were designed in order to eliminate the possibility of primer incompatibility. The sequencing analysis of these products did not match any part of APC gene, but matched with high fidelity to peroxiredoxin. Interestingly, peroxiredoxin encodes a protein with antioxidant function and is localized in the mitochondnon. The human and mouse peroxiredoxin are highly conserved, and they map to regions of synteny between mouse and human chromosomes. Sequence matching with recently cloned mammalian homologues suggests that these genes consist of a family that is responsible for regulation of cellular proliferation, differentiation, and antioxidant function (Tsuji et al., 1995). APC has also been shown to regulate cellular proliferation and differentiation (Santoro et al., 1997). This may suggest that BS containing APC isoform may constitute of a combination of APC exons that makes up a unique mRNA sequence with high similarity to peroxiredoxin. They may comprise members of the same family. However, the different chromosomal locations of native APC and peroxiredoxin suggest that they are not splice variants of the same gene. in order to investigate the expression pattern of native and 8s-APC in cardiac development and disease, we designed a series of primers spanning the sequence from either BS or exon 1 to exon 15 as well as several specific nested primers. Sequencing of the RT-PCR products revealed differential expression and çwitching of these isofons during cardiac development and in disease. BS- APC expression was consistently higher in fetal heart compared to adult and diseased heart. whereas exon 1-containing APC was highly expressed in adult and hypertrophic heart relative to fetal heart. This suggests that the BS-APC may be involved in proliferation of myocytes, since the increase of cardiac tissue mass in fetal stage is mainly attributed to the hyperplasia of cardiac myoblasts, whereas in adult, it is due to the hypertrophy of cardiac myocytes exclusively (Rumyantsev, 1991). The absence of exon 1 in BS-APC isofoms eliminates the possibility of homodimerization since this is supported by exon 1 (Su et al., 1993). This suggests that BS-containing isofoms may regulate cellular proliferation through an alternative pathway that does not require protein interaction by homodimerization. The predominance of exon 1sontaining isofonn in adult hearts suggests that this isofon may contribute to differentiation. suppression of proliferation andor hypertrophy. It has already been shown that the expression of APC isofoms with and without exon 1 (.3 exon) are tissue specific with the highest expression level of exon 1-lacking APC isofons in post mitotic, terminally differentiated tissues. This suggests that changes in APC isoform expression could be induced by growth inhibition or differentiation of cells (Santoro et al., 1997). In conclusion, the curent findings demonstrate devetoprnentalfy- and pathotogicalty-regutatect switching of APC isofons in human cardiac tissues. We postulate that temporal changes in the expression of APC isoforms may underlie, at least in part. the phenotypic transition from hyperplasia in fetal cardiac development to the quiescent state or hypertrophie growth characteristic of normal or diseased adult heart. CHAPTER 5: GENERAL DISCUSSION, CONCLUSIONS AND FUTURE DIRECTIONS 1. Synthesis of major findings Two principal findings have emerged from the work presented in this thesis: 1) EST-based in silico northem hybridization allows for large scale expression profiling of the heart during development and in progression of disease, thereby petmitting the identification of novel key regulatory genes and signaling pathways that may be involved in regulation of cardiac growth and remodeling during development and disease. 2) Differential expression and switching of alternative!^ spliced isoforms of the tumor suppressor adenomatous polyposis Coli (APC) occur during cardiac developmental and in progression of pathological hypertrophy in the adult heart. implicating a role of this cell-cycle regulatory protein and associated signaling pathways in regulation of cardiac growth and difierentiation in health and disease. The power of EST-based in silico northem analysis resides in the fact that it allows the investigation of expression patterns of multiple genes simultaneously. Such analytical versatility penits large scale expression profiling of cells and tissues and could potentially reveal temporal and spatial relationships between key genes and underlying signaling pathways involved in the regulation of diverse biological processes, such as development. differentiation and pathogenesis. This is in striking contrast with traditional methods of assessing gene expression, whereby only a single gene or a small number of genes can be analyzed concurrently, thus precluding the ability to identify presumptive functional interrelationships between genes that may be involved in regulation of specific processes. Using the in silico approach to screen our human cardiovascular cDNA-derived EST collection (CvBEST, we identified several functionally-related genes (gene families) that are differentially expressed in the human heart during development and in pathological hypertrophy (Hwang et al., 1997; Dempsey et al., 1998; Tan et al., 1999). Of particular relevance in cardiac differentiation and growth, we identified several developmentally- and disease-dependent differences in the expression levels of some apoptosis- and proliferation-related genes. These temporally related differences in gene expression might underlie crucial events in cardiac development, differentiation and growth, given the role that these genes play in maintenance of cell number homeostasis. For example, pro-proliferative genes and some apoptotic genes were found to be highly expressed in fetal cardiac cDNA library relative to adult libraries, coincident with the high rate of hyperlastic growth and remodeling occumng throughout this developmental stage (Saphier et al, 1998; Lesche et al, 1997; Saiki et al, 1997; Slomp et al, 1997; Kajstura et al, 1995; Sorokin et al, 1994). These observations illustrate how large-sale gene profiling using the EST in silico approach can be used to predict potential functional interactions between genes in the regulation of specific biological processes. The inclusiveness of the in silico approach also lends itself to the discovery of novel genes and pathways previousfy unsuspected of playing a role in regulating a particular biological process. For example, our in silico of cardiac- derived EST revealed the differential expression of a number of apoptotic and tumor suppressor genes not known previously to be involved in cardiac development and growth. The in silico survey of cardiac EST'S revealed differential expression of the turnor suppressor APC and its associating protein p-catenin during development and in hypertrophic disease. This implicates the involvement of this growth- regulating gene in regulation of cardiac differentiation and growth via interaction with the intracellular wnt-signaling pathway. Specifically, I found an increase in the expression levels of APC in adult compared to fetal heart and hypertrophic diseased heart, whereas a reciprocal changes in p-catenin protein level was found in al1 cases. A direct role of APC in cardiac differentiation was further established in an in vitro model of myogenesis (Chapter 3). Using rnurine C2Cq2 myoblasts, I showed that antisense inhibition of APC translation reduces cellular proliferation and myotube formation and leads to an increase in cell death, in parallel with an increase in p-catenin protein levels. Therefore, these findings confim unequivocally a novel role of the APC/P-catenin pathway in myoblast growth and differentiation. Several APC protein isoforms were identified in the heart in a developmental and disease-specific manner (Chapter 3). Cornmensurate with this, I found differences in the expression level of several altematively-spliced APC gene isofotms, with fetal heart expressing a high level of exon BS- containing isofon, and aduft and hypertmphic hmrt showing a preponderance of exon-1 containing isoform (Chapter 4). These findings suggest that APC isoform switching may underlie specific events in cardiac differentiation and growth. The absence of exon 1 is known to disrupt the ability of APC protein to homodimerize (Su et al., 1993). Given that APC homodimerization may be an essential structural requirement for interaction with p-catenin (Su et al., 1993), it is possible that the switching from exon BS-expressing isoform to exon-l containing isoform may be responsible, at least in part, for the transition from the proliferative fetal and neonatal cardiac phenotype into the quiescent phenotype characteristic of terminally differentiated adult myocardium. Adult cardiac myocyctes are unable to reenter the cell cycle. Hence, an increase in heart mas and size occurs obligatorily via hypertrophy of existing myocytes (Rumyantsev, 1991). Cardiac hypertrophy is a pivotal feature in the progression of heart failure. Although the hypertrophic process nonnally begins as an adaptive response to a pathophysiological stimulus, such as hemodynamic overload, in tirne, the process becomes rnaladaptive and leads to myocardial dysfunction and heart failure (Katz, 1994). In general, pathological cardiac hypertrophy is cornplex and is accompanied by a number of quantitative and qualitative changes in the gene expression. The regulation of cardiac gene expression in end-stage heart failure implies a pathophysiological role for altered gene expression in the progression from eariy adaptive hypertrophic response to late maladaptive myocardial dysfunction. At the molecular level, the hypertrophic myocardium reexpresses a gene profile that is characteristic of embryonic myocadium. For exarnpte, teft ventficfe expression of ANF is high in the ernbryonic heart, but rapidly subsides to very low levels in the neonatal heart (Knowlton et al., 1991). In response to a hypertrophic stimulus, ANF is re- expressed at high level in the left ventricle of adult heart, illustrating reversion to the embryonic gene profile. Likewise, there is a switch in the expression of adult myosin heavy chain (a-MHC) to fetal P-MHC isofom (Lyons et al., 1990; Waspe et al., 1990; Ng et al., 1991; lzurno et al., 1987; Kurabayashi et al., 1988; Yazaki et al., 1989; Parker et al., 1990). In contrast to this, the current study shows that the switching of APC isoforms in hypertrophy does not follow this pattern of reprogramming into the embryonic genotype. Rather a pattern of gene expression more characteristic of the adult heart was observed. Two distinct APC protein isoforms were found in the adult heart. A 45 kDa protein is exclusively expressed in normal myocardium (APC-A) whereas a 60 KDa isofom is upregulated in the hypertrophic heart (APC-D) (Chapter 3). The induction of APC-D by hypertrophy suggests that a balance in the expression levels of APC-A and APC-D is required for maintenance of myocyte quiescence. The disease- induced up-regulation of APC-D protein would disrupt this homeostatic balance, leading to the increase in myocyte size that underlies cardiac hypertrophy. The implication from these findings is that APC-D may play a pathophysiological role in myocyte enlargement in hypertrophy. However, the functional significance of APC isofom switching during heart development and in the progression of disease remains to be established. 2. Summary The results presented in this thesis indicate that: 1. Large scale EST-based in silico northern hybridization of cardiac cDNA libraries uncovered the differential expression of several gene families during development and in disease, with particular emphasis on genes involved in regulation of proliferation and growth (cell cycle proteins, oncogenes, tumor suppressors) and programmed cell death (apoptosis-related proteins (Chapter 2). 2. The tumor suppressor adenomatosis polypois coli (APC) and its interacting protein p-catenin are differentiaily expressed during cardiac development and in hypertrophic disease, resulting in higher abundance of APC in normal adult heart relative to hypertrophied and fetal hearts, and in reciprocal alterations in B-catenin protein levels. (Chapter 3) 3. Antisense inhibition of APC translation in cultured murine C2CI2 myoblasts inhibits proliferation and myotube formation and leads to an increase in cell death, in parallel with an increase in basal P-catenin protein level (Chapter 3). 4. Three novel APC protein isoforms were found to be expressed in the heart in a developmental and disease-specific rnanner (Chapter 3). 5. Expression levels of altematively spliced BS- and exon 1-containing APC gene isoforms Vary in a developmental and disease-related fashion, with fetal heart expressing exon BStontaining isofom, and adult and hypertrophic heart expressing predominantly exon 1œcontaining isoform (Chapter 4). 3. ConcCusions Based on the findings presented in this study, the following conclusions are made. 1. EST-based in silico northern hybridization is a useful approach for identification of novel genes and signaling pathways that may be involved in regulation of basic biological processes such as cardiac growth and remodeling during development and in progression of disease. 2. The tumor suppressor adenornatous polyposis coli plays a direct role in cardiac rnyocyte growth and differentiation. 3. Differential expression and switching of altematively spliced andlor post-translationally modified APC isoform may underlie, at least in part, sorne of the developmental and disease-dependent alterations in cardiac growth phenotype. 4. Overall significance of the findings. The current study exemplifies the power of large-scale genomic screening as a means of identifying and predicting the role of novel genes and signaling pathways involved in regulation of specific biological processes. Using in silico northem hybridization of cardiac-denved EST cDNA sequences in conjunction with a conventional loss-of-function approach using antisense inhibition of translation, this study establishes for the first tirne a temporal and functional association of APC with rnolecular and morphological events accompanying cardiac cell growth and differentiation, thereby revealing a previously unsuspected role of this protein in regulation of cardiac phenotype. Thus. large scale screening of expression profites has ttre potentkf for idenmng and predicting the role of novel developmentally and disease-regulated genes which could serve as targets for therapeutic intervention in the treatment of rnyocardial disease. 5. Future Directions Several topics of investigation are left open with the results of this thesis. The current study clearly establishes a functional role of APC in regulation of myocyte growth and differentiation in vitro, and implicates a role of isofon switching in developrnental and disease-dependent alterations in cardiac growth. However, the significance of these events in vivo remains to be established. The most pressing future experiments should be airned at characterizing the roles of native and alternate APC isoforms in cardiac development and disease. The engineering of mouse models allowing temporally-regulated cardiac-specific alterations in the expression of native or alternative APC isoforms will help define the physiological role of the different APC variants in cardiac development and in disease. Engineering of conditional knockouts for each of the APC isofoms using Cre-lox for cardiac-specific expression of the nuIl mutation would allow the precise definition of the roles of the various isoforms in cardiac development, whereas cardiac-speclic overexpression of isofoms would help defining their role in induction of pathological processes, such as myocardial hypertrophy and remodeling. Cleariy the magnitude of such an undertaking lies beyond the scope of this thesis, but remains a viable and important topic of investigation in cardiovascular development and disease. REFERENCES References Adams MD, Kelley JM, Gocayne JD, Dubnick M, Polymeropoulos MH, Xiao Hl Meml CR, Wu A, Olde B, Moreno RF, Kerlavage AR, McCornbie WR, Venter JC. Complementary DNA sequencing: Expressed sequence tags and the Human Genome Project. Science. 1991 ; 252: 1651 -1 656. Adams MD, Dubnick M. Kerlavage AR, Moreno R, Kelley KT, Utterback TR, Nagle JW, Fields C, Venter JC. Sequence identification of 2,375 human brain genes. Nature. 1992; 355:632-634. Adams MD, Kerlavage AR, Fields C, Venter JC. 3,400 new expressed sequence tags identify a diversity of transcripts in human brain. Nature Genet. 1993; 4:256 267. Adams MD, Soares MB, Kerlavage AR, Fields C, Venter JC. Rapid cDNA sequencing (expressed sequence tags) from a directionally cloned human infant brain cDNA library. Nature Genet. 1993; 4:373-380. Adams MD, Kerlavage AR, Fleischmann RD, Fuldner RA, Bult CJ, Lee NH, Kirkness EF, Weinstock KG, Gocayne JD, White O, Sutton G, Blake JA, Brandon RC, Chiu MW, Clayton RA, Cline RT, Cotton MD, Earle-Hughes J. Fine LD, FitzGerald LM, FitzHugh WM, Fritchman JL. Geoghagen NSM, Glodek A, Gnehm CL, Hanna MC, ,Hedblom E, Hinkle Jr PS, Kelley JM, Kilrnek KM, Kelley JC, Liu LI, Marmaros SM, Merrick JM, Moreno-Palanques RF, McDonald LA, Nguyen DT, Pellegrino SM, Phillips CA, Ryder SE. Scott JL, Saudek DM, Shirley R, Small KV, Spriggs TA, Utterback TR, Weidman JF, Li Y, Barthlow R, Bednarik DP, Cao 1, Cepeda MA, Coleman TA, Collins EJ, Dimke D, Feng P, Ferrie A. Fischer C, Hastings GA, He WW, Hu JS, Huddleston KA, Greene JM, Gruber J, Hudson P, Kim A, Kozak DL, Kunsch C, Ji H, Li H, Meissner PS, Olsen H, Raymond L, Wei YF, Wing J, Xu C, Yu GL, Ruben SM, Dillon PJ, Fannon MR, Rosen CA, Haseltine WA, Fields C, Fraser CM, Venter JC. Initial assessrnent of human gene diversity and expression patterns based upon 83 million nucleotides of cDNA sequence. Nature (suppt). 7995; 377:3-t74. Agarwal ML, Agarwal A, Taylor WR, Stark GR. p53controls both the G2/M and the G1 cell cycle checkpoints and mediates reversible growth arrest in human fibroblasts. Proc Natl Acad Sci U S A 1995; 92(18): 8493-7. Anderson SF, Schlegel BP, Nakajima T, Wolpin ES, PaMn JD. BRCAl protein is linked to the RNA polymerase II holoenzyme complex via RNA helicase A. Nat Genet 1998 Jul; 19(3):254-6 Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. Basic local alignrnent search tool. J Mol Biol. 1990; 215:403410. Barbaux S, Niaudet P, Gubter MC, Gnrnfeld JP, Jaubert F, Kuttenn F, Fekete CN, Souleyreau-Therville N, Thibaud E, Fellous M, McElreavey K. Donor splice- site mutations in WTI are responsible for Frasier syndrome. Nat Genet 1997 17(4):467-70. Basu, T. N.; Gutmann, D. H.; Fletcher, J. A.; Glover, T. W.; Collins, F. S.; Downward, J. : Aberrant regulation of ras proteins in malignant tumour cells from type 1 neurofibromatosis patients. Nature 1992; 356: 713715. Behrens J, von Kries JP, Kuhl M, Bruhn L, Wedlich D, Grosschedl R, Birchmeier W. Functional interaction of beta-catenin with the transcription factor LEF-1. Nature 1996; 382(6592): 638-42. Behrens J, Jerchow BA, Wurtele M, Grimm J, Asbrand C, Wirtz R, Kuhl M, Wedlich D, Birchmeier W. Functional interaction of an axin hornolog, conductin. with beta-catenin, APC, and GSK3beta. Science 1998; 280(5363): 596-9. Beroud ClSoussi T. APC gene: database of germline and somatic mutations in human tumors and cell lines. Nucleic Acids Res. 1996; 24: 121-1 24 Bienz M. APC: the plot thickens. Curr Opin Genet Dev 1999; 9(5):595603. Brodskey WY., Arefyeva A.M., Uryvaeva I.V. Mitotic polyploidization of rnouse heart myocytes during the first postnatal week. Cell Tissue Res. 1980; 21 0: 133- 144 Buchkovich K. Duw LA, Harlaw E. The retinoblastoma protein is phosphorylated during specific phases of the cell cycle. Cell 1989; 58: 1097-1105. Chien KR, Zhu H, Knowlton KU, Miller-hance W, van Bilsen M, O'Brian TX, Evans SM. Transcnptional regulation during cardiac growth and development. Annu Rev physiol. 1993; 5577-95. Chen P-L, Scrilly P. Shew J-Y, Wang JY, Lee W-H. Phosphorylation of the retinoblastoma gene product is modulated dunng the cell cycle and cellular differentiation. Cell 1989; 58:1193-1198. Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem. 1987; 162: 156- 159. Clarke AR, Purdie CA, Harrison DJ, et al. Thymocyte apoptosis induced by p53- dependent and independent pathways. Nature 1993;362:786-787. Claycomb, W.C. (1 992). Trends Cardiovasc. Med. 2:231-236 Ctubb F. J. JR., Bishop S.P. Formation of binucteated rnyocardiaf celts in the neonatal rat. An index for growth hypertrophy. Lab Invest. 1984; 50: 571-577 Cohen C, Parry DA. Alpha-helical coiled coils: more facts and better predictions. Science 1994 Jan 28;263(5146):488-9. Cohen J. The genornics gamble. Science. 1997; 275767-772. D'Alessi0 JM, Noon MC, Ley III HL. Gerard GF. One-tube double-stranded cDNA synthesis using cloned m-mlv reverse transcriptase. Focus. 1987; 9:l-4. Decaprio JA. Ludlow JW, Lynch D, furukawa Y. griffin J, Piwnica-Worms H, Huang C-M, Livingston DM. The product of the retinoblastoma susceptibility gene has properties of a cell cycle regulatory element. Cell 1989; 58:1085-1095. Deka J, Kuhlmann J, Muller O. A domain within the tumor suppressor protein APC shows very similar biochemical properties as the microtubule-associated protein tau. Eur J Biochem 1998; 253(3): 591-7. Dulic V, Kaufmann WK, Wilson SJ, Tlsty TD, Lees E. Harper JW, Elledge SJ, Reed SI. p53-dependent inhibition of cyclin-dependent kinase activities in human fibroblasts during radiation-induced G1 arrest. Ce11 1994; 76(6): 101 3-23. Dempsey, AA and Liew, CC. Genes involved in normal cardiac development. In: Sheridan DJ, ed. Left Ventricular Hypertrophy. London: Churchill Livingstone, 1998;61-70. Evans T. Rosenthal ET, Youngblom J, Distel D, Hunt T. Cyclin: a protein specified by matemal mRNA in sea urchin eggs that is destroyed at each cleavage division. Cell 1983; 33(2):389-96 Fields C., Adams MD., White O., Venter J.C. How many genes in the human genome? Nature Genet. 1994; 7345-3 R Fodde. W Edelmann, K Yang, C van Leeuwen, C Carlson, B Renault. C Breukel, E Alt, M Lipkin, PM Khan and R Kucherlapati. A targeted chain- temination mutation in the mouse Apc gene results in multiple intestinal tumors. Proc Natl Acad Sci U S A 1994 Sep 13;91(19):8969-73. Friedl W. Meuschel S, Caspari R, Larnberti C, Krieger S, Sengteller M. Propping P. Attenuated familial adenomatous polyposis due to a mutation in the 3-prime part of the APC gene: a clue for understanding the function of the APC protein. Hum. Genet. 1996 97: 579-584 Funayarna N, Fagotto F, McCrea P, Gumbiner BM. Embryonic ais induction by the armadillo repeat domain of beta-catenin: evidence for intracellular signaling. Cell 8iol 1995; 128(5):959-68. Gish W. States DJ. ldentification of protein coding regions by database similanty search. Nature Genet. 1993; 3:266-272. Groden J., Thliveris A., Samowitz W., Carlson M., Gelbert L., Albertsen H., Josylyn G., Stevens J., Spirio L., Roberson M., Sargeant L., Krapcho K., Wolff E., Burt R.. Hughes J.P., Warringtom J., McPherson J., Wasmuth J., Le Paslier D., Abderrahim H., Cohan D., Leppert M., White R. . ldentification and characterization of the familial adenornatous polyposis coli gene. Cell 1991; 66: 589-600 Gubler U, Hoffrnan BJ. A simple and very efficient method for generating cDNA libraries. Gene. 1983; 25:263-269. Hamada F, Murata Y, Nishida A, Fujita F, Tomoyasu Y, Nakamura M. Toyoshima K. Tabata Tl Ueno N, Akiyama T. ldentification and characterization of E-APC, a novel Drosophila homologue of the tumour suppressor APC. Genes Cells 1999; 4(8):465-74. Hamada F, Tornoyasu Y, Takatsu Y, Nakamura M, Nagai S, Suzuki A, Fujita F, Shibuya H, Toyoshima K, Ueno N, Akiyama T. Negative regulation of Wingless signaling by D-axin, a Drosophila homolog of min. Science 1999; 283(5408): 1739-42. He TC, Sparks AB, Rago C, et al. ldentification of c-MYC as a target of the APC pathway. Science 1998; 28 1 (5382): 1509-1 2. Hart MJ, de los Santos R, Albert IN, Rubinfeld B. Polakis P. Downregulation of beta-catenin by human Axin and its association with the APC tumor suppressor, beta-catenin and GSK3 beta. Curr Biol 1998; 8(10):573-81. Hinds PW, Weinberg RA. Tumor suppressor genes. Current opinions in genetics & development. 1994; 4: 135-1 41. Hirschl D, Bayer P, Muller O. Secondary structure of an armadillo single repeat from the APC protein. FEBS Lett 1996; 383(1-2):31-6 Horii A, Nakatsuni S, lchii S, Nagase H, Nakamura Y. Multiple foms of the APC gene transcripts and their tissue-specific expression. Hum Mol Genet 1993; 2(3):283-7. Hutsken J, Birchmeier W. Behrens J. E-cadherin and APC compete for the interaction with beta-catenin and the cytoskeleton. J Cell Biol 1994; 127(6 Pt 2):2061-9. Hwang DM, Hwang WS, Liew CC. Single pass sequencing of a unidirectional hurnan fetal heart cDNA library to discover novel genes of the cardiovascular system. J Mol Cell Cardiol. 1994; 36:1329-1333. Hwang DM, Fung YVi, Wang RX, Laurenssen CM, Ng SH, Lam WY, Tsui KW, Fung KP, Waye M. Lee CY, Liew CC. Analysis of expressed sequence tags from a fetal human heart cDNA library. Genomics. 1995;30:293298. Hwang D.M., Dempsey A.A., Wang R.X., Rezvani M., Barrans J.D.. Dai K.S., Wang H.Y., Ma H., Cukerman E., Liu Y.Q., Gu J.R., Zhang J.H., Tsui S.K.W., Waye M.M.Y., Fung K.P., Lee C.Y., Liew C.C. A genome-based resource for molecular cardiovascular medicine: toward a compendium of cardiovascular genes. Circulation 1 997;96: 41 46-4203 Hwang DM, Dempsey AA, Lee CY, Liew CC. Identification of differentially expressed genes in cardiac hypertrophy by analysis of expressed sequence tags. Genomics 2000; 66(l):1 -1 4 Ikeda S. Kishida S, Yamamoto H, Murai H, Koyama S, Kikuchi A. Axin, a negative regulator of the Wnt signaling pathway, foms a complex with GSK- 3beta and beta-catenin and promotes GSK-3beta-dependent phosphorylation of beta-catenin. EMBO J 1998; l7(S):IWl-84. lzumo S, Lompre AM, Matsuoka R, Koren G, Schwartz K, nadal-Ginard 6, Mahdavi V. Myosin heavy chain massenger RNA and protein isoform transitions during cardiac hypertrophy. Interaction between hemodynamic and thyroid hormon-induced signals. J Clin Invest. 1987; 79(3): 970-977. Ji H, Liu YE, Jia T, Wang M, Liu J, Xiao G, Joseph BK, Rosen C, Shi YE. Identification of a breast cancer-specific gene, BCSG1, by direct differential cDNA sequencing. Cancer Res 1997;57(4): 759-64 Johnson DG, Schneider-Broussard R. Rote of E2F in cell cycle control and cancer. Front Biosci 1998; 3:d447-8 Johnson DG, Walker CL. Ann Rev Phan Tox. Cyclins and cell cycle checkpoints. 1999;39:295-312. Joslyn J, Carlson M, Thliveris A, Albertsen H, Gelbert L, Samowitz W, Groden J, Stevens J, Spirio L, Robertson M Krapcho K, Sargeant L, Wolff E, Burt R, Hughes JP, Warrington J, McPherson J, Wasmuth J, Le Paslier D, Abderrahim Fi, Cohen D, teppert M. White R. Identification of detetion rnubtiuns and thme new genes at the familial polyposis locus. Cell 1991; 66(3): 601 -613 Jou TS, Stewart DB, Stappert J, Nelson WJ, Marrs JA. Genetic and biochemical dissection of protein linkages in the cadherin-catenin complex. Proc Natl Acad Sci U S A 1995; 92(11):5067-71. Katz AM. The cardiomyopathy of overload: an unnatural growth response in the hypertrophied heart. Ann intem Med 1994; 121:363-371. Kemler R. From cadherins to catenins: cytoplasmic protein interactions and regulation of cell adhesion. Trends Genet 1993; 9(9):317-21. Kinzler KW, Nilbert MC, Vogelstein B. Bryan TM, Levy DB, Smith KJ, Preisinger AC, Hamilton SR, Hedge P, Markham A, et al. ldentification of a gene located at chromosome 5q21 that is mutated in colorectal cancers. Science 1991; 25 1(4999) : 1 366-70. Kinzler K W, Vogelstein B. Lessons from hereditary colorectal cancer. Cell 1996; 87: 159-170 Kirshenbaum LA and Schneider MD. Adenovirus E1A represses cardiac gene transcription and reactivates DNA synthesis in ventricular myocytes, via alternative pocket protein- and p300-binding domains. J B Chem. 1995; 270:7791-7794. Kirshenbaum LA and de Moissac. The bcl-2 gene product prevents programmed cell death of ventricular myocytes. Circulation. 1997: 96: 1580-1 585. Kishida M, Koyama S, Kishida S, Matsubara K. Nakashima S. Higano K, Takada R, Takada S, Kikuchi A. Axin prevents Wnt-3a-induced accumulation of beta- catenin. Oncogene 1999; 18(4):979-85. Knowlton KU, Baracchini E, Ross RS, Hams AN, Henderson SA, Evans SM, Gternbotski CC, Chien KR. Co-regutation of the atriat natriuretic factor and cardiac myosin light chain-2 genes during alpha-adrenergic stimulation of neonatal rat ventricular cells. Identification of cis sequences within an embryonic and a constitutive contractile protein gene which mediate inducible expression. J Biol Chern 1997 ; 266(12):7759-68. Koziell A, Chamandari E, Hindmarsh PC, Rees L, Scambler P, Brook CG- Frasier syndrome, part of the Denys Drash continuum or simply a WTI gene associated disorder of intersex and nephropathy? Clin Endocrinol (Oxf) 2000; 52(4):5 19-24 Kurabayashi M, Tsuchimochi H, Komuro 1, Takaku F, Yazaki Y. Molecular cloning and characterization of human alpha- and beta-form rnyosin heavy chain comptementry DNA clones. Regutation of expression during devefoprnent and pressure overioad in human atrium. J Clin Invest. 1988; 82(2):524-531. Langer GA. The Myocardium. 1997; Academic Press, San Diego. Lee SB, Haber DA. Wilms tumor and the wtl gene. Exp Cell Res 2001 Mar 1 0;264(1):74-99. Lee, T. C.; Li, L.; Philipson, L.; Ziff, E. B.: Myc represses transcription of the growth arrest gene gasl . Proc. Nat. Acad. Sci. 1997; 94: 12886-12891. Lee, J. M.; Bernstein, A. : p53 mutations increase resistance to ionizing radiation. Proc. Nat. Acad. Sci. 1993; 90: 574295746. Levy D, Larson M.G., Vasan R.S., Kannel W.B., Ho K.K. The progression from hypertension to congestive heart failure. JAMA 1996; 275(20): 1557-1 562 Liew CC. A human heart cDNA library-The development of an efficient and simple method for automated DNA sequencing. J Mol Cell Cardiol. 1993; 25:891- 894. Liew CC, Hwang DM, Fung YW, Laurenssen C, Cukerman E, Tsui S, Lee CY. A catalogue of genes in the cardiovascular system as identified by expressed sequence tags (ESTs). Proc Nat1 Acad Sci U S A. 1994; 91 :10645-10649. Lijnen p, Petrov V. Antagonism of the renin-angiotensin sytem, hypertrophy and gene expression in cardiac myocytes. 1999; 21 (5): 363-74. Lodish H. Molecular Cell Biology. 4thed. By Freeman and Company publisher. Lotem J, Sachs L. Hematopoietic cells from mice deficient in wild-type p53 are more resistant to induction of apoptosis by some agents. Blood 1993; 82(4):t 092-6 Luongo C, Gould K A, Su L-K, Kinzler K W, Vogelstein B. Dietrich W. Lander E S, Moser A R. Mapping of multiple intestinal neoplasia (Min) to proximal chromosome 18 of the mouse. Genomics 1993; 15: 3-8. Lyons GE, Schiaffino S, Sassoon D, Barton P, Buckingham M. developmental regulation of myosin gene expression in mouse cardiac muscle. J Cell Biol. 1990; 1 1 1(6 Pt 1 ): 2427-2436. Matsumine A, Ogai A, Senda T, Okumura N, Satoh K, Baeg G-H, Kawahara T, Kobayashi S, Okada M, Toyoshima K, Akiyama T. Binding of APC to the human homofog of the Drosophita discs large tumor suppressor protein. Science 1996; 272: 1020- 1023. Mehlen, P.; Rabizadeh, S.; Snipas, S. J.; Assa-Munt, N.; Salvesen, G. S.; Bredesen, D. E.: The DCC gene produce induces apoptosis by a mechanism requiring receptor proteolysis. Nature 1998; 395: 801 -804. Miyoshi Y, Nagase H, Ando H, Horii A, lchii S, Nakatsuru S. Aoki T, Miki Y. Mon T, Nakamura Y. Somatic mutations of the APC gene in colorectal tumors: mutation cluster region in the APC gene. Hum. Molec. Genet. 1992; 1: 229-233. Moon R.T., Miller J.R. The APC tumor suppressor protein in development and cancer. Trends in Genetic. 1997; 13(7): 256258 Moore, K.L. (1998). The Cardiovascular System, In: The developing human, 4m ed., W. B. Saunders, Philadelphia, 286-333. Morin PJ, Sparks AB, Korinek V, Barker N, Cleven Hl Vogelstein 6,Kinzler KW. Activation of beta-catenin-Tcf signaling in colon cancer by mutations in beta- catenin or APC. Science 1997; 275(5307):1 787-90. Munemitsu S, Souza B, Muller O, Albert 1, Rubinfeld B, Polakis P. The APC gene product associates with microtubules in vivo and promotes their assembly in vitro. Cancer Res 1994; 54(14):3676-81. Nakamura Y, Lathrop M, Leppert M, Dobbs M. Wasmuth J, Wolff E, Carlson M. Fujimoto E, Krapcho K, Sears T, Woodward S, Hughes J, Burt R, Gardner E, Lalouel J-M, White R. Localkation of the genetic defect in familial adenomatous polyposis within a small region of chromosome 5. Am. J. Hum. Genet. 1988; 43: 638-644. Nakamura T, Hamada F, Ishidate T, Anai K, Kawahara K, Toyoshima K. Akiyama T. Axin, an inhibitor of the Wnt signaffing pathway, interach with beta-catenin, GSK-3beta and APC and reduces the beta-catenin ievel. Genes Cells 1998; 3(6):395-403. Nathke IS, Adams CL, Polakis P, Sellin JH, Nelson WJ. The adenomatous polyposis coli tumor suppressor protein localizes to plasma membrane sites involved in active cell migration. J Cell Biol 1996; 134(1):165-79. Ng WA, Gwpp IL, Subramaniam A, robbins J. Cardiac myosin heavy chah mRNA expression and myocardial function in the mouse heait. Circ Res. 1991; 68(6): 1742-1750. Olschwang S. Tiret A, Laurent-Puig, P, Muteris M., Parc, R., Thomas, G. Restriction of ocular fundus lesions to a specific subgroup of APC mutations in adenomatous polyposis coli patients. Cell 1993; 75: 959-968. Pai LM, Orsulic S, Bejsovec A, Peifer M. Negative regulation of Armadillo, a Wingless effector in Drosophila. Development 1997; 124(11):2255-66. Pardee AB. G1 events and regulation of cell proliferation. Science 1989; 246(4930):603-8. Parker TG, Parker SE, Schneider MD. Peptide growth factors can provoke "fetal" contractile protein gene expression in rat cardiac myocytes. J Clin Invest. 1990; 85(2): 507-514. Pyles RB, Santoro IM, Groden J, Parysek LM. Novel protein isofoms of the APC tumor suppressor in neural tissue. Oncogene 1998; 16(1):77-82. Rajan, J. V.; Wang, M.; Marquis. S. T.; Chodosh, L. A. : Brca2 is coordinately regulated with Brcal during proliferation and differentiation in mammaty epithelial cells. Proc. Nat. Acad. Sci. 1996; 93: 13078-13083. Rezvani, M. and Liew C.C. "Identification of APC gene in hurnan heart and its involvement in myocardial development and disease". Genome Mapping, Sequencing and Biology". 1998; Pl98. Rezvani M, Liew CC. Role of the adenomatous polyposis coli gene product in human cardiac development and disease. J Biol Chem 2000; 275(24):18470-5. Riabowol KT, Vosatka RJ, Ziff EB, Lamb NJ, Feramisco JR, micro injection of fos-specific antibodies block DNA synthesis in fibroblast cells. Mol Cell Biol. 1988; 8: 1670-1 676. Rich T, Allen RL, Wyllie AH. Defying death after DNA damage. Nature 2000; 407(6805):777-83. Riese J, Yu X, Munnerlyn A, Eresh S, Hsu SC, Grosschedl R, Bienz M. LEF-1, a nuclear factor coordinating signaling inputs from wingless and decapentaplegic. CelI 1997; 88(6):777-87. Rubinfeld, B.; Souza, B.; Albert, 1.; Muller, O.; Chamberlain, S. H.; Masiarz, F. R .; Munemitsu, S.; Polakis, P.: Association of the APC gene product with beta- catenin. Science 1993; 262: 1731-1 734. Rubinfeld 8, Souza B, Albert 1, Munemitsu S. Polakis P. The APC protein and E- cadherin fom similar but independent complexes with alpha-catenin, beta- catenin, and plakoglobin. J Biol Chem 1995; 27O(l O):5549-55. Rubinfeld 8,Robbins P, El-Gamil M, Albert 1, Porfiri E, Polakis P. Stabilization of beta-catenin by genetic defects in melanoma cell lines. Science 1997; 275(5307): 1790-2. Rumyantsev, P.P. Interrelations of the proliferation and differentiation processes during cardiact rnyogenesis and regeneration. Int. Rev. Cytol. 1997; 5 1 :1 86-273 Rumyantsev, P.P. (1991 ). Growth and hyperplasia of Cardiac Muscle Cells, In: Rurnyantsev pp (ed.). Hatwood Academic Publisher, London, 70-157 Sakanaka C, Weiss JB, Williams LT. Bridging of beta-catenin and glycogen synthase kinase-3beta by axin and inhibition of beta-catenin-mediated transcription. Proc Natl Acad Sci U S A 1998 Mar 17,95(6):3020-3. Sattar A, Robson SC, Patel HR. Angus B, Campbell FC. Expression of growth regulatory genes in a SCDl mouse-human model of intestinal regeneration. J Pathol 1999; 187(2):229-236. Santoro IM, Groden J. Alternative splicing of the APC gene and its association with terminal differentiation. Cancer Res. 1997 57: 488-4940 Schwartz D, Rotter V. p53-dependent cell cycle control: response to genotoxic stress. Semin Cancer Biol 1998;8(5):325-36. Sheng H., Shao J., Williams C.S., Pereira M.A., Taketo M.M., Oshima M., Reynolds AB., Washinton M.K., DuBois R.N., Beauchamp R.D. (1998). Carcinogenesis. 19(4):543-549 Sherr CJ. 01 phase progression: cycling on cue. Cell 1994 Nov 18;79(4):551-5 Smith KJ. Levy DB, Maupin P, Pollard TD, Vogelstein B, Kinzler KW. Wild-type but not mutant APC associates with the microtubule cytoskeleton. Cancer Res 1994 JuI 15,54(14):3672-5. Spirio L, Olschwang S. Groden J, Robertson M, Samowitz W. Joslyn G, Gelbert L, Thliveris A, Carlson M, Otterud 6, Lynch H, Watson P, Lynch P, Laurent-Puig P, Burt R, Hughes J P, Thomas G, Leppert M. White R. Alleles of the APC gene: an attenuated fom of familial polyposis. Cell 1993 75: 951957 Stappert J, Kernler R. A short core region of E-cadherin is essential for catenin binding and is highly phosphorylated. Celi Adhes Commun 1994 Aug,2(4):319- 27. Stokowski, R. P.; Cox, D. R. :Functionat anatysis of the neurofibmmatosis type 2 protein by means of disease-causing point mutations. Am. J. Hum. Genet. 66: 873-891,2000. Su L-K. Vogelstein B, Kinzler K W. Association of the APC turnor suppressor protein with catenins. Science 1993 262: 1734-1 737 Su LK, Burrell M, Hill DE, Gyuns J, Brent R, Wiltshire R, Trent J, Vogelstein B, Kinzler KW. APC binds to the novel protein EB1. Cancer Res 1995 Jul 15,55(14): 2972-7. Su, L.-K.; Vogelstein, B.; Kinzler, K. W. : Association of the APC turnor suppressor protein with catenins. Science 1993; 262: 1734-1737. Takeichi M. Watabe M, Shibarnoto S, Ito F, Oda H, Uemura T, Shimamura K. Dynamic control of cell-cell adhesion for multicellular organization. C R Acad Sci 111 1993 Sep,316(9):813-21. Tan, KT, Dempsey, AA, Liew, CC. Cardiac genes and gene databases for cardiovascular disease genetics. Curr Hypertension Rep 1999; 1:51-58. Thliveris A, Samowitz W, Matsunami N, Groden J, White R. Demonstration of promoter activity and alternative splicing in the region 5' to exon 1 of the APC gene. Cancer Res 1994 Jun 1,54(11):2991-5. Tsuji K, Copeland NG, Jenkins NA, Obinata M. Mammalian antioxidant protein complements alkyl hydroperoxide reductase (ahpC) mutation in Escherichia coli. Biochem J 1995 Apr l5;3Oi ( Pt 2):377-81. van der Luijt R B, Khan P M. Vasen H F A. Breukel C, Tops C M J, Scott R J, Fodde R. Germline mutations in the 3-prime part of APC exon 15 do not result in tnincated proteins and are associated with attenuated adenornatous polyposis coli. Hum. Genet. 1996 98: 727-734 van de Wetering M, Cavallo R, Dooijes D, van Beest M, van Es J, Loureiro J, Ypma A, Hursh D, Jones Tl Bejsovec A, Peifer M, Mortin Ml Clevers H. Arrnadillo coactivates transcription driven by the product of the Drosophila segment polarity gene dTCF. Cell 1997 Mar 21,88(6):789-99. Vogelstein, B.; Kinzler, K. W. X-rays strike p53 again. Nature 370: 174-175, 1994. Waspe LE. Ordahl CP, Simpson PC. The cardiac beta -rnyosin heavy chain isogene is induced selectively in a sub 1-adrenergic receptor-stirnulated hypertrophy of cultured rat heart myocytes. J Clin lnvest 1990;85:1206-14. Weinberg, R. "Tumor Suppressors Genes". Nemn, 11(3), t2 Aug 1993, pp. 191-1 96. Yamamoto H, Kishida S, Uochi T, lkeda S, Koyama S, Asashima M. Kikuchi A. Axil, a member of the Axin family, interacts with both glycogen synthase kinase 3beta and beta-catenin and inhibits axis formation of Xenopus embryos. Mol Cell Biol 1998 May, 18(5): 2867-75. Yamamoto H, Kishida S, Kishida M, lkeda S, Takada S, Kikuchi A. Phosphorylation of axin, a Wnt signal negative regulator, by glycogen synthase kinase~betaregulates its stability. J Bi01 Chern 1999 Apr 16,274(16): 1O681 -4. Yazaki Y, Tsuchimochi H, Kurabayashi M, Komuro 1. Molecular adaptation to pressure overload in human and rat hearts. J Mol Cell Cardiol. 1989; 21 Suppl 5191-1 01. Yost C, Torres M, Miller JR, Huang E, Kimelman D, Moon RT. The axis-inducing activity, stability, and subcellular distribution of beta-catenin is regulated in Xenopus embryos by glycogen synthase kinase 3. Genes Dev 1996 Jun 15,1 O(12): 1443-54. Yu X, Waltzer L, Bienz M. A new Drosophila APC homologue associated with adhesive zones of epithelial cells. Nat Cell Biol 1999 Ju1,1(3):144-51. Zheng, L.; Pan, H.; Li, S.; Flesken-Nikitin, A.; Chen, P. -L.; Boyer, T. G.; Lee, W.- H. : Sequence-specific transcriptional corepressor function for BRCAl through a novel zinc finger protein, ZBRK1. Molec. Cell6: 757-768, 2000. Zhong, Q.; Chen, C. OF.; Li, S.; Chen, Y.; Wang, CL;Xiao, J.; Chen, P.-L.; Sharp, Z. D.; Lee, W.-H. Association of BRCAl with the hRad50-hMrell-p95 complex and the DNA damage response. Science 285: 747-750,1999. Zhou BB, Elledge SJ. The DNA damage response: putting checkpoints in perspective. Nature 2000 Nov 23;4O8(68 11 ):433-9. Appendix A Clinical Investigation and Reports A Genome-Based Resource for Molecular Cardiovascular Medicine Toward a Compendium of Cardiovascular Genes David M. Hwang, BSc, Adam A. Dempsey, BSc; Ruo-Xiang Wang, MD, PD; Mojgan Remi, MSc; J. David Banans, MHSc; Ken-Shwo Dai, MSc; Hui-Yuan Wang, MD; Hong Ma, MD; Eva Cukerman, MSc; Yu-Qing Liu, MD;Jian-Ren Gu, AD; Jing-Hui Zhang, PhD; Stcphen KW. Tsui, PhD; Mary M.Y. Waye, PD;Kwok-Pui Fung, PhD; Cheuk-Yu Lee, PhD; Choong-Chin Liew, PhD BacAgtod Large-scale partial scqucncing of cDNA Iibrar- vascular systcm. In silico Northem analysis of known gcnc iuto generate wrprwsed sequenœ tags (ESTs) is an effective matches idcatificd widcly ocpressed cardiovascular genes as means of discoveriag nmlgents and cbaracterUing transcrip weli as gens putatively exhibithg grtater tissue specificity or tiou patterns in diffcrcnt tissues. To catalogue the identities developmental stage spedcity. More detailed anaiysis identi- and expression levels of gents in the cardiovascuiar system, we fied 48 gents potentially ovcrcxprcsscd in cardiac hypertrophy, initiatcd large-scale sequencing and andysis of human cardiac at least 10 of which werc previously ddocumented as dinercn- cDNA libmio. h'ally cxpresxd. Cornputer-based chromosornai locaiixations of Mdhodt MdResdts Using automated DiJA sequencing, we 1048 cardiac ESTs were perforrned to further aist in the gcnerated 43 % ESïs from human heart cDNA iibraries, An scarch for discase-related gencs. additional 41 619 ESTs wcre rctricved from public databases, Conclunom These data reprcscnt the most extensive com- for a total of 84 904 ESTs represeating more than 26 million carâiavascular nudtotides of raw cDNA scquence data hm13 independent pilation of gcne expression information to date. cardiovascuiar systembascd cDNA Iibraries. Of thesc, 55% niey fùrther dernonstrate the untappcd potentiai of genome matched to known gencs in the Gcnbank,EMBUDDRT data- research for invcstigating questions rclated to cardiovaxnilar bases, 33% rnatched only to other EST'S, and 12% did not biofogy and rtprcscnt a first-generation genomc-bascd re- match to any known scquenas (dcsignated cardiovascular source for rnolecular cardiovascular medicine. (Circutorion. system-based EST% or CVbESïs). ESTs that matched to 1997;96:41464203.) known gcnes wen classified awrdiag to function, dowing for &y WorrLr cardiomyopathy a cardiovascular diseases detcction of d8ercnccs in general tmscription patterns bc- cDNA library cxprcssed scquencc tas a heart failure twcen various tissues and dcvelopmentd stages of the cardio- human genome projcct hypertmphy he complcxity of the human cardiovascular sys- dation, endotheliai ceUs lining the vascular tree, and tem is derived fkom its muIticomponent constit- matrnr secretory ctk responsiôte for the deposition and T uency, with the hart at its center and the upkeep of fibrous and elastic components of the system. vascular network at its periphery. These further rcduce Undermg this cornplexity at the macroscopic lcvel is to a diversity of aU types that fwction in concert to mmendous complexity at the rnoledar level. The generate normal cardiovascular function, inducLing mus- intntncadesof cardioyascufar fiuiction are determined by cle uiis invoived in producing and maintainhg pulsatile a proportion of the 60000 to 120 000 genes of the flow, ncuroendocrine œih invoived in control and reg- human genomqlJ bctwecn 15 000 and 30 000 of which 1 yc expressed in any given single ceil of the dovas- cdar systtm. Although a significant proportion of these Reccived April 17, lWZ minon mcivtd Jdy 16, 1W7; ac- are dcvoted to the maintenance of basic celIdar funtion ccptcd Aug. 1, 1997. and arc widely exprcssed, more restrkted expression From the Cardiac Gent Unit, Departments of Laboratory (eg, spatial, temporal, contumial, or kinetic restriction) Mediane and Pathobiolofiy and Medicine. Cenm for Cardiwas L of subsets of genes presumabîy gives rise to the divcrsiîy cular Research, The Toronto Hospital, UMtyof Toronto, Ontario, Canada (D.M.H.,AA9, =W., M.R., J.D& K-SD, of ceil types, tissues, and organs of the system, Thus, a-Y.W, M.,EC, C-YL, Ca);China National Center changes in gent expression in response to developmen- for Biotechnology Dcvclopment, STC, Bermg, China (Y.-QG td cues drive the growth and differentiation of the kart 1.-RG.); National Ccnter Fm Biotechnology inhrmatim. Be- and blood vesscls, resulting in the establishment of thesda, Md (J.-ILZ); and the Department of Biochcmirtry, Chi- normal circulatory function. Further, dynamic interac- nese University of Hong Kong, Sbatin (S,KW.T9 M.M.Y.W.. tion of the cardiovascnfar system with physioIogid or K-PX., C-YL, Ca).DM Hwang and AA Dempsey con- pathological stimuli also elicits alterations m gene ex- triited cquaiiy to thx work. Correspondence to CC Licw, Banting institute, University of pression, ultimatety leading to generation of adaptive Toronto, 100 Conegc St, Toronto, Ontario M5G ILS, Canada rtspo-• E-mail [email protected] Recent yeas have seen encouraging progress in un- O 1997 American Heart Association, Tnc derstanding the genetic basis of cardiovascufar function, Hwang et al Genome-Based Resource for Cardiovascular Medicine 4147 development, and discase (for revicws, see References 3 through 10)- Howevcr, many questions remain unan- swereb. For e~a~ljd~tbeidentitkdthe uastmajody of genes expressed in the cardiovascular system, to- gether with th& roles in the processes of ontogeny, growth, and normal fwction, remain unknown. Further- more, aithough some inroads have been made in iden- tifying genes involved in monogeaic dis or der^,^ the ge- netic factors underiying rnultifactorial disorders and their roles in the pathogenesis of such common condi- tions as hypertension, atherosderosis, coronary artcry disease, and kart failure remain elusive. To provide a base to aid in the exploration of some of these unknowns, we initiated a project to characterize gene expression in various devclopmental and patholog- ical states of the cardiovascdar system by use of high- throughput sequencing of randornly selected clones from human heart cDNA libraries to generatc "ex- pressed sequence tags" (ESTS)."-'~This appmach has proved to be a powerful means of discoverhg novel genes expresscd in a wide variety of human tissue^.^'-^ Because cDNA libraries are reprcsentative of gene tra-ption in cclls or tissues used to construct the iiibrary, random sampIing and sequencing by the EST approach simultaneousiy generatc gene expression pro- files that arc useful for detailed genetic-level cornpari- sons of dineren t developmtntai and athological states of the ceiis and tissues of intere~t.'~~'!?In this report, we present the anaiysis of 84 904 Esrs from 13 cDNA libraries of the cardiovascular systeni, representing the most extensive compilation of cardiovascular gent ex- pression information to date, and we discuss the poten- tial impact of this genome-based resource on the field of molecular cardiovascular medicine. Fia 1. Overview of methodology. Methods Gigapack Gold packaging uttracts. Mer titracion, aliquots of RNA Isolation ptimary padcaging rnix were stored in 7% DMSO at -8(PC as Total RNA was isolatcd hmhuman hcart sampfes by the primary iiiraiy stocks, and the rcrnaindcr was amplified to method of Chomaynski and Sacchi." Tissues werc powdertd establish stable üôrary stocks. under liquid nitrogcn before bomogcnization and two rounds of extraction with acidic guanidinium isothiocyanatt-phtnol- Large+Scale Sequencing of cDNA Iiiserts chlorofom. The poiy(A)+ RNA fraction was isolated by Protmk for large-scale PCR-bascd squmang of A gtll oligo-di" cellulose chromatography (Pharmacia; Stratagcnc). and gt22A IiMits have been descriid prcviously"'' and are Purity and RNA integrity were asxsxd by absorbana at outlincd in Fig 1. These protocols made use of phage plaqua 260/280 nm and by agarose gel elcctrophoresis. as the direct source of cDNA clones, thus climinating problems of bias due to in vivo excision assa5atcd with most otbcr EST pmjemx Forh ZAPtirprtJshhxks, pbagcpiaqueswere Initiaii~~we uscd nondirectionaily cioned human adult and plated at lm density (CS00 pfbh50-mai plate) ont0 Esche- fetal heart cDNA Iri&cs, which were purchascd from Clon- richirr coli XLI-blue MRF' lawas, with ïPTûBC-gai for color tech. Subsequcnt to conœrns regardhg the prrscna of bactc- seleaion. Plaques wete picked into 75 & suspension medium rial or yea. contaminating sequenm in some commercial buffer. Phage duatts (5 pL) WC= uscd for PCR rcacfions (50 iiirarics, unidireaional cDNA übraries wm constnicted with pLfiaal volume) in the prtscnce of 125 pmoilL of each dNTP a 3 to 5 i~gpoly(A)+ RNA in a modifieci Gubler and Ho5an (Pharmacia), IO pmol cach of mdedT3 (5'-GCCAAGCïC onotube &NA synthesis proctdure.~Aii riiraries wcre GAAAITMCCCKACTAAAGGG-3') adTI (5'-CCAGT constructcd in the A ZAP Express vector (Stratagene) accord- GAATTGTAATACGACïîACTATAGGGCG-3') primcrs, ing to. protocols suppkd by the manufacturtr, with the cx#p and 2 U of Taq DNA poiycnera~t(Pharmacia). PCR samplcs tion of one library constructed in the A gt22A ~ector.~''Brieffy, were mcubatcd at 9S0C for 5 minutes, foIlowed by 28 cycics of first-strand cDNA was synthesized with an Xho Eoligo(dT) ampülicôtiou (94°C 45 seconds; WC, 30 seconds; TC 3 adapter-primcr m the presenœ of 5'-methyl dLfP to protect minutes) and a terminal isothermai attnsion (t2"C 3 minutes) the synthcsized cDNA hmsubsequcnt Bo1 dctioa After in a DNA Thermal Cyder (Perkin-Elmer), mer aga- gel second-strand synthesis and ligation of Eco= adapters, cDNA elecîrophoresis to asscss purity and concentration, PCR prod- was digested with Xho 1, generating cDNA fiaakcd by EmRI ucts (100 to 150 ng) wcce uscd dirrctly, without further sites at the S'-ends and XAo 1 sites at the 3'-ends. Digcsted purification, for DNA scquencing rcactions ushg Tag Cyclist cDNAs wcrt sàe-fiactionattd in Sephacryl S-500 spin columns (Stratagene) or Amplicycle (Ferlin-Elmer) cyde scqucncing to remver cDNAs îargcr than 05 kb Mort ligation mto A ZAP kits and 5 pmol of a dye-lakled (0uorescein or C'moditied Exprtss vcctor prcdigcstcd with EcoRI and Xho 1. The dt- 13 @III= (5'-GAAAmAACCCTCACTAAAGGG-3'). Re- hg A DNAfcDNA concatomcrs wcrc packagcd by use of actions wtn incubatcd at 94°C for 2 minutes, fonowtd by linear ampliacation (94°C 30 seconds; SOT, 15 secon& WC, 1 Bricfiy, the EST'S werc combined with aU entries in the minute for U3 cycles and WC, 30 seconds; ?TC,1 minute for UniGene databasc and proccssed by use of a sequence duster- 15 cycles), then stoppcd by addition of 05 vol loading bufftr ingalgonthm.Thme tharbcloogcdtoaditacrwerckdardas (9595 formandé, M mmoT/L EDTA, 1O mg/mL blue dextran). one group. A second group was wmpiled consisting of stads- Sequencing rcactions wen electrophonscd with ALF, and ticaiiy sipi6cant matches to databasc entries after BLAST A.L.F. Express DNA sequenccrs (Pharmacia). searches were pcrformed against the Genbank databases (W=12, E=1.0x104). Chromosome locations of the cardio- Data Acquisition and Analysis vasaiar ESTs wen determincd hmthe integrated genome EST scquence data from other tissues of the cardiavascular mapping and sequencing data compiied at the NCBI (Zhang systcm werc rchieved by various strategies from the GenbanlJ and Osteli, unpublishtd; http.J/ivww..acbi.nlm.nih.gwIEntrcz/ EMBUDDBJ databases at the National Ccnter for Biotech- Genome/orghtml) based on significant sequcnce similarity nology Information (NCBi). When possible, entire data sets between members of cithet pup and sequcnces on the hmindividual iiirarics were isolatcd and rctriewd by tact integrated map. string scarcbg. Failing bis, individual a-on numbers for Sequena deposition in dbEpwas by the standard ff at file each libraxy were obtained from field-rcstncled &EST queries, submission format Furthet clone information is amilable and sequcnas were rctrimd with Batch Entrez Sequencts mughNCBI or at the Cardiac Gene Unit world-wide web site from the Genorne Sequencing Ccnter at Washington Univcr- (URL: httpJrwwW.tcgu.med.utoronto.ca). Cioues are available siv were obtained by retrieving Genbank accessions for each oa rcquest, as dctailed in GenBank reports. data set from the Gtnome Scauencinn Ccnter woddwide web site (URL: httpd/gtnome.wusti.edu/~esthm&hnl) and re- Resul ts trieving the corresponding sequemes with Batch Entrcz Sequencc similarity searching of dl ESTs against the nome- LargeScale cDNA Sequencing and EST Acquisition dundant G~~~~MBuDDË~Jand dbmdatabases (Re- A total of 43 285 ESTs were generated in ow labora- lease 98.0) were pcrformed with the BLAST aigonthmna on a tories hmsix dif€erent human cardiac cDNA libraries Pcntium Pro200 Solaris x86 platform (Micron Electronics). ESTs representing severai developmentai stages and disease Assignments of putative identitics for exhibithg matches 1A). 41 ESTs to known gcnes or to other ESTs rquircd a minimum value of States (Table An additional 619 from P=lO'la and nucleotide sequena identity >95%. Gent homo- seven cardiovascular tissues or ce1 types wcre obtained logues wcrc defined as tbose ESTs that had a value of P chromosome 3 Fm 2 P~ES4-10. Chromosome map locations of disEST% A total of 1MESTs from humcardihic cDNA tibrarf83 WW assignecl to chromosomal iod on the basis of sequence identfty to genes or ESTs of known map locatfon. Presented are locus names of matching genes a nurnbem of mappd €Sis. A completet Mng of Oenbank accession numbem of ESTs vsed in thb analysfs, togeîher with matchmg geries and map locaaoru, fs ghin Appendix 2. 4150 Circulation Vol No 12 Decembcr 14 1997 chromosome 4 chromosome 5 Hwang et al GenomeBaseà Resource for Cadovasciilar Meàicine 4U1 chromosome 6 Ivw.12 s~&mn wis* *B~Mk-I sin wtm d,t ~WSS&~ &- chromosome 7 chromosome 8 4152 Circulation Vd No 12 Decentber 14 1997 chromosome 9 chromosome 10 chromosome 11 Huang et al Genome-Based Resource for Cardiovascuiar Medidnt 4153 chromosome 13 chromosome t 5 chromosome 16 chromosome 18 Hwang et al GenorneBased Rcsonrce for Cardfovasdar Medldne 4155 chromosome 19 chromosome 22 chromosome 20 chromosome 21 4156 Cirtrilation Vol S& No 12 Dece& ld, f 997 numben of transcripts in Werent tissues and in Mer- ESTs matching to known genes (cxcluding repetitive ent developmental and pathological states of the cardio- eitments and probable rnicrobia4 contaminant se- u- systern, quences) were catalogued into seven generai categories Several transcripts were widely expressed throughout (ceil division, ceU signaling/ceIl communication, ceil most tissues and developmentai stages (Table 6), al- stmcturc/motiIity, cei.l/organism defense, gendprotein though none were uniformly observed in all hiraries, expression, metabolism, and unclassified) based on the probably because of the srnall sample sizes ofseveral of putative functions of the known genes, as descnbed by the liraries used in the analysis (Table 1). A large Adams et alt9 (sumxnarized in Table 2; see Appendix 1 proportion of these wideiy expressed genes are involved for alphabctical listing of aü genes). ISvo subcategories in basic cellular functions such as protein synthesis (eg, were added under ceil stnicture/motility, namely, con- n'bosomal proteins), energy generation (eg, cytochromes tractile prottins and vesicular transport. and ATP synthases), and maintenance of ctll and tissue In total, up to 4575 unique known genes were repre- structure (eg, cytoskeletal 2nd extracellular matrix pro- sented in the data set (Table 2). In concordance with the teins). A number of genes also appearcd to be more resdts observed by Adams et al,'' the Iargest class of rcstricted in their distribution, being highiy expressed genes represented those involved in gene and protein only in specific tissue types or developmental states expression (24% of all genes represented). This was (Table 7). Several of these were not unexpected, on the foiiowed by genes invoIved in ce11 signaling/cell commu- basis of known gene and organ fuactions (eg, plasmino- nication (18%), metabolism (16%), ceIl stnicture/motil- gen activator hhiiitor and platelet-endothelid ceIl ad- ity (IO%), cell/organism defense (7%). and celi division hesion molecule in endothelia1 cells, smooth muscle (6%). Genes lacking enough information to be classifkd caldesmon in aorta, myosin gencs in aduit hem, and constituted the remaining 20%. A more detailed break- yglobin in fetal heart). Others (eg, SDFS isologue in down by &NA liirary (Table 3) found that in general, aorta, G protein-activated potassium Channel in atrium, the fractions of genes devoted to these ccUular functions and osteobiast specific factor in fetal heart) rnay warrant did not deviate significantiy from the overall average, furthcr verification as to their tissue specüicity. except in the case of the endothelia1 ceil iibrary, which Analysis of Known Gene Expression in Disease had slightly more genes devoted to gendprotein expres- sion and slightly fewer for ce11 structurdmotility, and in Cdiac Hypertrophy the case of =erd heart libraries that exhibited a greater In silico Northern analysis was used to identifv genes proportion of gtnes invoived in ce11 structure and poten tially ovcrexpressed in cardiac hypertrophy am- mo tility. pared with normal myocardium. In total, 69 gencs were Although the proportions of unique genes invoked in represented by at lest one EST. in both hypertrophic each function were relatively unifom between cDNA cDNA libraries. Of these, 23 were identified to be strong libraries, striking diaerenccs wtisted be~eenactual lev- candidates for high expression in cardiac hypcrtrophy, cls of gene expression (Table 4). For example, endothe- inchcihg mitochondrial genome transcn'pts (which wert lia1 ceUs exhiiited elevated expression of genes involved counted as a single entity), myosin iight chain-2, brain in gent and protein expression (52%) and relatively natriuretic peptide, desmin, heat shock protein 70, and depresscd leveb of rnetabolic (12%) and celi structurel superoxide dismutase (Table 8A). Anothcr 11 were good motility (8%) genes cornparcd with all other tissues, candidates, including atn'al natriuretic factor, a-skeletal most likely reflective of rapid proMeration in culture. As musde tropomyosin, and a-cardiac actin (Table 8B), previously desc~i'bed,~*the fetal heart consistently exhtib- whereas an additionai 14 were identified as weak candi- ited higher expression of genes invotved in gene and dates for difkrentiai expression (Table 8C). Tb e rtrnain- protein expression and lower expression of cd stntc- hg 21 gens ahiiited combincd values of PB.05 and turdmotility genes than the adult hart (22% to 33% were therefore not identified as dinerentialiy expressed versus 14% to 18% and 12% to 17% versus 22% to 25%. (data not show), respectively). Irttetestiagly, the expression of ctll struc- Simitar anaigsts were perfuxmed to identify genes turehotiiity genes in adult hypertropbic hearts (14% to wthtbiting diminished expression in cardiac hypertrophy 16%) was also significantly ciiminished compared with compared with normal myocardium by identwg gens nomai aduk hearts (2%to 25%), whereas expression highiy wrpressed in other libraries that were absent hm of transcripts iwolved in celi/organism defense was both hypertrophic libraries. These analyses identified siightiy mcreased in both hypertrophic heart libraries oniy three gents acbicving statisticai significanu: atrial (7% to 8%) compared with aU other cardiac Iibraries myosin light chah-2 (P= 15~IO"), ygiobin (P=.0004), (4% to 6%), with the exception of the two normaîized and a-tubulin (P=.02). Iriraris (7% and 11%)- Jdenb'ficah'on of Diseuse Genes ih the ~iovascUtot In S&o Nortliern Adysis EST Datu Set= Database Search and Relative frequencies of known ESTs for each gene Chromosome Locafircrtion were computed, and frequena'es were represented by A large number of knmdisease genes were identi- differing intensities ta generate an "in silico Northern fied in the cardiovasdar EST data set. These Indude blot" of laiawn genes of the cardiovascular system genes identified by bidemical and positionai strategies (Table 5). As for conventional Northern blots, higher for a variety of cardi0MsCula.r system-reIated (Table frequencies were represented by darker intensities and 9A) and noncardiovascular (Table 9B) disorders, To laver frequencies by ligbter intensities, aiiowing for as& in the search for new candidates for cardiovasdar mnvenient assessrnent of the relative abundance of large genetic disordes, 22 623 humau heart ESTs generated Genomt+Based Resource for Cardiovasdar Meàîcine 4157 in our laboratory were analyzed for chromosome map found that 12% of cardiovascular ESTs rcpresented Iocations. With the protocols descrii'bed in the methods novel transcripts (CVbESîs), although this number & 19 &58 ESTs wem mat&& ta entris in the appeai:ed ta be~hue andm library deptndcnt (Table GcnBank databases; of these, 1048 were locaiized to 1). Nevertheles, thcse numbers suggest that EST gcn- chromosomes (Fig 2; see Appendix 2 for cornplete eration remains a reasoaable method for the discovery listing). of novel genes of the cardiMar system, dwpitt the 850 000 human EST'S cunentIy available in &EST. Discussion Functional categorization of ESTs with known gene The application of moledar biological techniques to matches highlighted gened differences in gene expres- the study of cardiovascular biology has proved to be a sion between different tissues and developmental States powerful means of exploring the molecular mechanisms of the cardiovasdar system. Previous work established underlying cardiovascular function, development, and that fctal hcart exhibitcd fewer tr-pts representing disease. Aithough these methods have traditionally fo- contractile proteins and more transcripts representing cused on the discovery and characterization of single signai transduction and ceiï regdatory proteins than genes or of relatively limited combinations of genes, adult hem, consistent with a ltss dinerentiated, rapicüy growing phenotype.'' nie data presented this paper recent developments in human genome research have in . * led to the rapid discovery of thousancls of previoudy (TabIe 4) strengthen thest findings by vcrifying them in unhown genes and increasingiy to the ability to analyze a larger number of independent libraries (although it large numbers of genes simdtaneously. However, al- should be noted that the categories used in this study though J3Ts and related genome-based data represent were slightly diiferent from those used previo~sly).~' an important resource for the Human Genome Project, They furthet suggest that global changes in gene expres- their vast potential for moiecular medicine remains sion are occurring in the adult hypertrophie heart, for largely untapped. example, in the decreased expression of ceiî structure/ Previousiy, we reported the deveiopment and applica- motility gents, perhaps rerniniscent of a switch to more tion of an efficient protocol for the large-scale sequenc- embryonic patterns of gene expression, and in the in- hg of human cardiac cDNA IiI~rarits~~-~'and dernon- creased expression of genes invoived in ceU and organ strated the utility of EST data for studying the genetics defense. of cardiac de~eloprnent.'~in this report, we present In addition to observation of global patterns of gene results from the analysis in out laboratories of an transcription, EST data were used for more detailed additional 38 000 ESTs from six human heart cDNA large-scale monitoring of single gene expression in var- Libraries and compile detailcd expression data for known ious tissues of the cardiovascular system and in different genes of the cardiovascuiar system £rom these and al1 dcvclopmenta1 and pathological States of the heart, other ESTs derived fiom cardiovasdar system-based Cross-cornparisons between cDNA iiiraries identified a cDNA libraries cunentIy in dbEST. Preliminary analysis nurnber of genes that were widely expressed throughout TABLE1. Summary of EST Data TABLE2 Functional Distribution of Known Genes in the Cardiovascular System: Ovendew Fncttonal C8tegoy -=awWY No. of Qmea %ofaems cawmfa? OeneraC 87 1.90 DNA SyntheSwrepRcation 24 0.52 w@-& 28 0.61 cell cVck 73 1.59 Chrwnosoma- 48 1.05 CaWOry total 260 5.68 Hiuang et a1 Genomc-Bascd Resotuce for Caràiovascalar Medicine 4159 TAEU 3, Functtonal Distniuüon of Known Genes in the Cardfovascular System by Ubrary ceu w bond Total Nwnberof Cd CoiSI~naiingiStructurd Orguihm Protein Meta- Numbar Unique Human Cardiomstufar cONA Ubrary MvIdon CommuJcaoon MoMny Odomm Exprodon bobm daasfnsd of Gone$ Qorm Endotheilal celk Shtaqme (Washington Unhiersii 4.89 14.58 6.94 6.a 32.54 16.50 1820 8- 132 (15.m Aorta Fufm(u GEN) 10.87 15.22 4.35 6.52 1522 17.39 30.43 48 8 (17.M) Clontech (Fujiwara, Otsuka GEN) 7.1 1 14.64 11.92 6.90 26.78 15.06 17.36 477 87 (18.24) Heart Atrlum (Gem!lon) 8.76 12.41 17.52 43 21.90 16.06 18.98 137 29 (21.17) Fstal, 8-10 Wk (TarontO) 5.71 t 721 10.33 5.75 26.64 16.89 17.52 2226 748 (33.51) Fetal. 10.12 wk (Toronto) 5.03 14.26 13.93 5.87 27.88 17.62 15.60 596 75 (lm Fetai, 19 wk nomiallred (Soeres. 5.84 18.29 8.99 6.57 24.48 15.83 20.06 2602 1088 (41.74 Washington Uq %tE&M*(Mordeeh.TUCfw 625 6.25 18.75 6.25 25.00 25.00 12.50 16 2 (12.w T'LE4. Relative Levels of Gene Expression in the Cardiovascular System Funcüod Categoy, % CeU CeII Sfgnaüngl Cdl Stmcîud Coiüûrganh Gem/)rrotan Hman Cardiovascaûar cONA Ubnry DivWon Communiclitlon Mofiiity ôdense Expression MetsbaRsm UnclasdfM Endothellal cdk sbataeene(w~~u~3.39 q1.79 8.31 4.38 52.23 11.94 7.98 Aortii Fufiwsra QEN) 1228 22.81 3.51 526 14.W 14.04 28.07 &m& ~WW-.omh GGN) 8.72 14.04 1522 6.06 18.68 27.1 6 10.13 Hm Am(-) 7.41 1298 19.14 4 .32 19.14 20.37 16.67 Genes are listed aiphabetidy within each functionai grouping. A compIete aiphabetid listing of genes with functional asignments may be found in Appendà 1. Accession numbers listed correspond to the putatively idensed gene. In the event that an EST matched to more than one entry, the enûy with the greatcst number of EST hi& was chosen. ESTs matching sigdicantiy to GtnBaak database entries (P cycani Heterochrwnatin protdn p2S High mobiliîy tyupl pmtsln @MG-1) Histane H2AZ Histone H3.3 W (nudsosome assembfy protedn) P21maJsehonidog m-n alpha mtaoricogene- sprndan @ph) CM signairi.ie/communkaron (n4) CelmoduRn -~proteh,GCs3alpha- Integrin beta-tD subunit cytopbmic damaln Rotsln Idnase, cAMP4qmdmt subunit RIkbeb -#nsiçe,-wt-abhasuknir nu-rdatad GTP-bRnding pmtein rapl6 svnexri.r Thyreski -4 Ceil tbuctrirdmataity (n-18) ~ctkr,Ma Actin, gsmma cytoskeietal CaMoiln Uathrln hsavy chah iso@ dpha-1 m Dyndn llOM 1, cytop- Exbacelkdar -pmtain (SI -5) Ffbranectln Mamx Gla pcotsln Myostn kavy chain-B nanmustle [MYHla) Myodn rsgulatow agM chah Mn Çerg(ydn SPARc/osteorrettlli Tmpaqdn, e@ha skeletai musde @TM-alpha) T-bsta- Tukiih, alpha vlmmth Worg~bmdefame (n-8) Complsmbnt mMbfw (CUI F~heevycml Olycoprotelir mucl8 Hm!-Jhack proteln. 9ô-W alpha Hofit shodc cognete protein hscm 71 kD Heat diock prateln, 28 kD Lactoferrh-bokg Supaoxlds (Sbw (Cu/%) OsnelProbdn -(n=48) AddlcrsosanalphaspnopoteInm- AddkW-Pl AeWcrlbasbmdVP2 Amybkiprecusar*P-2~ ca-m@w-E Cyckphah l-dpha r%lq#hnfaebal-beta- EU- EU- Mtlatfon factor41 --firdDI-ldo lsokg ---Al ---Al proteh Hetarogensora nudear nbonudeoprotadn A2181 aoteh Hwang et al Genome-Based Resourn for Catdiovascular Meddnc 4161 Tm7. Highiy Expmssed Genes ln Specific Tissues of the Cardiovascular Systern 4162 CIrcalation Vol % No 12 Dccmdxr 16 1997 TABLE8. DMemntial QeneExpression in Cardiac Hypertrophy ~erissraprasenbsdbyatkiastacl~~~)exprersed~~o~n~oftwat~~~~fr#nhypertro~cardiornyopattiitpatrents~ere IdentiRedPobson~~knmrn,~fareachlFkaryfpCMIOlndlcatesPdssonprobabttityforhypertropNcheanr[braryCTaontaMong Kocig);pcTo)~~probebllÿ~hypertroph-heertm~~or#iaon~thebasbafwdgMedgeriefreqoi#iciesobservedbi~thercatdlac Bkrwlsr(axcepüqnannalirsdabrarks).FOrsigmple,myogkMn~t~edStimesIn34f38ESTsfromromraladultandW heartcONAIl~but wastaggedf tïmes h474ESTstmmtheTaantohypertiiophicheeRçONABbiay.GlvMIthattheexpsctedmkrofobservations~myoglo#nInasat of 474 fSTs b 474%334736)=(X088 EST% the Pdsson proba#aty of abswing 7 or mars ESTs in the hypertrophlc set by chance alone. P(TO)-129~10~.S~,B~~s*arIdnfi*dhlDeDBT.lmnh.T~~~hheMcMUIbnn;M Neumfikomatods type 1 N-typa2 Norrk dbmsa meoe- m=f=w type It Ostsag- bMscta,tYpeRI PolycystlckldnsydbeaseQpet1 Po~clddneydtseesetype2 Prader-WU syndrome Pme-myockn~epllepsy PVrwate-daRdancV RetkroMattwM Splnel musde aîqhy Spinowmbedlar atanh Teuri dlsarus (g- storage dbease Vil) Treachsr cotlhs' syndrMns Tri- phosphate hamerasct detlckncy Tuberws SdBCOSis Tumersydrome Von Hlpped Maudhmse Wemrrsynûrome Wllms hmiot Wlbon's dbeass mott-A#rlch oyndrome xedema pigmentaaim gmup (3 the tissues of the cardiovascular system (Table 6), as wcli hypertrophy and congestive heart faiIure.% Tïtivo sarco- as several gents more restricted in their patterns of menc proteins ako identified as weak candidates have expression (Table 7). Perhaps the most stnking example, bcen weii characterizcd as being involved in the patho- hwever, was secn in the identification of pottntialiy genesis of hpnrophic cardiomyopathy, ic, &rnyosin difFerentially cxprcssed genes in hypertrophic cardiomy- heavy chah and cardiac troponin T.- opathy using multiple-tissue in silico Northem anW. In addition to the genes previously hown to be In this approach, expression frequencies of individual involved in cardiac hypertrophy, this approach &O genes in the normal heart were estimated from the suggests severai new genes to be dinerentiaiiy rtgulated number of ESCs matching to those genes in normal in hypertrophy. A numbcr of these were invobed in hcart cDNA librarics. Expcctcd frequencies of gene energy or high-entrgy phosphate mctabolism (myogio- expresdon in the hypertrophic hart were calctdated on bin, mitochondrial genome tramcripts, muxle and mi- the basis of observed gene frcquencics in the normal tochondrid isoforms of crcatine kinase, pymte dehy- cardiac Iibraries. Statistidy signifiant deviations hm dmgenase a-subunit, NADH de hydrogenase subunit expcaed hquency values identified potentiaily mer- ND2, cytocbrorne c oxidase subunit WIc, and ATEhse entiaiiy exprcssed genes. couphg factor 6 subunit), which might be antitipated, To idcntify gents ~erentiallyexpresscd in cardiac &en known alterations in substrate delivery and cnergy hypertrophy, a snaü sample of ESTs was gcnerated metaboiism in the hypertrophied heart. Severai others hm each of mm independent hypearophic hart CDNA were hoIved m protein synthesis (nisomal protein Iibraries (1089 EST' and 474 EST'S, respmhb see S28) or in regdating protein turnover, either in the Table 1). To minhhc the effects of stochastic donc intraœilular (a-- ubiquitin, 26S proteosorne amplification mnts during cDNA Ii'brary construction subunit p31) or the extraceiiutar (thrombin mhtbitor, and of m gene atpression Icveis betwecn tissue inhibitor of metailoprotcinase-3) compartments. individu& only genes teprtsentcd by at teast one EST Atthough the= is no direct evidence m the literaturc for in both hypcrtropbic iiirarics werc selected. PotentIsUy difkrcntiai regdation of these specific genes, thyroxhe- diffemtiaiiy expresscd gencs were groupcd mto thrce induced hypertrophy was found to mcrease rates of categories based on Poisson pmbabitin'cs, as descnied protein synthesis and protein degradation in rabbit above (Table 8). At least IO gcnes idenaed in this and the rernodeiing of the cardiac interstitium maimer as either strong candidates or potentiai candi- durhg hypertrophy is weli documented, suggesting a dates for diakrcntially expresscd gens have previoudy possible role for these and other related genes in such ken demonstratcd to be elevated or invoived in cardiac processes, Also of some interest was the identification of - hyperimphy, including auial nafriuretic factor,- brain prostaglandin D synthases as strong candidates for dif- natriuretic factorBa myosin iight cham-%a ferentiai expression. Given that prostaglandin D2 has heat shock protein 70,* supemxide dism~tse,*~a- betn shown to have positive inotropic effects on rodent cardiac ada and ~-tropomyosin,~Fur- h# and that prostagiandin F2 but not pfostagian- ther, the ADPIATP translocator, identified as a wtak din D2 mduccs candiomyocyte hypertrophy and cardiac candidate, is hmto be activated in severe cardiac mdOfurthet Mvestigatioa into whether differential Hwang et al Genome-Bascd Resowce for Cardiovascdar Mtdfcine 4165 regdation of these and other prostagiandin synthases is sented in the cardioYaSCUIar EST data set (Table 9), the occurring and into what role these may play in cardiac implication king that a substantiai number of currentIy hgpcrtrophymulmmiaitnreapptarstab~ ~~gtntsar~~iikciytokrtprwen~ Despite the preliminary nature of these data, the fact within the data set. Large-sale mapping of ESTs to their that a large number of genes identifid as candidates for chromosorna1 should wrpeditt the search for novel differential expression by the in silia method corre- disease genes by positionai candidate approache~~'~in spond to genes amknom to be differentially ex- which ESTs rnapping to a known discase locus serve as prtssed suggests that a combined Poisson probability candidate genes for bat disorder. Compilation of map cutoff of P<.OS is appropriate for screening and that this data for cardiovascular ESTs (Fig î, Appendix 2) sbodd method holds tremcndous potential for genome-wide ultimately allow for correlation of expression data with searching for novel gens invohed in cardiovascular map location and enhance the usehilness of this re- disorders such as cardiac hyprtrophy and heart failtue, source for the identification of gents -ated with even with rclativeb small EST data sets (1089 ESTs and cardiovascular disease susceptiiility loci. 474 ESTs in the two hypertrophie Libraries). Neverthe- less, increased numbers of ESTs hmboth normal and Future Directions diseased tissues wodd undoubtedly increase the sensi- Exploitation of the wealth of information generated tivity of this approach, espleciaily for tranxripts nomally by genome research holds exciting prospects for the wçprtssed at very Iow lmls and for dettction of tram field of cardiovascular science. Although an extensive scripts that might be underexpressed in disease. It database of human cardiac ESTs is rapidly being should also be noted that the aaafyses prestnted here cornpiled, EST3 from otber human cardiovascular included only ES'S with known gene matches. Extension tissues or ceU types or from diseased specimens of this strategy to ESTs without knom gent matches rcmain relatively limited. Moreover, cardiovascular presents more of a challenge because, in the absence of EST data from most other mode1 organisms widely full-length gcne sequences, it is not always apparent used for cardiovascular research (eg, rat, mouse, whether two ESTs represent two dXercnt genes or chicken, ftog, zebrafish) are almost nonexistent. Con- nonoverlapping segments of the same gent. tinued generation of ESTs fiom such specimens, Progress toward the tagging and eventual sequencing coupled with application of other strategies such as of the entire set of human gencs suggests that other serial analysis of gene expression and dincrential similar gcnome-based methods such as senai anaiysis of hybridization, is thcrefore essentid. gene expressionb1@or dinerential hybridization of ar- At the same tirne, as increasing numbers of genes are raycd &NA c10n~~will becorne incrcasingly infor- identifie& incrtasing emphasis needs to be placed on mative and powcrful for such analyses in coming years. functionai analysis of newly discovered genes in the However, the observation that 12% of cardiovascular cardiovascuiar system and on developing strategies to ESTs do not match to any known sequences suggtsts miurimi2e extraction of usefbl information £rom thclarge that a signifhnt proportion of human genes rnay remain body of raw data currently available. The constmction untagged despite the large number of ESTs currentiy of cardiwascular gene databases at Merent stages of availabk and hence that EST generation will continue to development and pathology, coupled with htegration of play a kcy rolc in large-scale gene discovery and expres- information gleaned hmlarge-scale mapping, expres- sion snidies. sion, and functional analyses, will establish an invaluable The utility of EST information for the identification of resoutct for future genetic studics of cardiovascular novel gents invohred in disease was further demon- function and cast light on the cornplex genetic mecha- strated by the number of known disease genes for both nisms underIying disease, dcvcloprnent, and evolution of cardidar and noncardiovascular disorders repre- the cardiovascular system. Huang et al GenorneBased Rcsoarcc for Cardimscrüar Medicine 4167 APwcwrl. Cortünud Hwang et ol GenomeBased Resource tor Cardiovascular Medicine 4169 AppplW 2h ATP~.p1-Iidog ATPIADP cuilr pro(dn m ATPIADP carbr patdl (nt-2)homdog m ATPIADP cnkr potah honiokg 8 ATPIAOP BI ATPIADP tnnJocrw luxnobg m ATPIMP maoutor. musde 6l ATP~G~MW~QWn WW prtithn 61 AiPahQno-~protdnCABC1) a ATPbamng-protsino €a 68 ATp- w ATP- (Fl-AThW rlph. nJtodiocrdhl W ATP-rynthiucsiknltmltob#nQWQ1~~handoO 6d ~~~Fo~danJnftu~bdog6d ATPynthwoomplaFo~krmbomirkignibunltboloe 6d ATPynth.iirdsubwk-~ w ATP-sywmae gamma lukinlt W AnJ-~~-horokO Bd Aw-protshbdog w ~r~ynaiiw~a.~ 6d ATPyn(hii8ubtdtePlfam) W AtP-rynthiisiuknlt~(pz~) w F1m dilh-nibunit w ATP~bet83UksJI w AmW.paai--hdog W ATP synmmo, H(+) rubm R 6d ~~oup&i0hetor6iubrrnn.~(ATPSA)- w AWhomdoq 6d A--proWnbolog Ti Ci pumphg, mar&ma eMCA48) a ATPII.. WIQ) (il AfPisr,cJdumpurghg.~- 61 ~~eJcfum.dunM-~~rnradriwloO a A~coepr~ I ATP#,~bu\rqar(lig~tYP. BI AmFI-FO Mknn* bobo 6d ATPlu.prot#svwudrEm 61 ~~~~.pom~vrudr1WIW000arbunlt~ BI A~potoii.vwoCrM~7ocmurkrrdtgdog m AfPiypat4Mnntpobmdunil~knlt BI ATPiR,pmton.vœudœaikinttD el ATPno,poaon.--D~obO Bi ATpii.,poton*-ruk*ilt~ a ATpIwpmtonvwudrVl~.Pibviltc a ATPirs.~Jph-bdoO 111 ~1Pi#.protor4Ohiaimgirti.rc BI A'Tpii..piitithnhomdoO ed AfPIiS--l- (il ATP.... wœ-2 (ilPmhanoioO BI A~~~3crtdytlt~iiokg- BI ATPI#icdbnSpduhmrlpnr-3- BI ATpIi.,#QurJpotirlun~lrukrnlt a Am--- 61 A~-~-~oO 81 A1pII..- a A- A- prolh W+) BI mw~ticlor 2d mynmiursticp.ptia~ M .(ropNR+- 7. ~l-potdn(rm~ 7. AUH 6f UhandoO L 71 urornao*r-.~~ 7. - 78 ua3ntrgnw 8utmntmprlcribid-1(pcM-11 7i -myroid-- 78 misdo0 5bZ gcnltrnipabrdw-m 3. uaiJOnrpoibadm-handDg 38 7. ' 71 &cd-pdah 78 &iPi.aptol-pmbbi(BAq~9isdoO 1. scJl~aOdit.dpm(dn(BAq~bdag 4c Balmcm=-pdJnQiBAq 4c Bcdm=fJ---BhandbO 2h Bcdr&spta~-eiiDtam M 5J 7. "-812 pro(dn homobg 78 82- rsapPr a -2 pnih 7i Hwang et al Genomc-Based Resourct for Canliovascdar Meàidne 4171 A~moa1. Conttnued Codt RiWnly-O«n Codr ehnnd.lkehteafdmmkuwpiotdnIAOP-1)--- -bdaO 3c 4172 Ciradation Vol % No 2 2 kember l6j 1997 Hwang et ai Cenome-Based Resorvcc for Cudovascular Medicine 4173 APPI?NDIX t. Contlnueâ Hwang a al Genome-Based Rcsource for Caràiovascuiar Medicine 4175 APPEN~~~.Continuad 4178 Circulation Vol 96 No 12 Decentber 16 1997 Hwong et al Genome-Bad Resource for Cardlovascular Medicine 4181 Hwang et al Genome-Based Resome for Cardlovaseular Medicine 4183 Hwang a al Genome-Based Resotme for Cardfovascular Medicine 4185 APPENWC~. Contlmied Hwong et al Cenome-Based Resonrte for Cardiovascular Meàicine 4187 Hwong n al Genorne-Bad Resonrce for Caràiovascular hiecilcint 4189 a 20 29 20 zo2Q zo to 2!J 2!J 90 29 4b3 Ob3 2c %3 7. 7r 2. 20 2e 20 20 2, 6h g. Ba 53 sa3 m 6h 78 5a2 2h Sbt Sb1 5bl Sb1 Sb1 Sb1 5bl 5bl 5bl Sb1 5bl 20 2, 2. 2. 2. a Ti 78 7i 71 lb 2. 3c 3c 3e k3 7r 7r 7. Ir 59 92 582 7r 7r 2. 2. 78 7i 59 59 fi 7i 7r 7i 7. 3c 78 fi 4190 Circulation Vol 96 No 12 Decunbet 16 1997 Hwang et al Genome-Bssed Re.source for CardiovBrmlLv Medicine 4191 Hwang et al Genome-Based &source for Cardiovascular Medicine 4193 APPEHD# 2 Summary of Accession Numbata for Mappd Eitprsesed Seqwnce Tegs (Esrs), Togeümr Hnth the Locus ldantffkr for the Camsponding Meor EST Match and Chromosornai Locus Loew IdsnWier EST Accamion No. Matth Mau Location Locus ldentffier ESTAtca+don No. Match Mao Location 14 EST Gens 5426383 EST GeMI 55ô2270 EST GeM 5587907 EST Geme 5589482 EST Gens 87370921 EST Gene Ob* Gene GeMt 140 EST Gme 14-3-3 EST Gene 3pK EST Geno A001708 ESF Gens mC37 EST Gm ArnR23 EST Gene A006E 1 9 EST Gens A006F37 EST Gene A008H23 EST Gene A006J31 EST Gm A2M Gme Gme AA089958 EST Gsne AA090010 EST Gene -1 42 EST Gene AA090839 EST Gene AA090909 Est Gene AA090950 EST Gm AAû91481 m c3em AA093067 EST Geiw AA093341 EST Gerre AAu93511 EST Gene AAû93048 EST Gerte AA084148 EST Gens Mû94658 EST Geme -1 2 EST Gale AAmss!j EST Gene AA095911 EST Gene -15 EST Osne AAm6448 EST Gane &A247551 EST Gane AA263115 EST Gefle AACf Gane Gme ACAA &ne Gene ACADM Gan8 Gene ACTA3 Gene Gsne Am Gene Gecie ACTG2 Gane Gm actMn Oene Gene ml Gene Gene Am Gem, Gene -Hl Gsn, Gane ADHS Gene me AFM196xal EST Gefle AmM34tm €sr Gernr ARMs6ww EST Gene EST Gene -AFP Gane Gane AGL Gene G0im AGT Oene Gene cm1 Gem EST cw4 Gcffie €sr a36 Gene EST Co44 Gens €sr CD58 Gene EST Co9 Gene EST ccmbfll EST EST EST EST Hwang et al Genome-Bad Resoarce for Caràiovascular Meàidne 4195 CdRmea? EST 00S9013E EST Maloh04 Gene DOS3021E EST Cdal ad12 Gsrie ûûS9029E EST Cdal SM7 GeM, DlûSlM EST Cdal Sm Gene Dl3SSO8E EST Cdal7fl O Gene 013s65tE EST Cdalchll Gene D14S98E ES Câalfaû5 Gm D2Sl84E EST -1idoe Gene D5S211 EST Cdatpcl2 Gene DAP-1 Gene CDK4 Gala dbUacbp Gene COR1 Gene OBT Gene cfb Gene OEFl Gene CHIP28 Gene dek Gene cm Gens deha Gene CM Oens dGK Gens CL Getle DUT Gene COLIA1 Gens DMD Gene COLIA2 Geno OMO Gene COLZA1 Gene DOC-2 Gene CO13Al Gene DP1 Gene Cûi4At Gene OR1 Gans COLM Gene ORAL Gm COLSA2 Gene ER1 Gefle WX7A2 Gefle E-cadheiin Osne coxa Gene €14 Gene CPE Gens €2 Gene CRYA2 Gene EAP Gane CST3 Gene EDDRl Gerle CTCF Gene EDHl7B2 Gene ms Gem EDN 1 Gene CfÇB Gemt EONRA Gene CW-1 Gtrns EDNRB Gene CyP3 Gsne EEAl Gefle mP51 Gene EEFlA Gens WS1SO1 E EST EEFlB3 Oene WS2539E ES EHHADH Gene mil 6E EST eIF-26 Gene ûOS2ô27E EST EP6 Gsne DOS8532E EST EPOR Gane Dos3MaE EST ERCC3 Gene M)S8658E EST ERG9 Gene M1S8716E EST ER= Gene WS8728E EST ESf1 O9538 EST WS8146E EST EST114025 EST DQSB777E EST EST116348 EST OQS8794E EST ES118931 EST -1 4E EST ESn27954 EST ms592 EST GmHm dene EsTl64488 Esr mm Gene ESTlf0379 EST G03MT3ST aem ES'l7446 EST gem Gena Im22!5?02 EST GFAP Gene EST231253 f ST GIA4 Gene EST GKPZ Gm --Esm2508 EST GLBl Gene mMOB1 EST GLU01 Gene ESf30T064 EST GMZA Gm Esm8409 EST GW1 Gene -14 EST GNAL Gefle Esm4smo EST GP36B Gene Sm48393 EST GPX-P Gens ESf349440 EST Glu-1 Gene Esn!Ms? EST GRL 4196 Circulation Vol 96 No 12 December 26 1997 -- Locurld.n~~& ESTAcœssknNa MM Map Location Locw IdmüfW ESTAccssslon Na Match Map Cocaaon EST361848 US7265 EST GRP78 Gene Esl3m2W NB7958 EST GSTMl b Gerie EST373741 AA090682 EST GSTM4 Gene Eçi375078 A57063 EST GSrPl Gene EST389670 AAD95205 EST MRK1 Gene EST393291 Mo93480 EST hag Gene EST406019 AAû93û61 EST H-plk Gene ESf4M73 NB? 191 EST H- RYK Gene EST47735 N56334 ES H-LUCA1 S. 1 Gene ES1480 15 AAû92467 EST H-N79E2.1 Gene ESl5û791 AA093012 EST HAP1 Osne EST64628 N55694 EST hW GWn ESTR5244 Ml 5901 EST HE0 Oene m MO94264 me HBNF-1 Gene €'A20 N87ï64 Gene hCOClO Gene F2R AA090540 Gena Hcox6b Gsne Fm -17 Gene hCyP40 Gene FM &Io09644 Gane HO Gale f st FI58184 Gene HDC Gens fsm man Gene hdut Gene FGG R5aslS Gefle HEB Gene FHL-1 -9657 Gm HEK11 Geme FKSOg Na8739 Gene HEPCOP Gene ni-1 ml0631 Gens hFat Gene FPRP NB3258 me HûBE Gone a08111 AM47446 EST Gene 010686 Mû96298 EST hHT Gene QlOP1 PA249243 Gene HIF-1 Gamt 015936 AAû91787 EST hinge Gene 022P1 AA090QJ9 Oens HLRA Gens G26516 N87247 ES HU-B27W Gêne 09a Ml673 Gene HLA-C Gena WT AM48195 Gsris HU-DFe1 Gene GAP AA090263 Gena HIA-ORB3 Gem GART -781 Gene hl14 Gene GAS3 N85922 Gefle HLTF Gene GATAûSB08 AA090785 EST HMû-2 Gem, G8P-1 A.283171 Gens HMP Gem GBP-2 AN83171 Oene hMSH6 Gsns GC AAD92309 Gene HNRPA261 Gem hP311 Ml 184 Osne IEF Geri4 HPBRll-4 AA249263 Geme IFNAR Oene hP' AA210671 Gene IGFl Gene hR-PTPu N83471 me IGFBP-3 GelTe HRHl AAa91111 Gene IGFBPS Gene tiRPSSa N84stT Gene K Gene HRS R58011 Gme lltR Gens Hs-cuC1IA Ml 94 Gene IL6 Geule HSCOlHOg2 AAOg9688 Gens INSR Gan8 HSCOZH112 AA093407 Gene IQGAP1 Gene HSCWCl@ N85187 Gans RF1 Gefle HSCOfW72 AA093090 Gem ïïGBl Oene HSC068082 AAo91423 Germ m-1 Gene HsCOfB042 -1 3 Oene JUN OeM, HSC098012 AA090894 Gens KIAA0004 Oene HscoeHOE2 AA092145 Oene KlAAOOOS Gene HSCOCK182 L48824 Gene KIAAMK)B Gefle HSCOOA042 N55843 Gem KIAAMn4 Gene HSCûûE112 lu03557 Gene KIAA0032 Gene HsunBOg2 AA090750 Oene KfAA0033 Gella Hscorn AAlû4û3û Gene KIAAM#8 Gernr HSCûLE122 AM91559 Gene -9 Gene HSCOMFla2 l.49063 Gene KWun63 Gene HSCONAM# NW77 Gens KMAa068 Gene Hwong et al Cenome-Based Resource for Cardiovascular Medicine 4197 HSCûûH042 Geno KIAA0080 Gena HSCûüB102 Gene KIAA0086 Gene HÇCOVH122 G~MI K1AA0092 Gene HSllSR2 Gene K1AA009r, Gene HSPB1 Gene KIAA0096 Gene HTP-aipha G%ne KIM0097 Geme hoa-2 Gene KlAAOlOO Gene HUM Gene KIAAOlO1 Gene Humdp2 Gene W117 Gem HUMM3 Getle Wl26 Gene HUMSWS370 Gene Ml27 Gene HUMM1Oô1 Gene KlAAOt 37 Gene HUMSWX1095 Gene KlAAO152 Gene HUMSWX2012 Gens KtAA(3157 Gemr HUMSWX2788 Gene Wl58 Gene HUMSWX3041 Gene KIAAOl 60 Gene HUMSWXBn Gent Ml 71 Gene HUMSWX828 Gene Wlô3 Gene HUMUT809 Gala KIAA0201 &ne HMCAO Ocm, KIAA0203 Gene hWRS Gefle KtAA0206 Gem HXB Gene Km15 Gene HZF10 Gene KIAA0242 GeneJ m4 Gem, K1AA0243 Garm HtFB Gent3 KIAA0249 Gene 101 191 ES7 KIAAM65 Gerle 181457 EST KMAû281 Gme 183282 Es' K1AA098 G~M, 1635u3 EST Kn Gene 1853 EST WTTGE Gene ml Gefle L38608 EST 10s Gme La92 EST L8 Gens Nô4732 EST LAMB1 Gene N85167 EST LAME2 Gene Na5671 EST iaminin Gane N86003 EST LAPIS Gelte N-7 EST WR Gene Na6062 EST LDHB Gerio Nam70 EST UPA Osnri Nm68 EST US1 Gene N86223 EST LOX Gene NB6960 EST LUCAI 5 Geru3 NB6895 EST Ly-GD1 Oene N874 14 EST MG3987 EST Nô9365 EST MACS Gene NA81 Gene MAGE9 Gene NACP Gene MAPlB Gemt NAP Gerie MAP4 Gsrie NCAM Gem MAZ Gene NU Gene Mm Gens NCXf Gene MCC Gene MpS2 Gene MCP Gene NET1 Gene MOHA Gene NF-= Gene me@ Gens NF-kappal-B Gene MGP Oc##r NI61417 EST - MC2 Gene NIB1540 EST migs Gene NI61562 EST MlHB Ger# NI61568 EST MW-1 Gene NI81830 EST MLC Gene NIBlû9û EST MLN Gene Mm778 EST MLN Gens NBî199 EST Mog Gemt Ni8237 ESr MSH2 G8ne ddogen Gene mVIsp75 Gerwt NKEFA Gsne ml Ger# NKG2-8 Gefle WC Gene NKG2-C Gene ml O Gsns NMB Gelle MYH7 Gefle NOTCH4 Gene MVHT Gene NPY Gene Mn1 GeiM NT5 Gene ml Gene OCRl Gene MYK Gene ad Gene Mn3 Ottne osf-2 Gene N-myc Gem osf-4 Gm N2A38 Oene oxcr Gene N55934 EST OZF GtMs N56020 EST Pl Gene NE6078 EST Plcdc47 Gene N56088 ES p62 Gene NS6l4S EST P@ Gene N56224 EST P78 Gene N56331 EST PACE4 Gene N56359 EST PCCA Geme NW03 EST PCC8 Geme Na3757 EST PDEA &me N83T19 EST PDG- Getne Gene nn Oene PDK3 Gene RET Gene PEA-15 Gene RFG Gene PM Gene RFW me PGAM2 Gtme RH1 lf4 EST POAM2 Gem RH1200 EST mm Gene RH1206 ES PGK1 Oens RH1213 EST PH109 Oens RH1218 EST PHKA en0 RH1283 EST PHP32 Gsne RH1331 çsr PlPK Gene RH1379 EST pki*d Gene Rh50 Gme PLB Gsns RH1941 EST PLCE4 Gm RH8501 EST PLGL Gemr RHWO EST PlP Gene RHB912 EST PMPl Gens RH9025 EST PMS2 Gene RH9065 EST POU3F4 Gem RH9107 EST Pm Gene RH9282 Es' Pm Gene m12 Gens PPP3CA Gene mp24 Gemr PRKAR2A OeM, rwl Gens ma Gene RP-LlO Gene PRKCL Gwe RP-L9-1 Gem, Pm-1 Gerle a11 Ge# pros-30 Gene RPLl 0 Gene Pr? Gens RPL27 Gem, 601 Gens RPL3 Gme PSGô. Gerwr rp130 Gene PSMC2 Gene RPL32 Gene m Gale W7A Gene m Gene RPLQ Gene PrPNl2 Gens RPLG Gene Pm Gene RPi7A Cime QM Gelle RPS3 Gene RSf380 EST RPç14 Gene Rs79!3 EST RPSl6 Gene EST Rm7 Gene EST RPS21 Geoe EST M4 Gene EST WS25 Gene Gene RPS26 Gene Gem RPS3 Gene Gent3 m4x Gene Gane RPSG Gene Gene w7 Gene Grne rpss Gene Gene RR2 Gene Gens Gme Gene S311125 Gene Gens SCAl Gme Gecie SM-1 beta Gme Gans SCN6 Gene Gbne =A7 Gene Gens SHGC-1578û EST Gm SHGC-15814 EST G~MI SHGC-15881 EST Gene SHGC-15893 EST Oene SHGC-15896 EST EST SHGC-15925 EST EST SHGC-15932 EST EST SH-15955 EST EST SHGC-16799 EST ES SHGG1699û EST EST SHGGl7 1% EST EST SHGC-9963 EST EST SlahBP1 Gene EST SIL Gene EST Skpl Gene EST SLBP Gem EST SLC1 BA1 Gone EST SM22 Gene EST SNmm Gene EST SNRPN Gene EST SM Gens EST soma Gene EST SPARC Gene EST !Pm Gefle EST SPPI Gene EST SPrSNl Oene EST SRû5Al Gene EST SRE-ZBP Gene EST SRW Gena EST Sm Gene EST WR Gene EST Sm Gene EST SSAl Gene EST sa Gene EST SSm Getne EST stomaln Gme ES7 SrSGloa04 EST EST sTSû-lQ283 EST EST ml 0285 EST EST SrSGl0309 EST EST STSû-10497 EST EST SlSû-9965 EST EST SUPT4H Gene EST SWSS1285 EST EST SWSS2039 EST EST SWSS3221 EST EST Tl1820 EST EST Tl9524 EST 4200 Circdation Vol 96 No 12 Decembcr 16,1997 SHûC-14882 Tl 9640 EST SOC-14694 nwn EST SHGC-14653 132962 EST SHOC-15173 T33554 EST SHOC-15194 Tm155 Gene !3HGGls225 fAP Geme SHGû-1 5399 Tm Gene SHûC-15744 TE2 Gene TCF'l W-11570 EST TCRBM4Sl Wi-11593 EST m WI-11603 EST mm Wb11680 EST TFilD Wb1 1753 EST ml WI-11760 EST mc WI-11793 EST tgf-beta WI-11845 EST ter-a WI-19864 EST THBD WI-11889 EST THasl Wb11921 EST THS2 WI- 11 929 EST Win WI-11937 EST TKT Wb11 947 EST TM1 w-t 2093 EST MD WI-12099 EST TMPO WI-12191 EST TOP1 WI-12207 EST TOP2 WI-12381 EST tom WI-InSI EST TPA WI-12392 EST FM2 WI-12412 EST Wl WI-12414 €Sr TRAPZ Wl-12457 EST TREBS Wi-12482 EST TRlPl Wb12497 EST TRN WI-12591 EST TUBA1 WI-12711 EST TüBB Wb12839 EST TYMS Wl- 12953 EST rYRPl Wl-12968 EST undm Wl-12999 EST U32519 WC13077 EST uw W-13085 EST UbABO WI-13136 EST UBEZH Wb13331 EST U8E21 WI-13351 ESf ut0 WI-13421 EST UHG WI-13462 EST unph W-13468 EST mm WI-13471 EST uTFw804 WI-13548 EST uma68 Wl-136l3 EST va. w-lm9 EST VDAC Wl-13652 EST vHjF Wl-13654 EST VEGF-6 wl-13m EST wu WI-136T4 EST VWF WI-13694 EST W11015 WI-13804 mr wt-11267 WI-13811 EST WI-f 1277 Wb13857 EST WI-11428 Wb1408 EST W1-11452 WI-1411 EST 1M-11480 Wl-14135 EST WllSSO Wl-141% Hwang et d Genome-Based Resource for CarùiovascuJar Medicine 4201 EST EST EST EST EST EST EST EST EST EST EST ES EST EST EST EST ESf EST EST EST €sr EST EST EST EST EST EST EST EST EST EST ES EST EST EST EST EST EST EST EST EST EST EST EST ES7 EST EST EST EST EST EST EST EST EST ES7 EST EST EST EST EST EST EST EST EST EST EST EST EST EST EST EST ESy EST EST EST EST EST EST EST EST EST EST EST EST EST EST €sr EST EST EST EST EST EST EsF EST EST EST EST EST EST EST ES7 EST EST EST EST EST EST EST EST EST EST EST EST EST €sr €sr EST sr 4202 CtrcaIation Vol 96, No 12 Decemba 16 1997 IO. Mably JD, Licw CC. Fadon imrotvcd in cardiogtnesis and the rtgulation of cadac-spe&c genc ucpression Cin: Ru. 19%; 79s-S. €sT 11. Liew CC A human hem cDNA library.. the deetopment of an and DNA EST cfscicnt simple method for automatcd scqueacing. JMd Ce# Centid. 1993;25:891-894. EST 12 Liew CC, HmgDM, Fuog YW,Laureasen C,Cukerman E, Tnti EST S. Lcc W.A catalogue of gaies in the cardio~scularsystem as EST identificd by atprrsscd scqueoce tags (ESTs). PmNat1 Arad Su EST USA. I994;91:10645-10649. EST 13. Hwang DM, Hwang WS, Licw CC Single pas scquenang of a ES7 unidirectional human fttai htart &NA library to discover nwcl gena of the cardi- systern. J Mol Gii Cmibl. 199rl.26: EST 1329-1333. EST 14. Hwang DM. Fung YW, Wang RX, Lauremen CM, Ng SH, Lam EST W.Tsui KW. Fuag KP, Wayc M, Lee Ci', Litw CC Aaalysis of EST cxpresicd sequcnce tagr From a fetai human htart cDNA Li'brary. EST GQUI~.1995;30.SJX298. EST 15. Adsms MD, KdcyJM, ûocayoc JD, Dubnick M,Poiymempoulos MH, Xiao H, MdCR, Wu k Olde B, Moreno RF, Ktrlavage EST AR, McCombic WR Venter JC. Complementary DNA ESF ~qutncing:urprrsscd sequena tags and tke Hwnan Genome Proj- EST ect. Sàencc. 1991;2521651-1626. EST 16. Adatru MD, Dubnick M, Kerla~geAR, Moreno R, Keiicy KT, EST Utterback TR, Nage JW, Fields Ç Venter JC Sequenec idencifi- EST cation of 2,375 human braio gencs. Nam. 1992;355:632-634. Adairu MD, AR, Fields Ç JC 3,400 Est 17. Kerlavage Venter new arprrsscd sequtacc tags identify a divcrsity of mmxipts in buman EST b& Na Gare. 1993;4.356-267. EST 18. Adams MD, Soares MB, Kerlavage AR, Fields C,Venter JC. Rapid =-ST cDNA xquencing (uprcssed sequena tags) from a dinaionalfy Gan0 cloned tuman infant brain &NA hicary. Nat Gmt. 1993;4: Geno 3-380. Adams AR, RA, EST 19. MD, Kerlavage ïieischmann RD, Fuldner Bult U,Let NH, Kirkncss EF, WeiastocL KG, Gocayne JD, White O, cbm Sutton G, Blake 14 Brandon RC auMW, Clayton RA, aioc Gcns RT, Cotton MD, Esrtc-Hughes J. Fme LD, FitzGerald LM. Gens FirrHugh WM, Fritchman Ji, Gcoghageri NSM,Glodek A, Gnehm Gene CL Hanna MC, Hcdblom E, HUilde PS Jr, KeUey M,Kilmek KM. asris WIey JC, Liu Li, Mannaras SM, Memck JM, Morco~Paiaaqucs RF, McDanald LA, Nguyto DT, Pekgrino SM, PhÏiiipr CA,Rydet SE, Scott JL Suudek DM, Shirley R, Srnail KV, Spriggi TA Uttcrùack TR Weidmaa IF, Li Y,Barthlow R Bednarüc DP, Cao Acknowledgments L Cepcda MA, Colcmaa TA, Cab EJ, Dimlre D, Fmg P, Farie The Cardiac Gene Unit was estabiished in memory of Nigel A, Fuchcr C Hastings GA, He WW, Hu JS, Huddlcston KA, M.S. Martin. This work was supportcd by The Canadian Greene JM, Gnibcr J, Hudson P. Kim 4 Kozak DL,Kunscb C. fi Genome Analpis and Tcchnology Program, The Medical H, ti H, MUsicr PS, Okn H, Raymond L Wei YF, Wiq J, Xu Rescarch Couacil of Canada, The Heart and Stmke Founda- Ç Yu GL Ruben SM, Düîon Pl, Fannon MR, Rostn CA, Hafcltine WA, Fidh C, Fraser CM, Venter JC Initial assument tion of Ontario, Spectral Diagnostics, Inç, and the Research of human genc divmity and expression pattern bascd upon 83 Gran6 Coud of Hong Kong (CUHK 418/95M, CUHK mgion nudeotida of &NA xquena Nam. 199937ï(ntppl): 205#6M). D.M.H. is a rtcipient of a Mcdicai Research Councii 3- 174. of Canada Studentship. M.R. is a ncipicnt of a Heart and Stmke Foundation of Ontario Trainceship. KSD. is a recip- ient of a University of Toronto Graduate Studies Award for International Studcnoi. S.K.W.T. is a rccipient of a Postdoc- tom1 Feilowsbip from the Chimese University of Hong Kong. References Hw~get al GuiaxnaBaseà Remarce for CardiovascuJat Mediciad 4203 26. Murakawa Y iikmh Y FUuhha A, Ywhü 1, Ohbo K 51. Villarrtai FJ, Lee AA, Diümann WH, Giordano FJ. Adeaovinu- Chtommal assigmcnt of 3'-dirtaed partial cDNA scqucnces mediated overupressioa of human transforming growth rqmmbg nmlpcs cxprnrrà fn grarm1ocymtd col&. tactor-ùcai f&rat cd%cnbrobihs& myocytes andmaotii de Galom&Y. 1=1994;23:379-389. œüs. J Md Ccll Cordid. 1996;28:735-742. 27. Ohbo K. Hori N, Matoba R, Nriyama T, Fuhdha4 Kcjtna Y, 52. Thierklda L, Watkins Ei, MacRae C, Lamas R MdCtnns W, Matsubara K. Large scaie cDNA queocing for adysis of quan- Vosberg HP, Seidanan JG, Seidman CE. Alpha-tropomyosin and titative and qualitative a~pec~of geoe arpcd011 Na Gcnrt. 1% catdiac troponin T mutations cause familial hyputrophic cardio- 2173-179. myapathy: a discase of the sarcome=. Cefi. 1994;7f.701-712. 28. Pawlak A, Toussaint C, Lcvy X, MeF, Poyaxd M, Barouki R, 53. Watkins H, MdCenna WS, 'fZuerfelder L, Suk HJ, Anan R, Gueiiatn O. (3haradentiitian of iqepopulation of mRNAs from O'Doooghue 4 Spirito P, Matnunori A, Moravec CS, Seidman JG, humtatir MU.1995;26:151-158. Seidman CE. Mutations in the ncna for cardiac trownin T and 29. Schrami P, Shipman R Colombi M. Ludwig CU. Idairification of gmes difkrcntislly expresscd in normal iung and non-smafi cen lwy~Caranomr Che. Conea Rrt. 1994;545236-5240. 54. Zhu YC, Zhu YZ Spimagel H, Go& P, Unger T. Substrate 30. Sudo K,, China K. Nairamura Y. 2ûS8 qnssed scqucncc tags meiaboüsm. hormone interaction, and angiotcnsui-convuting (ESïs) hm a human fetal lung &NA iibray. Genomiu. 199424: uuyme inhibiton in Idt vcntn'cular hypemophy. Diabeta. 1996; 276-279. 45s9465. 31. TMJ, Yano H, Eng S, Zcng Y, Bciî GL A molmilat invuitory 55. Tanigawa G, Jarcho JA, Kas S, Solomon SD, Vosberg HP, of human pancrcatic idem scqucacc anaiysh of 1OOO &NA doncs. Seibnan JG, Seidmm CE. A molecular basis for fadial hypcr- Hum Md Gwt, 1~~1793-1798, trophic cafdiomyapatby. an dphalbeta cardiac myosin hcavy chnin 32 Tanaka T, Ogiwara A, Uchiyama I, Talcagi T, Yual0 Y, Naluimura hybrid guie, Cd. 19W62991-998. Y. Construction of a normalired dirrctionally cioned cDNA libray 56. Geisterfer-Lawraace AA, Kau S, Tanigawa G, Vosberg HP, from acittit hemand analysis of 3Mû danu by partiai scqueacing. McKcnna W, Seidmm CE Seidman JG. A molecular basis for -. 1996aZ1-235. familid hyputrophic domyopathy a beta cardiac myosin heavy 33. Watson MA, Fleming TP. IsaIation of diffcrcntiaiiy expresscd chah @ne mi9eiue mutation. Cd. 1990;62999-1006. sequericc tag fmm human brrast caoccr. Coneu &. WS: 57. (aleman PS, Parmaak MS, Lesch M, Samare1 AM. Rotein syn- 4598-4602. thesis and degradation during rcgrtlsion of thymcine-induced 34. Chomaynski P. Sacchi N. Sindestep mcrhod of RNA isolation by dachypcrtrophy. f Md Cd Cordid. 1989;21:9lI-9Z. acid guanidinium thioeyanate-phenolchloraformextradon. Anol 58. Hanoi Y, Levy R Ulect of PGD2 on cardiac contractility: a Bioehan, 19a1;162A56-U9. ncgative inotroph setondary to cotoaary vasocoiutridion 35. Gubler U, Hafian BI. A simple and vcry aïkitnt method for conceais a primary positive inotropic action./ PhomrucdEp W. generating cDNA hiesGare. 1983;Z-269. JM, S98637:719-724. 36. D'AlcJsio Noon MC, Ley HL In, Genrd GF. One-cuôc 59. Uemura S, NeJranUhi T, Maauoka S, Friedman WF, Jarniakani doubk-strPoded cDNA synthcsis ushg doncd m-mhr reverse mn- M. -tase. Fw. 1981;$1-4. Inotropic &ects of prostaglandin D2 and El on tbe newborn SF, W, EW, Lipman DL nbbit hem Prdiotr Rtt, 1984;18:1277-1281. 37. Atschul Gish Miiier W, Myen Basic local 60. Lai 3, Jin H, Yang R, Wiier J, Li W, Yen R King Ki, Zeigla F, alignment smmb tooL I Md Bid. 1990;235344&410. Ko R 38. Girh W, States DJ. Identification of ptotcin cod@ ngioiu by A, Qieng J, Bunting S, Paoni NF. Prostaglandin aipba database sidadty seorch.Nat Genet. 1993;3%ô-272. induces cardiac myocyie mphyin vitro and cardiac growth in *Am 39. Bogurti M. db- a database of cqmsdwquencc ta~pNor JPhy~bî.1996;271:H219ï-H2U)8. W.1993;492-333. 61. Vclculescu VE, Pinng ï, Vopistein B, Kinzier KW. Serial analysis 40. Poulos JE, Gower WRSr, Suiiebagcr JT,Fontanet HL, Vese fy DL of gtne cxpnssioa Scicnct. 199530..484-487. Congestive hmfailun: incrrrsed œrdisc and exman& atrial 62. Zhang L, Zhou W, Velcule~uVE, Kern SE, Hruban RH, natriurctic peptide gene enpressio~Cordfoyp~c Ru. 1996;32: Hamilton SR, Vogclstein B, WerKW. Gcnc expression profiles 909-919. in normal and cancer ccils. Sciuin. 1W;276:1268-1272. 41. Butûick PM, Kaplaa M, LehdL4 Schcuer S. Alterations in 63. Fung YW, Licw CC Identincation of guies asmdated with myo- gene arprcssion in the rat hem aftcr chmnic pathoI*cal and audiai developmeat.J Md Ceil Cordial. 19%;28:1241-1249. pby~iologialioaàs. J Md îeü Cordld 1994;26:61-67. 64. Schair M, Won D, Davis RW, Brown PO. Quantitative moni- 42 Nakagawa O, 0- Y, Itoh H, Suga S, Konrrtsu Y, Kthimoto I. toring of gent cxpr&on pattcnu with a wmplementay DNA ETishino K, Yoshimasa T, NaLao K. Rapidtrsaoaiptiod activation d~.Sciurce. 1995m467-470. and early mRNA trirnovcr of bmin naaituetic peptide m atdiocyte 65. Schena M, Shah D, HeUer R, Chai A Brown PO, Davis RW. bypcraophy: cvidena for bnia natriantic peptide as an 'emer- Pardicl human genome an- microamy-bwd expression gcncy'~honnoae~valtriallaravcrlord.JCPnInvat. monitoriog of lûûû gam. hcNad Acad Sci USA- 1996s: 1995;96:128&128ï. 10614-10619. 43. Daod SK, Pan LX, Carleton S, Mamontcm S, Sidm'qui MA 66 Schia GD, Bo@ MS, Stewart EA, Stem LD, Gyapay (3, Rice Adsptatioaai rrspow in transcription faston Lringdevelopmcnt K, White RE, Rodrigua-Tome P, Agprwai A, Bajorck E, Ben- of myacardial hypmophy. f Md Cr31 Cmdid. 13996;27:2359-2372. toiiïa S, BSrrn BB, Buder A, Cutle AB, ChkmWchai N, Qu 4 44. Lob JF. hld-mC, Dsnt M4 N, Doni GW II, Qee C, WesS, Day PI, Dibling T, Drouot N, Dunham I, Duprat Walsh RAThe tole of the cytoskdeton in lcft vmeicuiar pm S,EPftC,mC,Fan-Fa~gN,FttamuC,GmaC doadhypcmqhyandfaitme.IMdCrllOuilfd19W;28t Green L, Hadlq D, Hanit M. Harrison P. Brady S, Hicb A 143S1443. Ho~E,HuiLHusrainS,~Dit-SnllyC,MeJ,Mitniihnry 45. Watson PA. Hannan R, Cul U, GipKE Desmin gene A, Mader C, Maratukuiam A, Macise TC. McKusick KB, ~nmardiaemyocytuisraponsivetu~~ Morigem f, MU@ A. ~osckrD, usb bai un HC,PW DÇ ~edr and stmtchAm JPhyrid 1996. -Clpg. A Peritins S, Piuy M, Qin F, Quackmbuth J, Ranh S, &if T, a g rd mi- rndpaim Raam S, Saaden C, Sbe X, SihJ, Slwim DK, Sacietfaad C, Sun and nprogmmmhg of cardiac gcne uprwrlon produccd by WLTaôar P. Thaagamjah T,Vega-aSnry N, Vollrath D, Vqticky pressure OY#loabRac Nad AdSa USA, 1988;853-9-343. S, wiimet T, WuX, Adams MD,Aunray C, Wattu NAR. Brandao 47. Kinhcobam LA, HJ1 hit. Singai PK Eadogcnour antiaxidants in R Dehejia A, Goodfdow PN, Houlgatte R, Hu* JR Sr, Ide SE. isdatcd mhidardiac my#yrer ami ~-raqgena- 1- KR, Lee WY, Scki N, Nagase T, Lhilracur K Nomm N, tion mjary. J Md Cell GmiioL 1995m2îS272. 48. Gupta M. SiPK Higha antioxida!ive ctpaeity &ring a chmaïc E!Zc,~TLREtEc"IIJM"~~~~ stable heart bypatmphp. Clic Ra. 1989;6439%4û6. IcabschJ,MyusRM.CoxDR,Sames MR,BeatkyD,DdoukuP, 49. Adhi, SrnuLi TB Nagai* R nticahmi pet are Lnnckr ES, Hudson TJ. A gaie mitp of the human genome,Sctcnce- uprr~tcdi~~~daimcgilatedin1996$74540-546. scmcardiachypertmphy~bypnaunwaioad.JMd~ o1. Bdiabio A The rise and faii of positional doning? Nat Genet. Cmdtd. ~Jsm15901590 i993;3m-m. 50. -ci Ji, Dobur I, Contttd F. Schwam K. Rappaport L Bio- 68. QUms FS Fuitional donhg movcs hmpcrditiand to traditionai. bgtdsignais of cdhc --Et4 Hm1.1990Jl:I-7. Nat &nec. 1995$547-350.