MOLECULAR INTERACTION OF INFECTIOUS SALMON
ANAEMIA VIRUS AND THE ATLANTIC SALMON INNATE
IMMUNE SYSTEM
A Thesis Submitted to the Graduate Faculty
in Partial Fulfillment of the Requirements for the Degree of
DOCTOR OF PHILOSOPHY
Department of Pathology and Microbiology
Faculty of Veterinary Medicine
University of Prince Edward Island
Samuel Workenhe
August 2009
©2009. Samuel Workenhe Library and Archives Bibliotheque et 1*1 Canada Archives Canada Published Heritage Direction du Branch Patrimoine de I'edition 395 Wellington Street 395, rue Wellington OttawaONK1A0N4 OttawaONK1A0N4 Canada Canada
Your file Votre reference ISBN: 978-0-494-64475-1 Our file Notre reference ISBN: 978-0-494-64475-1
NOTICE: AVIS:
The author has granted a non L'auteur a accorde une licence non exclusive exclusive license allowing Library and permettant a la Bibliotheque et Archives Archives Canada to reproduce, Canada de reproduire, publier, archiver, publish, archive, preserve, conserve, sauvegarder, conserver, transmettre au public communicate to the public by par telecommunication ou par I'lnternet, preter, telecommunication or on the Internet, distribuer et vendre des theses partout dans le loan, distribute and sell theses monde, a des fins commerciales ou autres, sur worldwide, for commercial or non support microforme, papier, electronique et/ou commercial purposes, in microform, autres formats. paper, electronic and/or any other formats.
The author retains copyright L'auteur conserve la propriete du droit d'auteur ownership and moral rights in this et des droits moraux qui protege cette these. Ni thesis. Neither the thesis nor la these ni des extraits substantiels de celle-ci substantial extracts from it may be ne doivent etre imprimes ou autrement printed or otherwise reproduced reproduits sans son autorisation. without the author's permission.
In compliance with the Canadian Conformement a la loi canadienne sur la Privacy Act some supporting forms protection de la vie privee, quelques may have been removed from this formulaires secondaires ont ete enleves de thesis. cette these.
While these forms may be included Bien que ces formulaires aient inclus dans in the document page count, their la pagination, il n'y aura aucun contenu removal does not represent any loss manquant. of content from the thesis.
1+1 Canada CONDITION OF USE
The author has agreed that the Library, University of Prince Edward Island, may make the thesis freely available for inspection. Moreover, the author has agreed that permission for extensive copying of this thesis for scholarly purposes may be granted by the professor or professors who supervised the thesis work recorded herein or, in their absence by the Chairman if the Department or Dean of the Faculty in which the thesis was done. It is understood that due recognition will be given to the author of this thesis and the University of Prince Edward Island in any use of the materials in this thesis. Copying or publication or any other use of the thesis for financial gain without approval by the University of Prince Edward Island and the author's written permission is prohibited.
Requests for permission to copy or make any other use of material in this thesis in whole or in part should be addressed to:
Chair of the Department of Faculty of Veterinary Medicine University of Prince Edward Island Charlottetown, PEI Canada CI A4P3
1 SIGNATURE PAGE
(n)4(iif)
REMOVED ACKNOWLEDGEMENTS
This work was supported by a Natural Sciences and Engineering Research
Council (NSERC) of Canada Discovery grant to Dr. Frederick Kibenge. I would also like to thank the Department of Pathology and Microbiology, AVC, UPEI for partial stipend top-ups.
First and foremost I am very thankful to Dr. Frederick Kibenge for giving me the opportunity to work with him and for his excellent supervision. Dr. Kibenge has been helpful in guiding me the way to be an independent scientist. Many thanks are due to my supervisory committee members, Dr. Glenda Wright, Dr. Edan
Foley, Dr. Dave Groman, and Dr. Gerald Johnson, for their best intellectual inputs in my research project and reading the thesis.
My acknowledgments extend to Dr. Molly Kibenge for her best mentorship and wise advice in hard times. I would also like to thank Dr. Molly Kibenge, Dr.
Matthew Rise, Tiago Hori, Dr. Glenda Wright, Dorota Wadowska, Dr. Dave
Groman, and Dr. Tokinori Iwamoto, for their contribution as co-authors of the manuscripts we published.
I am highly indebted to my families especially Tinsae, Tigist, and Addis for their significant moral support during my study. Last but not least, my gratefulness is for my friends Wondafrash Eshete, Tizita Wondafrash, and Nina Molla for the fun and caring we shared.
IV ABSTRACT
Infectious salmon anaemia (ISA) is a fatal viral disease of Atlantic salmon.
Despite more than two decades of research to provide knowledge for instituting effective control measures, the disease continues to cause devastating losses, most recently in Chile and Scotland. Research aimed at better understanding the initial stages of the virus-host cell interactions is required to generate more knowledge on the pathogenesis and immunology of the disease process. The thesis project looked into the molecular interaction of ISA virus (ISAV) and the Atlantic salmon cells (erythrocytes, Chinook salmon embryo CHSE-214 cells, and Atlantic salmon TO macrophage/dendritic-like cells). Transmission electron microscopy used to examine the physical interaction between ISAV and erythrocytes provided evidence that ISAV undergoes endocytosis in Atlantic salmon erythrocytes. A follow-up study examined the possibility of ISAV replication and expression of type I interferon (IFN) system genes in Atlantic salmon erythrocytes following
ISAV haemagglutination. Haemagglutination induced by the high pathogenicity isolate NBISA01 but not the low pathogenicity isolate RPC/NB-04-0851 resulted in productive infection as evidenced by increased ISAV segment 8 transcripts and increase in the median tissue culture infectious dose (TCID50). Moreover, ISAV up-regulated the expression of the mRNA levels of key type I IFN system genes
(IFN-a, Mx, ISG15, STAT1) in erythrocytes. Although Atlantic salmon TO cells are known to up-regulate the expression of type I IFN system genes, information on the effect of ISAV strain variation on this expression is lacking. To better understand this interaction, the two ISAV isolates of differing pathogenicity
v phenotype and genotypes (NBISA01 and RPC/NB-04-085-1) were initially used
to infect TO and CHSE-214 cells and the mRNA levels of key type IIFN system
genes and ISAV transcripts were measured by real-time quantitative reverse
transcription-Polymerase chain reaction (QRT-PCR). The results of the TO cell
experiment showed remarkable differences in the expression of the key type I IFN
system genes and viral transcripts in TO cells in response to the two ISAV
isolates. NBISA01 replicated robustly and showed very low mRNA levels of the
key type I IFN system genes. On the other hand, RPC/NB-04-085-1 replicated
slowly and showed higher mRNA levels of the type I IFN system genes. Based on
these results, we proceeded to characterize the Atlantic salmon TO cell global
gene expression responses to infection with NBISA01 and RPC/NB-04-085-1
using microarray analysis and validation by QRT-PCR. Overall, the microarray
experiment showed that RPC/NB-04-085-1-infected cells had a higher total
number of reproducibly dysregulated genes than the NBISA01-infected cells. The
microarray experiment identified several salmon genes that were differentially
regulated by NBISA01 and RPC/NB-04-085-1, and which may be useful as
molecular biomarkers of ISAV infection. A further study was carried out to
expand the knowledge on the expression of microarray identified immune response genes using a selection of 4 ISAV isolates (NBISA01, RPC/NB-04-085-
1, RPC/NB-0593-1, and Norway-810/9/99) that differ in pathogenicity and geographic origins. The RPC/NB-04-085-1 infected cells showed the highest mRNA expression for most immune-relevant genes, followed by Norway-
810/9/99. NBISA01 and RPC/NB-01-0593-01 (both of North American
vi genotype) showed lower mRNA expression of the genes that were highly expressed by RPC/NB-04-085-1 infected cells. These findings show that ISAV isolates have strain-specific variations in their ability to induce fish immune response genes.
vn ABBREVIATION
Ml Microliter
HM Micromolar
API activator protein 1
APC antigen presenting cells
ASK Atlantic salmon kidney
ATF-2 activating transcription factor 2
CAB Carassius auratus blastulae
CARD caspase recruitment domain
CARDIF CARD adaptor inducing IFN-P cDNA complementary DNA
CHSE chinook salmon embryo cells
CID a central interacting domain
CPE cytopathic effect
CpG nucleotides cytosine and guanine in repetition
CREB cAMP response element binding protein cRNA complementary RNA
Ct cycle threshold
CTL cytotoxic T lymphocytes
DAI DNA-dependent activator of IFN-regulatory factors
DC dendritic cells
DNA deoxyribonucleic acid dsRNA double stranded RNA EDTA ethylenediaminetetraacetic acid
EIF eukaryotic translation initiation factor
ELISA enzyme linked immunosorbent assay
EST expressed sequence tags
F fusion protein
FBS fetal bovine serum
GAS gamma- associated site
GCHV grass carp hemorrhagic septicemia virus
GBP guanylate binding protein
GED GTPase effector domain
HA haemagglutinin protein
HE haemagglutinin-esterase
HMEM Hanks' minimum essential medium
HPR highly polymorphic region
IFAT indirect fluorescent antibody test
IFN Interferon
IKK IKP kinase
IPNV infectious pancreatic necrosis virus
IPS-I IFN-P stimulator 1
IRAK-4 interleukiu-l -receptor (IL-lR)-associated kinase-4
IRF interferon regulatory factor
ISA infectious salmon anaemia
ISAV infectious salmon anaemia virus ISG interferon stimulated genes
ISRE interferon stimulated response element
ISRE interferon stimulated response element
JAK Janus associated kinase
kDa KilloDalton
KV Kilovolt
LRR leucine rich repeats
LGP2 laboratory of genetics and physiology 2
MAPK mitogen activated protein kinase
MAVS mitochondrial antiviral signaling
Mda5 melanoma differentiation associated gene 5
mRNA messenger RNA
Mx myxovirus resistance protein
MyD88 myeloid differentiation primary response gene (88)
NA neuraminidase
NF-KB nuclear factor kappa B
NK natural killer
Nm Nanometer
NS1 non-structural protein 1
NP Nucleoprotein
OIE world organization for animal health
ORF open reading frame
PA acidic polymerase PBS phosphate buffered saline
PB1 basic potymerase 1
PB2 basic polymerase 2
PCR polymerase chain reaction
pDC plasmacytoid dendritic cells pDNA plasmid DNA
PKR protein kinase R
PKZ Z-DNA binding protein kinase
Poly I:C polyinosinic:polycytidylic acid
PIWI P- element induced wimpy testis
PRR pattern recognition receptors
PVDF polyvinylidene fluoride
QRT-PCR quantitative reverse transcription-polymerase chain reaction
RDE receptor-destroying enzyme
RHIM RIP homotypic interaction motif
RIG-I retinoic acid inducible protein - I
RIP receptor-interacting protein
RISC RNA induced silencing complex
RLC RISC loading complex
RLH RIG-I like helicases
RNA ribonucleic acid
RNAi RNA interference
RNase Ribonuclease rRNA ribosomal RNA
RT-PCR reverse transcription-polymerase chain reaction
SDS-PAGE sodium dodecyl sulfate polyacrylamide gel electrophoresis
SH2 Src homology 2
SHK-1 salmon head-kidney 1 shRNA short hairpin RNA siRNA small interfering RNA ssRNA single stranded RNA
STAT signal transducers and activators of transcription
TAB TAK -binding protein
TAK transforming growth factor /^-activated kinase 1
TANK TRAF family member associated NF-Kp activator
TBK TANK binding kinase
TCID tissue culture infectious dose
TIFF tagged image file format
TIR toll/interleukin-1 receptor (IL-1R) homology
TLR toll-like receptor
TNF tumor necrosis factor
TRAF tumor necrosis factor receptor- associated factor
TRIF toll-IL-1 receptor domain containing adaptor inducing interferon-P
TYK tyrosine kinase
UV ultraviolet
VAMP viral associated molecular patterns VHSV viral haemorrhagic septicemia virus
VMRD veterinary medical research and development vRNA viral RNA
ZBP Z-DNA binding protein
I-KP inhibitors of NF-K[3
xni TABLE OF CONTENTS
CONDITION OF USE i PERMISSION TO USE POSTGRADUATE THESIS ii CERTIFICATION OF THESIS WORK iii ACKNOWLEDGEMENTS iv ABSTRACT : v ABBREVIATION viii TABLE OF CONTENTS xiv LIST OF TABLES xvii LIST OF FIGURES xviii 1. General Introduction 1 1.1. Molecular interaction of ISAV and the Atlantic salmon innate immune system... 1 1.2. Innate immune response against viruses 3 1.3. Sensing of viralassociated molecular patterns 4 1.3.1. Toll-like Receptors 7 1.3.2. Retinoic acid inducible protein-I like helicases 9 1.4. Type I interferons 11 1.4.1. Signaling pathways of IFN action 14 1.4.2. Key genes of the Atlantic salmon type I IFN system 15 1.5. Virus evasion of the type I IFN system 19 1.6. Infectious salmon anaemia virus 21 1.6.1. Genome coding assignment of ISAV 21 1.6.2. Molecular aspects of ISAV virulence 25 1.6.3. Immunology of ISAV infections 30 1.6.4. Diagnosis of IS A 31 1.6.5. Control of ISA 32 1.7. Quantitative real-time reverse transcriptase-polymerase chain reaction 33 1.8. Use of microarrays in gene expression analysis 34 1.9. RNA Interference 36 1.10. Rationale and objectives 38 1.11. REFERENCES 41 2. Absolute quantitation of infectious salmon anaemia virus using different real-time reverse transcription PCR chemistries 66 2.1. SUMMARY 66 2.2. INTRODUCTION.. 67 2.3. MATERIALS AND METHODS 69 2.3.1. Viruses 69 2.3.2. Cell culture 70 2.3.3. RNA extraction 70 2.3.4. cDNA synthesis 71 2.3.5. Preparation of plasmid DNA standards 72 2.3.6. In vitro transcription of ISAV RNA segment 8 72 2.3.7. Construction of ISAV segment 8 in vitro transcribed RNA standards 73 2.3.8. Two tube QRT-PCR with SYBR Green I chemistry 73 2.3.9. Single tube one-step QRT-PCR with TaqMan® chemistry 74
xiv 2.3.10. Standard curve for estimating TCID50 from Ct values 76 2.4. RESULTS AND DISCUSSION 76 2.4.1. Absolute quantitation of IS AV using SYBR® Green I chemistry and ISAV RNA segment 8 recombinant plasmid DNA standards 76 2.4.2. Absolute quantitation of IS AV with SYBR® Green I and TaqMan® Probe chemistry using ISAV RNA segment 8 in vitro transcribed RNA standards 79 2.4.3. Correlation of TCID50 with Ct values 84 2.5. REFERENCES 88 3. Infectious salmon anaemia virus endocytosis in fish erythrocytes 92 3.1. SUMMARY 92 3.2. INTRODUCTION 93 3.3. MATERIALS AND METHODS 94 3.3.1. Viruses 94 3.3.2. Haemagglutination assays... 94 3.3.3. Transmission electron microscopy 94 3.3.4. One tube QRT-PCR of ISAV segment 8 95 3.4. RESULTS AND DISCUSSION 96 3.4.1. ISAV endocytosis in erythrocytes 96 3.4.2. Segment 8 transcripts after ISAV induced haemagglutination 99 3.5. REFERENCES 103 4. Infectious salmon anaemia virus replication and induction of IFN-a in Atlantic salmon erythrocytes 105 4.1. SUMMARY 105 4.2. INTRODUCTION 107 4.3. MATERIALS AND METHODS 110 4.3.1. Viruses 110 4.3.2. Virus inactivation 110 4.3.3. Haemagglutination assays 110 4.3.4. Poly I:C stimulation of Atlantic salmon erythrocytes 112 4.3.5. Detection of cytokine expression and ISAV replication by QRT-PCR.... 112 4.3.6. Detection of virus replication by titration on TO cell line 115 4.4. RESULTS 115 4.4.1. ISAV replication in Atlantic salmon erythrocytes 115 4.4.2. ISAV-induced haemagglutination up-regulates the expression of key type I IFN system genes in fish erythrocytes 118 4.4.3. Poly I:C stimulated erythrocytes showed minimal induction of type I IFN system genes 120 4.5. DISCUSSION AND CONCLUSIONS 125 4.6. REFERENCES 132 5. Molecular interaction of infectious salmon anaemia virus with the type I IFN system of Atlantic salmon 137 5.1. SUMMARY 137 5.2. INTRODUCTION 138 5.3. MATERIALS AND METHODS 140 5.3.1. Viruses 140 5.3.2. Virus infection of TO cells 141
xv 5.3.3. Virus infection of CHSE-214 cells 141 5.3.4. Poly I:C transfection of TO and CHSE-214 cells 141 5.3.5. Molecular cloning..... 142 5.3.6. Expression analysis using immunfluorescence 144 5.3.7. Estimation of transfection efficiency 144 5.3.8. Luciferase assay 145 5.3.9. Chinook salmon beta-actin siRNA design and transfections 146 5.3.10. Complementation of RPC/NB-04-085-1 with NBISA01 segment 7 and segment 8 proteins 147 5.3.11. Western blotting 147 5.3.12. RNA extraction and DNAse I treatment 148 5.3.13. Quantitative Reverse Transcription - Polymerase Chain Reaction 148 5.4. RESULTS ; 151 5.4.1. Poly I:C transfection up-regulates the type IIFN system genes 151 5.4.2. ISAV isolates show differing expression patterns of key type I IFN system genes in TO cells 153 5.4.3. Expression of type I IFN system genes and viral transcripts in CHSE-214 cells after ISAV infection 157 5.4.4. Studies on the IFN antagonizing activity of ISAV 159 5.5. DISCUSSION AND CONCLUSIONS 169 5.6. REFERENCES.' , 175 6. Variation of host macrophage/dendritic-like cell line TO gene expression responses caused by different ISAV isolates assessed using genomic techniques 180 6.1. SUMMARY 180 6.2. INTRODUCTION.. 182 6.3. MATERIALS AND METHODS , 184 6.3.1. Viruses 184 6.3.2. UV inactivation of ISAV 185 6.3.3. Virus infection of TO cells 185 6.3.4. RNA extraction and DNAse I treatment 186 6.3.5. Array hybridization 186 6.3.6. Microarray image analysis 188 6.3.7. Quantitative reverse transcription-polymerase chain reaction 189 6.4. RESULTS 191 6.4.1. Microarray analysis of global gene expression 191 6.4.2. Expression of QRT-PCR validated genes of interest in response to four ISAV isolates 198 6.5. DISCUSSION AND CONCLUSIONS 206 6.6. REFERENCES 217 7. GENERAL DISCUSSION 226 7.1. General Discussion and Conclusions 226 7.2. Future directions 236 7.3. REFERENCES 239 APPENDICES 246
xvi LIST OF TABLES
Table 1.1. Viral proteins encoded by the 1SAV genome 24 Table 2.1. Comparison of the dynamic range and reliable detection limit of ISAV segment 8 two tube QRT-PCR with SYBR® Green I chemistry and single tube one-step QRT-PCR with TaqMan probe chemistry 83 Table 4.1. Transcript levels of viral genes on ISAV segment 8 in extended haemagglutination assays 117 Table 5.1. PCR primers used for cloning the ISAV segment 7 (ORF1 and ORF1/2), and segment 8 (ORF1 and ORF2) proteins into pCDNA3.1 vector 143
xvn LIST OF FIGURES
Figure 1.1. A model showing the various stages of orthomyxovirus replication, the VAMPs produced, and the PRRs responsible for detection 6 Figure 2.1. cDNA copy number of ISAV segment 8 78 Figure 2.2. Standard curve relating TCID50 to Ct value of ISAV segment 8 86 Figure 3.1. Transmission electron micrographs showing the various stages of apparent endocytosis of the NBISA01 virus in Atlantic salmon erythrocytes 98 Figure 3.2. Amplification, melting curve, and agarose gel electrophoresis of QRT-PCR targeting a 220 bp product on ISAV segment 8 using total RNA from haemagglutination tests at different sampling points 100 Figure 4.1. Expression of key type IIFN system genes by intact ISAV particles 122 Figure 4.2. Expression of key type I IFN system genes by inactivated ISAV particles. 123 Figure 4.3. Expression of key type I IFN system genes by erythrocytes in response to poly I:C stimulation 124 Figure 5.1. Expression of key type I IFN system genes in poly I:C stimulated cells 152 Figure 5.2. Expression of key type I IFN system genes in TO cells infected with NBISA01 and RPC/NB-04-085-1 isolates of ISAV 155 Figure 5.3. Expression of ISAV transcripts in TO cells infected withNBISAOl and RPC/NB-04-085-1 isolates of ISAV 156 Figure 5.5. Expression of the various ISAV proteins detected by immunofluorescence. 161 Figure 5.6. Transfection efficiency of CHSE-214 transfected with pEGFP-Cl 161 Figure 5.7. Atlantic salmon minimal IFN promoter activity in CHSE-214 cells co- transfected with various pDNA constructs 164 Figure 5.8. Expression of IFN, Mx, and ISG-15 in CHSE-214 cells co-transfected with various pDNA constructs 165 Figure 5.9. Atlantic salmon minimal IFN promoter activity in CHSE-214 cells infected withNBISAOl isolate of ISAV 166 Figure 5.10. Expression of IFN, Mx, and ISG-15 in CHSE-214 cells infected with NBISA01 isolate of ISAV 167 Figure 6.1. Overview of microarray experimental design and results 196 Figure 6.2. Hierarchical clustering of reproducibly dysregulated genes 197 Figure 6.3. Expression of microarray identified and QRT-PCR validated genes after infection of TO cells with four ISAV isolates 204 Figure 6.4. Absolute copy numbers of ISAV segment 8 per ng of total RNA 205
xvin 1. General Introduction
1.1. Molecular interaction of ISAV and the Atlantic salmon innate
immune system
Infectious salmon anemia (ISA) virus (ISAV) is a fish orthomyxovirus that continues to cause significant production losses in Atlantic salmon producing countries
(Thorud and Djupvik, 1988; Godoy et al., 2008). ISAV causes a fatal clinical disease in
Atlantic salmon (Salmo salar) with signs of exophthalmia, pale gills, ascites, congestion of gut, enlargement of liver and spleen, petechial hemorrhages in the visceral organs, and severe anemia (Thorud and Djupvik, 1988). Endothelial cells are the primary target cells for ISAV (Hovland et al., 1994); as a result, in infected fish the virus is found widely distributed in most tissues including mid-kidney, head-kidney, liver, spleen, intestine, gills and heart (Rimstad et al., 1999; Moneke et al., 2005).
The genome of ISAV consists of eight segments of negative sense single stranded (ss) RNA that code for at least 10 viral proteins (Kibenge et ah, 2004). ISAV
RNA segments 1 through 6, encode one protein each in the following order: basic polymerase (PB) 2, PB1, nucleoprotein (NP), acidic polymerase (PA), fusion (F) protein, haemagglutinin-esterase (HE) protein, respectively. There are three proteins encoded by
ISAV segment 7; Seg7 ORF1, Seg7 ORF1/2 (Biering et al, 2002) and Seg7 ORF1/3
(Kibenge et al, 2007a). The Seg7 ORF1 product was reported as an interferon (IFN) signaling antagonist but its mechanism of action was not established (McBeath et al,
2006; Garcia-Rosado et al, 2008). Genomic segment 8 uses a bicistronic coding strategy with the smallest protein identified as the virus matrix protein (Falk et al., 2004), and the second protein (Seg8 ORF2 product, Garcia-Rosado et al, 2008) as a structural protein
1 having a predominantly nuclear localization and minor type I IFN antagonizing activity
(Garcia-Rosado et al., 2008)(Table 1.1).
ISAV isolates vary in their pathogenicity for Atlantic salmon hosts as well as
cells (Kibenge et al., 2006). Part of the variation has recently been explained by the
variation in the HE and F proteins suggesting the two proteins are important virulence
factors of ISAV (Kibenge et al., 2007b; Markussen et al., 2008). ISAV haemagglutinates
erythrocytes from several fish species including Atlantic salmon and the receptor destroying enzyme (RDE) activity dissolved the haemagglutination for all erythrocytes that were agglutinated by ISAV except for Atlantic salmon erythrocytes (Falk et al.,
1997). The inability of RDE to dissolve the haemagglutinations of salmon erythrocytes may be important for ISAV virulence and pathogenesis since virus isolates that showed
RDE activity with salmon erythrocytes seemed to be less virulent (Falk and Dale, 2006).
Atlantic salmon have been shown to respond to ISAV infection by mounting both innate (Kileng et al., 2007; McBeath et al., 2007) and adaptive immune responses
(J0rgensen et al., 2007). Several studies on the interaction of innate immune response of
Atlantic salmon to ISAV infection show that ISAV induces the key genes of type I IFN system although the induced antiviral proteins were not able to prevent the replication of the virus (Kileng et al, 2007; McBeath et al., 2007). The segment 7 ORF1 and segment 8
ORF2 proteins of ISAV have been reported to be a major and minor IFN system antagonizing proteins, respectively (McBeath et al., 2006; Garcia-Rosado et al., 2008).
Moreover; the segment 7 and 8 sequences of European ISAV isolates show the highest percentage of amino acid substitutions (Markussen et al, 2008). These sequence variations in the IFN antagonizing proteins between ISAV isolates possibly determine the
2 capacity of the proteins to antagonize the Atlantic salmon IFN system suggesting that those proteins could be virulence factors utilized by highly pathogenic ISAV isolates to replicate in the presence of a potent innate immune system. However, there is no information on the putative IFN antagonistic proteins as virulence factors of ISAV.
1.2. Innate immune response against viruses
The principal immune effector cells of the innate immune system are monocytes/macrophages, dendritic cells (DC), and natural killer (NK) cells. These effector cells recognize pathogen-associated molecular patterns (viral nucleic acid, viral surface proteins, unmethylated CpG DNA) through a variety of pattern recognition receptors (Janeway and Medzhitov, 2002). Activated cells release a variety of proinflammatory cytokines and chemokines, which recruit inflammatory cells to the site of infection and initiate inflammation and antiviral immune response. These soluble mediators also activate macrophages, NK cells, and DC, and the activated DC express adhesion molecules and migrate to lymph nodes to present antigen to T and B cells
(Janeway et al., 2005). Viral infections are usually accompanied by NK cell activation that kill virus-infected cells and serve as an immediate source of IFN-y. The NK cell- secreted IFN-y plays an important role in inducing an effective antiviral immune response
(Lanier et al., 2008). Although multiple cytokines and chemokines are produced by different kinds of host cells during virus infection, type I IFNs are the principal cytokines involved in the antiviral response (Koyama et al., 2008). Most virus-infected cells use the cytoplasmic RNA helicases retinoic acid inducible protein-1 (RIG-I) and melanoma differentiation associated gene 5 (Mda-5) or toll-like receptors (TLRs) to sense viral nucleic acids (Takeuchi and Alum, 2007). Binding of viral replication nucleic acid
3 intermediates to RIG-I, Mda-5, or TLRs results in a coordinated activation of the
transcription factors NF-K(3 and IFN regulatory factor 3 (IRF-3) and IRF-9 (Randall and
Goodbourn, 2008) that in turn regulate the expression of hundreds of genes such as IFNs
and IFN-stimulated genes, and proinflammatory cytokines and chemokines that are
involved in the orchestration of the adaptive immune response (Katze et al., 2008).
1.3. Sensing of viral associated molecular patterns
All viruses consist of nucleic acids, either DNA or RNA, a capsid protein shell that encloses the nucleic acids, as well as, other structural proteins essential for replication of the virus. Many viruses are also enclosed by a phospholipid envelope containing embedded viral glycoproteins (Flint et al., 2004). Enveloped viruses enter cells by either fusion at the plasma membrane or via endocytosis that leads to release of viral genome to the cytoplasm. Virus replication in either the cytoplasm or the nucleus leads to generation of dsRNA and ssRNA genome replication intermediates. The proposed mechanisms of dsRNA synthesis are different among different virus genomes.
Negative-stranded RNA viruses are proposed to generate dsRNA molecule upon transcription of their genome, while positive-stranded RNA viruses and DNA viruses are proposed to generate dsRNA via replication and convergent transcription, respectively.
Cellular mRNAs are capped while viral RNAs (single stranded or double stranded) have a 5' phosphate that can be recognized by cellular pattern recognition receptors (PRRs)
(Pichlamair et al., 2006). Two forms of DNA are also recognized by cellular PRRs; unmethylated bacterial DNA with CPG motif (Klinman et al., 2004) and dsDNA with the left handed Z-conformation that is generated by negative supercoiling generated by RNA polymerases (Rich and Zhang, 2003). Thus ssRNA, dsRNA, and viral glycoproteins
4 constitute the basic viral associated molecular patterns (VAMPs) whereby PRRs
recognize an invading virus. As shown in Figure 1.1, production and presentation of
VAMPs may occur at multiple stages of the viral life cycle, with cellular
compartmentalization determining VAMP-PRR interactions (Thompson and Locarnini,
2007). Signaling via PRRs leads to the production of a variety of cytokines including
inflammatory cytokines, type I IFN, chemokines and to increased surface expression of
co-stimulatory molecules to support the proliferation of T cells and differentiation into T
helper cells. Type I IFNs play a central role in the induction of antiviral responses as they
lead to transcription of many IFN-inducible genes, which influence protein synthesis,
growth arrest, and apoptosis. Type I IFNs also enhance DC maturation, NK cell
cytotoxicity, and differentiation of virus-specific cytotoxic T lymphocytes, thus providing a link between innate and adaptive immune responses (Honda et ah, 2006). In recognizing viral nucleic acid and proteins of RNA viruses, the PRRs; TLRs, RIG-I and
Mda5 are relevant (Kawai and Akira, 2006).
5 Stages of orthomyxovirus Viral associated PRRs responsible, adaptor proteins replication molecular marker and the transcription factors activated
Figure 1.1. A model showing the various stages of orthomyxovirus replication, the VAMPs produced, and the PRRs responsible for detection. RIG-1 and Mda-5 have similar effects downstream of IPS-1; as a result only the pathway of RIG-1 is shown. Activation of NF-KB leads to nuclear translocation and activation of the promoter region of proinflammatory cytokines. Activation of IRF3 and IRF7 leads to induction of the promoter of type IIFN system genes.
6 1.3.1. Toll-like Receptors
Toll-like receptors (TLRs)(Lemaitre et al., 1996) comprise a transmembrane
leucine-rich repeat (LRR) domain and a cytoplasmic Toll/interleukin-1 receptor (IL-1R)
homology (TIR) domain. The TIR domain is localized in the cytoplasm, whereas the
LRR domain faces the lumen of endosomes or extracellular space and it is responsible for
pathogen sensing (Akira et al., 2006). Several TLRs that sense different VAMPs have
been identified. TLR3 (shows cell surface expression in some immune cells), TLR7, and
9 are localized on cytoplasmic vesicles such as endosomes, and endoplasmic reticulum
and recognize viral nucleic acids (Uematsu and Akira, 2007). Toll-like receptor 4 and
TLR2 are expressed on the cell surface, and recognize viral envelope proteins and haemagglutinins. TLR3, 7 and 8 recognize viral RNA, whereas TLR9 detects unmethylated DNA with CPG motifs. TLR3 recognize dsRNA, TLR7 senses ssRNA
(Randall and Goodbourn, 2008). Several kinds of viruses utilize the endocytic pathway for cell entry or budding and this allows surveillance of nucleic acid VAMPs by TLR 3,
7, and 9 (Kumagai et al, 2008)
Upon recognition of dsRNA by the LRR domain of TLR3, the TIR domain triggers a signaling cascade via the adaptor protein TIR domain-containing adapter inducing IFN-[3 (TRIF)(Akira et al., 2006). TRIF associates with tumor necrosis factor
(TNF)-receptor associated factor 3 (TRAF3) and TRAF6 through TRAF-binding motifs present in its N-terminal portion (Hacker et al., 2006). TRIF also contains a C-terminal receptor-interacting protein (RIP) homotypic interaction motif (RHIM), as a result TRIF interacts with RIP1 and RIP3 (Meylan et al, 2004). TRAF6 recruitment and oligomerization activate its lysine 63-linked ubiquitin E3 ligase activity, leading to
7 polyubiquitination of itself and RIP1 (Randall and Goodbourn, 2008). The polyubiquitin chains are recognized by TAK1-binding proteins 2 and 3 (TAB2 and TAB3)(Kanayama et al, 2004), whichchaperone transforming growth factors-activated kinase 1 (TAK1) to the complex (Deng et al, 2000; Wang et al, 2001). The IKK complex is recruited to the
TRIF-RIP1-TRAF6-TAB-TAK1 complex; as a result of this juxtaposition, the IKKy5 subunit of the IKK complex is phosphorylated directly by TAK1 (Wang et al, 2001), leading to the downstream phosphorylation of inhibitor of kappa-P (I/cB), its subsequent ubiquitination and degradation and the eventual nuclear uptake of nuclear factor kappa-
B(NF-KB). In contrast, TRAF3 is responsible for inducing type I IFNs through activation of IRF3 (Hacker et al, 2006) (Fig. 1.2).
Sensing of ssRNA by the LRR domain of TLR7 activates the TIR domain of
TLR7 to interact with the adaptor protein myeloid differentiation factor 88
(MyD88)(Hemmi et al, 2000). MyD88 forms a complex with interleukin-1-receptor (IL- lR)-associated kinase-4 (IRAK-4), IRAK-1, TRAF3, TRAF6 (Kawai et al, 2004;
Hacker et al, 2006). TRAF6 recruitment can activate NF-KP through TAK1-TAB2-
TAB3 and the canonical IKK complex (Randall and Goodbourn, 2008). The MyD88-
IRAK-1-IRAK-4-TRAF6 complex binds directly to IRF7 and this results in phosphorylation induced activation and nuclear translocation of IRF7 (Takeu chi and
Akira, 2007). Activated IRF7 and NF-KP in the nucleus bind to regulatory DNA sequences to activate the promoter of type I IFNs and proinflammatory cytokines, respectively (Haller et al, 2006). TLR9 shares a similar signaling pathway as TLR7
(Bonjardim et al, 2009) (Fig. 1.2).'
8 Fish orthologs to mammalian TLR9 and TLR3 have been identified from channel catfish (Ictalurus /w/7C/ata.s-)(Bilodeau and Waldbieser, 2005), zebrafish (Danio rerio)
(Jault et ah, 2004), and Atlantic salmon (Skjasveland et ah, 2008). A conserved function of these receptors with their mammalian orthologs is suggested as Japanese flounder
(Paralichthys olivaceus) TLR9 is able to activate a TNF promoter upon CpG DNA stimulation (Takano et ah, 2007), while rainbow trout (Oncorhynchus mykiss) (Rodriguez et ah, 2005) and zebrafish TLR3 (Phelan et ah, 2005) expressions were up-regulated upon polyinosinic:polycytidylic acid (poly I:C) injection and virus challenge.
Nevertheless, functional studies for most fish TLRs are absent. TLR22 has been shown to occur exclusively in aquatic animals (Matsuo et ah, 2008). In the fugu (Takifugu rubripes), TLR3 and fugu TLR22 link the IFN-inducing pathway via the fugu TRIP adaptor in fish cells. Fugu TLR3 resides in endoplasmic reticulum and recognizes relatively short-sized dsRNA, whereas fugu TLR22 recognizes long-sized dsRNA on the cell surface (Matsuo et ah, 2008). Moreover, many of the Atlantic salmon TLR9 functional sites are conserved between fish and mammals (Skjeeveland et ah, 2008).
1.3.2. Rctinoic acid inducible protcin-I like helicascs
Retinoic acid inducible protein-I (RIG-I)(Yoneyama et ah, 2004), Mda-5 (Kang et ah, 2002) and laboratory of genetics and physiology 2 (LGP2) are cytoplasmic RNA helicases that collectively form a family of proteins called RIG-I like helicases (RLHs)
(Onomoto et ah, 2007). All RIG-I, Mda-5, and LGP2 have an RNA helicase domain
(Yoneyama et ah, 2005).. Besides, Mda-5 and RIG-I have a caspase recruitment domain
(CARD), but LGP2 does not have a CARD domain. Thus RIG-I and Mda-5 are microbial sensors, while LGP2 is suggested as a negative regulator of PJG-I and Mda-5 (Takeuchi
9 and Akira, 2007). While the helicase domain of RLHs is essential for recognition of
dsRNA, the CARD domain directs interactions with other CARD containing adaptor
proteins for downstream signaling (Yoneyama et ah, 2005). RIG-I and Mda-5 recognize
different RNA viruses such as paramyxovirus, influenza virus, vesicular stomatitis virus,
Japanese encephalitis virus, and the DNA virus Epstein-Barr virus (Kato et ah, 2005;
2006; Gitlin et ah, 2006).. Moreover, RIG-I not Mda-5 is able to sense the 5' phosphate of
viral RNAs. Mda-5 has been shown to recognize picornaviruses (Pichlmair et ah, 2006).
Upon recognition of viral RNA, the CARD domain of RIG-I/Mda-5 interacts with the CARD domain of the IFN-p promoter stimulator-1 (IPS-l)(Kawai et ah, 2005). IPS-1 transmits the signal to tumor necrosis factor receptor-associated factor (TRAF) family member associated NF-KP activator (TANK) binding kinase (TBKl)/Inhibitors of NF-K(3
(iKp) kinase (IKK-/) and the IKK complex to activate IRF-3/IRF-7 and NF-KB, respectively (Randall and Goodbourn, 2008). Homodimers of the phosphorylated IRF-3 translocate to the nucleus and recruit the transcriptional coactivators p300 and cAMP responsive element binding (CREB) proteins to initiate IFN-P mRNA synthesis (Haller et ah, 2006)(Fig. 1.2).
RIG-I and Mda-5 like expressed sequence tags (EST) were reported in sea bream
(Spams anrata)(Dios et ah, 2007), in Crucian carp (Carassius carassius)(Zhang et ah,
2007) and identified in the genome of fugu (Yoneyama et ah, 2005). Additionally, the downstream signaling adaptor of RIG-I and Mda-5, IPS-1 have been cloned and over- expression of Atlantic salmon IPS-1 leads to up-regulation of Atlantic salmon IFN-al promoter, an up-regulation of the NF-KB promoter, and establishment of antiviral state in
10 chinook salmon embryo cells (CHSE-214 cells) against infectious pancreas necrosis virus
(IPNV)(Lauksund et al, 2008).
1.4. Type I interferons
Interferons are widely expressed inducible and multifunctional cytokines that are
involved in cell growth regulation, and a first-line antiviral defence of vertebrates (Issac
and Lindemann 1957; Samuel, 2001). The IFN family includes three classes of cytokines
named: type I, type II, and type III IFNs. The large number of viral IFN genes in the
human includes 13 IFN-a genes, 1 JFN-P gene and 1 IFN-co gene. There is only one type
II IFN that is IFN-y (Platanias, 2.005). Type III IFNs (IFN-X or interleukin-28/29 [IL-
28/29]), were discovered recently (Kotenko et al., 2003), and they have been shown to
display IFN-like activities (Brand et ah, 2005). Although they do not have human
homologues, IFN-5, and IFN-x, have been described in pigs and cattle, respectively.
In fish, IFN genes have been cloned from zebrafish (Altmann et al., 2003),
Atlantic salmon (Robertsen et al, 2003), spotted green puffer fish (Tetradon
nigrovirides) (Lutfalla et al, 2003) and channel catfish (Long et al., 2004). In contrast to
the type I IFNs of birds and mammals, which have no introns, the fish IFNs contain 5
exons and 4 introns similar to IFN-ys (Robertsen, 2006). In Atlantic salmon there are 11
clusters of IFN genes recently discovered and classified into three subtypes (a, b, and c)
of type I IFNs, all possessing genes with an intron-exon structure similar to human IFN-
X, although their protein sequences are more similar to IFN-a than IFN-A, (Robertsen,
2006; Sun et al., 2009). Atlantic salmon IFN-a and IFN-b are not orthologs of
mammalian IFN-p1 and IFN-a, respectively, but appear to utilize similar induction pathways. The presence of an NF-KB site in their promoters and their strong up-
11 regulation by poly I:C, suggest that salmon IFN-a genes are induced through similar pathways as IFN~p. In contrast, the apparent lack of NF-KB motif in the promoter and the
strong up-regulation by ssRNA in head-kidney and leukocytes, suggest that IFN-b genes are induced through a pathway similar to mammalian IFN-a. IFN-c genes were shown to have different expression patterns from both IFN-a and IFN-b (Sun et al, 2009).
12 Figure 1.2. Viral nucleic acid sensors in the cytoplasm and endosomes, and their downstream signaling. (A) RIG-I- and Mda5-mediated signaling pathway. RIG-I and Mda5 interact with an adapter IPS-1. IPS-1 initiates intracellular signaling pathways leading to IRF3, NF-KB and AP-1 via TBKl/IKKi, IKKa/p and MAP kinases (MAPKs), respectively. (B) TLR3-mediated signaling pathway. Upon dsRNA binding to the LRR of TLRs the TIR domain interacts with the adaptor protein TRIF. TRIF interacts with TRAF3, TRAF6, and RIP 1. TRAF6 polyubiquitinates itself and RIP1 and this allows the formation of TRIF-RIP1-TRAF6-TAB-TAK1 complex that recruits the IKK complex. This allows the IKKP subunit of the IKK complex to be phosphorylated by TAK1, leading to the downstream phosphorylation of IKB, its subsequent ubiquitination and degradation and the eventual nuclear uptake of NF-KB. In contrast, TRAF3 is responsible for phosphorylation induced homodimerization and nuclear translocation of IRF3 (C) TLR7/8- and TLR9-mediated signaling pathway. After ligand ligation, TLR7/8- and 9 elicit the MyD88-dependent pathway. MyD88 forms a complex with IRAK-4, IRAK-1, TRAF3, and TRAF6. TRAF6 recruitment can activate NF-Kp through TAK1-TAB2- TAB3 and the canonical IKK complex. TRAF6 recruitment can also activate API through MAPKs. The MyD88-IRAK-l-IRAK-4-TRAF6 complex binds directly to IRF7 resulting in phosphorylation induced activation and nuclear translocation of IRF7. Activated IRF7 and NF-KP in the nucleus bind to regulatory DNA sequences to activate the promoter of type I IFNs and proinflammatory cytokines, respectively (Randall and Goodbourn, 2008).
13 1.4.1. Signaling pathways of IFN action
Host cells use either RNA helicases or the TLRs to sense viral replication nucleic acid intermediates and activate the expression of type I IFN genes. The action of expressed IFNs are initiated by binding of the protein to their cognate receptors on the surface of cells, which results in the activation of the JAK (Janus associated kinase)/STAT (signal transducers and activators of transcription) pathway (Goodbourn et ah, 2000). The type I IFN receptors (IFNAR) have two distinct subunits: IFNAR1 and
IFNAR2. IFNAR1 and IFNAR2 receptors are associated with tyrosine kinase 2 (TYK2) and JAK1 (Samuel, 2001). The binding of type I IFNs to IFNAR results in the transphosphorylation and activation of TYK2 and JAK1. TYK2 then phosphorylates the
IFNAR1 creating a new docking site for STAT-2. STAT-2 is next phosphorylated by
TYK2 and serves as a platform for the recruitment of STAT-1, which is subsequently phosphorylated. The phosphorylated STAT-1/2 heterodimers then dissociate from the receptors and are translocated to the nucleus to bind unphosphorylated IRF-9 to form ISG factor 3 (ISGF3), which initiates transcription of IFN stimulated genes (ISGs)
(Goodbourn et al., 2000). The ISGF3 complex is the only complex that binds specific elements known as IFN-stimulated response elements (ISRE) that are present in the promoters of certain ISGs, thereby initiating their transcription. There follows the induction of the IFN stimulated genes, ISG15, protein kinase R (PKR), oligo adenylate synthetase (OAS) and myxovirus resistance protein (Mx) among others (Randall and
Goodbourn, 2008).
14 1.4.2. Key genes of the Atlantic salmon type IIFN system
1.4.2.1. Signal transducers and activators of transcription 1
The signal transducers and activators of transcriptions (STATs) are a family of cytoplasmic transcription factors that mediate intracellular signaling initiated at cytokine cell surface receptors with dual functions of transducing signals and activating transcription (Stephanou and Latchman, 2005). Seven mammalian STAT proteins have been identified as STAT1-4, STAT5A, STAT5B, and STAT6 (Darnell et al, 1997;
Samuel, 2001). Structurally, each STAT protein shares a number of conserved domains for its function, including an ammo-terminal (N) domain, a coiled-coil domain, a DNA binding domain, a linker and an src-homology 2 (SH2) domain (Berg et al., 2008).
Among all the domains, SH2 domain is the most characteristic region of STAT proteins and is identified as a modular unit that binds specifically to phospho tyro sine (Kovarik et al., 2001). The SH2 domain is required for three critical STAT signaling events: (1) recruitment of the STAT to the cytokine receptor phosphotyrosine motifs (2) association of the STAT with the phosphorylating JAKs, and (3) for STAT hetero-/homo- dimerization and DNA binding. At the carboxy terminal end, the transcriptional activation domain activates the transcriptional functions of the various STAT proteins
(Kisseleva et al., 2002).
In fish STAT1 has been cloned and characterized in zebrafish (Oates et al.,
1999), channel catfish (Rycyzyn et al., 1998) grass carp (Carassius auratus)(Zhang and
Gui, 2004), and Atlantic salmon (Collet et al., 2008). Atlantic salmon STAT1 is 68% identical to the human STAT 1-a and contains a number of characteristic features of the
15 STAT family. In the kidney of infected salmon, STAT1 expression levels peaked at 6 and
4 days after injection with ISAV or IPNV, respectively (Collet et ah, 2008).
1.4.2.2. Mx proteins
The IFN induced Mx protein is one of the best-studied components of the
antiviral state induced by type I IFN in many species of animals (Haller and Kocks,
2002). The Mx family of GTPases was first identified as antiviral proteins in an inbred
mouse strain that showed an extraordinary high degree of resistance against infection
with influenza A viruses (Lindenmann, 1964; Horisberger et ah, 1983). The Mx proteins
are high molecular weight dynamin-like proteins with intrinsic GTPase activity. The
large GTPases are present in various cellular localizations where they perform a variety
of functions including endocytosis, intracellular vesicle transport, and mitochondria
distribution (MacMicking, 2004). Mx proteins possess a highly conserved N-terminal
GTPase domain containing the tripartite GTP binding consensus element, a central
interacting domain (CID) and a GTPase effector domain (GED)(also called Leucine
zipper motif)(Haller et al., 2007). Both the CID and GED domains are necessary to
recognize the viral target structures (MacMicking, 2004).
Viruses that are susceptible to the activities of Mx protein include
orthomyxovirus, paramyxovirus, rhabdovirus, togavirus, and bunyavirus (Sadler and
Williams, 2008). Although the antiviral mechanism of Mx proteins is still not known, in vivo experiments conducted by injecting viral nucleocapsids to Mx expressing cells show that Mx binds to viral nucleocapsids and blocks their intracellular transport (Haller and
Kocks, 2002). Mx protein genes have been cloned from several fish species (Robertsen,
2006). There are three Atlantic salmon Mx transcripts all encoding polypeptides of 623
16 amino acids and a molecular weight of about 71 kDa (Robertsen et al, 1997). The deduced polypeptide sequence alignment showed conserved typical tripartite GTP binding motif, which is conserved in all Mxl protein of vertebrates (Robertsen et al.,
1997). Constitutive expression of Atlantic salmon Mxl has been shown to inhibit the replication of IPNV (Larsen et al., 2004). Moreover, the interference of Mx protein on the replication of ISAV has been shown by the significant delay in development of cytopathic effect (CPE) and a reduction in the severity of CPE, as well as a 10-fold reduction in virus yield for CHSE-214 cells constitutively expressing Atlantic salmon Mx compared to normal CHSE-214 monolayers infected with ISAV (Kibenge et ah, 2005).
1.4.2.3. ISG15
ISG15 is one of the IFN-stimulated genes that contain ubiquitin-like domains
(Loeb and Haas, 1992). Upon IFN stimuli ISG15 is up-regulated and becomes conjugated to diverse cellular proteins by a process known as ISGylation (Korant et al., 1984).
ISG15 is a key player in the ISGylation process and the protein is expressed as 165 amino acid precursor that is subsequently processed to expose the C-terminal sequence
LRLRGG (Sadler and Williams, 2008). The diglycine residues within this motif are adenylated and conjugated by a thiol ester bond to cysteine residues of three enzymes: a ubiquitin activating enzyme (El), a ubiquitin conjugating enzyme (E2) and a ubiquitin ligase enzyme (E3), before being transferred to lysine residues of protein substrates (Kim et ah, 2004). Unlike ubiquitinylation, ISGylation does not promote degradation of the target protein; instead it parallels the activating effects of ubiquitination mediated by
K63-linked ubiquitin (Sadler and Williams, 2008). Many of ISG15 putative targets have important roles in the type I IFN response, including JAK1, STAT1, RIG-I, Mx, PKR,
17 and RNaseL (Zhao et al, 2005). The role of ISG15 in the antiviral activity of IFN
signaling against influenza virus has been showed in human cells (but not mouse cells)
treated with siRNAs targeting ISG15 (Hsiang et al, 2009). ISG15 was shown to inhibit
Sindbis virus infection in mice (Lenschow et al, 2005) and it has also been linked to IFN
mediated inhibition of HIV-1 replication (Okumara et al, 2006).
The ISG15 orthologue of Atlantic salmon showed increased mRNA expression
in response to poly I:C stimulation and ISAV infection (Rokens et al., 2007).
Immunoprecipitation of ISAV protein from infected TO cells using anti-Atlantic salmon
ISG15 antiserum suggests that binding between Atlantic salmon ISG15 and the ISAV
nucleoprotein occurred indicating the antiviral role of Atlantic salmon ISG15 in ISAV
infection of Atlantic salmon (Rokens et al., 2007).
1.4.2.4. PKR
A common response to virus induced cellular stress is to shut down protein
synthesis. The eIF2a kinases are activated by various stressors such as virus infection to
stop translation by phosphorylation induced inhibition of eukaryotic translation initiation
factor (elF) 2a, a protein involved in translation initiation. PKR is the most studied
member of the alpha subunit of eukaryotic initiation factor 2 (eIF2oc) specific kinase
subfamily. It is a serine/threonine kinase composed of a kinase domain and two dsRNA
binding domains that regulate its activity (Galabru and Hovanessian, 1987). PKR has two
kinase activities: autophosphorylation in response to binding of dsRNA with high affinity
and ssRNA with low affinity, and phosphorylation of eIF2a to impair protein synthesis
during virus infection (Garcia et al., 2007). Atlantic salmon PKR-like protein has Z-DNA binding domains instead of dsRNA binding domains in the regulatory domain, and has
18 thus been termed Z-DNA binding protein kinase (PKZ). PKZ mRNA expression showed up-regulation in response to stimulation by IFN in Atlantic salmon TO cells and poly I:C in Atlantic salmon head-kidney. Moreover, the recombinant Atlantic salmon PKZ, expressed in Escherichia coli phosphorylates eIF2a (Bergan et al., 2008).
1.5. Virus evasion of the type I IFN system
Coexistence of a virus and its immunocompetent host requires a balance between the rates of viral replication and viral clearance by the immune system for mutual survival. On one hand, the host's immune system employs a variety of strategies to eliminate the virus; on the other hand the virus has developed an array of immune evasion mechanisms to escape its elimination by the host's immune system. The mechanisms for viral immune evasion can broadly be divided into three categories. These mechanisms include strategies that (i) interfere with immune effector functions, for example the expression .of cytokines (ii) interfere with the functioning of the cellular immune response, for example by disabling peptide presentation or impairment of NK cell functions, and (iii) enable the virus to avoid recognition by the humoral immune response, for example by changing its immune-dominant epitopes (Vossen et al., 2002).
More than one hundred genes are known to be IFN responsive. Several of these genes have been shown to contribute to the antiviral state induced by IFNs. Most viruses have molecular mechanisms to override the IFN system, in many cases utilizing non structural viral proteins. These IFN antagonists are often multifunctional proteins that interact with multiple viral or host cell components and are involved in regulating many different functions in infected cells (Haller et al., 2006). There are several ways by which viruses circumvent the IFN response of which the main ones can be categorized into four.
19 First, several viruses have developed a mechanism of avoiding sensing of VAMPs or
inactivating the RNA helicases RIG-I and Mda5. Keeping the production of VAMPS to a
minimum can be done by using a replication strategy that minimizes the production of
VAMPs by: (a) tightly controlling virus transcription and replication to minimize the
production of VAMPs; (b) encapsidating both genomic and antigenomic RNA as, in the
case of negative-strand RNA viruses; protecting the 5' end of their mRNA from recognition by RIG-I; and (c) integrating their genomes into host chromosomes and thereafter using cellular machinery for virus transcription and replication as in retroviruses. The second mechanism of evasion is at the level of adaptor proteins required for downstream signaling of TLRs or the RNA helicases RIG-I, and Mda5. This includes the inhibition of TRIF, and IPS-1. The third mechanism of virus induced antagonism is at the level of transcription factors NF-KB and IRFs. The last two stages in which viruses antagonize the type I IFN system are at the level of IFN signaling and/or activation of
IFN stimulated antiviral effector proteins such as PKR, and ISG15 (Randall and
Goodbourn, 2008).
ISAV has been shown to up-regulate the transcripts of key type I IFN system genes, without being inhibited by the antiviral proteins (Kileng et al., 2007). Moreover, it has been shown that ISAV is able to replicate without inducing the activity of Atlantic salmon IFN promoter. Luciferase assays using IFN (Garcia-Rosado et al., 2008) and Mx promoters (McBeath et al., 2006) and transient co-transfection of segment 7 and segment
8 ORFs suggest segment 7 ORF1 and segment 8 ORF2 as major and minor IFN antagonizing proteins, respectively.
20 1.6. Infectious salmon anaemia virus
The orthomyxoviridae family consists of five genera namely: Influenzavirus A,
Influenzavirus B, Influenzavirus C, Isavirus and Thogotovirus (Kawaka et ah, 2005).
ISAV is the only species of the genus Isavirus. ISAV is a fish orthomyxovirus that causes a highly fatal clinical disease in Atlantic salmon. ISA was first recorded in 1984 in
Norway (Thorud and Djupvik, 1988) and subsequently reported in Canada (Byrne et al.,
1998; Mullins et ah, 1998), Scotland, U.K. (Bricknell et al, 1998), Faroe Islands
(Siggins, 2002), in the USA (Bouchard et al., 2001) and recently in Chile (Godoy et al.,
2008). ISA disease outbreaks have only been recorded in Atlantic salmon; although
ISAV has been detected in rainbow trout in Ireland (Siggins, 2002) and coho salmon (O. kisuutchi) in Chile (Kibenge et al., 2001a). In non susceptible salmonids, ISAV produces asymptomatic infection in experimental challenges, but in rainbow trout, some virulent
ISAV isolates have been shown to induce mortality (Kibenge et ah, 2006; Biacchesi et ah, 2007; MacWilliams et ah. 2007) suggesting host susceptibility and virus pathogenicity as determinants of the outcome for ISAV infection in fish (Kibenge et ah,
2006). Extensive literature review is available on the epidemiology and pathogenesis of
ISA in Kibenge et al. (2004) and Rimstad et al. (2007).
1.6.1. Genome coding assignment of ISAV
ISAV shares similar morphological, biochemical and physiochemical features with influenza viruses. ISAV particles are enveloped with a diameter of 90-140 nm
(Dannevig et ah, 1995). The genome of ISAV consists of eight segments of negative sense ssRNA ranging in length from 1.0 to 2.4 kb with total molecular size of approximately 14.3 kb (Clouthier et ah, 2002). The eight-genome segments of ISAV
21 code for at least 10 viral proteins (Kibenge et al, 2004). Table 1.1 shows genome coding assignments of the 8 RNA segments of ISAV. Using purified virus particles four major structural proteins including the matrix (22 kDa), nucleoprotein (66kDa), and two membrane glycoproteins haemagglutinin-esterase (HE)(42 kDa) and fusion protein (50 kDa) have been detected (Falk el al, 1997; Falk et al, 2004). Segments 1, 2 and 4 of
ISAV encode the polymerase proteins PB2 (84 kDa)(Snow et al, 2003), PB1 (84 kDa)(Krossoy et al, 1999), and PA (71 kDa)(Ritchie et al, 2001), respectively. Segment
3 codes for a nucleoprotein of 66-71 kDa (Aspehaug et al, 2004) that has been shown localized in the nucleolus of infected cells (Goic et al, 2008). ISAV RNA segment 5 codes for a type I membrane precursor fusion protein that is proteolytically cleaved to two fragments upon trypsin digestion. The cleaved protein is a metastable fusion activated state that can be activated by low pH, high temperature or high concentration of urea (Aspehaug et al., 2005). ISAV is unique among orthomyxoviruses in having a separate fusion protein. Segment 6 of ISAV encodes HE (Krossoy et al, 2001). HE is a major surface glycoprotein of ISAV with dual functions: the haemagglutinin portion is used for host cell recognition by attaching to the cellular sialic acid receptor for inducing infection through the endosomal pathway, whereas the esterase portion is a receptor destroying enzyme (RDE) that dissolves the haemagglutinin binding thereby allowing release of new virus particles from infected cells (Falk et al, 2004). ISAV segments 7
(Ritchie et al, 2002) and 8 encode two proteins each (Biering et al, 2002), although using immunoprecipitation assays with rabbit antiserum to ISAV, it was possible to demonstrate the existence of three proteins from segment 7 (Seg7 ORF1, and two alternatively spliced products - ORF1/2 and ORF1/3 - based on removal of introns from
22 the 0RF1 transcript)(Kibenge et al, 2007a). Seg7 ORF1 and ORF1/2 are structural proteins of ISAV (Kibenge et al, 2007a). The Seg7 ORF1/3 protein is a new protein of unknown status and function, and consists of the first 22 amino acids of the Seg7 ORF1 product with a 257 nucleotide intron spliced out so that the translation continues in the +3 reading frame for a total of 81 amino acids with a predicted molecular weight of 9.5 kDa
(Kibenge et al, 2007a). The Seg7 ORF1 product, one of the most variable of the ISAV genes characterized to date (Ritchie et al, 2002), was recently reported as an IFN- signalling antagonist but its mechanism of action was not established (McBeafh et al,
2006; Garcia-Rosado et al, 2008). Genomic segment 8 uses a bicistronic coding strategy with one protein identified as the virus matrix protein (Falk et al., 2004), and the second protein (Seg8 ORF2 product, Garcia-Rosado et al, 2008) as a structural protein having a predominantly nuclear localization and minor type I IFN antagonizing activity (Garcia-
Rosado et al, 2008).
23 Table 1.1. Viral proteins encoded by the ISAV genome
Segment of Protein name Protein size References ISAV (kDa) 1 Polymerase (PB2) 80 Clouthier et al, 2002; Snow et al, 2003 ; Kibenge ef a/., 2001a 2 Polymerase (PB1) 80.5 Krossoy et al, 1999 3 Nucleoprotein 66-71 Snow et al, 2001 ; Ritchie et al, 2001 ; Aspehaug et al, 2004 ; Falk et al, 2004; Kibenge et al, 2000 4 Polymerase (PA) 65.3 Clouthier et al, 2002 ; Ritchie et al, 2001 5 Fusion protein (F) 50 Clouthier et al, 2002; Aspehaug et al, 2005 6 Haemagglutinin- 42 Falk et al, 2004; Krossoy et al, esterase (HE) 2001;Rimstade?a/., 2001 7 7 0RF1 32.5 Biering et al, 2002; Kibenge et 7 ORF1/2 16 al, 2004, 2007a; Grifiths et al, 7 ORF1/3 Variable 2001 8 Matrix protein 22 Biering et al, 2002; Falk et al, 2004 8 0RF2 27 Clouthier et al, 2002; Garcia- Rosado et al, 2008
24 1.6.2. Molecular aspects of ISAV virulence
Virus virulence is a complex phenomenon involving the interaction of virions, the host and the environment (Burnet and Lind, 1954). Information on the virulence determinants of ISAV is emerging; however, influenza virus, that belongs to the same orthomyxovirus family and shares similarities in the physical, genetic, and biochemical properties with ISAV, has been well studied in this respect. In mammalian cells, factors that contribute to the virulence of avian influenza virus depend on all the steps of virus replication (Cinatl et al., 2007). Highly virulent influenza A viruses have alterations in the sequences of any of the viral proteins haemagglutinin (HA), neuraminidase (NA), the viral polymerase complex and the non-structural proteins (Baigent and McCauley, 2003).
Influenza virus infection is initiated by binding of the viral HA protein to the cellular membrane based N-acetylic neuraminidic acid (Flint et al., 2004). Virus replication requires release of viral RNA complexed with polymerase and ribonucleoprotein out of the virus particles through membrane fusion (Skehel and Wiley,
2000). A precursor HA molecule undergoes post-translational cleavage into HA1 and
HA2 subunits by host proteases with generation of a fusogenic domain at the amino terminus of HA2 that mediates fusion between the viral envelope and endosomal membrane (White et al., 1982). The HAs of low pathogenic avian viruses possess a single arginine at the cleavage site that is recognized by extracellular trypsin-like proteases (Murakami et al., 2001). For this reason the HA of low pathogenic influenza viruses is cleaved only in the respiratory and gastrointestinal tracts c ausing mild to asymptomatic infection. On the other hand, highly pathogenic avian viruses possess multiple basic amino acids at the cleavage site that are recognized by ubiquitous
25 intracellular proteases allowing those viruses to induce systemic infections (Stieneke-
Grober et al, 1992; Horimoto et al., 1994). A carbohydrate side chain near the cleavage site can also affect cleavability of HA by interfering with the accessibility of host proteases to the cleavage site (Kawaoka et al., 1984). All avian viruses lethal to humans have a highly cleavable HA and mutants of these highly pathogenic strain whose HA cleavage site has been changed to less cleavable type was attenuated in mice (Hatta et al.,
2001). These findings show that the factors affecting the cleavability of HA influence the virulence of avian influenza viruses. Interestingly the 1918 influenza virus HA does not have a multibasic cleavage site and possibly its own NA protein is involved in the cleavage of HA (Tumprey et al., 2005).
The influenza virus NA facilitates the mobility of virions by removing sialic acid residues from virus and infected cells during both entry and release from the cells
(Air and Laver, 1989). For a virulent virus the receptor-binding properties of HA should be functionally compatible to the cleavage specificity of NA and the stalk length of NA since release of virus from cell surface requires cleavage of the receptor by NA.
Incompatibility between HA and NA can restrict the virulence of reassortant viruses, while some combinations of HA and NA are associated with infection of certain host species (Kobasa et al., 2001). The NA stalk, which holds the active site above the virion envelope, varies in sequence and length (Blok and Air, 1982). A short-stalked NA is inefficient in disaggregating progeny virus particles because the active site cannot access its substrate efficiently. A shortened NA stalk reduces ability of virus to elute from erythrocytes (Els et al., 1985), can decrease virus growth in Madin-Darby Canine Kidney
26 Cells (MDCK) (Luo et ai, 1993) and embryonated chicken eggs, andean decrease virulence for mice (Castrucci and Kawaoka, 1993).
The third most studied factor of virulence in influenza virus is the non-structural protein 1 (NS1) protein that is encoded by the unspliced mRNA derived from RNA segment 8. The NS1 protein is a virulence factor in part due to its ability to antagonize the IFN-a/p response during influenza virus A infection (Garcia-Sastre et ai, 1998). NS1 prevents the synthesis of IFN-p by preventing the activation of transcription factors such as activating transcription factor 2 (ATF-2)/c-jun, NF-KB and IRF-3/7 and sequestering dsRNA to limit activation of PKR. The NS1 protein also binds and inhibits the function of two cellular proteins that are required for the modification of the 3' end of cellular mRNA (Randall and Goodbourn, 2008).
The fourth virulence factor in influenza virus is the polymerase complex which includes PB1, PB2, and PA proteins. The three polymerases are associated with each of the viral genome RNAs and copy these genomic RNAs in to viral mRNAs. PB2 amino acid 627 is a known determinant of replication efficiency (Naffakh et ai, 2000). For instance the substitution PB2 E627K was attributed to increased pathogenicity in avian
H5N1 influenza viruses isolated in 1997 in Hong Kong (Hatta et ai, 2001).
Studies suggest that ISAV isolates have differences in their pathogenicity for
Atlantic salmon hosts (Mjaaland et ai, 2005; Kibenge et ai, 2006; Ritchie et ai, 2009).
The HE protein, the F protein, the RDE and the IFN antagonistic proteins have been speculated for the virulence of ISAV (Rimstad et ai, 2007), and the virulence motifs of F and HE proteins have been uncovered (Kibenge et ai, 2007b).
27 The HE protein is a surface glycoprotein that is essential for the initial binding of ISAV to cellular sialic acid receptors (Helleb0 et al, 2004). The HE protein shows the highest sequence variability (Kibenge et al, 2001b; Mjaaland et al, 2002; Mjaaland et al, 2005) and most of the variation in this protein is concentrated to a 35-amino acid small highly polymorphic region (HPR) in the stem region of HE near the transmembrane domain (Kibenge et al., 2001b; Cunningham et al., 2002), which has been suggested to result from differential deletions of a full-length avirulent precursor gene (HPR0) resulting in more or less pathogenic viruses (Mjaaland et ah, 2002). Virus isolated from
ISAV diseased fish contains gaps in their HPR compared to the HPR0 virus. The presence of ISAV HPR0 isolate has been confirmed in healthy wild and farmed Atlantic salmon (Cunningham et al., 2002; Cook-Versloot et al., 2004) and its detection in sick fish has been associated only with proliferative gill inflammation (Nylund et al., 2007).
There are currently 24 HPR groups among European ISAV isolates and 4 HPR groups among North American isolates (Rimstad et al., 2007). There are at least 28 distinct HE-
HPR variants associated with the ISA outbreaks in Chile (Kibenge et al, 2009). The HPR of HE protein most likely represents an important virulence marker although the virulence of ISAV is not only determined by the deletions in the HPR because virus isolates with identical HPR vary in their virulence (Mjaaland et al, 2005; Kibenge et al,
2006).
Kibenge et al. (2007b) analyzed the full length sequence of the HE protein of
13 isolates of ISAV belonging to European and North American genotypes that have been characterized for their pathogenicity phenotypes (Kibenge et al, 2006). Based on the results of the sequence analysis and correlation with growth properties of the isolates
28 in cell culture, it was hypothesized that the number of amino acids deleted/inserted and/or mutations of the 352FNT354 motif in the HPR of the HE protein are determinants of IS AV virulence. A pattern observed from sequence analysis data is that HPRO (non-cultivable isolates) do not have deletions in the HPR of the HE protein, whereas less pathogenic isolates with <13 amino acid deletions but with the 352FNT354 motif have reduced cycles of infection. On the extreme side, most ISAV isolates with >13 amino acid deletions (or if less with deletions or mutations of the 352FNT354 motif appear to be highly pathogenic
(Kibenge et al, 2007b).
A portion of the HE protein is an esterase that carries out the RDE activity in
ISAV (Hellebo et al, 2004). The function of the RDE is to cleave the receptor binding and its major function is associated with the release of new virus particles from infected cells and to prevent agglutination of these particles from infected cells. ISAV haemagglutinates erythrocytes from several fish species including Atlantic salmon. RDE activity dissolved the haemagglutinations for all erythrocytes that were agglutinated by
ISAV except for Atlantic salmon erythrocytes. The inability of RDE to dissolve the haemagglutinations of salmon erythrocytes may be importance for ISAV virulence and pathogenesis since virus isolates that show RDE activity with salmon erythrocytes seem to be less virulent (Falk and Dale, 2006).
In ISAV, the proposed fusion peptide at the N-terminus of the F2 subunit spanning amino acids 277-292 is highly conserved within virus families (Aspehaug et al.,
2005). By comparing the amino acid sequence of the fusion protein from 13 ISAV isolates, Kibenge et al. (2007b) identified a virulence marker motif (265YP 66) close to the
F protein cleavage site. A similar observation has been reported by Markussen et al.
29 (2008). The YP mutations may alter the the cleavage site to become less accessible
to proteases and so prevent cleavage or make cleavage less efficient. This in turn possibly
limits the fusion capacity of ISAV to host cell membranes thereby affecting the virulence
of the virus.
The segment 7 ORF1 and segment 8 ORF2 proteins of ISAV have been reported to be major and minor IFN system antagonizing proteins (McBeath et ah, 2006;
Garcia-Rosado et ah, 2008), respectively. These IFN antagonizing proteins of ISAV are essential to reduce the expression of innate immune response genes allowing the virus to replicate robustly. Markussen et ah (2008) observed high percentages of amino acid substitutions in gene segments 7 and 8 of ISAV isolates. Those substitutions in the amino acid sequences might result in functional differences in the IFN antagonizing proteins which may contribute to virulence of ISAV isolates.
1.6.3. Immunology of ISAV infections
Atlantic salmon have been showed to respond to ISAV infection by up- regulating both the innate (Kileng et ah, 2007; McBeath et ah, 2007) and adaptive immune response genes (J0rgestein et ah, 2007). The importance of the adaptive humoral response to ISAV was demonstrated by passive immunization studies (Falk and
Dannevig, 1995a). Increased resistance of Atlantic salmon to ISAV re-infection (Ritchie et ah, 2009) or after passive immunization with serum from ISA recovered fish (Falk and
Dannevig 1995a), or following vaccination with inactivated virus has been documented
(Jones et ah, 1999a; Brown et ah, 2000). Teleost fish have only two immunoglobulin heavy chain isotypes: IgM and IgD (Whyte et ah, 2007). Farmed Atlantic salmon show two different types of antibody responses to ISAV in that naturally infected ISAV RT-
30 PCR positive Atlantic salmon show a specific antibody response to ISAV suggestive of chronic infection or resistance to ISAV while those fish that were RT-PCR negative had elevated non-specific antibody reactivity (Kibenge et al, 2002). The anti-ISAV antibodies produced by Atlantic salmon target the HE protein (Clouthier et al, 2002).
Early stage infection of ISAV is characterized by rapid up-regulation of the MHC class I pathway but not the MHC class II genes suggesting that the CD8+ T cell response is responsible for lysis of ISAV infected cells (Jorgensen et al, 2007).
1.6.4. Diagnosis of ISA
ISA diagnosis is based on clinical and pathological findings, isolation of the virus in cell culture followed by immunological detection (Dannevig et al, 1995), antibody- based demonstration of ISA virus antigen in tissues and reverse transcription- polymerase chain reaction (RT-PCR) techniques (Mjaaland et al, 1997). Patho-morphological evaluation is based on histopathological visualization of formalin-fixed paraffin- embedded tissue sections (Evensen et al, 1991) and/or electron microscopy (Hovland et al., 1994). Virus isolation from infected fish is usually performed using CHSE-214
(Bouchard et al., 1999), salmon head kidney-1 (SHK-l)(Dannevig et al, 1995) and/or
Atlantic salmon kidney-2 (ASK-2) cells (Rolland et al, 2003; Rolland et al, 2005).
SHK-1 and ASK-2 cells are macrophage-like cells cultured from head kidney of Atlantic salmon (Dannevig et al, 1995; Rolland et al, 2005). CHSE-214 cells were generated from minced Chinook salmon embryo tissue (Fryer et al, 1965).
Demonstration of ISA virus antigens includes detection using anti-ISAV antibodies on tissue cryosections, tissue imprints and cell culture samples using indirect fluorescent antibody test (IFAT)(Falk and Dannevig, 1995b), or lateral flow kit (a
31 chromatographic immunoassay kit)(Aquatic Diagnostics) on formalin-fixed paraffin- embedded tissue sections using immunohistochemistry, and in-situ hybridization on tissue samples from suspected fish (Gregory, 2002; Moneke et ah, 2003; 2005).
RT-PCR detects ISAV genetic material and is rapid, and specific (Mjaaland et ah,
1997). Different applications of this method have been described including applications using the improved QRT-PCR methods (Munir and Kibenge, 2004; Snow et ah, 2006).
Fish serology could be important for detecting asymptomatic virus carriers among fish stocks for various viral diseases but is not yet validated and no serological detection test is yet approved by regulatory authorities (Kibenge et al., 2002). However, an indirect enzyme linked immunosorbent assay (ELISA) that detects ISAV specific antibodies in the sera of infected and/or vaccinated fish have been described (Kibenge et al., 2002).
1.6.5. Control of ISA
ISA disease control involves use of vaccines and general husbandry practices.
Vaccination against ISAV is considered to be a very important strategy in controlling the disease by protecting Atlantic salmon followed by eradication strategies. One vaccine, based on inactivated whole ISA virus particles of Canadian isolates, is currently available for use in farmed Atlantic salmon in Canada, the USA, Faroe Islands, and most recently in Chile (Jones et al., 1999a; Brown et al., 2000). This vaccine does not clear the virus in immunized fish, which may become virus carriers (Kibenge et ah, 2003). Immunization against ISA using plasmids expressing the ISAV HE demonstrated moderate protection after challenge with ISAV. Although fish in the HE-immunized group had earlier onset of virus clearance than control fish, there was no detectable ISAV specific humoral response after immunization. However, a specific humoral response was demonstrated in the fish
32 in all groups after challenge, but no correlation between this response and protection was found (Mikalsen et ah, 2005). A US patent (patent no-7183404) was granted to a DNA vaccine for ISAV. This vaccine was generated by cloning the cDNA sequence encoding immunogenic ISAV proteins into mammalian expression vectors for expression in
Atlantic salmon upon injection of the recombinant plasmid DNA (pDNA). Within the
European Union vaccination of aquaculture stocks is not permitted and policy for controlling ISAV outbreaks consists of other measures (Rimstad et ah, 2007).
ISA is transmitted from fish to fish horizontally by contact with infected fish or fish parts, contact with equipment contaminated by infected fish or people who handled infected fish and fish products from infected sites (Rolland and Nylund, 1999).
Therefore, the incidence of ISA may be greatly reduced by implementation of legislatory measures or husbandry practices regarding the movement of fish, mandatory health control, and transport and slaughterhouse regulations. Specific measures including restrictions on affected, suspected and neighbouring farms, enforced sanitary slaughtering, generation segregation ('all in/all out') as well as disinfection of offal and wastewater from fish slaughterhouses and fish processing plants may also contribute to reducing the incidence of the disease. Further spread of the ISAV may be managed by control of ship or boat and personnel movements among sites, destruction of infected fish groups, and fallowing of contaminated sites (Cipriano, 2002).
1.7. Quantitative real-time reverse transcriptase-polymerase chain
reaction
QRT-PCR is a sensitive method to quantify the mRNA expression of different genes that are often expressed at very low levels (Giulietti et ah, 2001). It is used to
33 define the exponential phase of a PCR that is accurate for calculation of the initial copy number at the beginning of the reaction (Bustin et al, 2005). There are two main chemistries most commonly used for detection of PCR products during QRT-PCR. These are the DNA binding fluorophore SYBR® Green I (Simpson et al, 2000), and the sequence-specific fluorescently labeled TaqMan probes (Holland et al, 1991). SYBR green is widely used detection chemistry since the early days of QRT-PCR development.
SYBR green has an undetectable fluorescence when it is in free form, but once bound to dsDNA it emits fluorescence when exposed to a blue light (Guilietti et al, 2001). The amount of emitted fluorescence detected is proportional to the amount of PCR product and this enables monitoring of the PCR in real-time PCR instruments. Thus, the more copies of the target are at the beginning of the assay the fewer cycles of amplification are required to generate the number of amplicons that can be detected reliably (Bustin et al.,
2005). Reactions are characterized by the point in time where the target amplification is first detected. This value is usually referred to as the cycle threshold value (Ct), the time at which fluorescence intensity is greater than the background fluorescence. Therefore, the greater the quantity of starting material, the faster a significant increase in fluorescent signal will appear, yielding a lower Ct (Ginizinger, 2002). QRT-PCR using SYBR green and TaqMan chemistries has been developed for use in research and diagnosis of ISAV infections (Munir and Kibenge, 2004; Snow et al, 2006)
1.8. Use of microarrays in gene expression analysis
The use of microarray to., analyze gene expression on a global level has recently received a great deal of attention (Bryant et al, 2004). DNA microarrays exploit the unique feature of ssDNA to hybridize to its complementary DNA sequences, thereby
34 allowing sequence specific identification of DNA. DNA microarray is unique to other hybridization technologies in that the earlier hybridization techniques allow analysis of one or a few genes, while DNA microarray allows analysis of thousands of genes using
DNA chips that have DNA sequences systematically affixed to a solid support (Schena et al, 1995).
DNA microarrays consist of nucleic acid probes on the surface of a solid support. There are two types of probes available for printing in to a glass surface or on nylon membrane: complementary DNA (cDNA), and oligonucleotides. Probes for cDNA microarrays are typically PCR products generated from cDNA libraries or clone collections generated using either vector specific or gene specific primer, and are spotted onto glass slides or nylon membranes at defined locations (Cheung et al., 1999). Using this technique, arrays consisting of more than 30,000 cDNAs can be fitted onto the surface of a conventional microscopic slide. For oligonucleotide arrays, short 20-25mers are either spotted on mechanically or - more often - are synthesized in loco on the glass surface (Schulze and Downward, 2001).
Most of the time the biologic sample for hybridization with the DNA microarray is derived from RNA extracted from tissue. The purified RNA is reverse transcribed into cDNA, which is labelled commonly with fluorophores. The labelled target cDNA is hybridized to the probes on the microarray for 16-24 hr, then washed and scanned thereafter (Khan et al., 1999). The fluorescent intensity of the immobilized target
DNA is measured with a laser confocal microscope, and the fluorescent image is obtained with excitation and emission filters specific for the wavelength used. In the 2-color hybridization approach, different filters for each sample are applied and the intensities of
35 both DNA targets are compared with each other and expressed as a ratio value (Schulze and Downward, 2001).
To date, microarray-based analyses of host response to ISAV have been limited only to highly pathogenic virus isolates using a salmonid microarray containing only
1,800 different cDNAs selected for their putative immune response and inflammation related functions (SFA2.0 immunochip, GEO GPL6154)(j0rgensen et al, 2008; Schiotz era/., 2008).
1.9. RNA Interference
RNA interference (RNAi) refers to the phenomenon of posttranscriptional or transcriptional gene silencing in response to the introduction of dsRNA into a cell (Fire et al., 1998). Small interfering RNAs (siRNAs), which are produced endogenously from cleavage of long dsRNA molecules, elicit gene silencing via targeted mRNA degradation as part of the RNAi pathway. There is a long list of small regulatory RNAs; however, siRNAs, and microRNAs (miRJMAs) are the common ones (Ambros, 2004). siRNAs are
20-24 nucleotide long dsRNA generated by dicer processing of long dsRNA and typically have perfect complementarity to their target mRNA. Mammalian miRNAs are 20-24 nucleotide long RNA generated from hairpin RNAs with the stem-loop structure and unlike their plant counterparts contain mismatches to their usual untranslated regions of target mRNA (Tolia and Joshua-Tor, 2007).
RNAi is a natural biological mechanism that results in a highly specific suppression of gene expression in most cells of many living organisms, from plants to arthropods, nematodes to chordates. Despite the absence of fully elucidated mechanisms,
RNAi represents the result of a multistep process. Once inside the cell, long dsRNAs are
36 processed by the RNAse III enzyme Dicer (Wadhwa et al, 2004). Following that RNAi is mediated by the RNA-induced silencing complex (RISC) which, guided by one strand of the siRNA, recognizes mRNA containing a sequence homologous to the siRNA
(Mocellin and Provenzano, 2004). RISC is a multi-component complex involving elongation factor (elf) 2C1, elf2C2, RNA helicase Gemin3 and Gemin4 (Wadhwa et al.,
2004). The key component of the RISC complex is the Argonaute protein. It is the sheer enzyme of the RNAi effector complex. Once the siRNA is loaded to Argonautes, the mechanism of Argonaute slicing probably involves Mg +-activated water molecule that performs nucleophilic attack of the phosphate that proceeds through a pentavalent intermediate (Faehnle and Joshua-Tor, 2007). Following the collapse of this high-energy intermediate a 5' product RNA with a 3' hydroxyl and 3' product carrying a 5' phosphate is released. This mRNA initially cleaved by the RISC is further digested by the cellular exonuclease activity thereby inducing the posttranscriptional gene silencing (Wadhwa et al, 2004).
The physiological mechanism of RNAi has been utilized for silencing of genes in vivo and in vitro. RNAi can be triggered by two different strategies: 1) RNA-based approach where the effector siRNAs are delivered to target cells as preformed 21 base duplexes; or 2) a DNA based strategy in which the siRNA effectors are produced by intracellular processing of longer RNA hairpin transcripts. The latter approach is primarily based on nuclear synthesis of short hairpin RNAs (shRNAs) that are transported to the cytoplasm via the miRNA machinery and are processed into siRNAs by Dicer (Aagaard et al., 2007). RNAi have been of considerable interest for the treatment of viral diseases and as a tool for studying the various steps of virus replication
37 cycle, but has never been applied to study ISAV replication (Colbere-Garapin et al.,
2005). However, RNAi has been used to block the replication of the fish virus viral haemorrhagic septicemia virus (Ruiz et al., 2009).
1.10. Rationale and objectives
ISAV continues to cause high economic losses to the Atlantic salmon farming countries of the world. ISA in marine-farmed Atlantic salmon is characterized by variable mortality with ascites, exophthalmia, petechiation of the visceral adipose tissue, haemorrhagic liver necrosis, renal interstitial haemorrhage and tubular nephrosis, filamental sinus congestion of the gills, splenic congestion with concomitant erythrophagocytosis, and congestion of the lamina propria of the stomach and foregut
(Thorud and Djupvik, 1988; Jones et al, 1999b). The clinical disease caused by ISAV in marine-farmed Atlantic salmon is associated with anaemia (Evensen et al., 1991), which is mainly due to hemorrhages associated with endothelial cell damage (Kibenge et ah,
2004). Previous studies have shown that there is variation in pathogenicity among ISAV isolates for Atlantic salmon and rainbow trout (Kibenge et al., 2006). When the ability to kill fish was compared with virus growth in cell culture, the highly pathogenic isolates were more aggressive, inducing CPE sooner and more completely in most cell lines than the less pathogenic ISAV isolates, although these in vitro markers were not absolute
(Kibenge et al, 2006; 2007b). Virulence of influenza virus isolates has mainly been associated with the haemagglutinin, NA, F and NS1 proteins (Neumann et al., 2006). In
ISAV the HE and F protein virulence marker motifs have been identified (Kibenge et al.,
2007b; Markussen et al., 2008). In addition, the HE protein was associated with the
38 virulence of the virus in that virus isolates that were able to elute caused low mortality in a challenge experiment (Falk and Dale, 2006).
The long-term goal of this project is to characterize the early events of ISAV infections in order to better understand the host susceptibility to clinical infection in fish.
The main objectives of this research project are: 1) to investigate how ISAV isolates of differing pathogenicity interact with Atlantic salmon erythrocytes (2) to determine the global host transcriptome responses and type IIFN system transcriptional profiles of fish cells when infected with different ISAV isolates; and (3) to identify the key ISAV proteins that exert potential IFN antagonistic effects during virus infection. The work in the proposed research project was carried out as follows:
(i) Develop absolute quantification QRT-PCR method that can be used to relate
ISAV copy number to median infectious titer in cell culture using high and
low pathogenic isolates of ISAV.
(ii) Study the physical interaction of ISAV with Atlantic salmon erythrocytes
during ISAV induced haemagglutinations.
(iii) Study the ISAV replication and induction of type I IFN system genes using
Atlantic salmon erythrocytes and ISAV isolates of high and low
pathogenicity,
(iv) Study the expression of key type I IFN system genes in Atlantic salmon cells
(erythrocytes, and TO and CHSE-214 cell lines) infected with different ISAV
isolates.
39 (v) Identify the key ISAV proteins that exert potential IFN antagonistic effect
during virus infection,
(vi) Study the expression of microarray identified ISAV infection marker genes in
Atlantic salmon TO cells in response to different ISAV isolates.
40 1.11. REFERENCES
Aagaard L, Rossi JJ. RNAi therapeutics: principles, prospects and challenges. Adv Drug Deliv Rev 2007;59:75-86.
Air GM, Laver WG. The neuraminidase of influenza virus. Proteins 1989;6:341-56. Akira S, Uematsu S, Takeuchi O. Pathogen recognition and innate immunity. Cell 2006;124:783-801.
Altmann SM, Mellon MT, Distel DL, Kim CH. Molecular and functional analysis of an interferon gene from the zebrafish, Danio rerio. J Virol 2003;77:1992-2002.
Ambros V. The functions of animal microRNAs. Nature 2004;431:350-355.
Aspehaug V, Mikalsen AB, Snow M, Biering E, Villoing S. Characterization of the infectious salmon anaemia virus fusion protein. J Virol 2005;79:12544-53.
Aspehaug V, Falk K, Krossoy B, Thevarajan J, Sanders L, Moore L, Endresen C, Biering E.. Infectious salmon anemia virus (ISAV) genomic segment 3 encodes the viral nucleoprotein (NP), an RNA-binding protein with two monopartite nuclear localization signals (NLS). Virus Res 2004;106:51-60.
Baigent SJ, McCauley JW. Influenza type A in humans, mammals and birds: determinants of virus virulence, host-range and interspecies transmission. BioEssays 2003;25:657-671.
Bergan V, Jagus R, Lauksund S, Kileng 0, Robertsen B. The Atlantic salmon Z-DNA binding protein kinase phosphorylates translation initiation factor 2 alpha and constitutes a unique orthologue to the mammalian dsRNA-activated protein kinase R. FEBS J 2008;275:184-97.
41 Berg T. Signal transducers and activators of transcription as targets for small organic molecules. ChemBioChem 2008;9:2039-44.
Biacchesi S, Le Berre M, Benmansour A, Bremont M, Quillet E, Boudinot P. Fish genotype significantly influences susceptibility of juvenile rainbow trout, Oncorhynchus mykiss (Walbaum), to waterborne infection with infectious salmon anaemia virus. J Fish Dis 2007;30:631-636.
Biering E, Falk K, Hoel E, Thevarajan J, Joerink M, Nylund A, Endresen C, Krossoy B. Segment 8 encodes a structural protein of infectious salmon anaemia virus (ISAV); the co-linear transcript from Segment 7 probably encodes a non-structural or minor structural protein. Dis Aquat Org 2002;49:117-22.
Bilodeau AL, Waldbieser GC. Activation of TLR3 and TLR5 in channel catfish exposed to virulent Edwardsiella ictaluri. Dev Comp Immunol 2005;29:713-721.
Bonjardim CA, Ferreira PCP, Kroo EG. Interferons: Signaling, antiviral and viral evasion. Immunol Lett 2009;122:1-11.
Bouchard DA, Brockway K, Giray C, Keleher W, and Merrill PL. First report of infectious salmon anaemia (ISA) in the United States. Bull Eur Assoc Fish Pathol 2001;21;86-88.
Bouchard D, Keleher W, Opitz HM, Blake S, Edwards KC, Nicholson BL. Isolation of infectious salmon anemia virus (ISAV) from Atlantic salmon in New Brunswick, Canada. Dis Aquat Org 1999;35:131-137
Blok J, Air GM. Variation in the membrane-insertion and 'stalk'sequences in eight sub types of influenza type A virus neuraminidase. Biochemistry 1982;21:4001-4007.
42 Brand S, Beigel F, Olszak T, Zitzmann K, Eichhorst ST, Otte JM, Goeke B, Diepolder H, Adler B, Auernhammer C, Dambacher J. The novel lambda-interferons IL-28A and IL-29 mediate proinflammatory, antiproliferative, and antiviral signals in intestinal epithelial cells. Gastroenterology 2005;129:371.
Bricknell IR, Bruno DW, Cunningham CO, Hastings TS, McVicar AH, Munro PD, Raynard RS, Stagg RM. Report on the first occurrence of infectious salmon anemia (ISA) in Atlantic salmon {Salmo salar) in Scotland, United Kingdom. In: Proc 3rd Int Symp Aquatic Animal Health, Baltimore. APC Press, Baltimore, MD, 1998.
Brown LL, Sperker SA, Clouthier S, Thornton JC. Development of a vaccine against infectious salmon anaemia virus (ISAV). Bull Aqua Assoc Canada 2000;100:4-7.
Bryant P, Venter D, Robins-Browne R, Curtis N. Chips with everything: DNA microarrays in infectious diseases. The Lancet Infect Dis 2004;4:100-111.
Burnet M, Lind PE. Genetics of virulence in influenza viruses. Nature 1954; 173:627- 630.
Bustin SA, Benes V, Nolan T, Pfaffl MW. Quantitative real-time RT-PCR- a perspective. J Mol Endo 2005;34:597-601.
Byrne PJ, MacPhee DD, Ostland VE, Johnson G, Ferguson HW. Haemorrhagic kidney syndrome of Atlantic Salmon, Salmo salar L. J Fish Dis 1998;21:81-91.
Castrucci MR, Kawaoka Y. Biologic importance of neuraminidase stalk length in influenza A virus. J Virol 1993;67:759-764.
Cheung VG, Morley M, Aguilar F, Massimi A, Kucherlapati R, Childs G. Making and reading microarrays. Nat Genet 1999;21:15-19.
43 Cinatl J, Michaelis M, Doerr HW. The threat of avian influenza A (H5N1). Part I: Epidemiologic concerns and virulence determinants. Med Microbiol Immunol 2007;196:181-190.
Cipriano RC. Infectious Salmon Anemia Virus. Fish Disease Leaflet # 85, United States Geological Survey, National Fish Health Research Laboratory, Kearneysville, WV, USA, 2002.
Clouthier SC, Rector T, Brown NE, Anderson ED. Genomic organization of infectious salmon anaemia virus. J Gen Virol 2002;83:421-428.
Cook-Versloot M, Griffith S, Cusack R, McGeachy S, Richie R. Identification and characterization of infectious salmon anaemia virus (ISAV) haemagglutinin gene highly polymorphic region (HPR) type 0 in North America. Bull Eur Assoc Fish Pathol 2004;24:203-208.
Colbere-Garapin F, Blondel B, Saulnier A, Pelletier I, Labadie K. Silencing viruses by RNA interference. Microbes Infect 2005;7:767-775.
Collet B, BainN, Prevost S, Besinque G, McBeath A, Snow M, Collins C. Isolation of an Atlantic salmon (Salmo salar) signal transducer and activator of transcription STAT1 gene: Kinetics of expression upon ISAV or IPNV infection. Fish Shellfish Immunol 2008;25:861-867.
Cunningham CO, Gregory A, Black J, Simpson I, Raynard RS. A novel variant of the infectious salmon anemia virus (ISAV) haemagglutinin gene suggests mechanisms for virus diversity. Bull Eur Assoc Fish Pathol 2002;22:366-374.
Dannevig BH, Falk K, Namork E. Isolation of the causal virus of infectious salmon anaemia (ISA) in a long-term cell line from Atlantic salmon head kidney. J Gen Virol 1995;76:1353-1359.
44 Darnell JE. STATs and gene regulation. Science 1997;277:1630-1635.
Deng L, Wang C, Spencer E, Yang L, Braun A, You J, Slaughter C, Pickart C, Chen ZJ. Activation of the IKB kinase complex by TRAF6 requires a dimeric ubiquitin-conjugating enzyme complex and a unique polyubiquitin chain. Cell 2000;103:351-361.
Dios S, Poisa-Beiro L, Figueras A, Novoa B. Suppression subtraction hybridization (SSH) and macroarray techniques reveal differential gene expression profiles in brain of sea bream infected with nodavirus. Mol Immunol 2007;44:2195-2204.
Els MC, Air GM, Murti KG, Webster RG, Laver WG. An 18-amino acid deletion in an influenza neuraminidase. Virology 1985;142:241-247.
Evensen O, Thorud KE, Olsen YA. A morphological study of the gross and light microscopic lesion of infectious salmon anemia in Atlantic salmon (Salmo salar L.). Res VetSci 1991;51:215-222.
Faehnle CR, Joshua-Tor L. Argonautes confront new small RNAs. Curr Opin Chem Biol 2007;11:569-577.
Falk K, Dale OB. Experimental evidence indicating that lack of viral receptor destroying enzyme is a major factor for infectious salmon anemia pathogenesis. Abstr Fifth International Symposium on Aquatic Animal Health, California USA, 2006.
Falk K, Dannevig BH. Demonstration of protective immune response in infectious salmon anaemia (ISA) infected Atlantic salmon Salmo salar. Dis Aquat Org 1995a;21:l- 5.
Falk K, Dannevig BH. Demonstration of infectious salmon anaemia virus (ISA) viral antigens in cell cultures and tissue sections.Vet Res 1995b;26:499-504.
45 Falk K, Asperhaug V, Vlasak R, Endresen C. Identification and characterization of viral structural proteins of infectious salmon anemia virus. J Virol 2004;78:3063-3071.
Falk K, Namork E, Rimstad E, Mjaaland S, Dannevig BH. Characterization of infectious salmon anemia virus, an orthomyxo-like virus isolated from Atlantic salmon (Salmo salar L.). J Virol 1997;71:9016-9023.
Fire A, Xu SQ, Montgomery MK, Kostas SA, Driver SE, Mello CC. Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans. Nature 1998;391:806-811.
Flint SJ, Enquist LW, Krug RM, Racaniello VR, Skalka AM. Principles of Virology: Molecular biology, pathogenesis, and control of animal viruses. ASM Press, Washington, DC, 2004.
Fryer JL, Yusha A, Pilcher KS. The in vitro cultivation of tissue and cells of Pacific salmon and steelhead trout. Ann NY Acad Sci 1965;126:566-586.
Galabru J, Hovanessian A. Autophosphorylation of the protein kinase dependent on double-stranded RNA. J Biol Chern 1987;262:15538-15544.
Garcia MA, Meurs EF, Esteban M. The dsRNA protein kinase PKR: Virus and cell control. Biochimie 2007;89:799-811.
Garcia-Rosado E, Markussen T, Kileng 0, Baekkevold ES, Robertsen B, Mjaaland S, Rimstad E. Molecular and functional characterization of two infectious salmon anaemia virus (ISAV) proteins with type I interferon antagonizing activity. Virus Res 2008;133:228-238.
46 Garcia-Sastre A, Egorov A, Matassov D, Brandt S, Levy DE, Durbin JE, Palese P, Muster T. Influenza A virus lacking the NS1 gene replicates in interferon-deficient systems. Virology 1998; 252:324-330.
Gitlin L, Barchet W, Gilfillan S, Cella M, Beutler B, Flavell RA, Diamond MS, Colonna M. Essential role of mda-5 in type I IFN responses to polyriboinosinic:polyribocytidylic acid and encephalomyocarditis picornavims. Proc Natl Acad Sci, USA 2006;103:8459- 8464.
Giulietti A, Overbergh L, Valckx D, Decallonne B, Bouillon R, Mathieu C. An overview of real time quantitative PCR: applications to quantify cytokine gene expression. Methods 2001;25:386-401.
Godoy MG, Aedo A, Kibenge MJT, Groman DB, Yason CV, Grothusen H, Lisperguer A, Calbucura M, Avendano F, Imilan M, Jarpa M, Kibenge FSB. First detection, isolation and molecular characterization of infectious salmon anaemia virus associated with clinical disease in farmed Atlantic salmon (Salmo salar) in Chile. BMC Vet Res 2008;4:28.
Goodbourn S, Didcock L, Randall RE. Interferons: cell signaling, immune modulation, antiviral response and virus countermeasures. J Gen Virol 2000;81:2341-2364.
Goic B, Bustamante J, Miquel A, Alvarez M, Vera MI, Valenzuela PDT, Burzio LO. The nucleoprotein and the viral RNA of infectious salmon anemia virus (ISAV) are localized in the nucleolus of infected cells. Virology 2008;379:55-63.
Gregory A. Detection of infectious salmon anaemia virus (ISAV) by in situ hybridization. Dis Aquat Org 2002;50:105-110.
Griffiths S, Cook M, Mallory B, Ritchie R. Characterization of ISAV proteins from cell culture. Dis Aquat Org 2001;45:19-24.
47 Hacker H, Redecke V, Blagoev B, Kratchmarova I, Hsu LC, Wang GG, Kamps MP, Raz E, Wagner H, Hacker G, Mann M, Karin M. 2006. Specificity in Toll-like receptor signalling through distinct effector functions of TRAF3 and TRAF6. Nature 2006;439:204-7.
Haller O, Kocks G. Interferon induced Mx proteins: Dynamin like GTPases with antiviral activity. Traffic 2002;3:710-717.
Haller O, Kochs G, Weber F. The interferon response circuit: induction and suppression by pathogenic viruses. Virology 2006;344:119-130.
Haller O, Stertz S, Kochs G. The Mx GTPase family of interferon-induced antiviral proteins. Microbes Infect 2007;9:1636-43.
Hatta M, Gao P, Halfmann P, Kawaoka Y. Molecular basis for high virulence of Hong Kong H5N1 influenza A viruses. Science 2001;293:1840-1842.
Helleb0 A, Vilas U, Falk K, Vlasak R. Infectious salmon anemia virus specifically binds to and hydrolyses 4-O-acetylated sialic acids. J Virol 2004;78:3055-62.
Hemmi H, Takeuchi O, Kawai T, Kaisho T, Sato S, Sanjo H, Matsumoto M, Hoshino K, Wagner H, Takeda K, Akira SA. Toll-like receptor recognizes bacterial DNA. Nature 2000;408:740-745.
Holland PM, Abramson RD, Watson R, Gelfand DH. Detection of specific polymerase chain reaction product by utilizing the 5-3 exonuclease activity of Thermus aquaticus DNA polymerase. Proc Natl Acad Sci, USA 1991;88:72-76.
Honda K, Takaoka A, Taniguchi T. Type I interferon gene induction by the interferon regulatory factor family of transcription factors. Immunity 2006;25:349-360.
48 Horimoto T, Nakayama K, Smeekens SP, Kawaoka Y. Proprotein-processing endoproteases PC6 and furin both activate hemagglutinin of virulent avian influenza viruses. J Virol 1994; 68:6074-6078.
Horisberger MA, Staeheli P, Haller O. Interferon induces a unique protein in mouse cells bearing a gene for resistance to influenza virus. Proc Natl Acad Sci, USA 1983;80:1910- 1914.
Hovland T, Nylund A, Watanabe K, Endresen C. Observations of infectious salmon anaemia virus in Atlantic salmon, Salmo salar L. J Fish Dis 1994;17:291-296 .
Hsiang TY, Zhao C, Krug RM. Interferon-induced ISG15 conjugation inhibits influenza A virus gene expression and replication in human cells. J Virol. 2009;83:5971-5977.
Issac A, Lindemann J. Virus interference. Proc R Soc London Ser. B 1957;147:258-267.
Janeway CA, Travers P, Walport M, Shlomchik MJ. Immunobiology: the immune system in health and disease, 6th edition Garland Press, New York and London, 2005.
Janeway CA, Medzhitov R. Innate immune recognition. Ann Rev Immunol 2002;20:197- 216.
Jault C, Pichon L, Chluba J. Toll-like receptor gene family and TIR-domain adapters in Danio rerio. Mol Immunol 2004;40:759-771.
Jones SRM, MacKinnon AM, Groman DB. Virulence and pathogenicity of infectious salmon anemia virus isolated from farmed salmon in Atlantic Canada. J Aquat Anim Health 1999b; 11:400-405.
Jones SRM, Mackinnon AM, Saloilius K. Vaccination of freshwater- reared Atlantic salmon reduces mortality associated with infectious salmon anaemia virus. Bull Eur
49 Assoc Fish Pathol 1999a;19:98-10i.
J0rgensen SM, Afanasyev S, Krasnov A. Gene expression analyses in Atlantic salmon challenged with infectious salmon anemia virus reveal differences between individuals with early, intermediate and late mortality. BMC Genomics 2008;9:179.
J0rgensen SM, Hetland DL, Press CM, Grimholt U, GJ0en T. Effect of early infectious salmon anaemia virus (ISAV) infection on expression of MHC pathway genes and type I and II interferon in Atlantic salmon (Salmo salar L.) tissues. Fish Shellfish Immunol 2007;23:576-588.
Kanayama A, Seth RB, Sun L, Ea CK, Hong M, Shaito A, Chiu YH, Deng L, Chen ZJ. TAB2 and TAB3 activate the NF-«B pathway through binding to polyubiquitin chains. Mol Cell 2004;15:535-548
Kang DC, Gopalkrishnan RV, Wu Q, Jankowsky E, Pyle AM, Fisher PB. mda-5: An interferon-inducible putative RNA helicase with double-stranded RNA-dependent ATPase activity and melanoma growth-suppressive properties. Proc Natl Acad Sci, USA 2002;99:637-642.
Kato H., Sato S., Yoneyama M., Yamamoto M., Uematsu S., Matsui K., Tsujimura T., Takeda K., Fujita T., Takeuchi 0. Cell type-specific involvement of RIG-I in antiviral response. Immunity 2005;23:19-28.
Katze MG, Fornek JL, Palermo RE, Walters KA, Korth MJ. Innate immune modulation by RNA viruses: emerging insights from functional genomics. Nat Rev Immunol 2008;8:644-654.
Kawai T, Akira S. Innate immune recognition of viral infection. Nat Immunol 2006;7:131-137.
50 Kawai T, Takahashi K, Sato S, Coban C, Kumar H, Kato H, Ishii KJ, Takeuchi O, Akira S. IPS-1, an adaptor triggering RIG-I- and Mda5-mediated type I interferon induction. Nat Immunol 2005;6:981-988.
Kawai T, Sato S, Ishii KJ, Coban C, Hemmi H, Yamamoto M, Terai K, Matsuda M, Inoue J, Uematsu S, Takeuchi O, Akira S. Interferon- a induction through Toll-like receptors involves a direct interaction of IRF7 with MyD88 and TRAF6. Nat Immunol 2004;5:1061-1068.
Kawaoka Y, Naeve CW, Webster RG. Is virulence of H5N2 influenza viruses in chickens associated with loss of carbohydrate from the hemagglutinin? Virology 1984;139:303- 316.
Kawaoka Y, Cox NJ, Haller O, Hongo S, Kaverin N, Klenk H-D, Lamb RA, McCauley J, Palese P, Rimstad E, Webster RG. Infectious Salmon Anaemia Virus. In: Fauquet CM, Mayo MA, Maniloff J, Desselberger U, Ball LA. (Eds.), Virus Taxonomy - Eight Report of the International Committee on Taxonomy Viruses. Elsevier Academic Press: New York, 2005; 681-693.
Khan J, Saal LH, Bittner ML, Chen Y, Trent JM, Meltzer PS. Expression profiling in cancer using cDNA microarrays. Electrophoresis 1999;20:223-229.
Kibenge, MJT, Munir K, Kibenge FSB. Constitutive expression of Atlantic salmon Mx protein in CHSE-214 cells confers resistance to infectious salmon anaemia virus. Virol J 2005;2,75.
Kibenge FSB, Kibenge MJT, Groman D, McGeachy S. In vivo correlates of infectious salmon anemia virus pathogenesis in fish. J Gen Virol 2006;87:2645-2652.
Kibenge FSB, Kibenge MJT, Joseph T, McDougal J. The development of infectious salmon anemia virus vaccines in Canada. In: Technical Bulletin 1902, Miller O, Cipriano
51 RC, (eds). International Response to Infectious Salmon Anemia: Prevention, Control and Eradication. Proceedings of a Symposium, 3-4 September 2002, New Orleans, Louisiana, USA. US Department of Agriculture, Animal and Plant Health Inspection Service; US Department of the Interior, US Geological Survey; U.S. Department of Commerce, National Marine Fisheries Service, Washington DC, USA, 2003:39-49.
Kibenge FSB, Lyaku JR, Rainnie D, Hammell KL. Growth of infectious salmon anaemia virus in CHSE-214 cells and evidence for phenotypic differences between virus strains. J Gen Virol 2000;81:143-150.
Kibenge MT, Opazo B, Rojas AH, Kibenge FSB. Serological evidence of infectious salmon anaemia virus (ISAV) infection in farmed fishes, using an indirect enzyme-linked immunosorbent assay (ELISA). Dis Aquat Org 2002; 51:1-11
Kibenge FSB, Xu H, Kibenge MJT, Qian B, Joseph T. Characterization of gene expression on genomic segment 7 of infectious salmon anaemia virus. Virol J 2007a; 4:34.
Kibenge FSB, Munir K, Kibenge MJT, Joseph T, Moneke E. Infectious salmon anemia virus: causative agent, pathogenesis and immunity. Anim Health Res Rev 2004;5:65-78.
Kibenge FSB, Garate ON, Johnson G, Arriagada R, Kibenge MJT, Wadowska D. Isolation and identification of infectious salmon anemia virus from coho salmon in Chile. Dis Aquat Org 2001a;45:9-18.
Kibenge FSB, Kibenge MJT, Wang Y, Qian B, Hariharan S, McGeachy S. Mapping of putative virulence motifs on infectious salmon anaemia virus surface glycoprotein genes. JGenVirol2007b;88:3100-3111.
Kibenge FSB, Kibenge MJT, McKenna PK, Stothard P, Marshall R, Cusack RR, McGeachy S. Antigenic variation among isolates of infectious salmon anaemia virus
52 correlates with genetic variation of the viral haemagglutinin gene. J Gen Virol 2001b;82:2869-2879.
Kibenge FS, Godoy MG, Wang Y, Kibenge MJ, Gherardelli V, Mansilla S, Lisperger A, Jarpa M, Larroquete G, Avendano F, Lara M, Gallardo A. Infectious salmon anaemia virus (ISAV) isolated from the ISA disease outbreaks in Chile diverged from ISAV isolates from Norway around 1996 and was disseminated around 2005, based on surface glycoprotein gene sequences. Virol J. 2009;6:88.
Kileng 0, Brundtland MI, Robertsen B. Infectious salmon anemia virus is a powerful inducer of key genes of the type I interferon system of Atlantic salmon, but is not inhibited by interferon. Fish Shellfish Immunol 2007;23:378-389.
Kim KI, Giannakopoulos NV, Virgin HW, Zhang DE. Interferon-inducible ubiquitin E2, Ubc8, is a conjugating enzyme for protein ISGylation. Mol Cell Biol 2004;24:9592-9600.
Kisseleva T, Bhattacharya S, Braunstein J, Schindler, CW. Signaling through the JAK/STAT pathway, recent advances and future challenges. Gene 2002;285:1-2.
Kobasa D, Wells K, Kawaoka Y. Amino acids responsible for the absolute sialidase activity of the influenza A virus neuraminidase: relationship to growth in the duck intestine. J Virol 2001;75:11773-11780.
Korant BD, Blomstrom DC, Jonak GJ, Knight JE. Interferon induced proteins. Purification and characterization of a 15,000-dalton protein from human and bovine cells induced by interferon. J Biol Chem 1984;259:14835-14839.
Kotenko, SV, Gallagher G, Baurin VV, Lewis-Antes A, Shen M, Shah NK, Langer JA, Sheikh F, Dickensheets H, and Donnelly RP. IFN-Xs mediate antiviral protection through a distinct class II cytokine receptor complex. Nat Immunol 2003;4:69-77.
53 Kovarik P, Mangold M, Ramsauer K, Heidari H, Steinborn R, Zotter A, Levy DE, Muller M, Decker T. Specificity of signaling by STAT1 depends on SH2 and C-terminal domains that regulate Ser727 phosphorylation, differentially affecting specific target gene expression. EMBO J 2001;20:91-100.
Koyama S, Ishii KJ, Coban C, Akira S. Innate immune response to viral infection. Cytokine 2008;43:336-341.
Kross0y B, Hordvik I, Nilsen F, Nylund A, Endresen C. The putative polymerase sequence of infectious salmon anemia virus suggests a new genus within the Orthomyxoviridae. J Virol 1999; 73:2136-2142.
Kross0y B, Devoid M, Sanders L, Knappskog PM, Aspehaug V, Falk K, Nylund A, Koumans S, Endresen C, Biering E. Cloning and identification of the infectious salmon anaemia virus haemagglutinin, J Gen Virol 2001;82:1757-1765.
Kumagai Y, Takeuchi O, Akira S. Pathogen recognition by innate receptors. J Infect Chemother 2008;14:86-92.
Lanier LL. Evolutionary struggles between NK cells and viruses. Nat Rev Immunol 2008;8:259-268.
Larsen R, Rokenes TP, Robertsen B. Inhibition of infectious pancreatic necrosis virus replication by Atlantic salmon Mxl protein. J Virol 2004;78:7938-7944.
Lauksund S, Svingerud T, Bergan V, Kileng 0, Robertsen B. Molecular cloning and functional studies of Atlantic salmon mitochondrial antiviral signaling protein. Abstracts and Reviews of the 7l Joint Conference of the International Cytokine Society and the International Society for Interferon and Cytokine Research. Cytokine 2008;43:294.
54 Lemaitre B, Nicolas E, Michaut L, Reichhart J-M, Hoffmann JA.The dorsoventral regulatory gene cassette spatzle/Toll/cactus controls the potent antifungal response in Drosophila adults. Cell 1996;86:973-983
Lenschow DJ, Giannakopoulos NV, Gunn LJ, Johnston C, O'Guin AK, Schmidt RE, Levine B, Virgin HW. Identification of interferon-stimulated gene 15 as an antiviral molecule during Sindbis virus infection in vivo. J Virol 2005;79:13974-13983.
Lindenmann J. Inheritance of resistance to influenza virus in mice. Proc Soc Exp Biol Med 1964; 116:506-509.
Loeb KR, Haas AL. The interferon-inducible 15-kDa ubiquitin homolog conjugates to intracellular proteins. J Bio Chem 1992;267:7806-7813.
Long S, Wilson M, Bengten E, Bryan L, Clem LW, Miller NW, Chinchar VG. Identification of a cDNA encoding channel catfish interferon. Dev Comp Immunol 2004;28:97-111.
Luo G, Chung J, Palese P. Alterations of the stalk of the influenza virus neuraminidase: deletions and insertions. Virus Res 1993;29:141-153.
Lutfalla G, Crollius HR, Stange-Thomann N, Jaillon O, Mogensen K, Monneron D. Comparative genomic analysis reveals independent expansion of a lineage-specific gene family in vertebrates: the class II cytokine receptors and their ligands in mammals and fish. BMC Genomics 2003;4:29.
MacMicking JD. IFN-inducible GTPases and immunity to intracellular pathogens. Trends Immunol 2004;25:601-609.
55 Mac Williams C, Johnson G, Groman D, Kibenge FSB. Morphologic description of infectious salmon anaemia virus (ISAV)- induced lesions in rainbow trout Oncorhynchus mykiss compared to Atlantic salmon Salmo salar. Dis Aquat Org 2007;78:1-12.
Markussen T, Jonassen CM, Numanovic S, Braaen S, Hjortaas M, Nilsen H, Mjaaland S. Evolutionary mechanisms involved in the virulence of infectious salmon anaemia virus (ISAV), a piscine orthomyxovirus. Virology 2008;374:515-527.
Matsuo A, Oshiumi H, Tsujita T, Mitani H, Kasai H, Yoshimizu M, Matsumoto M, Seya T. Teleost TLR22 recognizes RNA duplex to induce IFN and protect cells from birnavimses. J Immunol 2008;181:3474-3485.
McBeath AJA, Snow M, Secombes C.T, Ellis AE, Collet B. Expression kinetics of interferon and interferon-induced genes in Atlantic salmon {Salmo salar) following infection with infectious pancreatic necrosis virus and infectious salmon anaemia virus. Fish Shellfish Immunol 2007; 22:230-241.
McBeath AJA, Collet B, Paley R, Duraffour S, Aspehaug V, Biering E, Secombes CJ, Snow M. Identification of an interferon antagonist protein encoded by segment 7 of infectious salmon anaemia virus. Virus Res 2006;115:176-184.
Meylan E, Burns K, Hofmann K, Blancheteau V, Martinon F, Kelliher M, Tschopp J. RIP1 is an essential mediator of Toll-like receptor 3-induced NF-kappa B activation. Nat Immunol 2004;5:503-507.
Mikalsen AB, Sindre H, Torgersen J, Rimstad E. Protective effects of a DNA vaccine expressing the infectious -salmon anemia virus hemagglutinin-esterase in Atlantic salmon. Vaccine 2005;23:4895^I905.
56 Mjaaland S, Rimstad E, Falk K, Dannevig BH. Genomic characterization of the virus causing infectious salmon anemia in Atlantic salmon (Salmo solar L.): an orthomyxo-like virus in ateleost. J Virol 1997;71:7681-7686.
Mjaaland S, Hungnes O, Teig A, Dannevig BH, Thorud K, Rimstad E. Polymorphism in the infectious salmon anemia virus hemagglutinin gene: importance and possible implications for evolution and ecology of infectious salmon anemia disease. Virology 2002;304:379-391.
Mjaaland S, Markussen T, Sindre H, KJ0glum S, Dannevig BH, Larsen S. Grimholt U. Susceptibility and immune responses following experimental infection of MHC compatible Atlantic salmon (Salmo salar L.) with different infectious salmon anaemia virus isolates. Arch Virol 2005;150:2195-2216.
Mocellin S, Provenzano M. RNA interference: Learning gene knock-down from cell physiology. J Translat Med 2004;2:39.
Moneke E, Kibenge MJT, Groman D, Johnson GR, Ikede BO, Kibenge FSB. Infectious salmon anemia virus RNA in fish cell cultures and in tissue sections of Atlantic salmon experimentally infected with infectious salmon anemia virus. J Vet Diagn Invest 2003;15:407-417.
Moneke E, Groman DB, Wright GM, Stryhn H, Johnson GR, Ikede BO, Kibenge FSB. Correlation of virus replication in tissues with histologic lesions in Atlantic salmon experimentally infected with infectious salmon anemia virus.Vet Pathol 2005; 42:338- 349.
Mullins JE, Groman D, Wadowska D. Infectious salmon anemia in salt water Atlantic salmon (Salmo salar L.) in New Bninswick, Canada. Bull Eur Assoc Fish Pathol 1998;18:110-114.
57 Munir K, Kibenge FS. Detection of infectious salmon anemia virus by real-time RT- PCR. J Virol Methods 2004;117:37-47.
Murakami M, Towatari T, Ohuchi M, Shiota M, Akao M, Okumura Y, Parry MA, Kido H. Mini-plasmin found in the epithelial cells of bronchioles triggers infection by broad- spectrum influenza A viruses and Sendai virus. Eur J Biochem 2001;268:2847-2855.
Naffakh N, Massin P, Escriou N, Grescenzo-Chaigne B, van der Werf S. Genetic analysis of the compatibility between polymerase proteins from human and avian strains of influenza A viruses. J Gen Virol 2000;81:1283-1291
Neumann G, Kawaoka Y. Host range restriction and pathogenicity in the context of influenza virus pandemic. Ernerg Infect Dis 2006;12:881-886.
Nylund A, Plarre H, Karlsen M, Fridell F, Ottem KF, Bratland A, Saether PA. Transmission of infectious salmon anaemia virus (ISAV) in farmed populations of Atlantic salmon (Salmo salar). Arch Virol 2007;152:151-179.
Oates AC, Wollberg P, Pratt SJ, Paw BH, Johnson SL, Ho RK, Postlethwait JH, Zon LI, Wilks AF. Zebrafish stat3 is expressed in restricted tissues during embryogenesis and statl rescues cytokine signaling in a STAT 1-deficient human cell line. Dev Dyn 1999;215:352-370.
Okumura A, Lu G, Pitha-Rowe I, Pitha PM. Innate antiviral response targets HIV-1 release by the induction of ubiquitin-like protein ISG15. Proc Natl Acad Sci, USA 2006;103:1440-1445.
Onomoto K, Yoneyama M, Fujita T. Regulation of antiviral innate immune responses by RIG-I family of RNA helicases. Curr Topics Microbiol Immunol 2007;316:193-205.
58 Phelan PE, Mellon MT, Kim CH. Functional characterization of full-length TLR3, IRAK-4, and TRAF6 in zebrafish {Danio rerio). Mol Immunol 2005;42:1057-1071.
Pichlmair A, Schulz O, Tan CP, Naslund TI, Liljestrom P, Weber F, Reis e Sousa C. RIG-I-mediated antiviral responses to single-stranded RNA bearing 5'-phosphates. Science 2006;314:997-1001.
Platanias LC. Mechanisms of type I and type II interferon mediated signaling. Nat Rev Immunol 2005;5:375-385. Randall RE, Goodbourn S. Interferons and viruses: an interplay between induction, signalling, antiviral responses and virus countermeasures. J Gen Virol 2008;89:1-47.
Rich A, Zhang S. Timeline Z-DNA: the long road to biological function. Nat Rev Genet 2003;4:566-572.
Rimstad E, Falk K, Mikalsen AB, Teig A. Time course tissue distribution of infectious salmon anaemia virus in experimentally infected Atlantic salmon Salmo salar. Dis Aquat Org 1999;36:107-112.
Rimstad E, Mjaaland S, Snow M, Mikalsen AB, Cunninhgham CO. Characterization of the infectious salmon anaemia virus genomic segment that encodes the putative hemagglutinin. J Virol 2001:75:5352-5356.
Rimstad E, Biering E, Brun E, Falk K, Kibenge F, Mjaaland S, Snow M Winton J. Which risk factors relating to spread of Infectious Salmon Anaemia (ISA) require development of management strategies? Opinion of the Panel on Animal Health and Welfare of the Norwegian Scientific Committee for Food Safety 2007.
Ritchie RJ, Heppell J, Cook MB, Jones S, Griffiths SG. Identification and characterization of segments 3 and 4 of the ISAV genome. Virus Genes 2001;22:289- 297.
59 Ritchie RJ, Bardiot A, Melville K, Griffiths S, Cunningham CO, Snow M. Identification and characterization of the genomic segment 7 of the infectious salmon anaemia virus genome. Virus Res 2002;84:161-170.
Ritchie RJ, McDonald JT, Glebe B, Young-Lai W, Johnsen E, Gagne N. Comparative virulence of infectious salmon anaemia virus isolates in Atlantic salmon, Salmo salar L. J Fish Dis 2009;32:157-71.
Robertsen B. The interferon system of teleost fish. Fish Shellfish Immunol 2006;20:172- 191.
Robertsen B, Trobridge G, Leong JA. Molecular cloning of double-stranded RNA inducible Mx genes from Atlantic salmon {Salmo salar L.). Dev Comp Immunol 1997;21:397-412.
Robertsen B, Bergan V, Rjakenes T, Larsen R, Albuquerque A. Atlantic salmon interferon genes: cloning, sequence analysis, expression, and biological activity. J Interferon Cytokine Res 2003;23:601-612.
Rodriguez MF, Wiens GD, Purcell MK, Palti Y. Characterization of Toll-like receptor 3 gene in rainbow trout (Oncorhynchus mykiss). Immunogenetics 2005;57:510-519.
Rolland JB, Nylund A. Sea running brown trout: carrier and transmitter of the infectious salmon anaemia virus (ISAV). Bull Eur Assoc Fish Pathol 1999;18:50-55.
Rolland JB, Bouchard DA, Winton JR. The ASK cell line: an improved diagnostic tool for isolation, propagation, and titration of the infectious salmon anemia virus (ISAV). In: Technical Bulletin 1902, Miller O, Cipriano RC, eds. International Response to Infectious Salmon Anemia: Prevention, Control and Eradication. Proceedings of a Symposium, 3-4 September 2002, New Orleans, Louisiana, USA. US Department of Agriculture, Animal and Plant Health Inspection Service; US Department of the Interior,
60 US Geological Survey; U.S. Department of Commerce, National Marine Fisheries Service, Washington DC, USA, 2003:63-68.
Rolland JB, Bouchard D, Coll J, Winton JR. Combined use of the ASK and SHK-1 cell lines to enhance the detection of infectious salmon anemia virus. J Vet Diagn Invest 2005;17:151-157.
R0kenes TP, Larsen R, Robertsen B. Atlantic salmon ISG15: expression and conjugation to cellular proteins in response to interferon, double stranded RNA and virus infection. Mol Immunol 2007;44:950-959.
Ruiz S, Schyth BD, Encinas P, Tafalla C, Estepa A, Lorenzen N, Coll JM. New tools to study RNA interference to fish viruses: Fish cell lines permanently expressing siRNAs targeting the viral polymerase of viral hemorrhagic septicemia virus. Antiviral Res 2009;82148-156.
Rycyzyn MA, Wilson MR, Bengten E, Warr GW, Clem LW, Miller NW. Mitogen and growth factor-induced activation of a STAT-like molecule in channel catfish lymphoid cells. Mol Immunol 1998;35:127-136.
Sadler AJ, Williams BRG. Interferon-inducible antiviral effectors. Nat Rev Immunol 2008;8:559-568.
Samuel CE. Antiviral actions of interferons. Clin Microbiol Rev 2001;14:778-809.
Schena M, Shalon D, Davis RW Brown PO. Quantitative monitoring of gene expression patterns with a complementary DNA microarray. Science 1995;270:467-470.
Schi0tz BL, J0rgensen SM, Rexroad C, GJ0en T, Krasnov A. Transcriptomic analysis of responses to infectious salmon anemia virus infection in macrophage-like cells. Virus Res 2008;136:65-74.
61 Schulze A, Downward J. Navigating gene expression using microarrays - a technology review. Nat Cell Biol 2001;3:E190-195.
Siggins L. Salmon virus detected in Clew Bay fish farm. The Irish Times, 12 August 2002. www.ireland.com.
Simpson DA, Feeney S, Boyle C,Stitt AW. Retinal VEGF mRNA measured by SYBR green I fluorescence: A versatile approach to quantitative PCR. Mol Vis 2000;6:178-183.
Skehel JJ, Wiley DC. Receptor binding and membrane fusion in virus entry: the influenza hemagglutinin. Annu Rev Biochem 2000;69:531-569
Skjaeveland I, Iliev DB, Zou J, Jorgensen T, Jorgensen JB. A TLR9 homolog that is up- regulated by IFN-y in Atlantic salmon {Salmo salar). Dev Comp Immunol 2008;32:603- 607.
Snow M, Cunningham CO. Characterization of the putative nucleoprotein gene of infectious salmon anaemia virus (ISAV). Virus Res 2001 ;74:111-118.
Snow M, McKay P, McBeath AJ, Black J, Doig F, Kerr R, Cunningham CO, Nylund A, Devoid M. Development, application and validation of a Taqman real-time RT-PCR assay for the detection of infectious salmon anaemia virus (ISAV) in Atlantic salmon {Salmo salar). Dev Biol 2006;126:133-145.
Snow M, Ritchie R, Arnaud O, Villoing S, Aspehaug V, Cunningham CO. Isolation and characterisation of segment 1 of the infectious salmon anaemia virus genome. Virus Res 2003;92:99-105.
Stepanous A, Latchman DS. Opposing actions of STAT-1 and STAT-3. Growth Factors 2005;23:177-182.
62 Stieneke-Grober A, Vey M, Angliker H, Shaw E, Thomas G, Roberts C, Klenk HD, Garten W. Influenza virus hemagglutinin with multibasic cleavage site is activated by furin, a subtilisin-like endoprotease. EMBO J 1992;11:2407-2414.
Sun B, Robertsen B, Wang Z, Liu B. Identification of an Atlantic salmon IFN multigene cluster encoding three IFN subtypes with very different expression properties. Dev Comp Immunol 2009;33:547-558.
Takano T, Kondo H, Hirono I, Endo M, Saito-Taki T, Aoki T. Molecular cloning and characterization of Toll-like receptor 9 in Japanese flounder, Paralichthys olivaceus. Mol Immunol 2007;44:1845-1853.
Takeuchi O, Akira S. Recognition of viruses by innate immunity. Immunol Rev 2007; 220:214-224.
Thompson AJ, Locarnini SA. Toll-like receptors, RIG-I-like RNA helicases and the antiviral innate immune response. Immunol Cell Biol 2007;85:435-445.
Thorud K, Djupvik, HO. Infectious salmon anemia in Atlantic salmon (Salmo salar L.) Bull Eur Assoc Fish Pathol 1988;8:109-111.
Tolia NH, Joshua-Tor L. Slicer and the argonautes. Nat Chem Biol 2007;3:36-43.
Tumpey TM, Basler CF, Aguilar PV, Zeng H, Solorzano A, Swayne DE, Cox NJ, Katz JM, Taubenberger JK, Palese P, Garcia-Sastre A. Characterization of the reconstructed 1918 Spanish influenza pandemic virus. Science 2005;310:77-80.
Uematsu S, Akira S. Toll-like receptors and type I interferons. J Biol Chem 2007;282: 15319-15323.
63 Vossen MT, Westerhout EM, Soderberg-Naucler C, Wiertz EJ. Viral immune evasion: a masterpiece of evolution. Immunogenetics 2002;54:527-542.
Wadhwa R, Kaul, SC, Miyagishi M, Taira K. Know-how of RNA interference and its applications in research and therapy. Mutation Res 2004;567:71-84.
Wang C, Deng L, Hong M, Akkaraju GR, Inoue J, Chen ZJ. TAK1 is a ubiquitin- dependent kinase of MKK and IKK. Nature 2001;412:346-351.
White J, Kartenbeck J, Helenius A. Membrane fusion activity of influenza virus. EMBO J 1982;1:217-222
Whyte SK.The innate immune response of fish- A review of current knowledge. Fish Shellfish Immunol 2007;23:1127-1151.
Yoneyama M, Kikuchi M, Natsukawa T, Shinobu N, Imaizumi T, Miyagishi M, Taira K, Akira S, Fujita T. The RNA helicase RIG-I has an essential function in double-stranded RNA induced innate antiviral responses. Nat Immunol 2004;5:730-737.
Yoneyama M, Kikuchi M, Matsumoto K, Imaizumi T, Miyagishi M, Taira K, Foy E, Loo Y-M, Gale M, Akira S, Yonehara S, Kato A, Fujita T. Shared and unique functions of the DExD/H-Box helicases RIG-I, MDA5, and LGP2 in antiviral innate immunity. J Immunol 2005;175:2851-2858.
Zhang Y, Gui J. Molecular characterization and IFN signal pathway analysis of Carassius auratus CaSTATl identified from the cultured cells in response to virus infection. Dev Comp Immunol 2004;28:211-227.
Zhang Y-B, Jiang J, Chen Y-D, Zhu R, Shi Y, Zhang Q-Y, Gui J-F. The innate immune response to grass carp hemorrhagic virus (GCHV) in cultured Carassius auratus blastulae (CAB) cells. Dev Comp Immunol 2007;31:232-243.
64 Zhao C, Denison C, Huibregtse JM, Gygi S, Krug RM. Human ISG15 conjugation targets both IFN-induced and constitutively expressed proteins functioning in diverse cellular pathways. ProcNatl Acad Sci, USA 2005;102:10200-10205.
65 2. Absolute quantitation of infectious salmon anaemia virus using
different real-time reverse transcription PCR chemistries
2.1. SUMMARY
Routine laboratory diagnosis of infectious salmon anaemia virus (ISAV) infection is primarily by reverse transcription polymerase chain reaction (RT-PCR) owing to the high sensitivity and rapid turnaround time of the test. However, the existing QRT-PCR neither allow absolute quantitation of ISAV copy numbers nor relate ISAV QRT-PCR Ct values to virus titers. This chapter describes methods for highly reproducible absolute viral load measurements using external standard curves generated with either ISAV recombinant plasmid DNA (pDNA) standards or transcribed RNA standards prepared by in vitro transcription with T7 RNA polymerase, and using a two tube QRT-PCR with
SYBR® Green I chemistry and a single tube QRT-PCR with TaqMan® probe chemistry.
When applied to virus samples of known virus titer for the highly pathogenic ISAV isolate NBISA01 and the lowly pathogenic ISAV isolate RPC/NB-04-085-1, both methods showed a 100-fold lower detectable titer for RPC/NB-04-085-1 but with a higher number of viral RNA molecules compared to NBISA01. Overall, the SYBR®
Green I method overestimated copy numbers in samples having equivalent Ct values with the TaqMan probe method. Taken together, the findings suggest that the TaqMan probe method with the in vitro transcribed RNA standard curve is the preferred method for
Workenhe ST, Kibenge MJT, Iwamoto T, Kibenge FSB. Absolute quantitation of infectious salmon anaemia virus using different real-time reverse transcription PCR chemistries. J Virol Methods 2008;154:128-134.
66 reliable and rapid quantitation of ISAV in samples.
2.2. INTRODUCTION
Data generated by QRT-PCR can be analyzed using either absolute or relative quantitation (Bustin, 2005). Absolute quantitation requires construction of a standard curve using relevant standards such as a known copy number of pDNA or in vitro transcribed RNA standards (Bustin, 2000; Wong and Medrano, 2005). Relative quantitation describes the change in expression of the target gene relative to some untreated control sample and normalized to an endogenous reference gene (Giulietti et al, 2001; Livak and Schmittgen, 2001). It is becoming increasingly apparent that more than one reference gene is required for proper use of relative quantitation (Vandesompele et al, 2002), making it cumbersome to use let alone to compare test performance between different laboratories. Moreover, endogenous reference genes are not necessarily appropriate normalizers for QRT-PCR data normalization (Sellars et al, 2007). In contrast, absolute quantitation analysis is useful in determining absolute viral RNA copies based on a constant copy number, allowing straight forward comparison of data from different PCR runs on the same day or on different days, and more importantly between different laboratories.
There are two chemistries most commonly used for detection of PCR products during QRT-PCR. These are the DNA binding fluorophore SYBR® Green I (Simpson et al, 2000), and the sequence-specific fluorescently labeled probes (Holland et al, 1991;
Lay and Wittwer, 1997). Quantitation of ISAV by QRT-PCR first utilized the SYBR®
Green I format, targeting RNA segment 8 (Munir and Kibenge, 2004), and then
67 subsequently used TaqMan probes initially targeting RNA segment 8 (Mjaaland et al.,
2005) and then comparing RNA segments 7 and 8 (Snow et al., 2006). Snow et al. (2006) found the segment 8 TaqMan® QRT-PCR assay to be more sensitive than the segment 7
TaqMan' QRT-PCR assay most likely due to the abundant expression of ISAV segment
8 mRNA in the virus replication cycle. All the previous ISAV quantitation reports have used relative quantitation of ISAV transcripts calibrated to endogenous reference genes
(Mjaaland et al, 2005; Kileng et al, 2007); however, there has never been correlation with biological significance of the amount of viral RNA detected in a sample. Using expression of endogenous reference genes is relevant when studying gene expression, but has less relevance in viral quantitation except for estimating the quality of the RNA in a sample and detecting presence of inhibitory effects.
This chapter describes the use of ISAV segment 8 pDNA and in vitro transcribed RNA standards for absolute quantification of ISAV RNA copy number equivalents in both a two tube QRT-PCR using SYBR® Green I and a single tube one- step QRT-PCR with a TaqMan® probe. Moreover, this study establishes the relationship of QRT-PCR cycle threshold (Ct) value to median tissue culture infectious dose (TCID50) when used to assess viral load in a sample for ISAV isolates of differing pathogenicities.
Considering the replication strategy of influenza viruses, ISAV replication is expected to generate viral mRNA and cRNA from the vRNA genome. When primed with gene specific primer or random hexamers, the total RNA from ISAV infected cultures will have a population of cDNA generated from viral mRNA, cRNA, and vRNA. It is possible to specifically amplify ISAV vRNA by priming the non-coding UTR region in the RT step with sequence specific primer, but this requires a two-step QRT-PCR to
68 allow RNase treatment before addition of a second gene specific primer in the PCR stage.
Thus, the idea of relating transcript copies to ISAV genome equivalents is limited when using cDNA primers that are not specific for vRNA, although this method was used for absolute quantitation of coronavirus (Vijgen et al., 2005), a non-segmented ssRNA virus of positive sense. When quantitating segmented RNA viruses the question would be how many individual genome segments are contained in an infectious virus particle? ISAV is not well studied in this respect; but influenza virions containing more than eight individual RNA segments have been isolated (Flint et al., 2004). Thus for the present study, in order to extrapolate the segment 8 ISAV copies as ISAV RNA copy number equivalents, an assumption was made that the genome in a single infectious ISAV particle has at least one molecule of each RNA segment.
2.3. MATERIALS AND METHODS
2.3.1. Viruses
Two ISAV isolates of differing genotypes and pathogenicities were compared.
NBISA01 is a highly pathogenic isolate belonging to the North American genotype, whereas RPC/NB-04-085-1 is a low pathogenicity isolate of the European genotype found in Eastern Canada (Kibengc et al., 2006). The two isolates have variations in the amino acid sequence of the haemagglutinin-esterase (HE) protein, with deletions of 13 and 17 amino acids in the highly polymorphic region (HPR)(compared to the HPR0 that do not have deletions) for RPC/NB-04-085-1 and NBISA01, respectively (Kibenge et al.,
2007). NBISA01 belong to HPR21 wheras RPC/NB-04-085-1 is assigned in a unique
HPR group. In an experimental trial using equal viral doses, NBISA01 induced very high
69 mortality in Atlantic salmon (95%) and moderate mortality in rainbow trout (50%), whereas RPC/NB-04-085-1 induced very low mortality in Atlantic salmon (18.2%) and no mortality in rainbow trout (Kibenge et al., 2006).
2.3.2. Cell culture
The dendritic/macrophage like TO cell line derived from head kidney leukocytes of Atlantic salmon (Wergeland and Jakobsen, 2001; Pettersen et al., 2008) was grown in Hanks' minimum essential medium (HMEM)(Bio Whittaker) with 10% fetal bovine serum (FBS), 2 mM L-glutamine, 1% non-essential amino acids and 50 ug/ml gentamicin. Cells in 6-well tissue culture plates were incubated at room temperature (24°C) and the monolayers were used after 24 hr (-80% confluent). One milliliter of the virus was applied to each well of a six well plate. The virus was allowed to adsorb for 2 hr at room temperature before addition of 1 ml of HMEM with 5% FBS, antibiotics and glutamine. Infected cells were incubated at 16°C in maintenance medium.
Sampling was done at days 0, 3 and 6 by freezing the whole plate at -80°C prior to the total RNA extraction step.
2.3.3. RNA extraction
Total RNA was extracted from virus samples and fish tissue samples from
ISAV challenged fish using 1.25 ml of TRIzol Reagent (Invitrogen) and 375 ul of sample volume. For the fish tissue samples, each tissue was weighed and macerated to a 10% suspension w/v in PBS with lOx antibiotics. The extracted RNA was eluted in 20-50 ul of nuclease-free water and was treated with DNAse I using the Roche DNAse treatment kit following the manufacturer's procedure. RNA was quantitated by UV
70 spectrophotometry.
2.3.4. cDNA synthesis
For use in the two tube SYBR® Green I method, first strand cDNA synthesis was performed using the Transcriptor reverse transcriptase first strand cDNA synthesis kit (Roche). Different amounts of RNA were used in cDNA synthesis depending on the source of the RNA. cDNA synthesis of ISAV segment 8 transcribed RNA used 1 ul of
RNA per reaction. cDNA synthesis of total RNA extracted from the different virus samples of known virus titer (in TCID50) and ISAV-positive fish tissues used llul of
RNA per reaction. cDNA synthesis of total RNA extracted from serial sampling during virus replication in TO cells used 300 ng of RNA per reaction. Three different primers were used for cDNA synthesis; random hexamer primers and oligo-dT primers that come with the cDNA synthesis kit (Roche), and the gene specific F5/R5 primers. The F5/R5 primers were first described by Devoid et al. (2000) to amplify 220 bp of the ISAV segment 8, and previously described for single tube one-step QRT-PCR (Munir and
Kibenge, 2004). The cDNA synthesis master mix consisted of 4 ul of 5x RT reaction buffer, 2 ul of dNTP mix (200 uM), primer (2 ul of random hexamer (600 uM) or 2 ul of oligo-dT primer (0.8 u.g/ul) or lul of gene specific F5/R5 primer (20 uM), 0.5 ul RNase inhibitor (40 U/ul), 0.5 ul of Transcriptor reverse transcriptase (20 U/ul), and nuclease- free water to adjust the 20 ul volume. The reactions were incubated at 25°C for 10 min followed by 55°C for 30 min with a final enzyme denaturation at 85°C for 5 min.
71 2.3.5. Preparation of plasmid DNA standards
The pDNA standard was obtained by cloning the 878 bp genomic RNA of
ISAV segment 8 RT-PCR product (Cunningham and Snow, 2000) into the pCRII-TOPO
vector (Invitrogen); the clone was designated pCRIITOPODNA-NBISA01-S8. The
recombinant plasmid was purified using the High Pure Plasmid Purification kit (Roche).
The plasmid DNA concentration was determined in triplicate by UV spectrophotometry.
The mass of a single pDNA molecule was calculated using the formula 1 bp ~ 660
grams/mole and the 4880 bp size of the recombinant plasmid, following the method in
the Applied Biosystems Manual of QRT-PCR (Anon, 2003).
2.3.6. In vitro transcription of ISAV RNA segment 8
The pCRIITOPODNA-NBISA01-S8 clone was also used for in vitro
transcription with T7 RNA polymerase in the sense direction in order to generate in vitro
transcribed RNA. For this, 200 ng of recombinant plasmid was linearized by digestion
with BamHl enzyme (New England Biolabs) in a 20 ul reaction volume following the
manufacturer's protocol. The linearized DNA was then purified using the QIA quick
PCR purification kit (QIAGEN), and was recovered in 30 ul of elution buffer. In vitro
transcription was carried out in a 40 ul-volume using 20 ul of linearized plasmid DNA,
lx T7 RNA polymerase buffer, 2 ul of 100 mM DTT, 16 ul of 10 mM NTPs
(Invitrogen), 1 ul RNase OUT (40 U/ul)(Invitrogen), and 1 ul of T7 RNA polymerase
(50 U/ul)(Invitrogen). The reaction was incubated for 2 hr at 37°C. RNA purification was
carried out using RNeasy kit (QIAGEN), and was eluted in 30 ul of nuclease-free water.
Nucleic acid concentration was determined by UV spectrophotometry. DNase treatment
72 was done using 1 unit of RQ1 RNase-free DNase 1(1 U/ul)(Promega) per u.g of RNA following the manufacturer's procedure. This treatment was performed twice to ensure complete elimination of any residual pDNA (which could potentially yield a positive result in two-step QRT-PCR even in the absence of RT). RNA was cleaned up using
RNeasy kit and eluted in 30 jutl of nuclease-free water and the concentration was again determined by UV spectrophotometry. The ISAV segment 8 in vitro transcribed RNA was analyzed using a native 1% agarose gel to check the integrity of the RNA before use.
2.3.7. Construction of ISAV segment 8 in vitro transcribed RNA standards
The concentration of the ISAV in vitro transcribed RNA was determined by UV spectrophotometry in triplicate. The copy number of the in vitro transcribed RNA per microliter was calculated as described by Fronhoffs et al. (2002). Serial 10-fold dilutions of the RNA transcripts were prepared starting with the highest concentration of 2.79x10 copies/ul. For use in the two tube SYBR Green I method, cDNA synthesis was carried out using 1 ul of each in vitro transcribed RNA serial dilution. The single tube one-step
QRT-PCR TaqMan® method used 8 ul of each in vitro transcribed RNA serial dilution per reaction.
2.3.8. Two tube QRT-PCR with SYBR Green I chemistry
QRT-PCR was performed on the first strand cDNA using the LightCycler (LC)
1.2 instrument (Roche) with Fast Start DNA Master SYBR® Green I (Roche) and the
ISAV segment 8 primer pair F5/R5 amplifying 220 bp product (Devoid et al., 2000;
Munir and Kibenge, 2004). Briefly, the 20 ul reaction consisted of 2 ul of cDNA and 18 ul of the master mix prepared using 0.3 ul of the 20 uM forward and reverse primers
73 (final concentration of 0.3 uM), 2 ul SYBR® Green I, 3.2 ul of the 25 mM stock MgCl2
(a final concentration of 0.005 uM), and 12.2 ul of nuclease-free water.
The cycling conditions consisted of 10 min denaturation at 95°C to activate the hot start polymerase followed by 50 cycles of 95°C for 5 s, 59°C for 10 s, 72°C for 10 s, and detection at 80°C for 2 s. Melting curve analysis was performed from 70°C to 95°C in 0.1°C/s increments to assess the specificity of the QRT-PCR products. For generation of the standard curves, the pDNA and in vitro transcribed RNA standards were run in triplicates. In order to use standard curves to calculate the ISAV segment 8 genome copies, pDNA and in vitro transcribed RNA standards were run alongside the unknown samples. For calculating viral genome copy numbers/ml of unknown sample, the viral genome equivalents/20 ul PCR reaction was multiplied by a factor of 20/11 x 1000/375.
The factor is based on cDNA synthesis using 11 ul of the total 20 ul RNA eluted from
375 ill of virus lysate, and the use of 2 ul of cDNA from the 20 ul cDNA synthesis reaction. The Ct values were used to generate a standard curve plot of cycle number (Y- axis) versus log concentration (X-axis). The quality of standard curves was judged by the slope of the standard curve and the correlation coefficient (r). The slope of the line was used to estimate the efficiency of the target amplification using the equation E= (10"
1/slope)-l. In case of the SYBR® Green I QRT-PCR, melting curve analysis was used to check the specificity of the QRT-PCR product. In some cases, the QRT-PCR products were resolved by 1% agarose gel electrophoresis.
2.3.9. Single tube one-step QRT-PCR with TaqMan® chemistry
The single tube one-step QRT-PCR with TaqMan primers and probe targeting
ISAV segment 8 is a modification of the TaqMan QRT-PCR assay for the detection of
74 ISAV described by Snow et al. (2006), which uses relative quantitation methods. The modifications made in this study included use of a single tube with a one-step QRT-PCR kit (Roche) and TaqMan® probe in a 96-well plate in the LC 480 instrument (Roche) with absolute quantitation methods. Briefly, 8 ul of RNA are added to 12 ul of master mix consisting of 9.28 ul LC 480 RNA Master hydrolysis probe, 1.88 ul of activator Mn
(OAc)2 (50 mM), 1 ul of enhancer (20x), 1.13 ul of ISAV Segment 8 forward and reverse primers (Snow et al, 2006) (20 mM each) and 1.04 ul of ISAV segment 8 probe (Snow et al, 2006) (6 uM). The primers and probe binding sequences are identical for both of the virus isolates used in the present study. The cycling conditions consisted of 1 cycle of RT for 3 min at 63°C followed by denaturation at 95°C for 3 s, and 45 cycles of denaturation at 95°C for 15 s, annealing at 60°C for 1 min and amplification and detection at 72°C for 1 s. For generation of the standard curve, the in vitro transcribed RNA standards were run in 5 replicates. The standard curve was constructed automatically with
LC software version 4.0 (Roche) using the Ct values obtained when the serial 10-fold dilutions of the in vitro transcribed RNA samples with known numbers of RNA transcripts were used as templates. The standard curve obtained was then used as an external standard curve in all subsequent TaqMan® QRT-PCR assays on LC480. For calculating ISAV RNA copy number equivalents per ml of unknown sample, the ISAV
RNA copy number equivalents/20 ul QRT-PCR reaction was multiplied by a factor of
20/8 x 1000/375 based on the use of 8 ul of the total 20 ul RNA eluted from 375 ul of virus lysate used for QRT-PCR reaction.
75 2.3.10. Standard curve for estimating TCID50 from Ct values
To construct a standard curve for relating the virus titer of a sample expressed
as TCID50 with the Ct values obtained in QRT-PCR, total RNA extracted from 10-fold
dilutions of virus lysates" of ISAV isolates NBISA01 and RPC/NB-04-085-1 was tested
with both the two tube QRT-PCR with SYBR® Green I chemistry and the single tube
one-step QRT-PCR with TaqMan® chemistry. The TCID50 (X-axis) of each sample was then plotted against the respective Ct value (Y-axis), and a linear fit was constructed as described in Falsey et al. (2003).
2.4. RESULTS AND DISCUSSION
2.4.1. Absolute quantitation of ISAV using SYBR® Green I chemistry and
ISAV RNA segment 8 recombinant plasmid DNA standards
In order to develop a QRT-PCR method for absolute quantitation of ISAV segment 8 RNA transcripts, the full segment 8 genomic RNA sequence was cloned into a pCRII-TOPO vector for use as the standard. The copy numbers of the pDNA standards prepared ranged from 3X.101 to 3xl09. Preliminary QRT-PCR analysis showed that copy numbers below 3x10 gave inconsistent Ct values within the triplicates. Thus pDNA standards of 3x102 to 3x107 copies were used to generate the standard curve. The curve had a PCR amplification efficiency of 2.0 with high linearity (correlation coefficient r =
0.9979). The pDNA standard curve was used to quantify the ISAV segment 8 cDNA copy number/ng of total RNA extracted from ISAV-infected TO cells and primed for cDNA synthesis using three different priming strategies (oligo-dT, random hexamers, and gene specific F5/R5 primers). In all cDNA priming strategies the 0 hr samples showed the lowest copy number compared to the 3 day and 6 day samples, indicating specific
76 increase in ISAV transcripts due to virus replication. cDNA generated using the gene specific primer showed an overall highest absolute copy number of the ISAV segment
8/ng of total RNA, followed by that of the random hexamer and then the oligo-dT primer
(Fig. 2.1). The agarose gel electrophoresis of the QRT-PCR products showed the expected 220 bp PCR product for the three different priming strategies (see Appendix I,
Supplementary Fig. 2.1), confirming specificity of the PCR reactions. Each primer has a different way of priming cDNA synthesis from RNA of ISAV-infected TO cell lysates.
The oligo-dT primer binds to the poly (A) tails of mRNA to generate first strand cDNA, whereas the gene specific F5/R5 primer anneals specifically to ISAV segment 8 genomic
RNA, cRNA or mRNA to generate first strand cDNA. Random hexamers are capable of priming cDNA at many points along the viral RNA, cRNA, or mRNA template as well as cellular RNA templates, generating fragmentary copies of entire populations of RNA molecules (Sambrook and Russell, 2001).
77 I •a I Random hexamer •5 I Oligo dT I Gene specific primer
0 hour 3 days 6 days Sampling days after ISAV infection
Figure 2.1. cDNA copy number of ISAV segment 8. cDNA copy number of ISAV segment 8 from unknown samples of cDNA generated using RNA extracted from TO cells infected with ISAV isolate NBISA01 and three priming strategies (random hexamer, oligo-dT and gene specific primer) (data are average ± SD of three separate triplicates). The QRT-PCR used SYBR® Green I chemistry with absolute quantitation based on the external standard curve of the ISAV RNA segment 8 pDNA standards.
78 As expected from the limiting RNA populations that can be primed using oligo- dT primers, this priming strategy had the lowest copy number of ISAV transcripts at all the sampling points. The process of mRNA synthesis from the ssRNA genome of ISAV is not well studied. However, influenza A virus which belongs to the Orthomyxoviridae family has been well studied in this respect. Influenza A virus negative-strand RNA
(vRNA) serves as a template for the synthesis both of capped, polyadenylated viral mRNA and of full-length positive-strand RNA or complementary RNA (cRNA)(Cros and
Palese, 2003). The poly (A) tail of influenza virus mRNA is synthesized by reiterative copying of a 5-7 nt long U sequences of 16 nt from the 5' end of the viral RNA template.
The cRNA is associated with the same viral proteins as the vRNA and serves as a template for the synthesis of new vRNA molecules, which in turn serve as templates for mRNA and cRNA, particularly early in the infection (Robertson et ah, 1981; Fodor and
Smith, 2004; Amorim and Digard, 2006). Even though there is no detailed characterization of molecular replication strategy of ISAV, sequencing of 3' and 5' ends of segments 7 and 8 has revealed that ISAV mRNA is polyadenlyated (Sandvik et al.,
2000).
2.4.2. Absolute quantitation of ISAV with SYBR® Green I and TaqMan®
Probe chemistry using ISAV RNA segment 8 in vitro transcribed RNA
standards
Since ISAV has a ssRNA genome, it would be more suitable to use in vitro transcribed RNA of the full segment 8 coding sequence to construct a standard curve. It was considered that in vitro transcribed RNA templates would more accurately estimate
79 template amounts in the RNA inputs and therefore give a more accurate quantitation as
they would be subjected to the same RT reaction (unlike the pDNA standards for QRT-
PCR). For initial calibration, first strand cDNA synthesis used the gene specific F5/R5
primer from 10-fold diluted in vitro transcribed RNA of 101 to 1010 copies. The F5/R5
primer showed non-specific amplification signals in transcribed RNA preparations with
<105 copies. Thus, for comparison of the F5/R5 with the random hexamer priming, in
vitro transcribed RNA standards were prepared in serial 5-fold dilutions with copies
ranging from 3.2x106 to lxl09. The QRT-PCR was carried out under the same conditions
as for the pDNA standard curve. The F5/R5 primed cDNA had a higher amplification
efficiency (E) of 2.14 compared to that for random hexamers primed cDNA (E = 1.94),
which was mainly a result of the lower dilutions of the in vitro transcribed RNA
standards, which generated closer Ct values between dilutions. These low template
reactions in the F5/R5 primed cDNA were associated with primer-dimers. Oligo-dT
priming was not attempted on the in vitro transcribed RNA templates since they were not
polyadenylated.
From the standard curves obtained using in vitro transcribed RNA standards
with the SYBR® Green I chemistry, we selected one default method for estimating the
viral load in the unknown samples. For this, the utility of the two primers (random hexamers and gene specific F5/R5: Oligo-dT primers were excluded since they would not be specific for T7 in vitro transcribed non-polyadenylated RNA standards) to prime cDNA synthesis from all ISAV templates (vRNA, cRNA, and mRNA) and optimality of the PCR amplification efficiency were compared. The F5/R5 showed non-specific primer-dimers in reactions using <10 in vitro transcribed RNA copies whereas the
80 quantitation limit with random hexamer primers was 10 in vitro transcribed RNA copies; the standard curves generated with random hexamer primers also had a better PCR efficiency (E=1.94) compared to those with the gene specific F5/R5 primers (E=2.14).
Thus, the random hexamer cDNA priming-based two step method was selected as the default for absolute quantitation with the SYBR Green I chemistry.
In order to provide a method for absolute quantitation of ISAV using TaqMan probe chemistry, the segment 8 TaqMan® probe-based QRT-PCR assay developed and validated by Snow et al. (2006) was modified for use in a single tube with a one-step
QRT-PCR kit (Roche) in a 96-well plate in the LC 480 instrument (Roche) with absolute quantitation methods. Preliminary QRT-PCR analysis showed that the in vitro transcribed
RNA preparations with >2.2xl01! copies (or >15.16 ng/ul cRNA) inhibited the QRT-
PCR, giving Ct values >34.0 whereas for preparations with 2.2x1010 copies, the Ct value was <5.0 and increased in proportion to the dilution of the in vitro transcribed RNA preparation with a detection limit of 2.2x10 in vitro transcribed RNA copies. Based on these observations, serial 10-fold dilutions were prepared, and those in the range from
2.2xl0:' to 2.2x10" were used to establish a standard curve for ISAV segment 8 RNA transcripts with 2 to 5 replicates per dilution point. The standard curve had an amplification efficiency of 1.965 and error of 0.00866.
Table 2.1 summarizes a comparison between the two methods (SYBR Green
I-based two tube QRT-PCR versus TaqMan® probe-based single tube one-step QRT-
PCR) when applied to RNA extracted from eight serial 10-fold dilutions of virus lysates of NBISA01 and RPC/NB 04-085-1 in terms of their dynamic range (defined as the dilutions that had ISAV positive result, and inconsistent Ct values between triplicates)
81 relative to the virus titres expressed as TCID5o/ml. Both methods had the same TCID50
475 275 detection limits for NBISA01 and RPC/NB-04-085-1, 10 TCID50/ml and 10
TCID5o/ml, respectively. For the same titers of the two isolates the SYBR® Green I method showed 215- and 81-fold higher copy numbers for NBISA01 and RPC/NB-04-
085-1, respectively. The data suggest that there is 100-fold lower detectable virus titer of the lowly pathogenic ISAV isolate RPC/NB-04-085-1, which was accompanied by 3- (in the SYBR® Green I method) and 8-fold (in the TaqMan® method) higher copy number of
RPC/NB-04-085-1 compared to NBISA01. The difference in the TCID50 detection limit for the two virus isolates is probably related to the fact that QRT-PCR also detects viral
RNA in non infectious or defective virus particles which are probably more in the lower pathogenic ISAV. This would imply that the molecular basis for the virulence difference between the two viruses occurs at the post-transcription steps of virus replication, probably resulting in a higher production of non-infectious virus particles by the low pathogenic ISAV isolate RPC/NB-04-085-1.
82 Table 2.1. Comparison of the dynamic range and reliable detection limit of ISAV
segment 8 two tube QRT-PCR with SYBR® Green I chemistry and single tube one-step
QRT-PCR with TaqMan probe chemistry
Two tube QRT-PCR with Single tube one-step QRT- SYBR® Green I PCR with TaqMan® probe
NBISA01 RPC/NB-04- NBISA01 RPC/NB-04- (io8-75 085-l(105-75 (10875 085-1 (10575 TCIDso/ml) TCID5o/ml) TCID5o/ml) TCIDso/ml)
Dynamic range3 io0-" 10u/3 10i/b 10L7i (TCIDso/ml) Reliable io4-73 1 Dynamic range is defined as the dilutions that had ISAV positive result, and inconsistent Ct values between triplicates bReliable detection is defined as the dilutions run in triplicate giving similar Ct values. 'Average and SD of the corresponding Ct values 83 While using the same in vitro transcribed RNA standards for quantitation of ISAV UNA copy equivalents in both chemistries, the SYBR® Green I-based system reported higher RNA copies per ml of virus lysate for a corresponding equivalent or higher Ct value in the TaqMan probe chemistry (Table 2.1). The difference can be partly explained by the sequence-specific detection chemistry of the TaqMan® probe chemistry (Holland et al, 1991; Lay and Wittwer, 1997), compared to the non-specific dsDNA binding of SYBR® Green I fluorophore (Simpson et al, 2000). Moreover, the SYBR® Green I method loses reliability in reactions with low templates amounts (Ct values >35.0). The inconsistency of SYBR! Green I readings for low template reactions was previously reported by Walters et al. (2004). 2.4.3. Correlation of TCIDso with Ct values Using the reliable detection limit (reliable detection is defined as the dilutions run in triplicate giving similar Ct values) for the virus titrations a standard curve was constructed to estimate TCID50/ml from Ct values for the two ISAV isolates, NBISA01 and RPC/NB-04-085-1. The standard curve plots of Ct versus logio TCID50/ml for the SYBR® Green I and TaqMan® chemistries are shown in Figures 2.2A and 2.2B. Both plots have a linear model fit and have small slope difference between the isolates manifested by the parallel nature of the two lines. Both the SYBR® Green I and TaqMan® reaction linear fits suggest that for a certain Ct value NBISA01 will have higher logio TCID50 compared to the RPC/NB-04-085-1 for the range of dilutions considered. This is consistent with NBISA01 being highly pathogenic (Kibenge et al, 2006) where with lower viral genome copies, it can give a higher titer TCID50 compared to the less pathogenic RPC/NB-04-085-1. Similarly, using the NBISA01 dilutions that have 5 points 84 on the standard curve, the linear fits generated using the TaqMan" one tube one-step method were compared with the linear fit generated using the SYBR® Green I two tube method (Fig. 2C). The linear fits show slight differences in the two methods in that the SYBR® Green I two tube reactions show a slightly higher Ct value for a specified TCID50 below 10 /ml (the TCID50 value where the two lines cross). The difference can be explained by the fact that the TaqMan® probe method involves a single step that uses all the cDNA from the RT-step whereas the SYBR® Green I method uses 2 ul of cDNA generated in 20 ul reaction, introducing a 10-fold dilution of the cDNA template. Thus, the slightly higher Ct values of the SYBR Green I two tube method are directly related to the template cDNA amounts available for the PCR stage. The standard curve for NBISA01 constructed using the TaqMan single tube one-step method was used to estimate the TCID50 in tissue samples of NBISA01 infected fish. The standard curve estimated the fish tissue samples to have virus titers ranging 487 623 from 10 to 10 TCID50/ml. thus, the method can be used to estimate ISAV loads in fish tissues based on RNA copy numbers, and to estimate the viral titers (TCID50) without use of the time-consuming virus titration in fish cell lines. 85 A • NBISAOl • RPC/NB-04 -085-1 40 - 35 - .^y = -3.8338x+54.428 30 • ^->^R2 = 0.9911 g 25 • y = -3.551X + 44.404 1 20 - R* = 0.9736 0 15 • 10 - 5 • n C 2 4 6 8 10 LogTCID50/ml B -NBISAOl I RPC/NB-04-085-1 40 -] 35 • *^^ y = -3 0918x+ 48.544 30 • ^"""'V^ ^^'-<^ R2 = 0.9815 „ 25 - •i 20 - y = -3.3977x+40.566 O> 15 - R* = 0 9655 10 • 5 • n - U 1 * * ' ' 0 2 4 6 8 10 LogTCID^/ml c • Taq Man • SYBR Green I 40 -i 35 - ». y = -3.8338x+54.428 •^x^^ R* = 0,9911 30 - y = -3.048K + 48. 204!!^sy ^ g 25 • 11 R* = 0.9824 ^-N^ f 20 - O 15 - 10 - 5 • 0 • 1 1 J 1 \ 2 4 6 8 10 LogTCIDjo/ml of NBISAOl isolate Figure 2.2. Standard curve relating TCID50 to Ct value of ISAV segment 8. Standard curve relating TCID50 to Ct value from QRT-PCR using 10-fold dilutions of virus lysates of known titre (A) SYBR® Green I two tube method, Ct values versus Log 10 TCID50 for NBISAOl and RPC/NB-04-085-1 (B) TaqMan® one tube method, Ct values versus LoglO TCID50 for NBISAOl and RPC/NB-04-085-1, (C) SYBR® Green I two- tube and TaqMan® one-tube method, Ct values versus LoglO TCID50 for NBISAOl. 86 In conclusion, this chapter describes methods for absolute quantitation of IS AV genome copies using external standard curves generated with either ISAV pDNA standards or in vitro transcribed RNA standards, and for the first time report a correlation of Ct values to viral titers expressed as TCID5(/ml using two ISAV isolates of differing pathogenicities and two detection chemistries. Both SYBR® Green I and TaqMan® probe chemistries showed a 100-fold lower detectable titer for RPC/NB-04-085-1, but with a higher number of viral RNA starting molecules compared to NBISA01, indicating that the lowly pathogenic ISAV produces more non-infectious or defective particles than the highly pathogenic ISAV. Overall, the SYBR® Green I method overestimated ISAV RNA copy number equivalents in samples having equivalent Ct values with the TaqMan® probe method. Thus, the TaqMan" probe method with the in vitro transcribed RNA standard curve is the preferred method for reliable and rapid quantification of ISAV in samples. Appendix I Supplementary Figure 2.1. Agarose gel electrophoresis picture of the QRT-PCR products of ISAV segment 8. 87 2.5. REFERENCES Amorim MJ, Digard P. Influenza A virus and the cell nucleus. Vaccine 2007;24:6651- 6655. Anonymous. Creating standard curves with genomic DNA or plasmid DNA templates for use in quantitative PCR, 2003. http://wwvv.appliedbiosystems.com/support/tutorials/pdf/quant pcr.pdf. Bustin SA. Absolute quantification of mRNA using real-time reverse transcription polymerase chain reaction assays. J Mol Endocrinol 2000;25:169-193. Bustin SA. Real-time, fluorescence-based quantitative PCR: a snapshot of current procedures and preferences. Expert Rev Mol Diagn 2005;5:493-498. Cros JF, Palese P. Trafficking of viral genomic RNA into and out of the nucleus: influenza, Thogoto and Borna disease viruses. Virus Res 2003;95:3-12. Cunningham CO, Snow M. Genetic analysis of infectious salmon anaemia virus (ISAV) from Scotland. Dis Aquat Org 2000;41:1-8. Devoid M, Kross0y B, Aspehaug V, Nylund A. Use of RT-PCR for diagnosis of infectious salmon anaemia virus (ISAV) in carrier sea trout Salmo trutta after experimental infection. Dis Aquat Org 2000;24:9-18. Falscy AR, Formica MA, Treanor JJ, Walsh EE. Comparison of quantitative reverse transcription-PCR to viral culture for assessment of respiratory syncytial virus shedding. J Clin Microbiol 2003;41:4160-4165. Flint SJ, Enquist LW, Racaniello VR, Skalka AM. Assembly exit and maturation. In: Principles of Virology: Molecular biology, pathogenesis, and control of animal viruses, ASM Press, 2nd ed., Washington, DC, 2004:450-489 88 Fodor E, Smith M. The PA subunit is required for efficient nuclear accumulation of the PB1 subunit of the influenza A virus RNA polymerase complex. J Virol 2004;78: 9144- 9153. Fronhoffs S, Totzke G, Stier S, Wernert N, Rothe M, Bruning T, Koch B, Sachinidis A, Vetter H, Ko Y. A method for the rapid construction of cRNA standard curves in quantitative real-time reverse transcription polymerase chain reaction. Mol Cell Probes 2002;16:99-110. Giulietti A, Overbergh L, Valckx D, Decallonne B, Bouillon R, Mathieu C. An overview of real-time quantitative PCR: applications to quantify cytokine gene expression. Methods 2001 ;25: 386-401. Holland PM, Abramson RD, Watson R, Gelfand DH. Detection of specific polymerase chain reaction product by utilizing the 5 -3 exonuclease activity of Thermus aquaticus DNA polymerase. Proc Natl Acad Sci, USA 1991;88:72-76. Kibenge FSB, Kibenge MJT, Groman D, McGeachy S. In vivo correlates of infectious salmon anaemia virus pathogenesis in fish. J Gen Virol 2006;87:2645-2652. Kibenge FSB, Kibenge MJT, Wang Y, Qian B, Hariharan S, McGeachy S. Mapping of putative virulence motifs on infectious salmon anaemia virus surface glycoprotein genes. J Gen Virol 2007;88:3100-3111. Kileng 0, Brundtland MI, Robertsen B. Infectious salmon anemia virus is a powerful inducer of key genes of the type I interferon system of Atlantic salmon, but is not inhibited by interferon. Fish Shellfish Immunol 2007;23:378-389. Lay MJ, Wittwer CT. Real-time fluorescence genotyping of factor V Leiden during rapid-cycle PCR. Clin Chem 1997;43:2262-2267. 89 Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time AAC quantitative PCR and the 2" Tmethod. Methods 2001;25:402-408. Mjaaland S, Markussen T, Sindre II, Kjoglum S, Dannevig BH, Larsen S, Grimholt U. Susceptibility and immune responses following experimental infection of MHC compatible Atlantic salmon (Salmo salar L.) with different infectious salmon anaemia virus isolates. Arch Virol 2005;150:2195-2216. Munir K, Kibenge FSB. Detection of infectious salmon anaemia virus by real-time RT- PCR. J Virol Methods 2004; 117:37-47. Pettersen EF, Ingerslev HC, Stavang V, Egenberg M, Wergeland HI. A highly phagocytic cell line TO from Atlantic salmon is CD83 positive and M-CSFR negative, indicating a dendritic-like cell type. Fish Shellfish Immunol. 2008; 25:809-819. Robertson JS, Schubert M, Lazzarini RA. Polyadenylation sites for influenza virus mRNA. J Virol 1981;38:157-163. Sambrook J, Russell DW. Molecular Cloning: A Laboratory Manual, 3rd ed., Cold Spring Harbor Laboratory Press, New York, USA, 2001. Sandvik T, Rimstad E, Mjaaland S. The viral RNA 3'- and 5'-end structure and mRNA transcription of infectious salmon anaemia virus resemble those of influenza viruses. Arch virol 2000;145:1659-1669. Sellars MJ, Vuocolo T, Leeton LA, Coman GJ, Degnan BM, Preston NP. Real-time RT- PCR quantification of Kuruma shrimp transcripts: A comparison of relative and absolute quantification procedures. J Biotec 2007;129:391-399. Simpson DAC, Feeney S; Boyle C, Stitt AW. Retinal VEGF mRNA measured by SYBR green I fluorescence: A versatile approach to quantitative PCR. Mol Vis 2000;6:178-183. 90 Snow M, McKay P, McBeath AJ, Black J, Doig F, Kerr R, Cunningham CO, Nylund A, Devoid M. Development, application and validation of a Taqman real-time RT-PCR assay for the detection of infectious salmon anaemia virus (ISAV) in Atlantic salmon (Salmo salar). Dev Biol 2006;126:133-145. Vandesompele J, De Preter K, Pattyn F, Poppe B, Van Roy N, De Paepe A, Speleman F. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol 2002;3: research0034.1-0034.11 . Vijgen L, Keyaerts E, Moes E, Maes P, Duson G, Van Ranst M. Development of one- step, real-time, quantitative reverse transcriptase PCR assays for absolute quantitation of human coronaviruses OC43 and 229E. J Clin Microbiol 2005;43:5452-5456. Walters G, Alexander SI. T cell receptor BV repertoires using real time PCR: a comparison of SYBR green and a dual-labelled HuTrec™ fluorescent probe. J Immunol Methods 2004;294:43-52. Wergeland HI, Jakobsen RA. A saimonid cell line (TO) for the production of infectious salmon anaemia virus (ISAV). Dis Aquat Org 2001;44:183-190. Wong ML, Medrano JF. Real-time PCR for mRNA quantification. BioTechniques 2005;39:75-85. 91 3. Infectious salmon anaemia virus endocytosis in fish erythrocytes 3.1. SUMMARY Infectious salmon anaemia (ISA) virus (ISAV) is a fish orthomyxovirus that has recently been assigned to the new genus Isavirus within the family Orthomyxoviridae. It possesses the major functional characteristics of the virus family including ability to haemagglutinate erythrocytes, receptor destroying enzyme (RDE), and fusion activities associated with the virion surface proteins. It is generally accepted that ISAV agglutinates erythrocytes of several fish species and that the ISAV RDE activity dissolves this haemagglutination reaction except for Atlantic salmon (Salmo salar) erythrocytes. Transmission electron microscopy was used to examine the physical interaction between ISAV and erythrocytes from Atlantic salmon and rainbow trout (Oncorhynchus mykiss) during haemagglutinations. The results provide evidence that ISAV enters into Atlantic salmon erythrocytes. Atlantic salmon erythrocytes incubated with ISAV for 4 hr showed endocytosis of the virus particles, which is consistent with virus infection. These observations suggest that the lack of dissolution of ISAV-induced haemagglutination of Atlantic salmon erythrocytes favours virus infection of the erythrocytes. Moreover, such a haemagglutination-infection phenotype is fundamentally different from haemagglutination by avian and mammalian orthomyxoviruses, and is indicative of a different pathogenesis for the fish orthomyxovirus. *Workenhe ST, Wadowska DW, Wright GM, Kibenge MJT, Kibenge FSB. Demonstration of infectious salmon anaemia virus (ISAV) endocytosis in erythrocytes of Atlantic salmon. Virol J 2007;4:13. 92 3.2. INTRODUCTION Enveloped viruses like ISAV enter target cells by attachment to receptor molecules on the plasma membrane and this initial attachment determines the host range and tissue tropism of the virus (Eliasen et ah, 2000). Hemagglutinin-esterase (HE) is a major surface glycoprotein of ISAV with dual function: the haemagglutinin portion is used for host cell recognition by attaching to the cellular sialic acid receptor for inducing infection through the endosomal pathway (Mikalsen et ah, 2005) whereas the esterase portion is a receptor destroying enzyme (RDE) that dissolves the haemagglutinin binding thereby allowing release of new virus particles from infected cells (Falk et ah, 2004). Infectious salmon anemia virus has been shown to agglutinate erythrocytes of several fish species except brown trout (Salmo trutta L) and the RDE activity allowed the virus to elute from erythrocytes of other fish species except Atlantic salmon, which did not elute after 24 hr (Falk et ah, 1997). This has been suggested to be related to the pathogenicity of the virus in that viruses that were able to elute also caused low mortality in a challenge experiment (Falk and Dale, 2006). In the present study, we performed haemagglutination tests using Atlantic salmon and rainbow trout erythrocytes with two ISAV isolates, NBISA01 and RPC/NB-04-085- 1, of differing genotypes and pathogenicity phenotypes. NBISA01 is a highly pathogenic isolate belonging to the North American genotype, whereas RPC/NB-04-085-1 is a lowly pathogenic isolate of the European genotype found in eastern Canada and its HE protein places it in a unique highly polymorphic region (HPR) group (Kibenge et ah, 2006). At specific intervals the haemagglutination reactions were sampled and processed for electron microscopy to visualize the physical relationships between the virus and the 93 erythrocytes. Samples were also used to quantitate the viral mRNA levels by QRT-PCR in order to confirm presence of virus in the samples and detect any virus replication. 3.3. MATERIALS AND METHODS 3.3.1. Viruses Two ISAV isolates of differing genotypes and pathogenicity phenotypes (NBISA01, and RPC/NB-04-085-1) (described in detail under section 2.3.1) were used. The viruses were propagated in TO cells and the lysates titrated in TO cells as previously described in Kibenge et al. (2001). The NBISA01 and RPC/NB-04-085-1 isolates used in the experiments had a TO cell passage of 3 and 5; respectively. 3.3.2. Haemagglutination assays The erythrocytes used for haemagglutination in this study were collected from specific pathogen free Atlantic salmon and rainbow trout weighing 20-30 g. The haemagglutination reaction was earned out with 50 ul of NBISA01 or RPC/NB-04-085-1 and 50 ul of 1% erythrocytes of Atlantic salmon or rainbow trout in a microhaemagglutination plate, according to the procedure described by Falk et al. (1997). The haemagglutination reactions were incubated at room temperature (24°C) and samples were collected at 0.5, 1.5, 4, 18, and 36 hr and processed for electron microscopy. 3.3.3. Transmission electron microscopy The haemagglutination reactions from each well were pooled and fixed overnight at 4°C in 3% final glutaraldehyde solution in 0.1 M phosphate buffer. The pellets were recovered by centrifugation at 3,000 rpm for 10 minutes and resuspended in 1ml of 0.1 M phosphate buffer. The samples were centrifuged at 4,000 rpm for 10 minutes twice to 94 completely remove the glutaraldehyde. Secondary fixation was done on the pellet using lml of 1 % osmium tetroxide in 0.1 M phosphate buffer for 30 minutes. The fixed samples were centrifuged at 4,000 rpm for 10 minutes and the pellet was embedded with 4% agar in distilled water and cut into pieces before dehydration in ascending concentrations of ethanol (50, 70, and 95% and absolute ethanol). A 5-minute propylene oxide step was done before the infiltration procedure. Infiltration was carried out with a mixture of epon resin and propylene oxide in a ratio of 1:1 and 1:3 each for 30 minutes, and a final overnight infiltration step with 100% epon in vacuum. The pellet pieces were then embedded in epon resin overnight at 60°C. Semi-thin sections (0.5 urn) were cut from two pieces of pellet (blocks) from each experimental unit and stained with 1% toluidine blue in 1% sodium tetraborate solution and viewed under light microscope. Ultrathin sections (80 nm) were cut ultramicrotome and recovered using copper super grids and double stained with uranyl acetate and Sato's lead stain. The sections were examined using a Hitachi H7500 transmission electron microscope operated at 80 kV. The experimental output presented is a result of replicate observations. 3.3.4. One tube QRT-PCR of ISAV segment 8 Infectious salmon anemia virus QRT-PCR was done using the LightCycler 1.2 system with RNA Amplification Kit SYBR Green I (Roche) and PCR primers FA-3/RA- 3 targeting a 220-bp product on ISAV segment 8 (Munir and Kibenge, 2004). For this, the pooled haemagglutination reaction samples collected at 0, 18, and 36 hr were centrifuged at 10,000 rpm for 5 minutes in a microfuge to pellet the erythrocytes and total RNA was then extracted using TRIzol reagent (Invitrogen) and the RNA pellet was dissolved in 15 JJ.1 of RNase free water of which lul was used in QRT-PCR. The 20 ul- 95 reaction volume included 19 ul of the master mix containing 0.3 uM each of the forward and reverse primers, 4 ul SYBR Green, 0.2 ul LC-RT-PCR enzyme mix, 3 ul resolution solution, 0.005 uM MgCi2, and 9.4 ul of nuclease-free water. The thermal conditions were one cycle of reverse transcription at 55°C for 30 min, initial denaturation at 95°C for 30 s followed by 50 cycles of 95°C for 5 s, 59°C for 10 s, 72°C for 10 s, and data acquisition at 80°C for 2 s. Melting curve analysis was performed from 70°C to 95°C in 0.1°C/s increments to assess the specificity of the QRT-PCR products. The quantitative (Ct values) and melting curve data were analyzed using Light Cycler software version 3.5 (Roche). The QRT-PCR products were also resolved by 1% agarose gel electrophoresis in 0.5 x Tris/Borate/EDTA buffer and stained with ethidium bromide and photographed under 304 nm UV light. 3.4. RESULTS AND DISCUSSION 3.4.1. ISAV endocytosis in erythrocytes Transmission electron microscopic analysis of the ultrathin sections showed the NBISA01 virus closely apposed to the cell membrane of Atlantic salmon erythrocytes and the apparent stages of endocytosis where there was an initial close apposition of the virus, the presence of the virus within an invagination of the plasma membrane that has formed a pit, partial closure of the pit, and virus particles in membrane bound vesicles within the cytoplasm of erythrocytes by 4 hr (Fig. 3.1). In the 18 hr sample, we observed stages of endocytosis of NBISA01 in Atlantic salmon erythrocytes as well as a number of virus particles within vesicles in the cytoplasm. Unlike the Atlantic salmon erythrocytes, it was possible to locate only one intracellular NBISA01 virus particle in the rainbow 96 trout erythrocytes in either the 4 hr or 18 hr sample after 3 hr examination of several grids from three different blocks. Thorough examination of several grids from three different blocks for 3 hr revealed that RPC/NB-04-085-1 haemagglutinations had close apposition of the virus to erythrocytes of both Atlantic salmon and rainbow trout by 1.5 hr but neither close apposition nor entry in the erythrocytes at 4 and 18 hr. The lack of haemagglutination elution in the pathogenic ISAV isolates has been explained by others as being due to the absence of a functional receptor-destroying enzyme, which allows the virus to persistently attach to erythrocytes (Falk and Dale, 2006). Our observation of NBISA01 virus entry into erythrocytes of Atlantic salmon suggests that the lack of hemagglutination elution in pathogenic ISAV isolates in conventional haemmaglutination tests favours virus infection of the erythrocytes. This is the first time such observation is reported and to the best of our knowledge such a haemagglutination-infection phenotype is fundamentally different from haemagglutination by avian and mammalian orthomyxoviruses, and indicates a different pathogenesis for the fish orthomyxovirus. 97 A B C D Figure 3.1. Transmission electron micrographs showing the various stages of apparent endocytosis of the NBISA01 virus in Atlantic salmon erythrocytes. (A) a virus particle within an invagination of the plasma membrane (bar= 139 nm); (B) partial closure of the pit containing a virus particle (bar =139 nm); (C) and (D) virus particle within a vesicle in the erythrocyte cytoplasm (bar= 139 nm). All the images were taken from haemagglutination samples incubated for 4 hr. 98 3.4.2. Segment 8 transcripts after ISAV induced haemagglutination Previous reports relate ISAV-induced pathogenesis of the anemia to haemagglutination of erythrocytes by the virus followed by uptake of the virus-coated erythrocytes by the immune cells (Dale et al., 2006). However, our present observation of the highly pathogenic NBISA01 isolate inside Atlantic salmon erythrocytes, and the nucleated nature offish erythrocytes led us to suggest that the ISAV-induced anemia may be linked to entry and possible multiplication of pathogenic virus in erythrocytes. To test this hypothesis, we used QRT-PCR to assess the viral mRNA levels in the haemagglutination re action samples taken at 18 and 36 hr. The QRT-PCR data are presented in Figure 3.2. Figure 3.2A shows that there was a slight increase in viral mRNA transcripts by 36 hr in the haemagglutination reaction of Atlantic salmon erythrocytes with NBISA01 virus, which is indicated by a lower mean Ct value (27.59±0.70) compared to the 0 hr (30.8±0.70) and 18 hr samples (32.62±1.10). This increase may be indicative of an early virus replication; however, a longer sampling interval will be necessary to confirm if ISAV replication occurs in fish erythrocytes. Figure 3.2B shows a single fluorescence peak on analysis of the melting curve, and Figure 3.2C shows the 220 bp product by agarose gel electrophoresis, indicating that the amplifications were virus-specific, and that there were uniform virus populations in the individual virus samples. 99 MM 12345 6789 10 Figure 3.2. Amplification, melting curve, and agarose gel electrophoresis of QRT- PCR targeting a 220 bp product on ISAV segment 8 using total RNA from haemagglutination tests at different sampling points. (A) QRT-PCR amplification curves (water (Ct=0) - no template negative control; 1% rbc rt (Ct=0) - rainbow trout erythrocyte control; 1% rbc as(Ct=0) - Atlantic salmon erythrocyte control; 0 hr rt (Ct=28.6±4.62) - NBISA01 haemagglutination reaction of 1% rainbow trout erythrocyte sampled at 0 hr; 0 hr as (Ct=30.8±0.70) - NBISA01 haemagglutination reaction of 1% Atlantic salmon erythrocyte sampled at 0 hr; 18 hr rt (sample not run in triplicate because of insufficient total RNA) - NBISA01 haemagglutination reaction of 1% rainbow trout erythrocyte sampled after 18 hr incubation; 18 hr as (Ct=32.62±1.10) - NBISA01 haemagglutination reaction of 1% Atlantic salmon erythrocyte sampled after 18 hr incubation; 36 hr rt (Ct=30.27±0.63) - NBISA01 haemagglutination reaction of 1% rainbow trout erythrocyte sampled after 36 hr incubation; 36 hr as (Ct=27.59±0.70) - NBISA01 haemagglutination reaction of 1% Atlantic salmon erythrocyte sampled after 36 hr incubation; NBISA01 (Ct=28.46±0.52) - virus positive control). (B) Melting curve of the QRT-PCR of the run in (A). (C) PCR products resolved on 1% agarose gel electrophoresis and visualized by ethidium bromide staining. The order of the lanes in the gel picture is the same as in the amplification curves (A). 100 In a previous fish challenge experimental study conducted in our lab to investigate correlates of ISAV virulence, the NBISA01 isolate was shown to induce very high mortality in Atlantic salmon (95%) and moderate mortality in rainbow trout (50%) (Kibenge et al., 2006). In the present study, the extent of endocytosis of this virus isolate in erythrocytes of the two different hosts seems to be related to host susceptibility to the virus in that in Atlantic salmon, which is the susceptible host, NBISA01 haemagglutinations showed numerous examples of apparent virus endocytosis by 4 hr and intracellular virus particles by 18 hr whereas in rainbow trout, which is a resistant host, there was limited virus endocytosis by 4 hr and none observed by 18 hr. Consistent with this analysis were our observations with ISAV isolate RPC/NB-04-085-1. This virus was shown to induce very low mortality in Atlantic salmon (18.2%) and no mortality in rainbow trout (Kibenge et al., 2006). Electron microscopy analysis of the haemagglutination reactions showed that RPC/NB-04-085-1 isolate did not undergo endocytosis in both Atlantic salmon and rainbow trout erythrocytes at 4 and 18 hr. In the 4 hr samples we observed invaginations in the erythrocytes' plasma membrane that probably had been induced by previous viral attachment to the erythrocytes. These results suggest an initial attachment of the virus to erythrocytes and a later release of the virus. This absence of virus endocytosis with the less pathogenic ISAV isolate when added to the evidence of haemagglutination-elution in the non-virulent isolates (Falk and Dale, 2006) highlights a new understanding of ISAV virulence variation among different isolates. In conclusion, these results show apparent endocytosis of the highly pathogenic NBISA01 isolate into erythrocytes of Atlantic salmon to a larger extent and in rainbow 101 trout to a minor extent. The entry of the virus into erythrocytes is favoured by the lack of haemagglutination elution of the pathogenic ISAV isolates and is suggestive of virus infection of Atlantic salmon erythrocytes. The lowly pathogenic RPC/NB-04-085-1 isolate was able to closely appose to erythrocytes of both hosts at an earlier sampling point but there was no morphological evidence of endocytosis by erythrocytes of both hosts at the later sampling point. 102 3.5. REFERENCES Dale OB, Falk K, Kvellestad A. An overview of infectious salmon anemia pathology and suggested pathogenesis. Fifth International Symposium on Aquatic Animal Health, 2006, USA. Eliassen TM, Fraystad MK, Dannevig BH, Jankowska M., Brech A, Falk K, Rom0ren K, GJ0en T. Initial events in infectious salmon anemia infection: Evidence for the requirement of a low-pH step. J Virol 2000;74:218-227. Falk K, Aspehaug V, Vlasak R, Endresen C. Identification and characterization of viral structural proteins of infectious salmon anemia virus. J Virol 2004;78:3063-3071 Falk D, Dale OB. Experimental evidence indicating that lack of viral receptor destroying enzyme is a major factor for infectious salmon anemia pathogenesis. Fifth International Symposium on Aquatic Animal Health, 2006, USA. Falk K, Namork E, Rimstad E, Mjaaland S, Dannevig BH. Characterization of infectious salmon anemia virus, an orthomyxo-like virus isolated from Atlantic salmon (Salmo salar L.). J Virol 1997;71:9016-9023. Mikalsen AB, Sindre H, Mjaaland S, Rimstad E. Expression, antigenicity and studies on cell receptor binding of hemagglutinin of infectious salmon anemia virus. Arch Virol 2005;150:1621-1637. Munir K, Kibenge FSB. Detection of infectious salmon anaemia virus by real-time RT- PCR. J Virol Meth 2004;117:37-47, Kibenge FSB, Kibenge MJT, Groman D, McGeachy S. In vivo correlates of infectious salmon anemia virus pathogenesis in fish. J Gen Virol 2006;87:2645-2652. 103 Kibenge FSB, Kibenge MJT, McKenna PK, Stothard P, Marshall R, Cusack RR, McGeachy S. Antigenic variation among isolates of infectious salmon anaemia virus correlates with genetic variation of the viral haemagglutinin gene. J Gen Virol 2001;82:2869-2879. 4. Infectious salmon anaemia virus replication and induction of IFN-a in Atlantic salmon erythrocytes 4.1. SUMMARY Infectious salmon anaemia (ISA) virus (ISAV), which causes ISA in marine- farmed Atlantic salmon, is an orthomyxovirus belonging to the genus Isavirus, family Orthomyxoviridae. ISAV agglutinates erythrocytes of several fish species and it is generally accepted that the ISAV receptor destroying enzyme (RDE) dissolves this haemagglutination except for Atlantic salmon erythrocytes. ISAV isolates that are able to elute from Atlantic salmon erythrocytes were shown to cause low mortality in Atlantic salmon challenge experiments. Moreover, ISAV-induced haemagglutination using the highly pathogenic ISAV isolate NBISA01 and the lowly pathogenic ISAV isolate RPC/NB-04-085-1, showed endocytosis of NBISA01 but not RPC/NB-04-085-1 (Chapter 3). QRT-PCR was used to assess the viral RNA levels in the ISAV-induced haemagglutination reaction samples, and we observed a slight increase in viral RNA transcripts by 36 hr in the haemagglutination reaction with NBISA01 virus when the experiment was terminated (Chapter 3). However, a longer sampling interval was considered necessary to confirm ISAV replication in fish erythrocytes and to determine if the infected cells mounted any innate immune response. This study examined the possible ISAV replication and the expression of type I interferon (IFN) system genes in Atlantic salmon erythrocytes following ISAV haemagglutination. *Workenhe ST, Kibenge MJT, Wright GM, Wadowska DW, Groman DB, Kibenge FSB. Infectious salmon anaemia virus replication and induction of alpha interferon in Atlantic salmon erythrocytes. Virol J 2008;5:36. 105 Haemagglutination assays were performed using Atlantic salmon erythrocytes and one haemagglutination unit of the two ISAV isolates, NBISA01 and RPC/NB-04-085-1, of differing genotypes and pathogenicities. Haemagglutination induced by the highly pathogenic NBISA01, but not the lowly pathogenic RPC/NB-04-085-1 resulted in productive infection as evidenced by increased ISAV segment 8 transcripts and increase in the median tissue culture infectious dose (TCID50) by 120 hr of incubation. Moreover, QRT-PCR used to compare mRNA levels of key type IIFN system genes in erythrocyte lysates of haemagglutination rea ctions with the two ISAV isolates showed a higher relative fold increase of IFN-a in NBISA01 compared to RPC/NB-04-085-1 haemagglutinations (33.0-44.26 relative fold increase compared to 11.29). Erythrocytes exposed to heat-inactivated virus or to polyinosinic:polycytidylic acid (poly I:C) or to L- 15 medium alone (negative control assays) had minimal late induction (<3.5 relative fold increase) of STAT1 and/or ISG15 and Mx genes, whereas erythrocytes exposed to UV- inactivated virus lacked any cytokine up-regulation. ISAV-induced haemagglutination by a highly pathogenic virus isolate results in virus uptake and productive infection of Atlantic salmon erythrocytes accompanied by significant up-regulation of IFN-a mRNA. This study also highlights the critical role of ISAV isolate variation in the initial stages of the virus-cell interaction during haemagglutination, and possibly in the pathogenesis of ISA. Moreover, the study shows that fish erythrocytes immunologically respond to ISAV infection. 106 4.2. INTRODUCTION The clinical disease caused by ISAV in marine-farmed Atlantic salmon is associated with anaemia (Evensen et al, 1991), which is mainly due to haemorrhagic blood loss, although the minor anaemia in the initial stages of the disease has been hypothesized to be linked with uptake of virus-coated erythrocytes by immune cells (Dale et al., 2006). The fish erythrocytes would probably be coated with ISAV through interaction of the cellular sialic acid receptors and the ISAV haemagglutinin-esterase (HE) glycoprotein as occurs during the haemagglutination reaction. ISAV haemagglutination of fish erythrocytes, similar to influenza A virus haemagglutination of avian and mammalian erythrocytes, involves three independent phenomena: (1) adsorption of viruses at the erythrocyte membrane by binding of the ISAV haemagglutinin protein to the erythrocytes sialic acid receptors, (2) subsequent elution effected by the activity of the receptor destroying enzyme (Hirst, 1941; Howe and Lee, 1972; Falk et al, 1997), which is not always complete, and (3) in case of persistent haemagglutination there will be uptake of viruses by the erythrocytes (Bossart et al., 1973). For ISAV, elution from erythrocytes was originally reported to occur with erythrocytes of several fish species except Atlantic salmon (Falk et al, 1997) in which the virus causes a natural clinical disease (Kibenge et al, 2004). However, recent work indicates that ISAV isolates that are able to elute from Atlantic salmon erythrocytes cause low mortality in challenge experiments (Falk and Dale, 2006). The HE protein of ISAV shows the highest sequence variability and is assumed to be of importance in ISAV virulence (Mjaaland et al, 2002; Mjaaland et al., 2005). Most of the variation in this molecule is concentrated to a 35 amino acid small highly 107 polymorphic region (HPR) in the stem region of HE near the transmembrane domain (Cunningham et ah, 2002; Mjaaland et al., 2002), suggested to result from differential deletions of a full-length avirulent precursor gene (HPRO) resulting in more or less pathogenic viruses (Mjaaland et al., 2002). Deletions or insertions in the HPR may affect several properties of the HE including flexibility and receptor binding specificity and affinity, antigenicity, esterase activity, interaction with other proteins and possibly polymerization of the protein (Aspehaug et ah, 2005). Kibenge et al. (2007) analyzed the full length sequence of the HE protein of 13 isolates of ISAV belonging to European and North American genotypes thai have been characterized for their pathogenicity phenotypes (Kibenge et al., 2006). Based on the results of the sequence analysis and correlation with growth properties of the isolates in cell culture, it is hypothesized that the number of amino acids deleted/inserted and /or mutations of the FNT motif in the HPR of the HE protein are determinants of ISAV virulence. A pattern observed from sequence analysis data is that HPRO (non-cultivable isolates) do not have deletions in the HPR of the HE protein, whereas less pathogenic isolates with <13 amino acid deletions but with the 352FNT354 motif have reduced cycles of infection. On the extreme side, most ISAV isolates with >13 amino acid deletions (or if less with deletions or mutations of the 352FNT354 motif appear to be highly pathogenic (Kibenge et al, 2007). Although these virulence markers were recently revealed there have been no studies to correlate the length of the HPR region with its influence in the receptor binding properties of ISAV isolates during haemagglutination or the RDE activity of the esterase protein. The type IIFN system constitutes the major antiviral defense mechanism in the innate immune system of mammals as well as fish (Robertsen, 2006). Most cell types are 108 able to detect viral replication nucleic acid intermediates and respond by secretion of IFN, which then uses the JAK/STAT signaling pathway to stimulate induction of the components of the type I IFN system genes such as Mx, ISG15 and STAT1 (Samuel, 2001). Atlantic salmon organs and the macrophage/dendritic like Atlantic salmon cell line TO (Wergeland and Jakobsen, 2001) respond to ISAV infection by up-regulating the expression of key type I IFN system genes (McBeath et ah, 2007). The limited immunological studies on the nucleated fish erythrocytes suggest that they possess a certain level of immune functions; the mature erythrocyte populations of rainbow trout, Oncorhynchus mykiss, were shown to surround macrophages phagocytosing Candida albicans and to secrete cytokine-Iike macrophage inhibitory factors (Passantino et al., 2004). However, there is no report of IFN mRNA expression by intact erythrocytes in fish, avian or mammalian species. The goal of this study was to investigate events of virus replication and expression of host type I IFN system genes. This information is essential to further clarify the pathogenesis of the clinical disease in fish. Haemagglutination assays utilized 1% erythrocytes and ISAV isolates NBISA01, a highly pathogenic North American isolate and RPC/NB-04-085-1, a lowly pathogenic European isolate. For studying the replication of ISAV into Atlantic salmon erythrocytes, virus titration in a permissive cell line and QRT-PCR were used. In order to obtain information on the putative associated innate immune response in erythrocytes, we used QRT- PCR assays to evaluate mRNA levels of key type I IFN system genes IFN-a, Mx, ISG15, PKZ and the transcription factor STAT1 at regular intervals up to 120 hr after virus-induced haemagglutination. 109 4.3. MATERIALS AND METHODS 4.3.1. Viruses Two ISAV isolates of differing genotypes and pathogenicity phenotypes (NBISA01 and RPC/NB-04-085-l)(described in detail under section 2.3.1) were used. The viruses were propagated in TO cells and the lysates titrated in TO cells as previously described (Kibenge et al, 2001). The NBISA01 and RPC/NB-04-085-1 isolates used in the experiments had a TO cell passage of 3 and 5, respectively. 4.3.2. Virus inactivation The viruses were inactivated by using either UV light or heat treatment. UV inactivation of ISAV was carried out with a germicidal UV lamp (G30T8 with 30 Watt and 36 inch length, and a UV intensity of 125 uW/cm2 at 1 meter from the lamp) suspended in a biological safety cabinet (Class II A/B3 BSC, Thermo Forma) following the procedure reported by 0ye and Rimstad (2001), with minor modifications. Briefly, 20.0 ml of virus suspension in a 4-well cell culture plate were placed 10 cm from the UV lamp. The plate was left open under UV-exposure for 18 hr. Heat inactivation of ISAV was performed by incubating 1.0 nil of the virus suspension in a 1.5-ml microfuge tube at 56°C for 5 minutes. Complete inactivation of virus by both methods was confirmed by titration in TO cells (Kibenge et al, 2001) before use in the haemagglutination reactions. 4.3.3. Haemagglutinatioji assays Atlantic salmon and rainbow trout erythrocytes were collected from specific pathogen free 100 g-Atlantic salmon and rainbow trout using EDTA-coated Vacutainer® tubes. All the haemagglutinations for the electron microscopy study (Chapter 3) were 110 carried out using 1% Atlantic salmon and rainbow trout erythrocytes in phosphate buffered saline (PBS). In the subsequent experiments, we wanted to maintain Atlantic salmon erythrocytes in PBS for a longer period; however, erythrocytes resuspended in PBS were dead after 48 hr. Therefore, common fish cell line growth media, Leibovitz's (L)-15 (Invitrogen) and Hanks minimum essential medium (Bio Whittaker)(HMEM) with -l 10% fetal bovine serum (FBS), 2 mM L-glutamine, 100 IU/ml penicillin G, 100 jug ml -l streptomycin, and 0.25 ug ml amphotericin B, were tested to identify which one better maintains erythrocyte viability. Using the Trypan blue dye exclusion test, we found that erythrocytes resuspended in L-15 growth medium had lower cell deaths, and those surviving maintained a normal shape in contrast to erythrocytes in HMEM which were shrunken. In subsequent experiments, the Atlantic salmon erythrocytes were washed and then resuspended in L-15 medium supplemented with 10% FBS. For determining the haemagglutination units of the stock virus preparations, haemagglutination reactions were set up using 50 ul of two-fold dilutions of the two virus isolates and 50 ul of 1% erythrocytes. The haemagglutination was set using four wells for each virus dilution; one haemagglutination unit was defined as the highest virus dilution that induced haemmaglutination in four wells within 1 hr at room temperature. Subsequent haemagglutination reactions used 1 haemagglutination unit of 50 ul TO cell lysate virus and 50 ul of 1% erythrocytes in L-15 growth medium. The sealed plates were kept at room temperature for 1 hr, and then transferred to 16°C for the extended incubation until sampled. Ill 4.3.4. Poly I:C stimulation of Atlantic salmon erythrocytes Washed Atlantic salmon erythrocytes were resuspended in L-15 medium consisting of 10% FBS, 2 mM L-glutamine, 100 IU/ml penicillin G, 100 |ig/ml streptomycin, and 0.25 u-g/ml amphotericin B, and polyinosinic: polycytidylic acid (poly I:C) (Amersham Biosciences/GE healthcare) at a final concentration of 30 ug/ml. One hundred microliters of 1% erythrocyte suspension was added to each well of the haemagglutination plate and incubated at 16°C. The preparations were sampled after 12, 24, and 72 hr. 4.3.5. Detection of cytokine expression and ISAV replication by QRT-PCR Total RNA from the haemagglutination samples was extracted from 375 ul of homogeneous erythrocyte suspensions using 1.25 ml of TRIzol Reagent (Invitrogen). RNA extraction was performed from two separate samples at each sampling point, which were then pooled before DNase treatment using the DNase treatment kit (Roche) prior to QRT-PCR amplification. For quantification of the type IIFN system genes and viral mRNA, first strand cDNA synthesis was done using the Transcriptor reverse transcriptase first strand cDNA synthesis kit (Roche). The cDNA synthesis was carried out using random hexamers and 125 ng of total RNA as described in section 2.3.4. QRT-PCR used first strand cDNA template with LightCycler FastStart DNA Master SYBR Green I (Roche) in the LightCycler (LC) 1.2 (Roche). The PCR primer pairs used are listed in Supplementary Table 4.1 (see Appendix I). The 20 ul PCR reaction consisted of 2 ul of undiluted cDNA for all genes except 18S rRNA (which was diluted 1:1000) and 18 ul of the master mix prepared using 0.5 ul of the 10 uM of the forward and reverse primers (a final 112 concentration of 0.25 uM), 2 ul of the LC SYBR Green I DNA Master mix, 1.6 (4.1 of the stock 25 mM MgCk (a final concentration of 0.003 uM), and 13.4 |_il of nuclease free water. The PCR programme for amplifying PKZ gene had a master mix consisting of 12.8 ul of water, 2.4 ul of 25 mM MgCl2 (a final concentration of 0.004 uM), 0.4 ul each of the 10 uM forward and reverse primer, and 2 ul of SYBR Green master mix. The PCR cycling conditions consisted of an initial denaturation at 95°C for 10 minutes to activate the hot-start polymerase, followed by 40 cycles of 95°C for 5 s, 59°C for 10 s (60°C for the PKZ gene), 72°C for 10 s, and detection at 80°C for 2s. Melting curve analysis was performed from 70°C to 95°C in 0.1°C/s increments to assess the specificity of the PCR products. For determining amplification efficiency of each primer set (see Appendix I, Supplementary Table 4.1), standard curves were generated using two-fold dilutions of cDNA run in triplicates for six consecutive dilutions. The cycle threshold (Ct) values, the number of cycles run in QRT-PCR when the fluorescence in the sample crosses a threshold value and enters a log-linear phase, i.e., when a sample is considered positive, were analyzed using LightCycler software version 3.5 (Roche). Each sampling point was run in triplicate and the stability of the 18S rRNA, used as endogenous reference gene, was followed. The Ct values were then analyzed using the Pfaffl method (Pfaffl, 2001) to get the relative fold ratio as described in the Pfaffl equation. The Pfaffl method is based on efficiency correction of the Ct value difference using the PCR efficiencies of the target and the endogenous reference gene primer pairs. Relative fold increases of the transcripts were calculated compared to 0 hr control samples. For down-regulated genes that showed a fold up-regulation below 1, fold down-regulations were calculated by taking the inverse 113 of fold up-regulation. /p \ ACt[targel(uninfected control-lSAV infected)] V^targev xzlQ[18s(uniniectedcoiitrol-ISAV infected)] To test if the difference in mean relative fold induction between the two virus isolates at each sampling point was statistically significant, data were initially checked for equality of variance using F- test in Microsoft Excel spread sheet. Then the t- Test was used considering the equality/inequality of variance where applicable (Richardson and Overbaugh, 2005). For quantifying the level of viral mRNA, QRT-PCR was done using the RNA Amplification Kit SYBR Green I (Roche) and PCR primer pairs amplifying 220 bp of the ISAV segment 8 as previously described (Munir and Kibenge, 2004), with minor modifications. Briefly, the 20 ill reaction consisted of 50 ng of total RNA in a master mix prepared using 0.3 ul of the 20 uM forward and reverse primers (final concentration of 0.3 uM), 4 ul SYBR Green, 0.2 pi LC-RT PCR enzyme mix, 3 ul of the 5x resolution solution, 1.6 ul of the 25 mM stock MgCl2 (a final concentration of 0.005 uM), and nuclease free water adjusted to a final volume of 20 ul. The cycling conditions consisted of one cycle of RT at 55°C for 30 min, initial denaturation at 95°C for 30 s followed by 50 cycles of 95°C for 5 s, 59°C for 10 s, 72°C for 10 s, and detection at 80°C for 2 s. Melting curve analysis was performed from 70°C to 95°C in 0.1°C/s increments to assess the specificity of the QRT-PCR products. At the end of the PCR programme, the Ct and melting curve data were analyzed using LightCycler software version 3.5 (Roche). The QRT-PCR products were also run in 1% agarose gel electrophoresis in lx Tris acetate 114 EDTA buffer (40mM Tris acetate and ImM EDTA) (Fisher Scientific) and stained with ethidium bromide and photographed under 304 nm UV light. 4.3.6. Detection of virus replication by titration on TO cell line Lysates of the haemagglutination assays were titrated to determine growth cycles of the NBISA01 isolate in Atlantic salmon erythrocytes. Virus titration utilized serial 10-fold dilutions of the samples inoculated on 48-well cell culture plates containing TO cell monolayers from which the median tissue culture infectious dose (TCID50) was determined as previously described (Kibenge et al, 2001). Each sampling point was run in triplicates to get a standard deviation. 4.4. RESULTS 4.4.1. ISAV replication in Atlantic salmon erythrocytes Using transmission electron microscopy, haemagglutination of Atlantic salmon erythrocytes by the highly pathogenic NBISA01 isolate has been associated with endocytosis of the virus particles (Chapter 3). To determine whether ISAV endocytosis by Atlantic salmon erythrocytes results in a productive infection, and to further analyze the differences between virus isolates of differing pathogenicity, we monitored the haemagglutination assays with 1 haemagglutination unit of NBISA01 and RPC/NB-04- 085-1 isolates and Atlantic salmon erythrocytes for transcription of viral genes on ISAV segment 8 using QRT-PCR. The QRT-PCR quantification Ct values of cDNA generated using random hexamers and RNA extracted from haemagglutinations induced by the highly pathogenic NBISA01 isolate show a steady decline from the 0 hr (26.57±0.14) to 120 hr (20.48±0.29) indicating an increase in viral gene transcription (Table 4.1). To 115 confirm if the decrease in Ct value was from newly synthesized viral mRNA we used oligodT primers for cDNA synthesis followed by QRT-PCR amplification. A similar decrease in Ct value from 0 hr (22.22±0.05) to 120 hr (19.29±0.12) was observed (Table 4.1). For a PCR reaction with 100% efficiency a 3.3 Ct difference between two samples is equal to a 10-fold difference in starting sample concentration (Rasmussen, 2001). The F5/R5 primer used in the present study had an amplification efficiency of 96.84%. Thus the changes in the Ct values for NBISA01 at each sampling point beginning at 48 hr (for the one tube QRT-PCR using F5/R5) or 72 hr (for oligodT primed two step QRT-PCR using F5/R5) had more than 10-fold difference in the starting sample concentrations from that of the 0 hr suggesting that there was de novo synthesis of viral RNA in the erythrocytes of Atlantic salmon. In contrast, the low pathogenic RPC/NB-04-085-1 isolate showed no significant change in the Ct values at each sampling point from the 0 hr (Table 4.1), indicating absence of virus replication. Atlantic salmon erythrocytes without virus, which were incubated alongside the haemagglutinations as a negative control showed no virus specific amplification (see Appendix I, Supplementary Figure 4.IE and F). Melting curve analysis and agarose gel electrophoresis showed virus specific amplification for NBISA01 and for RPC/NB-04-085-1 (see Appendix I, Supplementary Fig. 4.1A-D). 116 Table 4.1. Transcript levels of viral genes on ISAV segment 8 in extended haemagglutination assays. Sampling points NBISA01 using one NBISA01 QRT-PCR RPC/NB-04-085-1 using step QRT-PCR using oligodT primed one step QRT-PCR (averagei SD) cDNA (averagei SD) (averagei SD) Ohr 26.57±0.14 22.22i0.05 20.39i0.21 24hr 24.43±0.15 20.63i0.05 21.23i0.15 48hr 22.25±0.2l' 19.40i0.02 20.46i0.26 72hr 21.51i0.33"' 18.31i0.02" 20.76i0.36 96 hr 21.04±0.40* 18.67i0.27' 20.27i0.22 120 hr 20.48i0.29"' 19.29±0.12* 20.55i0.29 •denotes more than 3.3 Ct difference in the starting sample concentrations from that of the 0 hr. 117 Using the TO cell line, which is highly permissive for ISAV (Kibenge et al., 2001; Wergeland and Jakobsen, 2001), we examined if the de novo synthesis of viral RNA by the NBISA01 isolate in the erythrocytes of Atlantic salmon is accompanied with production of new infectious virus. For this, the haemagglutination reactions were sampled at 0, 72 and 120 hr days post-haemagglutination and titrated on the TO cell line. 70±0 433 The 0 hr samples showed a TCID50 of 10 ' /ml and 72 hr samples showed a TCID50 692±0143 7 75±025 of 10 /ml while the 120 hr sample had a TCID50 of 10 /ml, demonstrating a 0.75 logio increase in virus titre by 120 hr. This indicated a productive infection during ISAV-induced haemagglutination with the highly pathogenic NBISA01 virus. 4.4.2. ISAV-induced haemagglutination up-regulates the expression of key type IIFN system genes in fish erythrocytes It is generally accepted that key proteins of the type I IFN system are induced during ISAV infection but they arc unable to inhibit the replication of ISAV in vitro and in vivo (Kileng et al, 2007). Constitutive expression in CHSE-214 cells of Atlantic salmon IFN-induced Mxl protein does; however, confer resistance to ISAV (Kibenge et al., 2005). Moreover, the ISAV segment 7 ORF1 product was reported to be an IFN- signalling antagonist that enables the virus to counteract IFN-induced antiviral proteins of the host, a function similar to that of the non-structural (NS1) protein encoded by segment 8 of influenza A virus (McBeath et al., 2006). To determine whether fish erythrocytes mount any cytokine response to ISAV during haemagglutination, and to show the effect of virus replication on the quality of the response, we used QRT-PCR assays to evaluate mRNA levels of key type I IFN system genes IFN-a, Mx, ISG15, 118 STAT1, and PKZ at regular intervals during haemagglutination reactions using native virus and virus inactivated by exposure either to UV light or to heat. The data are summarized in Figures 4.1 and 4.2. The data show that the highly pathogenic NBISA01 virus had a higher relative fold increase for IFN-a transcripts than the less pathogenic RPC/NB-04-085-1 virus that did not replicate in erythrocytes. NBISA01 haemagglutinations showed increased IFN-a transcript levels, with a biphasic peak at 24 hr (44.26 ± 1.95) and 72 hr (33.0 ± 5.4)(Fig. 4.1A). In contrast, the RPC/NB-04-085-1 haemagglutinations showed a moderate increase by 48 hr (11.29 ± 2.59)(Fig. 4.1A). NBISA01 induced haemagglutinations had a statistically significant (p < 0.05) mean fold increase compared to RPC/NB-04-085-1 haemagglutinations at all sampling points except the 96 hr. The Mx transcript levels in the NBISA01 haemagglutinations were moderate with a maximum by 72 hr(8.71 ± 1.33)(Fig. 4.IB). Surprisingly the Mx transcript levels in the RPC/NB-04-085-1 haemagglutinations had a statistically significant (p < 0.05) mean fold increase compared to NBISA01 haemagglutinations at all sampling points except the 72 hr. ISG15 transcripts had a similar maximum peak for erythrocytes haemagglutinated with either NBISA01 or RPC/NB-04-085-1, except that the peak was by 72 hr for NBISA01 where there was a statistically significant mean fold increase compared to RPC/NB-04-085-1. For RPC/NB-04-085-1, 24 hr, 96 hr, and 120 hr showed statistically significant mean fold increases of ISG15 compared to NBISA01 (Fig. 4.1C). STAT1 is a signal transducer and activator of transcription involved in the JAK/STAT signalling for IFN response (Samuel, 2001). NBISA01 haemagglutinations showed up-regulation of STAT1 by 72 hr (7.42 ± 0.98). In contrast, RPC/NB-04-085-1 haemagglutinations showed a more stable up-regulation from 48 to 120 hr (Fig. 4.ID) 119 and statistically significant mean fold increase compared to NBISA01 at all the sampling points except 72 hr. NBISA01 haemagglutination showed increase in PKZ transcript levels by 72 hr (18.46 ± 0.79)(Fig. 4.1E). RPC/NB-04-085-1 haemagglutinations did not show specific amplification for PKZ mRNA. The negative control erythrocytes kept in L- 15 medium had very minimal induction with a maximum 2.34 ± 1.21 relative fold increase of Mx transcripts by 120 hr (Fig. 4.1A-D). The UV-inactivated NBISA01 and RPC/NB-04-085-1 preparations showed down-regulation of key type IIFN system transcripts (Fig. 4.2A-4.2D), whereas the heat- inactivated preparations of both isolates showed slight up-regulation of the transcripts except for IFN-a (Fig. 4.2A-4.2D). These results indicate that fish erythrocytes are immunologically active and produce key type I IFN genes, particularly IFN-a, upon detection of virus associated molecular patterns. 4.4.3. Poly I:C stimulated erythrocytes showed minimal induction of type I IFN system genes Poly I:C is a synthetic double stranded (ds) RNA that simulates viral replication nucleic acid intermediates. Poly I:C stimulation of the TO cell line has been shown to induce the expression of key type I IFN system genes (Kileng et ah, 2007). Poly I:C was included in this study as a direct positive control for inactivated virus preparations. To determine whether fish erythrocytes respond to poly I:C stimulation, Atlantic salmon erythrocytes were exposed to a large dose of poly I:C and incubated as for the haemagglutination reactions. As shown in Figure 4.3, there was only minimal induction of the genes investigated except for ISG15 and Mx by 72 lir after stimulation. These results show that, unlike TO cells, Atlantic salmon erythrocytes do not efficiently respond 120 to poly I:C stimulation. However, the response was similar to that of erythrocytes exposed to heat-inactivated ISAV or to L-15 medium alone (negative control assays). 121 0 hr 24 hr 48 hr 72 hr 96 hr 120 hr 0 hr 24 hr 48 hr 72 hr 96 hr 120 hr Sampling hours after ISAV haernaggJutinabon Sampling hours after ISAV haemagglutination Ohr 24hr 48hr 72hr 96hr 120hr Ohr 24 hr 48 hr 72 hr 96 hr 120 hr Sampling hours after ISAV haemagglutination Sampling hours after ISAV haemagglutination Ohr 24 hr 48 hr 72 hr 96hr 120hr Sampling hours after ISAV haemagglutination Figure 4.1. Expression of key type I IFN system genes by intact ISAV particles. Relative fold increase of key type I IFN system genes IFN (A), Mx (B), ISG15(C), STAT1 (D) and PKR (E) in response to NBISA01, RPC/NB-04-085-1, haemagglutinations or negative control erythrocytes incubated in L-15 medium. Relative fold of each sampling point are PCR efficiency corrected relative fold units calibrated to the 0 hr control and expression level of endogenous reference gene 18S rRNA (Error bars are standard deviations of a triplicate observation). 122 B U o I UV Inactivated NBISA01 I UVinactivatedRPC/NB-04-085-1 I Heat Inactivated NBISAOI ] Heat Inactivated RPC/NB-04-085-1 Ohr 48 hr 120 hr Ohr 4Shr 120hr Sampling hours after ISAV urination Sampling hours after ISAV haemagglutination D I UV Inactivated NBISA01 I UV InactivatedNBISA01 I UV Inactivated RPC/NB-04-085-1 I UVinactivatedRPC/NB-04-085-1 I Heat Inactivated NBISA01 I Heat InactivatedNBISA01 ] Heat Inactivated RPC/NB-04-085-1 ] HeatInactivatedRPC/NB-04-085-1 Ohr 48 hr 120 hr Ohr 48 hr 120 hr Sampling hours after ISAV haemagglutination Sampling hours after ISAV haemagglutination Figure 4.2. Expression of key type IIFN system genes by inactivated ISAV particles. Relative fold increase of the key type I IFN system genes IFN (A), Mx (B), ISG15 (C) and the transcription factor STAT1 (D) in erythrocytes incubated with UV-inactivated NBISA01; heat-inactivated NBISA01; UV-inactivated RPC/NB-04-085-1; and heat inactivated RPC/NB-04-085-1. Relative fold of each sampling point are PCR efficiency corrected relative fold units calibrated to the 0 hr control and expression level of the endogenous reference gene 18S rRNA (Error bars are standard deviations of a triplicate observation). 123 1 I 3 Ohr 12 hr 24 hr 72 te Sampling hours after paly I:C stimulation Figure 4.3. Expression of key type IIFN system genes by erythrocytes in response to poly I:C stimulation. Relative fold increase of the key type I IFN system genes (IFN, Mx, ISG15) and the transcription factor STAT1 in response to poly I:C stimulation of Atlantic salmon erythrocytes. Relative fold of each sampling point are PCR efficiency corrected relative fold units calibrated to the 0 hr control and expression level of endogenous reference gene 18S rRNA (Error bars are standard deviations of a triplicate observation). 124 4.5. DISCUSSION AND CONCLUSIONS In the present study we set up haemagglutination assays in L-15 growth medium to compare two phenomena (elution and uptake) of the ISAV-induced haemagglutination of Atlantic salmon erythrocytes between virus isolates of differing pathogenicity. We found remarkable differences in virus endocytosis, replication and quality of cytokine response in the fish erythrocytes. QRT-PCR was used to assess the viral mRNA levels in the haemagglutination reaction samples. Only the Ct values for the NBISA01 haemagglutinations showed any decrease from the 0 hr to 120 hr. This decrease was evident even when oligodT primers were used for cDNA synthesis, confirming that there was de novo synthesis of virus genes in the erythrocytes. However, the 0 hr samples showed a low background Ct value since we used a TO cell lysate that has viral mRNA. This might not happen if we used purified virus. The RPC/NB-04-085- 1 haemagglutinations showed no changes in the Ct values at any sampling point, indicating that the low pathogenic virus did not replicate in erythrocytes. Moreover, using virus titrations in the TO cell line, it was shown that NBISA01 haemagglutinations resulted in a productive infection. The increase in virus titre between 0 hr and 120 hr was 075 10 TCID5o in contrast to the 10-fold increase in the viral transcript levels detected by QRT-PCR within the same samples. This may be due to three factors: (1) the lower sensitivity of the virus titration in TO cell line compared to QRT-PCR, (2) the fact that QRT- PCR also detects non infectious or defective particles which the TCID50 does not, and (3) the fact that the virus replication associated with haemagglutination involved only a single cycle of virus replication as multiple haemagglutination events were unlikely. There was a QRT-PCR Ct value decrease but no change in TCID50 between 0 hr and 72 125 hr possibly because the virus passed the stage of genome transcription but was not assembled to provide fully infectious progeny virus. It is interesting to note that avian erythrocytes (which have a dormant nucleus in contrast to the complete nucleus in fish erythrocytes) also demonstrate virus uptake during haemagglutination by influenza A virus and show de novo synthesis of viral proteins but not production of new infectious virus (Cook et al., 1979) whereas mammalian erythrocytes that do not have a nucleus have completely lost the capacity for virus replication during influenza A virus-induced haemagglutination. In addition to virus replication in haemagglutinations induced by the highly pathogenic NBISA01 isolate, we found that there was also a higher expression of IFN-a mRNA than with the less pathogenic RPC/NB-04-085-1 isolate which did not replicate in erythrocytes. The high expression of type I IFN system genes closely followed the increase of NBISA01 transcripts in that by 24 hr the viral transcripts started to increase simultaneously with the first peak of type I IFN genes. The NBISA01 haemagglutinations showed a pattern of fold increase with a peak of IFN and Mx transcripts for a shorter period of time. This pattern of induction is not continuous like the inductions in TO cells infected with ISAV (Kileng et al., 2007). This may be due to differences between the cell cycle of TO cells (which actively multiply) and erythrocytes (which do not multiply) in combination with the single cycle of virus replication that probably occurs during haemagglutination in contrast to multiple cycles of infection possible in TO cells. For the NBISA01 haemagglutinations in the present study, the level of IFN appeared to have a transient biphasic peak at 24 and 72 hr post- haemagglutination. Both UV- and heat-inactivated preparations of NBISA01 and RPC/NB-04-085- 126 1 viruses showed no haemagglutiiiation. The UV-inactivated viruses also showed no induction of type I IFN system genes whereas the heat-inactivated viruses showed induction of the type I IFN system genes by 120 hr similarly to the poly I:C stimulation by 72 hr. The absence of haemagglutination in the UV-inactivated viruses was unexpected since the inactivation was directed towards the viral genome and not the surface glycoproteins required for haemagglutination. One possible explanation is that the UV lamp generated sufficient heat over the 18 hr of exposure to contribute to the denaturation of the virus surface glycoproteins. In contrast, the heat inactivation alone had no effect on the viral ssRNA genome but probably even disrupted the viral structural proteins so that the virus RNA was exposed and easily detected by the erythrocyte viral pattern recognition receptors so as to induce the observed minimal expression of the type I IFN system genes. STAT-1 expression has been studied in other fish species including rainbow trout (Collet et al., 2007) but this is the first study to investigate STAT1 expression in Atlantic salmon. It appears that induction of STAT1 is not as highly responsive to IFN induced by virus infection as the other component genes of the type I IFN system in that the fold increase was low compared to the other genes studied. This could be related to the multifunctional role of this transcription factor. In the present work the QRT-PCR data showed high expression of key type I interferon system genes IFN, Mx, ISG15, STAT1, and PKZ upon infection of erythrocyte by the highly pathogenic NBISA01 virus. This virus isolate showed higher expression of IFN-a mRNA compared to the RPC/NB-04-085-1 although both viruses had similar levels of Mx, ISG15 and STAT1 expression. The slight type I IFN response with 127 RPC/NB-04-085-1 haemagglutinations which involve only virus adsorption but no endocytosis and no replication is an interesting observation. Besides, the heat inactivated virus of both isolates showed slight up regulation of type I IFN system genes. Various viral recognition receptors are involved in the detection of viral associated molecular patterns such as dsRNA, ssRNA, DNA, and viral glycoproteins like haemagglutinin proteins. In the case of human cytomegalovirus (Boehme et ah, 2004), herpes simplex (Mossman and Ashkar, 2005) and human immunodeficiency virus (Ankel et ah, 1994), peripheral mononuclear cells have been shown to express type I IFN independent of virus replication, purely by the viral glycoproteins. Thus the low level of type I IFN system gene expression detected in the present study for the lowly pathogenic RPC/NB-04-085-1 isolate could possibly be associated with the detection of the viral HE protein during haemagglutination. Poly I:C is a double stranded synthetic RNA that is detected either by the RNA helicases or the TLR3 to activate the transcription of type I IFN system genes (Robertson, 2006). This has been showed in the macrophage/dendrific-like Atlantic salmon TO cell line (Kileng et ah, 2007). Stimulation of erythrocytes with poly I:C did not; however, result in up-regulation of type I IFN genes even with a poly I:C dose 10 times that used by Kileng et al. (2007). It was previously reported that CHSE-214 cells incubated with poly I:C showed no expression of Mx (Jensen et ah, 2002), probably because of inefficient response to poly I:C stimulation. In the present study, NBISA01 endocytosis and replication in Atlantic salmon erythrocytes resulted in up-regulation of the type I IFN system genes possibly by detection of the viral associated molecular patterns. Thus the minimal up-regulation of the genes in fish erythrocytes by poly I:C could be due to 128 inefficient membrane transport activity of erythrocytes. The results show that the highly pathogenic ISAV isolate NBISA01 undergoes virus replication and higher expression of IFN-a mRNA while the lowly pathogenic isolate used to set up haemagglutination at a similar 1 haemagglutination unit did not show virus replication, and high IFN-a mRNA expression. The HE protein coded by segment 6 of ISAV can be proposed to account for the observed differences between the two isolates. The haemagglutinin portion of the HE protein is a surface glycoprotein and it is essential for initial binding of ISAV to sialic acid receptors of ISAV where as the RDE allows mobility of virions by removing sialic acid residues from virus and infected cells during both entry and release from the cells. Deletions or insertions in the HPR may affect several properties of the HE including flexibility and receptor binding specificity and affinity, antigenicity', esterase activity, interaction with other proteins and possibly polymerization of the protein (Aspehaug et ah, 2005). Based on HPR sequence analysis and correlation with growth properties of the isolates in cell culture, Kibenge et al. (2007) hypothesized that the number of amino acids deleted/inserted in the HPR of the HE protein are determinants of ISAV virulence. Non-cultivable isolates (HPRO) do not have deletions in the HPR of the HE protein, where as less pathogenic isolates have <13 amino acid deletions. NBISA01 isolate has a 17 amino acid deletion in the HPR whereas RPC/NB-04-085-1 has a 13 amino acid deletion (Kibenge et al, 2007). Correlation of the experimental observations of this study with the number of amino acid deletions in the two isolates used suggest that the number of amino acid deletions in the HPR may affect either the binding properties of the haemagglutinin protein or its accessibility for the receptor destroying esterase. It is possible that the 17 129 amino acid deletions of NBISA01 allows better fitting of the haemagglutinin protein to cellular sialic acid receptors or alternatively preclude the esterase activity of the RDE to destroy the sialic acid receptors, both ways allowing persistent haemagglutination. In a similar line, the inability of RDE to dissolve the haemagglutinations of salmon erythrocytes was speculated to be importance for ISAV virulence and pathogenesis since virus isolates that show RDE activity with salmon erythrocytes seem to be less virulent (Falk and Dale, 2006). .Persistent haemagglutination of the highly pathogenic isolate arising from either better fitting of the haemagglutinin protein or limited activity of the RDE can lead to receptor mediated endocytosis of virus particles followed by virus replication and induction of immune response to the replicating virus. The reasoning is consistent with our observation that the lowly pathogenic isolate, RPC/NB-04-085-1 showed no endocytosis (Chapter 3), virus replication and up-regulation of the transcripts of type I IFN system genes. Such a haemagglutination-infection phenotype is fundamentally different from haemagglutination by avian and mammalian orthomyxoviruses, and may be indicative of a different pathogenesis for the fish orthomyxovirus. In conclusion, this report demonstrates that ISAV-induced haemagglutination by a pathogenic ISAV isolate results in productive infection of the erythrocytes accompanied by up-regulation of the transcripts of key type I IFN system genes IFN-oc, Mx, ISG15, STAT1, and PKZ. This study also highlights the critical role of ISAV isolate variation in the initial stages of the virus-cell interaction during haemagglutination, and possibly in the pathogenesis of ISA. Moreover, the study shows for the first time that fish erythrocytes immunologically respond to ISAV infection. 130 Appendix I Supplementary Table 4.1. Sequence and amplification efficiency of the QRT-PCR primers amplifying Atlantic salmon IFN, Mx, 18S, ISG15, STAT1 and PKZ genes. Supplementary Figure 4.1. Agarose gel electrophoresis and melting curves of QRT-PCR products of ISAV segment 8 using RNA from haemagglutination samples. 131 4.6. REFERENCES Ankel H, Capobianchi MR, Castilletti C, Dianzani F. Interferon induction by HIV glycoprotein 120: role of the V3 loop. Virology 1994;205:34-43. Aspehaug V, Mikalsen AB, Snow M, Biering E, Villoing S. Characterization of the infectious salmon anaemia virus fusion protein. J Virol 2005;79:12544-12553. Boehme KW, Singh J, Perry ST, Compton T. Human cytomegalovirus elicits a coordinated cellular antiviral response via envelope glycoprotein B. J Virol 2004;78:202- 1211. Bossart W, Meyer J, Bienz K. Electron microscopic study on influenza virus hemagglutination: pinocytosis of virions by red cells. Virology 1973;55:295-298. Collet B, Munro ES, Gahlawat S, Acosta F, Garcia J, Roemelt C, Zou J, Secombes CJ, Ellis AE. Infectious pancreatic necrosis virus suppresses type I interferon signalling in rainbow trout gonad cell line but not in Atlantic salmon macrophages. Fish Shellfish Immunol 2007;22:44-56. Cook RF, Avery J, Dimmock NJ. Infection of chicken erythrocytes with influenza and other viruses. Infect Immunol 1979;25,396-402. Cunningham CO, Gregory A, Black J, Simpson I, Raynard RS. A novel variant of the infectious salmon anemia virus (ISAV) haemagglutinin gene suggests mechanisms for virus diversity. Bull Eur Assoc Fish Pathol 2002;22:366-374. Dale OB, Falk K, Kvellestad A. An overview of infectious salmon anemia pathology and suggested pathogenesis. Abstr Fifth International Symposium on Aquatic Animal Health, 2006; California USA. ' Evensen O, Thorud KE, Olsen YA. A morphological study of the gross and microscopic 132 lesions of infectious salmon anaemia in Atlantic salmon (Salmo solar). Res Vet Sci 1991;51:215-222. Falk K, Dale OB. Experimental evidence indicating that lack of viral receptor destroying enzyme is a major factor for infectious salmon anemia pathogenesis. Abstr. Fifth International Symposium on Aquatic Animal Health, 2006; California USA. Falk K, Namork E, Rimstad E, Mjaaland S, Dannevig BH. Characterization of infectious salmon anemia virus, an orfhomyxo-like virus isolated from Atlantic salmon (Salmo salar L.). J Virol 1997;71:9016-9023. Hirst GK. The agglutination of red blood cells by allantoic fluid from chick embryos infected with influenza virus. Science 1941;94:22-23. Howe C, Lee LT. Virus erythrocyte interactions. Adv Virus Res 1972;17:1-50. Jensen I, Larsen R, Robertsen B. An antiviral state induced in Chinook salmon embryo cells (CHSE-214) by transfection with the double-stranded RNA poly I:C. Fish Shellfish Immunol 2002;13:367-378. Kibenge MJT, Munir K, Kibenge FSB. Constitutive expression of Atlantic salmon Mx protein in CHSE-214 cells confers resistance to infectious salmon anaemia virus. Virol J 2005;2:75. Kibenge FSB, Kibenge MJT, Groman D, McGeachy S. In vivo correlates of infectious salmon anemia virus pathogenesis in fish. J Gen Virol 2006;87:2645-2652. Kibenge FSB, Munir K, Kibenge MJT, Joseph T, Moneke E. Infectious salmon anemia virus: causative agent, pathogenesis and immunity. Ani Hlth Res Rev 2004;5:65-78. Kibenge FSB, Kibenge MJT, Wang Y, Qian B, Hariharan S, McGeachy S. Mapping of 133 putative virulence motifs on infectious salmon anaemia virus surface glycoprotein genes. J Gen Virol 2007; 88:310.0-3111. Kibenge FSB, Kibenge MJT, McKenna PK, Stothard P, Marshall R, Cusack RR, McGeachy S. Antigenic variation among isolates of infectious salmon anaemia virus correlates with genetic variation of the viral haemagglutinin gene. J Gen Virol 2001;82:2869-2879. Kileng 0, Brundtland MI, Robertson B. Infectious salmon anemia virus is a powerful inducer of key genes of the type I interferon system of Atlantic salmon, but is not inhibited by interferon. Fish Shellfish Immunol 2007;23:378-389. McBeath AJ, Snow M, Secombes CJ, Ellis AE, Collet B. Expression kinetics of interferon and interferon-induced genes in Atlantic salmon (Salmo salar) following infection with infectious pancreatic necrosis virus and infectious salmon anaemia virus. Fish Shellfish Immunol 2007;22:230-241. McBeath AJ, Collet B, Paley R, Duraffour S, Aspehaug V, Biering E, Secombes CJ, Snow M. Identification of an interferon antagonist protein encoded by segment 7 of infectious salmon anaemia virus. Virus Res 2006;115:176-184. Mjaaland S, Hungnes O, Teig A, Dannevig BH, Thorud K, Rimstad E. Polymorphism in the infectious salmon anemia virus hemagglutinin gene: importance and possible implications for evolution and ecology of infectious salmon anemia disease. Virology 2002;304:379-391. Mjaaland S, Markussen T, Sindre H, Kj0glum S, Dannevig BH, Larsen S, Grimholt U. Susceptibility and immune responses following experimental infection of MHC compatible Atlantic salmon {Salmo salar L.) with different infectious salmon anaemia virus isolates. Arch Virol 2005;150:2195-2216. 134 Mossman KL, Ashkar AA. Herpesviruses and the innate immune response. Viral Immunol 2005; 18:267-281. Munir K, Kibenge FSB. Detection of infectious salmon anaemia virus by real-time RT- PCR. J Virol Meth 2004; 117:37-47. 0ye AK, Rimstad E. Inactivation of infectious salmon anaemia virus, viral haemorrhagic septicaemia virus and infectious pancreatic necrosis virus in water using UVC irradiation. Dis Aquat Org 2001;48:1-5. Passantino L, Altamura M, Cianciotta A, Jirillo F, Ribaud MR, Jirillo E, Passantino GF: Maturation of fish erythrocytes coincides with changes in their morphology, enhanced ability to interact with Candida albicans and release of cytokine-like factors active upon autologous macrophages. Immunopharmacol Immunotoxicol 2004;26:73-585. Pfaffl MW. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res 2001 ;29,9e45. Rasmussen R. Quantification on the LightCycler. In: Meuer S, Wittwer C, Nakagawara K (eds.), Rapid Cycle Real-time PCR, Methods and Applications, Springer, Heidelberg. 2001:21-34. Richardson BA, Overbaugh J. Basic statistical considerations in virological experiments. J Virol 2005;79:669-676. Robertsen B. The interferon system of teleost fish. Fish Shellfish Immunol 2006;20:172- 191. Samuel CE. Antiviral actions of interferons. Clin Microbiol Rev 2001 ;14,778-809. 135 Wergeland HI, Jakobsen RA. A salmonid cell line (TO) for the production of infectious salmon anaemia virus (ISAV). Dis Aquat Org 2001;44:183-190. 5. Molecular interaction of infectious salmon anaemia virus with the type IIFN system of Atlantic salmon* 5.1. SUMMARY The innate immune response is an essential component of the host antiviral defence. The type I interferon (IFN) system constitutes part of the innate immune response infected cells mount to protect neighboring cells from virus infection. Infectious salmon anaemia virus (ISAV) isolates show variations in their ability to induce cytopathic effects in cells and mortality in Atlantic salmon hosts. Studies on the interaction of ISAV and the IFN system of Atlantic salmon suggest that ISAV is able to up-regulate the key genes of the type I IFN system without being inhibited. ISAV segment 7 ORF1 and segment 8 ORF2 have recently been characterized as IFN-a antagonistic proteins. However, specific information on the effect of ISAV isolate variation on the expression of IFN system genes is lacking. To better understand this interaction, two ISAV isolates, NBISA01 and RPC/NB-04-085-1, of differing genotypes and pathogenicity phenotype were used to infect CHSE-214 and TO cells, and QRT-PCR was used to analyze the expression of key type I IFN system genes and viral transcripts. The results of the TO cell experiment show remarkable differences in the expression of the key type I IFN system genes and viral transcripts in TO cells infected with two ISAV isolates. The NBISA01 isolate showed very low up-regulation of the key type I IFN system genes whereas the RPC/NB-04-085-1 isolate showed robust induction of the type Workenhe ST, Kibenge MJT, Kibenge FSB. Molecular interaction of infectious salmon anaemia virus with the type I IFN system of Atlantic salmon. Manuscript in preparation for submission to Virology Journal. 137 IIFN system genes. To identify NBISA01 proteins with type IIFN antagonistic activity transient co-transfection experiments were carried out in CHSE-214 cells using plasmid DNA (pDNA) constructs expressing ISAV segment 7 (Seg ORF1, Seg ORF1/2) and segment 8 (Seg ORF1 and Seg ORF2) proteins, and a luciferase gene under the control of Atlantic salmon minimal IFN promoter. The results show that among the four ISAV genes analyzed segment 7 ORF1 is a type I IFN antagonizing protein. However, the protein products of ISAV Seg 7 QRF1/2, Seg 8 ORF1, Seg 8 ORF2 did not antagonize the activation of the Atlantic salmon minimal IFN promoter. 5.2. INTRODUCTION In mammalian cells the viral replication nucleic acid intermediates (dsRNA, ssRNA, or DNA) are detected by the RNA helicases RIG-I and Mda5 in the cytoplasm or TLRs localized in endosomes. The RNA helicases recognize either dsRNA (both RIG-I and Mda-5) or ssRNA (RIG-I) intermediates of virus replication (Kato et al, 2006; Pichlmair et al, 2006). TLR3 recognizes viral dsRNA (Alexopoulou et al, 2001) whereas TLR7 recognizes viral ssRNA (Haller et al., 2006). Negative strand RNA viruses including influenza virus replication have been shown not to produce detectable levels of dsRNA suggesting that ssRNA might be their viral nucleic acid sensed by TLR7 and RIG-I (Weber et al., 2006). Each of the downstream signaling pathways activates the kinases responsible for phosphorylation of IRF-3/IRF7 for homodimerization and nuclear translocation before binding the promoter region of the IFN-B to activate the transcription and translation of IFN protein (Randall and Goodbourn, 2008). Secreted type I IFN proteins bind to their cognate receptors for initiating signal transduction via the 138 JAK/STAT pathway to form factors that bind to the promoter region and activate the transcription of IFN stimulated genes with antiviral activity such as Mx, and ISG15 (Haller et al, 2006). In a similar mechanism to mammals Atlantic salmon have been shown to mount an innate type I IFN system response upon ISAV infection and stimulation with viral ssRNA and dsRNA mimics (Robertsen, 2006; 2008). ISAV isolates show varying pathogenicity for Atlantic salmon hosts as well as cells (Mjaaland et al, 2005; Kibenge et al, 2006; Ritchie et al., 2009). The variation in the HE and F virulence motifs partly explain the differing pathogenicity of isolates (Kibenge et al., 2007a; Rimstad et al., 2007; Markussen et al., 2008). For influenza virus, a well studied orthomyxovirus that shares some similarities with ISAV, the NS1 protein encoded by the unspliced mRNA from the shortest RNA segment 8 is a virulence factor in part due to its ability to antagonize the IFN-a/p response (Garcia-Sastre et al., 1998; 2001; Krug et al., 2003). NS1 prevents the synthesis of IFN-P by preventing the activation of transcription factors such as ATF-2/c-jun, NFKP and IRF-3/5/7 and sequestering dsRNA to limit activation of PKR (Randall and Goodbourn, 2008). The NS1 protein also binds and inhibits the function of cellular proteins that are required for the modification of the 3' end of cellular mRNA (Krug et ah, 2003). The NS1 protein of different human influenza virus strains (H1N1) employ different mechanisms to antagonizing the host response (Kochs et al., 2007). ISAV has been shown to up-regulate the key genes of type I IFN system (IFN, Mx, ISG15, PKR, STAT1, IRF7) although the subsequently induced antiviral proteins were not able to prevent the replication of the virus (J0rgensen et al., 2007; Kileng et al., 2007; McBeath et al, 2007; Kileng et al, 2009). ISAV segment 7 ORF1 and segment 8 139 0RF2 proteins (the largest protein of the two segment 8 ORFs) have been reported to be a major and minor IFN system antagonizing proteins, respectively (McBeath et al., 2006; Garcia-Rosado et al., 2008). In this study, the transcript levels of type I IFN system genes and ISAV transcripts between a highly pathogenic North American isolate (NBISA01) and a lowly pathogenic European isolate (RPC/NB-04-085-1) were compared. TO cells infected with RPC/NB-04-085-1 showed statistically significant (p<0.05) up-regulation of most genes of the type I IFN system compared to NBISA01 isolate. Conversely, the NBISA01 isolates had higher fold increase of the viral transcripts when compared to RPC/NB-04- 085-1 isolate. In addition the IFN system antagonistic properties of NBISA01 segment 7 (ORF1, and ORF1/2) and segment 8 (ORF1, and ORF2) proteins were further characterized using a luciferase reporter assay. Only the segment 7 ORF1 protein product was found to counteract the activation of the Atlantic salmon minimal IFN promoter in response to poly I:C stimulation. 5.3. MATERIALS AND METHODS 5.3.1. Viruses Two ISAV isolates of differing genotypes and pathogenicity phenotypes (NBISA01 and RPC/NB-04-085-l)(described in detail under section 2.3.1) were used. The viruses were propagated in TO cells and the lysates titrated in TO cells as previously described (Kibenge et al, 2001). The NBISA01 and RPC/NB-04-085-1 isolates used in the experiments had been passaged 3 and 5 times in TO cells, respectively. 140 5.3.2. Virus infection of TO cells TO cells were grown as decribed in section 2.3.2. The virus stocks of NBISA01 50 and RPC/NB-04-085-1 propagated in TO cells were diluted to 10 TCID50/ml and used to infect TO cells as described in section 2.3.2. Infected cells were sampled at 12, 24, 36, 48, 72, and 96 hr post-infection by freezing the plate at -80°C, until RNA extraction and QRT-PCR analysis. 53.3. Virus infection of CHSE-214 cells The Chinook salmon embryo (CHSE-214) cell line (Fryer et al, 1965) was grown at 16°C in HMEM (Invitrogen) as previously described (Kibenge et al., 2000), and the monolayers were used after 24 hr. Cells were infected and incubated as for TO cells in section 2.3.2. Sampling was done at 1, 2, 3, 4, 5, 7, and 10 days post-infection by freezing the plate at -80°C, until RNA extraction. 5.3.4. Poly I:C transfection of TO and CHSE-214 cells The TO or CHSE-214 cell monolayer in each well of a six-well plate was transfected with 1 ug of synthetic dsRNA polyinosinic:polycytidylic acid (poly I:C) (Amersham Biosciences/GE healthcare) in 3 ul of FuGENE 6 transfection reagent (Roche). Sampling was carried out at 0, 6, 12, 24, 36, 48, 72 and 96 hr after transfection of CHSE-214 cells. The sampling points for TO cells were similar to CHSE-214 cells except that the 96 hr sampling point was not used for QRT-PCR analysis because the cells started dying at that time. 141 5.3.5. Molecular cloning The PCR products of ISAV segment 7 (ORJF1 and ORF1/2) and segment 8 (ORF1 and ORF2) generated using the primers listed in Table 5.1 were cloned in to pCDNA3.1 mammalian expression vector (Invitrogen). Three sets of primers; one forward and two reverse primers Rl, and R2 were used to clone each of the ORFs. The reverse primer Rl had a stop codon that allows expression of the ISAV ORFs without the V5- epitope in the pCDNAS.l vector whereas the reverse primer R2 did not have a stop codon as a result the translation continues to generate a fusion protein with V5-epitope tag. The minimal Atlantic salmon IFN gene promoter cloned in pGLAlO basic vector (Promega) PA1 (-202) is prepared as described in Bergan et al. (2006) except that the pGL4.10 vector was used. pDNA was extracted using the High Pure Plasmid Purification kit (Roche). pDNA extracted were initially checked for the orientation of the insert by restriction digestion and finally confirmed by sequencing. 142 Table 5.1. PCR primers used for cloning the ISAV segment 7 (ORF1 and ORF1/2), and segment 8 (ORF1 and ORF2) proteins into pCDNA3.1 vector. ISAV protein Primer sequences (5'to 3') Accession Coding no region Segment 8 F- CACC ATG AAC GAA TCA CAA TGG AF315063 12-602 ORF1 Rl-TTA CTT CAG GTA CCC CAG AAG R2- CTT CAG GTA CCC CAG AAG CA Segment 8 F- CACCATGGATACAAAAACATC AF315063 26-751 ORF1/2 Rl -TTATTGTATAGAGTCCTCCAAT R2-TTGTATAGAGTCCTCCAATTTG Segment 7 F-CACCATG GAT TTC ACC AAA GTG AF401077 1-903 ORP1 Rl- TCA CAT TCT GAA GTG AAG TCC AG R2- CATTCTGAAGTGAAGTCCAGC Segment 7 F- CACCATG GAT TTC ACC AAA GTG AF401077 1-66/ ORF1/2 Rl -TTAGTTCTC ATTAC AAATGAATTTTTC 593-1006 R2-GTTCTCATTACAAATGAATTTTTCAAC 143 5.3.6. Expression analysis using immunfluorescence One-day-old CHSE-214 cell monolayers were transfected with 2 \ig plasmid DNA and 6 ul of Fugene 6 (Roche) following the manufacturer procedure. The pDNA expressing ISAV ORFs were cloned in frame with the V5 epitope for immunofluorescence detection using fluorescein isothiocyanate (FITC) labeled anti-V5 antibody (Invitrogen). Transfected cells were maintained in HMEM with 5% FBS and grown at 16 °C for 48 hr. The medium was then removed and cells were washed two times in lx PBS, and fixed using 100% methanol for 5 minutes. Fixed cells were washed twice with PBS and blocked for 20 minutes using 1% bovine serum albumin. Finally cells were incubated for 1 hr with 1 ml of 1:500 dilution of FITC- conjugated anti-V5 antibody. Cover slips were applied onto the slide after application of veterinary medical research and development (VMRD) mounting medium (a 50/50 mix of fluorescent antibody rinse buffer, pH 9.0, and glycerol) (VMRD Inc.). The cells were visualized with a fluorescence light microscope with a FITC filter (Axio Imager, ZEISS Germany). 5.3.7. Estimation of transfcction efficiency CHSE-214, Atlantic salmon kidney (ASK-2), and TO cells were grown in Nunc slide flasks. After overnight incubation, cells were transfected with 4 \ig of pEGFP-Cl (BD biosciences, Clontech) and 10 ul of lipofectamine 2000 in Opti-MEM (Invitrogen) following the manufacturer procedure. The cells were incubated in 5% CO2 incubator at 24 °C for 4 hr. The Opti:MEM was then replaced with HMEM with 5% FBS and wells were kept at 16 °C until use. Two days later the cells were washed twice with PBS and fixed in 4% formaldehyde before mounting of the cover slide after application of VMRD mounting medium. The slides were then examined under green fluoresent protein (GFP) 144 filter with a fluorescence microscope (Axio Imager, ZEISS Germany). The proportion of green fluorescent cells to the total number of cells (counted under the halogen light source) was used to calculate transfection efficiency. 5.3.8. Luciferase assay Each well of a one-day-old CHSE-214 monolayer (24 well plate) was transfected with 400 ng of the pDNA constructs expressing ISAV ORFs (seg 7 ORF1, seg ORF1/2, seg 8 ORF1, and seg ORF2) in pcDNA3.1 without V5 tag and 400 ng of PA1 (-202) in pGL4.10 as well as 40 ng of pGL4.74 vector expressing Renilla luciferase under the control of Herpes simplex virus -thymidine kinase promoter. Transfected cells were maintained in Opti-MEM for 4 h at room temperature in 5% CO2, after which the medium was replaced with HMEM consisting 5% FBS. The same day as the transfections, cells were infected with NBISA01 using 105 TCID50 per each well of day old CHSE-214 cells. On day two cells were transfected with 1 (j.g of poly I:C and 3 ul of Fugene 6 (Roche). On day three the medium was changed and, on day four, cell monolayers were lyzed with 400 jil of passive lysis buffer (Promega). In each well of a 96 well opaque white plate, 70 ul of the lysed cells were applied and assay carried out using the dual luciferase assay system (Promega). The DLReady luminoskan reader (Thermo Scientific) was calibrated to automatically inject 100 ul of the LAR II, and stop and go reagents. Although the background light units of non-transfected cells were close to 0, they were subtracted from all the measurements and the light units in the results part are the values of firefly luciferase divided by the Renilla luciferase light units. The percentage reduction of IFN promoter activity by any of the ISAV proteins was reported compared to the pCDNA3.1 empty vector transfected wells. 145 5.3.9. Chinook salmon beta-actin siRNA design and transfections The coding region of Chinook salmon (Oncorhynchus tshawytscha) beta-actin sequence was amplified using RNA from CHSE-214 cells and PCR primers designed using Atlantic salmon beta-actin mRNA (accession no- NM_001123525). The PCR product of Chinook salmon beta-actin full length mRNA (1128 bp) was cloned into TOPO vector and sequenced (Accession no-FJ546418). Small interfering RNAs (siRNAs) targeting the beta-actin mRNA of Chinook salmon were designed using Dharmacon siRNA design center. The siRNAs were blasted to verify that they do not target other known genes of Chinook salmon and zebrafish (Dcmio rerio). The sequence of the siRNA are siRNAl (NNG QUA UGG AGU CUU GCG GUA), siRNA2 (NNG UAA GGA CCU GUA CGC AAA), and a negative siRNA (NNA UCU GCG GGA GAA CUC UCG) that was generated by scrambling the siRNAs 1, and 2. The sequence of the negative siRNA was blasted using the NCBI blastn online tool to make sure that the siRNA does not target other genes of Chinook salmon and zebrafish. The siRNAs were purchased from Dharmacon and 20 nmoles of the siRNAs was reconstituted in 1000 ul of IX siRNA buffer (Dharmacon) to get a final concentration of 20 uM siRNA. CHSE-214 cell suspensions in Opti-MEM with 10% FBS were transfected using either 50 nM or 100 nM of final siRNA concentration and 1 ul of lipofectamine 2000 using the reverse transfection protocol (Invitrogen). The transfection mix was dripped into each well containing the cell suspension. The cells were incubated at 24°C overnight in a 5% C02 incubator, and then the medium changed to ordinary CHSE-214 medium with 5% serum after 24 hr. The cell monolayer was frozen at 24 hr and 48 hr for QRT- PCR and 72 hr and 96 hr for Western blotting. 146 5.3.10. Complementation of RPC/NB-04-085-1 with NBISA01 segment 7 and segment 8 proteins To test if the NBISA01 IFN antagonistic proteins complement the replication potential of RPC/NB-04-085-1 iri CHSE-214 cells, one day old cells (24 well plates) were transfected with 400 ng of Seg 7 ORF1, Seg 7 ORF1/2, Seg 8 ORF1, Seg 8 ORF2 or the empty vector using 1 ul of lipofectamine 2000. On day two cells were infected 5 with RPC/NB-04-085-1 isolate at TCID50 of 10 . Triplicate wells (biological replicates) were sampled by day 5 post-infection for QRT-PCR quantification of ISAV segment 7 and 8 in wells transfected with constructs expressing ISAV segment 8 and 7 proteins compared to the control pcDNA3.1 empty vector transfected cells. 5.3.11. Western blotting CHSE-214 cell monolayers were washed once with PBS, lysed with 200 ul of 2X sodium dodecyl sulfate (SDS) gel sample buffer (0.5 M Tris pH 6.8, 25% glycerol, 10%SDS, 0.5% bromophenol blue, 0.05% 2-mercaptoethanol) boiled for 5 min, and centrifuged for 5 min at 20,800 g. Cell extract (10 ul) were run in SDS-PAGE using 4% stacking and 12% separating polyacrylamide gel. The gel electrophoresis was run for 1.5 hr at 150 V in the Miniprotean gel system (Biorad). The resolved proteins in the polyacrylamide gel were transferred to a PVDF membrane by a wet electroblotting transfer for 1 hr at 100 V. Protein immuno-detection was carried out using anti-rat beta- actin antibody raised in rabbit (Sigma Aldrich) as a primary antibody and goat anti-rabbit IgG as a secondary antibody (Biorad). The signal was detected using Imobilon ECL substrate and luminal enhancer (Fisher Scientific). 147 5.3.12. RNA extraction and DNAse I treatment Total RNA from the TO and CHSE-214 cell lysates was extracted using 1.25 ml of TRIzol Reagent (Invitrogen) and 375 ul of the cell lysate with minor modifications to the manufacturer's instructions. For poly I:C stimulation and siRNA transfection experiments cell monolayers were lysed using 1.25 ml of TRIzol reagent. The extracted RNA was DNAse I-treated using the Roche DNAse treatment kit (Roche) following the manufacturers' procedures. DNAse I treated RNA samples were column-purified using the RNeasy MinElute Cleanup kit (QIAGEN). The integrity of the RNA samples was checked by running them in 1% agarose/ethidium bromide gels and the purity of the RNA was checked by using the A260/A230, and A260/A280 ratio of the UV spectrophotometer reading. 5.3.13. Quantitative Reverse Transcription - Polymerase Chain Reaction First strand cDNA synthesis was carried out using the Transcriptor reverse transcriptase first strand cDNA synthesis kit (Roche). The cDNA synthesis was carried out using random hexamers and 300 ng of total RNA as described in section 2.3.4. The ISAV primers amplifying segment 7 ORF1, Seg7 ORF1/2, segment 3, and segment 8 (both ORFs) were designed to amplify both of the virus isolates used in this experiment. This was done by designing primers that anneal to conserved regions of the ORFs and assigning degeneracy at the nucleotide sequences where the isolates varied. The primers amplifying Seg7 ORF1/2 were designed based on the splicing model of Kibenge et al. (2007b) whereby the forward primer was designed to span the splicing site of the segment 7 ORF1 transcript. The primer for segment 8 was designed to amplify both ORF 1 and ORF2 (see Appendix I, Supplementary Table 5.1). Interest in ISAV segment 3 148 originated from the fact that NS1B protein of influenza B virus binds ISG15 and inhibits its conjugation (Yuan and Kxug, 2001), and in Atlantic salmon the ISAV segment 3 protein product (NP) was co-immunoprecipitated with ISG15 (Rokenes et al., 2007). The QRT-PCR primers were designed using either Primer3 (http://frodo.wi.mit.edu/) or Primer Express (Applied Biosystems). For determining amplification efficiency of each primer set, standard curves were generated using serial dilutions of cDNA run in triplicates for six consecutive dilutions. For the ISAV primers amplifying both isolates, the efficiency was similar in reactions consisting of templates from both isolates. For the type IIFN system genes the 20 (il PCR reaction consisted of 2 (il of undiluted cDNA and a master mix described in section 4.3.5. For the viral genes the 20 (il PCR reaction consisted of 2 ul of undiluted cDNA for all genes except 18S (which was diluted 1:1000) and 18 (il of the master mix prepared using 0.4 ul of the 10 uM forward and reverse primers (a final concentration of 0.2 uM), 2 (il of the LC FastSTART DNA Master SYBR Green I mix, 2.4 ul of the stock 25 mM MgCb (a final concentration of 0.004 u.M), and 12.8 (il of nuclease-free water. The PCR programme for amplifying PKZ gene had a master mix consisting of 12.8 |il of water, 2.4 ul of 25 mM MgCl2 (a final concentration of 0.004 uM), 0.4 (il of the 10 fiM forward and reverse primer, and 2 ul of SYBR Green master mix. The PCR cycling conditions consisted of an initial denaturation at 95°C for 10 minutes to activate the hot-start polymerase, followed by 50 cycles of amplification with denaturation of 95°C for 5 s, differing annealing temperature of 56-61°C (annealing temperatures are listed in Supplementary Table 5.1, Appendix I) for 10 s, extension at 149 72°C for 10 s, and detection at 80CC for 2 s. Melting curve analysis was performed from 70°C to 95°C in 0.1°C/s increments to assess the specificity of the PCR products. The LightCycler LC480 and LC480 SYBR Green master mix (Roche) were used for quantifying the transcripts of Chinook salmon beta-actin gene using 18S rRNA as an endogenous reference gene. The 20 ul reaction consists of 10 ,ul of SYBR Green I (2X), 7 [il of nuclease free water, and 0.5 uM of the forward and reverse primers. The PCR cycling consisted of hot-start of 95°C for 10 minutes, followed by amplification programme of 10 s for the annealing temperatures (see Appendix I, Supplementary Table 5.1), 15 s at 72°C and detection at 80°C for 2 s. The Ct values were analyzed using LightCycler software version 3.5 (Roche) or the LC480 version 1.5 software (Roche). Each sampling point had three biological replicates. The stability of the 18S rRNA, used as endogenous reference gene, was strictly validated. The Ct values were then analyzed using the Pfaffl method (Pfaffl, 2001) to get the relative fold ratio as described in section 4.3.5. To test for statistical significance between the observed mean differences of relative fold induction between the two virus isolates, Microsoft Excel was used for two tailed t-tests assuming normal distribution of the data and after running an F-test for homogeneity of variance. All the statistically significant mean differences mentioned in the results indicate statistically significant higher fold induction by RPC/NB-04-085-1 compared to NBISA01 isolate at a value of 0.05. 150 5.4. RESULTS 5.4.1. Poly I:C transfection up-regulates the type IIFN system genes TO and CHSE-214 cells were transfected with poly I:C for intracellular availability of the synthetic dsRNA that simulates the viral dsRNA intermediate. The poly I:C transfection experiment was designed to investigate if intracellular availability affects the expression of Atlantic salmon type I IFN system genes when compared to availability in the medium. The poly I:C transfection experiments were also used as a positive control for comparing the relative fold expression of key type I IFN system genes to virus infection experiments. The results from QRT-PCR relative quantification of the type I IFN system genes confirm that poly I:C transfection of TO and CHSE-214 cells up-regulated the expression of type I IFN system genes. Relative fold up-/down-regulation of each sampling point presented in Figures 5.1 A and B are PCR efficiency corrected fold units calibrated to the 0 hr control and expression level of the endogenous reference gene 18S rRNA. TO cells started up-regulation of the genes at 12 hr and reached a maximum relative fold expression at 24 hr after transfection and maintained declining levels by 36 hr with the lowest level at 48 hr. STAT1 expression had a maximal stimulation of 1.71 fold increase by 24 hr after transfection. In CHSE-214 cells the relative fold increase of IFN, Mx, and ISG15 started to rise by 6 hr and peaked at 36 hr for all the genes including STAT1. CHSE-214 cells show a lower IFN-a and higher ISG15 and Mx transcript up- regulation compared to TO cells. 151 A 400 ISG-15 300 - STAT1 200 100 o I 10 5 - 0 a! -5 Ohr 6hr 12hr 24 hr 36 hr 48 hr 72 hr Sampling hours after poly I:C transfection of TO cells g BO e I ei Ohr 6hr 12hr 24hr 36hr 48hr 72hr Sampling hours after poly I:C transfection of CHSE-214 cells Figure 5.1. Expression of key type IIFN system genes in poly I:C stimulated cells. Relative fold expression of the key type I IFN system genes and the transcription factor STAT1 in TO cells (A) and CHSE-214 cells (B) transfected with 1 ug of poly I:C. Relative fold up-/down-regulation of each sampling point are PCR efficiency corrected fold units calibrated to the 0 hr control and expression level of the endogenous reference gene 18S rRNA (Error bars are standard deviations of a triplicate observation). 152 5.4.2. ISAV isolates show differing expression patterns of key type IIFN system genes in TO cells To investigate the interaction of ISAV isolates of differing pathogenicities and genotypes with the type I IFN system of Atlantic salmon, RNA samples extracted from TO cells infected with equal infectious titers of NBISA01 and RPC/NB-04-085-1 isolates were subjected to QRT-PCR analysis of the key type I IFN system genes (Mx, IFN-a, and ISG15) and the transcription factor STAT1. NBISA01-infected TO cells showed low fold up-regulation of the IFN-a, as well as the Mx, and ISG15 transcripts when compared to RPC/NB-04-085-1 isolate. The IFN-a transcripts in NBISA01 infected cells had low expression levels at all the sampling points with the maximum at 48 hr (1.2±0.3). In RPC/NB-04-085-1 infected cells IFN-a transcripts started to rise from 36 hr (12.7±4.5) to reach a statistically significant maximum fold increase by 96 hr (432.5±6.5)(Fig. 5.2A). Mx mRNA expression in NBISA01 infected cells started to increase by 36 hr (4.1±0.2) and had maximal fold up-regulation by 48 hr (5.3±0.2). In RPC/NB-04-085-1 infected cells Mx transcripts started to rise from 12 hr, increasing to a statistically significant maximum by 96 hr (139±3.2)(Fig. 5.2B). ISG15 transcripts showed a similar pattern of induction as Mx, reaching maximum up-regulation at 36 hr in response to NBISA01 and a statistically significant maximum up-regulation by the last sampling point of 96 hr (283.6±35.4) in RPC/NB-04-085-1 infected cells (Fig. 5.2C). Interestingly, the transcripts of PKZ showed a moderate level of induction by 36 and 48 hr (12.2±1.3) in response to NBISA01 when compared to RPC/NB-04-085-1 (Fig. 5.2D). The transcripts of STAT1 were kept at minimal up-regulation levels in RPC/NB-04-085-1 (3.7±0 by 24 hr to 6.1 ± 1 by 48 hr), and mixed low up-regulation and down-regulation in response to NBISA01 153 (Fig. 5.2E). RPC/NB-04-085-1 -infected TO cells showed a generally high fold induction of the IFN-a transcripts as well as the ISGs Mx, and ISG15. In terms of the viral transcripts all the NBISA01 transcripts (segment 3, segment 8 and segment 7 ORF1, and ORF1/2) showed a statistically significant higher mean fold increase compared to RPC/NB-04-085-1-infected TO cells starting from 24 hr. In NBISA01-infected TO cells segment 8 had an early high relative fold increase from 48 hr (Fig. 5.3A-D). 154 A B warn NBISAOI •M NBISAOI [__ZJ RPC/NB-04-085-1 LIZ;) RPC/NB-04-C y I I / - . . L- 24 hr 36 hr 48 hr 72 hr 24 hr 36 hr 48 hr 72 hr 96 hr Sampling hours after ISAV infection Sampling hours after ISAV infection c D 300 - warn NBISAOI T 1 - J RPC/NB-04-085-1 CTJ RPC/NB -04-0 85-1 250 - a! ^ 12 150 - e io 100 • .. 13 50 • 1 1 24 hr 36 hr 48 hr 72 hr 96 hr 24 hr 36 hr 48 hr 72 hr Sampling hours after ISAV infection Sampling hours after ISAV infection R HHH NBISAOI LIZ! RPC/NB-04-085-1 I ! 1 I 12 hi- 24 hr 36 hr 48 hr 72 hr 96 hr Sampling hours after ISAV infection Figure 5.2. Expression of key type IIFN system genes in TO cells infected with NBISAOI and RPC/NB-04-085-1 isolates of ISAV. Relative fold expression of the type I IFN system genes IFN-a (A), Mx (B), ISG15 (C), PKR (D), and the transcription factor STAT1 (E) in TO cells infected with RPC/NB-04-085-1 and NBISAOI isolates of ISAV. Relative fold up-/down-regulation of each sampling point are PCR efficiency corrected fold changes calibrated to the 0 hr control and expression level of the endogenous reference gene 18S rRNA (Error bars are standard deviations of a triplicate observation). 155 A B • NBISA01 2.00000e+5 MM NBISA01 L_^J RPC/NB-04-085-1 1 RPC/NB-04-085-1 1.50000e+5 O 8.000&+4 - 1.00000e+5 5.000GOe+4 - • - 1.250e+2/ l.OOOe-t-2 7.500e+l 5.005e+l « 2.50000e+l -{ 2.500e+l :i_i 0.000 JJJJ 121i 241ir 36 hi 48 In 72 hi 12 lir 241ir 36 hr 48 hr 72 hr 96 hr Sampling hoins after 1SAV infection Sampling hours after ISAV infection D 1.000e+5 \ MM NBISA01 8.oooe+4 A rr;;j RPC/NBJM-OSS-I 6.000e+4 ] 4.000e+4 \ 2.000e+4 -j _ m 8.000e+l , 6.000e+l • 4.000&+1 • 2.000e+l - 0.000 12hi 241|I 36te 48hi 72ta 12 hr 1124 hr 36 hr 148 hr 72h r 96 hr Sampling hours after ISAV infection Sainpliiig hours after ISAV infection Figure 5.3. Expression of ISAV transcripts in TO cells infected with NBISA01 and RPC/NB-04-085-1 isolates of ISAV. Relative fold expression of ISAV transcripts: segment 8 (A), segment 7 ORF1 (B), segment 7 ORF1/2 (C), and segment 3 (D) in TO cells infected with RPC/NB-04-085-1 and NBISA01 isolates of ISAV. Relative fold up- /down-regulation of each sampling point are PCR efficiency corrected fold changes calibrated to the 0 hr control and expression level of the endogenous reference gene 18S rRNA (Error bars are standard deviations of a triplicate observation). 156 5.4.3. Expression of type IIFN system genes and viral transcripts in CIISE- 214 cells after ISAV infection The IFN-a transcripts in CHSE-214 cells infected with NBISA01 at all the sampling points showed down-regulation. ISG15, PKR, and STAT1 showed down- regulation for most of the sampling points and very low up-regulation for day 4 and 5 (Fig. 5.4A). Relative fold expression of the various ISAV segments showed remarkable up-regulation starting by day 4 (Fi g. 5.4B). The ISAV segment 3 showed high up- regulation at all sampling points. The RPC/NB-04-085-1 infected CHSE-214 cells showed down-regulation of the transcripts of type I IFN system genes and ISAV transcripts compared to the 0 hr infected controls (see Appendix I, Supplementary Tables 5.2 and 5.3), which is consistent with a failure of ISAV of European genotype to replicate in CHSE-214 cells (Kibenge et al. 2000). Comparing the NBISA01 transcripts in CHSE- 214 and TO cells shows that NBISA01 starts remarkable increase in all the viral transcripts one day after infection in TO cells and 4 days after infection in CHSE-214 cells. The viral transcripts of all the segments were lower in CHSE-214 cells when compared to TO cells. 157 0 hour dayl day 2 day 3 day 4 day 5 day 6 day 7 day 10 Sampling points after ISAV infection B 500 Seg8 Seg 7 ORF1 Seg 7 ORF2 •I , Seg 3 o 300 H >•a 200 <; W 100 tn LL Ohour dayl day 2 day 3 day4 day 5 day 6 day 7 day 10 Sampling points after ISAV infection of CHSE-214 cells Figure 5.4. Expression of key type IIFN system genes (IFN, ISG15, PKR, STAT1) and ISAV transcripts in CHSE-214 cells infected with NBISA01 isolate of ISAV. Relative fold expression of key type I IFN system genes (IFN, ISG15, PKR, and STAT1) (A) and ISAV transcripts: segment 8, segment 7 ORF1, segment 7 ORF1/2, segment 3 (B) in CHSE-214 cells infected with RPC/NB-04-085-1 and NBISA01 isolates of ISAV. Relative fold of each sampling point are PCR efficiency corrected fold changes calibrated to the 0 hr control and expression level of the endogenous reference gene 18S rRNA (Error bars are standard deviations of a triplicate observation). 158 5.4.4. Studies on the IFN antagonizing activity of ISAV In an effort to identify the functional roles of ISAV antagonistic proteins with type I IFN antagonistic activity we used three independent approaches: (1) Atlantic salmon minimal IFN promoter-driven luciferase gene reporter system to identify the NBISA01 proteins that can antagonize the IFN promoter stimulated by synthetic dsRNA in CHSE-214 cell lines; (2) Use small interfering RNA (siRNA) to individually knock down expression of ISAV antagonistic proteins in NBISA01 infected CHSE-214 cells; and (3) Complementation of the lowly pathogenic ISAV isolate RPC/NB-04-085-1 with individual proteins of the highly pathogenic ISAV isolate NBISA01. For this NBISA01 segment 7 and 8 proteins were cloned in a mammalian expression vector and confirmed their expression in CHSE-214 cells. 5.4.4.1. Molecular cloning and expression of ISAV proteins The segment 7 ORF1 and ORF1/2 of ISAV were cloned in pcDNA3.1 without a stop codon in frame with the V5 epitope tag of the pcDNA3.1 vector, and nucleotide sequence verified by sequencing. After transfection with pDNA, immunofluorescence was used to make sure that the proteins are expressed in CHSE-214 cells (Fig. 5.5). The results show that the pDNA clones of ISAV segment 7 ORF1, ORF1/2, and segment 8 ORF1 are expressed in CHSE-214 cells. ASK-2, TO and CHSE-214 cells were transfected with pEGFP-Cl using either FuGENE 6 or lipofectamine 2000. ASK-2 and TO cells had significant cell death or very low transfection efficiency. As a result CHSE-214 cells were selected for use in further optimization of the transfection conditions. The proportion of CHSE-214 cells expressing green fluorescent protein 2 days after transfection with pEGFP-Cl was used for 159 estimating the transfection efficiency achieved by using lipofectamine 2000 (Fig. 5.6). The results indicate that CHSE-214 cells transfected with lipofectamine 2000 had 44.5% transfection efficiency. These transfection conditions were used for transfecting the various constructs for luciferase assay. 160 A B C Figure 5.5. Expression of the various ISAV proteins detected by immunofluorescence. Immunofluorescence images of CHSE-214 cells transfected using lipofectamine 2000 and pDNA constructs expressing the ISAV segment 7 ORF1 (A), segment 7 ORF1/2 (B), segment 8 ORF1 (C). The cells were allowed to grow for 2 days after transfection and immunofluorescence carried out using FITC labeled antibody of the V5 epitope. A B Figure 5.6. Transfection efficiency of CHSE-214 transfected with pEGFP-Cl. CHSE-214 cells transfected with pEGFP-Cl using lipofectamine 2000 and 48 hr later fixed with 4% formaldehyde. Fluorescent cells visible under fluorescent light (A) and all cells in the field of view visible under halogen light (B). 161 5.4.4.2. ISAV segment 7 ORF1 is an interferon antagonistic protein The minimal Atlantic salmon IFN promoter PA1 (-202), cloned upstream of the firefly luciferase coding sequence,' controls the transcription of firefly luciferase mRNA. CHSE-214 cells transfected with PA1 (-202) construct and stimulated with poly I:C has been shown to express increased firefly luciferase protein measured by luminescent light activity (Bergan et al, 2006). We hypothesized that any of the ISAV encoded IFN antagonistic proteins co-transfected with the PA1 (-202) construct would counteract the induction of the IFN promoter in response to poly I:C if the ISAV proteins antagonize IFN signaling above the IFN promoter activation. The results of the luciferase assay show that segment 7 ORF1 of NBISA01 isolate co-transfected cells showed reduced promoter activity (67.91±1.7% relative light activity) when compared to the empty vector transfected cells (100%). This finding suggests that ISAV segment 7 ORF1 antagonizes poly I:C induced activation of the minimal Atlantic salmon IFN promoter. Segment 7 ORF1/2, segment 8 ORJF1, and segment 8 ORF2; however, showed a higher promoter activity when compared to the control empty vector transfected cells (Fig. 5.7). We wanted to further investigate if the expression of ISAV proteins affects the endogenous IFN promoters of CHSE-214 cells thereby affecting the transcripts of IFN, Mx, and ISG15. For this we analyzed the transcripts of key type I IFN system genes (IFN, Mx, and ISG15) in ISAV segment 7 (ORF1, and ORF1/2) and segment 8 (ORF1, and ORF2) co-transfected, and poly I:C stimulated CHSE-214 cells. Generally segment 7 (ORF1, and ORF1/2) and 8 (ORF1, and ORF2) co-transfected cells showed a higher relative fold expression of IFN, Mx, and ISG15 compared to the control empty vector transfected cells (Fig. 5.8). These results suggest that co-transfected segment 7 ORF1 counteracts the 162 activation of the minimal IFN promoter of Atlantic salmon, but not the full length endogenous IFN promoters of CHSE-214 cells. NBISA01 infected cells co-transfected with PA1 (-202) and pGL4.74 constructs show very low level of promoter activity close to the non-stimulated and non-infected controls. However, NBISA01 infection does not seem to counteract poly I:C induced minimal IFN promoter induction in that NBISA01 infected, co-transfected with PA1(- 202) and pGL4.74, and poly I:C stimulated cells showed higher promoter activity compared to control cells (Fig. 5.9). Moreover, NBISA01 infected and poly I:C stimulated cells showed higher IFN-alpha transcripts, but reduced transcripts of ISG15 and Mx when compared to non infected poly I:C stimulated cells (Fig. 5.10). This suggests the possibility that NBISA01 in addition to its antagonism at or above the IFN promoter activation, also antagonizes the IFN signaling at a point after the activation of IFN promoter. 163 > •S o o 60 Empty Vector - poly I:C Seg 7 ORF1 Seg 7 ORF2 Seg 8 ORF1 Seg 8 ORF2 Pi Figure 5.7. Atlantic salmon minimal IFN promoter activity in CHSE-214 cells co- transfccted with various pDNA constructs. CHSE-214 cells were transiently co- transfected with firefly luciferase reporter gene (pGIAlO) under the control of Atlantic salmon minimal IFN promoter (PA1 (-202)) together with Renilla luciferase expressing plasmid under the control of Herpes simplex thymidine kinase promoter (pGL4.74), and pCDNA3.1 vector expressing ISAV segments 7 (seg 7 ORP1, and ORF1/2) and segment 8 (seg 8 ORF1, and ORF2) proteins, and an empty vector control (in triplicates). The cells were stimulated or left unstimulated (-poly I:C) with poly I:C 24 hr post-transfection and after 48 hr cells were harvested for measurement of luciferase activity. The percent increase is calculated by setting the empty vector transfected cells at 100% (Error bars are standard deviations of a triplicate observation). 164 'H 400 Empty vector - poly I:C Seg 7 ORF1 Seg 7 ORF2 Seg 8 ORF1 Seg 8 ORP2 Figure 5.8. Expression of IFN, Mx, and ISG-15 in CHSE-214 cells co-transfected with various pDNA constructs. CHSE-214 cells were transiently co-transfected with firefly luciferase reporter gene (pGL4.10) under the control of Atlantic salmon minimal IFN promoter (PA1 (-202)) together with Renilla luciferase expressing plasmid under the control of Herpes simplex thymidine kinase promoter (pGL4.74), and pCDNA3.1 vector expressing ISAV segments 7 (seg 7 ORF1, and ORF1/2) and segment 8 (seg 8 ORF1, and ORF2) proteins, and an empty vector control (in triplicates). The cells were stimulated or left unstimulated (-poly I:C) with poly I:C 24 hr post-transfection and after 48 hr cells were harvested for measurement of mRNA expression of IFN-a, Mx, ISG15. Relative up-/down-regulation of each sampling point are PCR efficiency corrected fold changes calibrated to the 0 hr control and expression level of the endogenous reference gene 18S rRNA. (Error bars are standard deviations of a triplicate observation). 165 J3 00 JJ T 30 - 25 - !__„ 20 - 15 - o o •-d 10 - T3 5 - T3 n . i - i r ""^ i NBISA01 -polyLC -polyLC NBISA01 + poly I:C +polyI:C ea Figure 5.9. Atlantic salmon minimal IFN promoter activity in CHSE-214 cells infected with NBISA01 isolate of ISAV. CHSE-214 cells were transiently co- transfected with firefly luciferase reporter gene (pGL4.10) under the control of Atlantic salmon minimal IFN promoter (PA1 (-202)) together with Renilla luciferase expressing plasmid under the control of Herpes simplex thymidine kinase promoter (pGL4.74). The same day as the transfection cells were infected with NBISA01 (NBISA01 + poly I:C) or left uninfected (NBISAOl-poly I:C). The cells were stimulated (+poly I:C) or left unstimulated (-poly I:C) with poly I:C 24 hr post-transfection and after 48 hr cells were harvested for measurement of luciferase activity (Error bars are standard deviations of a triplicate observation). 166 •8 500 H 400 H O 300 I O g 81 <* -polyI:C NBISA01-polyI:C +polyI:C NBISAOl+poly I:C NBISA01 Figure 5.10. Expression of IFN, Mx, and ISG-15 in CHSE-214 cells infected with NBISA01 isolate of ISAV. CHSE-214 cells were transiently co-transfected with firefly luciferase reporter gene (pGL4.10) under the control of Atlantic salmon minimal IFN promoter PA1 (-202) together with Renilla luciferase expressing plasmid under the control of Herpes simplex thymidine kinase promoter (pGL4.74). The same day as the transfection cells were infected with NBISA01 (NBISA01 + poly I:C) or left uninfected (NBISAOl-poly I:C). The cells were stimulated (+poly I:C) or left unstimulated (-poly I:C) with poly I:C 24 hr post-transfection and after 48 hr cells were harvested for measurement of mRNA expression of IFN-a, Mx, ISG15. The column labeled NBISA01 is used for cells that are infected with NBISA01 but not transfected with the luciferase plasmid constructs. Relative up-/down-regulation of each sampling point are PCR efficiency corrected fold changes calibrated to the time matched untreated control and expression level of the endogenous reference gene 18S rRNA. (Error bars are standard deviations of a triplicate observation). 167 5.4.4.3. Use of siRNAs to silence ISAV segment 7 ORF1 From the QRT-P.CR quantification analysis of type I IFN system genes, we observed thatNBISAOl does not activate the IFN system genes while the virus is actively replicating. The luciferase reporter assays show that the segment 7 ORF1 protein product is an IFN promoter antagonist. To follow up on this finding the use of siRNAs targeting segment 7 ORF1 for investigating the loss of segment 7 ORF1 function in NBISA01 infected cells was planned. This study hypothesized that upon silencing of the NBISA01 segment 7 ORF1 a robust induction of the IFN system would occur, making the virus sensitive to the antiviral effects of IFN. Initial work to develop a method for silencing of ISAV antagonistic proteins was carried out by calibrating a positive control siRNA targeting Chinook salmon beta-actin. Two separate siRNAs, targeting different regions of the Chinook salmon beta-actin, were used individually or in combination at 50 and 100 nM concentrations and failed to silence both mRNA and protein. CHSE-214 cells had been used for silencing salmon annexin 1 using electroporation and 2 nmol of siRNA (Hwang et al., 2007). Hwang et al. (2007) used very high siRNA concentration which most likely induces type I IFN system genes. We did not want to use a very high concentration of siRNA (dsRNA) that would certainly induce type I IFN system genes, and at the end it will be difficult to identify whether the up-regulation of type I IFN system genes was from the silencing of the IFN antagonisitic proteins of NBISA01 or from the non-specific effects of the high dose siRNA. This suggested to us that fish cells may not be suitable for silencing using chemically synthesized siRNAs for this specific experiment; as a result the experimental plan to silence ISAV segment 7 ORF1 was not done. 168 5.4.4.4. Complementation of RPC/NB-04-085-1 with NBISA01 segment 7 and segment 8 proteins The CHSE-214 cell line has been shown to be permissive for ISAV isolates of North American genotype, but not for ISAV isolates of European genotype. NBISA01 belongs to the North American genotype and replicates in CHSE-214 cells wheras RPC/NB-04-085-1 isolate belongs to the European genotype and does not replicate in CHSE-214 cells. This differing permissiveness of CHSE-214 cells may be due to either limitation of the virus to counteract the host response or to unsuccessful virus host- receptor interactions. We had planned to complement the RPC/NB-04-085-1 isolate with NBISA01 segment 7 (Seg 7 ORF1, and ORF1/2) and segment 8 (Seg 8 ORF1, and ORF2) proteins, and explore the possibility that RPC/NB-04-085-1 could replicate in CHSE-214 cells. Complementation of RPC/NB-04-085-1 with NBISA01 segment 7 ORF1, ORF1/2 and segment 8 OR.F1, ORF2 products did not assist the RPC/NB-04-085- 1 to replicate in CHSE-214 cells as evidenced by the absence of any increase in segment 8/7 transcripts measured by QRT-PCR. 5.5. DISCUSSION AND CONCLUSIONS ISAV isolates have been shown to vary considerably in their cytopathogenicity in Atlantic salmon cells and pathogenicity for Atlantic salmon hosts (Kibenge et al, 2006; 2007a). Previous observations of in vivo challenge experiments indicate that a combination of ISAV virulence and host susceptibility determines the outcome of ISAV infections in fish (Kibenge et ah, 2006). ISAV up-regulates the expression of both the innate (Kileng et al, 2007) and adaptive immune response genes of Atlantic salmon 169 (J0rgensen et al, 2008; Schi0tz et al, 2008) and is resistant to host antiviral responses (Kileng et al, 2007). Kileng et al. (2007) used ISAV isolate belonging to the European genotype to infect TO cells and reported that the genes Mx, ISG15 and IFN-as were highly up-regulated by ISAV. There is no information on the level of expression of type I IFN system transcripts in response to ISAV isolates of differing pathogenicity or genotypes. The current study used two ISAV isolates of differing genotypes and pathogenicity phenotypes to investigate how ISAV strain variation affects the mRNA expression pattern of Atlantic salmon key type I IFN system genes using poly I:C transfection as a positive control. The results indicate that poly I:C transfection up- regulated IFN-a transcripts to a higher fold when compared to poly I:C stimulation reported by Kileng et al. (2007). TO cells challenged by NBISA01 showed low fold up- regulation of the key type I IFN system genes and very high up-regulation of the viral transcripts compared to the RPC/NB-04-085-1 isolate in TO cells. The RPC/NB-04-085- 1 isolate showed a high up-regulation of IFN-a, Mx, ISG15 transcripts and low fold increase of STAT1 and PKZ in TO cells. The same isolate showed a gently rising level of all the viral transcripts in TO cells starting from 24 hr and overall the expression is similar to poly I:C stimulated cells. NBISA01 infected CHSE-214 cells showed down- regulation or slight up-regulation of the key type I IFN system genes. The positive control poly I:C; however, showed induction of the key type I IFN system genes both in TO and CHSE-214 cells. The slight transcriptional up-regulation of the ISGs like PKR, Mx, ISG15, and IFN-a transcriptional shut off could be ISAV-induced IFN system antagonism mechanism. The results of TO and CHSE-214 cells infected with NBISA01 170 suggest that ISAV antagonism of the IFN system most likely takes place before the induction of the IFN-a. All in all, the key type I IFN system gene quantification results show that ISAV isolates differ in their capacity to up-regulate the type I IFN system genes of Atlantic salmon. This can be associated with the differences in ISAV isolates either to avoid detection of viral associated molecular patterns by the host or antagonism of type I IFN responses. Studies in influenza virus indicate that different strains of influenza virus have different IFN-P induction profiles in a strain specific way (Hayman et al., 2006) and the NS1 protein of several human influenza A virus strains have different mechanisms to abort host responses (Kochs et al., 2007). The segment 7 ORF1 and segment 8 ORF2 have recently been shown to be major and minor type I IFN system antagonizing proteins, respectively (McBeath et al., 2006; Garcia-Rosado et al., 2008). In order to antagonize the type I IFN system of Atlantic salmon, segment 7 ORF1 needs to be expressed early on ISAV infection. This study did not indicate an early transcriptional up-regulation of segment 7 ORF1 to antagonize the IFN-a expression in TO cells. However, the IFN promoter activity analysis using co- transient transfection experiments using viral segment 7 ORF1 supported the antagonism claimed by McBeath et al. (2006) and Garcia-Rosado et al. (2008). The results also suggested that co-transfected segment 7 ORF1 can counteract the activation of the minimal IFN promoter of Atlantic salmon, but not the full length endogenous IFN promoters of CHSE-214 cells, to affect the transcripts of key type I IFN system genes. The observation can possibly be explained by the species difference between Atlantic salmon and Chinook salmon, as well as, the low and transient expression of ISAV 171 proteins in pDNA transfections that possibly limit their capacity to antagonize the endogenous promoters. The accessibility of the full-length IFN promoters for antagonism by the ISAV proteins could be another possible reason since the full length promoter constructs of Atlantic salmon were shown to be less regulated compared to the PA1 (- 202) in response to poly I:C stimulation (Bergan et ah, 2006). ISAV segment 8 ORF2 has been shown to have minor IFN antagonizing activity (Garcia-Rosado et al., 2008) although we did not have a similar observation. The discrepancy can be explained by the differences in the methods and ISAV isolates used to clone the protein. NBISA01 infected cells show very low promoter activity close to the non- stimulated and non-infected controls and NBISA01 infected and poly I:C stimulated cells had higher promoter activity. This indicates that NBISA01 can replicate without inducing the type IFN system genes, and does not seem to counteract the activation of Atlantic salmon IFN promoter when it is used to infect CHSE-214 cells 24 hr before poly I:C transfection. The plasmid expressing NBISA01 segment 7 ORF1 did; however, had IFN promoter antagonizing activity. These observations can be explained by the possible differences in expression of the segment 7 ORF1 protein in virus infected and plasmid transfected CHSE-214 cells. In addition, NBISA01 infected and poly I:C stimulated cells showed higher IFN-a transcripts, but reduced transcripts of ISG15 and Mx when compared to non-infected poly I:C stimulated cells. This suggests the possibility that NBISA01 antagonizes the IFN signaling at a point after the activation of IFN promoter. Although this and previous studies suggest that ISAV encodes antagonistic proteins of the type I IFN system, further work is required to understand how ISAV antagonistic proteins counteract the IFN system of Atlantic salmon. Influenza virus NS1 protein has 172 multiple points to antagonize the type IIFN system, and one of the antagonisms is at the level of RIG-I, which inhibits the activation of IRP3 (Kochs et al, 2007). This study used chemically synthesized siRNAs to silence endogenously expressed beta-actin of Chinook salmon cell line CHSE-214 cells. This was a proposed positive control for silencing ISAV segment 7 ORF1. For two possible reasons (1) inefficient delivery of the siRNAs into CHSE-214 cells or (2) low potency of the siRNAs, we were not able to silence Chinook salmon beta-actin mRNA and protein with the recommended siRNA concentrations. Fish cells have been shown to have very low siRNA transfection efficiency (Ruiz et al., 2009). As a result it was not possible to proceed with silencing of ISAV segment 7 ORF1. In conclusion, this study shows that ISAV isolates mount differing levels of key type I IFN system gene expression. The observed variations could be related to virus virulence mechanisms that allow some isolates to replicate by minimizing their nucleic acid replication intermediates or it could be associated with their ability to counteract the host type I IFN response. A comprehensive study utilizing several ISAV isolates of differing pathogenicity and genotypes is recommended. This work identified ISAV segment 7 ORF1 to have IFN signaling antagonism activity. Further work to clarify the IFN antagonistic proteins can utilize alternative efficient delivery methods such as use of viral vectors to express shRNA from packaged pDNA. An alternative strategy is to develop ISAV reverse genetics system to generate attenuated recombinant viruses with known deletions of the suspected ISAV IFN antagonistic proteins. This is essential for the current understanding of ISAV IFN system antagonism. 173 Appendix I Supplementary Table 5.1. QRT-PCR primers used to quantify host and viral mRNA levels Supplementary Table 5.2. Down-regulation of type I IFN system gene transcripts, and STAT1 in CHSE-214 cells infected with RPC/NB-04-085-1 isolate of ISAV Supplementary Table 5.3. Down-regulation of ISAV transcripts in CHSE-214 cells infected with RPC/NB-04-085-1 isolate of ISAV 174 5.6. REFERENCES Alexopoulou L, Holt AC, Medzhitov R, Flavell RA. Recognition of double-stranded RNA and activation of NF-KB by Toll-like receptor 3. Nature 2001;413:732-738. Bergan V, Steinsvik S, Xu H, Kileng 0, Robertsen B. Promoters of type I interferon genes from Atlantic salmon contain two main regulatory regions. FEBS J 2006;273:3893- 3906. Fryer JL, Yusha A, Pilcher KS. The in vitro cultivation of tissue and cells of Pacific salmon and steelhead trout. Ann N Y Acad Sci 1965; 126:566-586. Garcia-Rosado E, Markussen T, Kileng 0, Baekkevold ES, Robertsen B, Mjaaland S, Rimstad E. Molecular and functional characterization of two infectious salmon anaemia virus (ISAV) proteins with type I interferon antagonizing activity. Virus Res 2008;133:228-238. Garcia-Sastre A. Inhibition of interferon-mediated antiviral responses by influenza A viruses and other negative-strand RNA viruses. Virology 2001;279:375-384. Garcia-Sastre A, Egorov A, Matassov D, Brandt S, Levy DE, Durbin JE, Palese P, Muster T. Influenza A virus lacking the NS1 gene replicates in interferon-deficient systems. Virology 1998; 252:324-330. Haller O, Kochs G, Weber F. The interferon response circuit: induction and suppression by pathogenic viruses. Virology 2006;344:119-130. Hayman A, Comely S, Lackenby A, Murphy S, McCauley J, Goodbourn S, Barclay W. Variations in the ability of human influenza A viruses to induce and inhibit the IFN-P pathway. Virology 2006;347:52-64. 175 Hwang HJ, Moon CH, Kim HG, Kim JY, Lee JM, Park JW, Chung DK. Identification and functional analysis of salmon annexin 1 induced by a virus infection in a fish cell line. J Virol 2007;81:13816-13824. Jorgensen SM, Afanasyev S, Krasnov A. Gene expression analyses in Atlantic salmon challenged with infectious salmon anemia virus reveal differences between individuals with early, intermediate and late mortality. BMC Genomics 2008;9:179. Jorgensen SM, Hetland DL, Press CM, Grimholt U, GJ0en T. Effect of early infectious salmon anaemia virus (ISAV) infection on expression of MHC pathway genes and type I and II interferon in Atlantic salmon (Salmo salar L.) tissues. Fish Shellfish Immunol 2007;23:576-588. Kato H, Takeuchi O, Sato S, Yoneyama M, Yamamoto M, Matsui K, Uematsu S, Jung A, Kawai T, Ishii KJ, Yamaguchi O, Otsu K, Tsujimura T, Koh CS, Reis e Sousa C, Matsuura Y, Fujita T, Akira S. Differential roles of MDA5 and RIG-I helicases in the recognition of RNA viruses. Nature 2006;441:101-105. Kibenge FSB, Kibenge MJT, Groman D, McGeachy S. In vivo correlates of infectious salmon anemia virus pathogenesis in fish. J Gen Virol 2006;87:2645-2652. Kibenge FSB, Lyaku JR, Rainnie D, Hammell KL. Growth of infectious salmon anaemia virus in CHSE-214 cells and evidence for phenotypic differences between virus strains. J Gen Virol 2000;81:143-150. Kibenge FSB, Xu H, Kibenge MJT, Qian B, Joseph T. Characterization of gene expression on genomic segment 7 of infectious salmon anaemia virus. Virol J 2007b;4:34. 176 Kibenge FSB, Garate ON, Johnson G, Arriagada R, Kibenge MJT, Wadowska D. Isolation and identification of infectious salmon anemia virus from coho salmon in Chile. Dis Aquat Org 2001; 45:9-18. Kibenge FSB, Kibenge MJT, Wang Y, Qian B, Hariharan S, McGeachy S. Mapping of putative virulence motifs on infectious salmon anaemia virus surface glycoprotein genes. J Gen Virol 2007a; 88:3100-3111. Kileng 0, Brundtland MI, Robertsen B. Infectious salmon anemia virus is a powerful inducer of key genes of the type I interferon system of Atlantic salmon, but is not inhibited by interferon. Fish Shellfish Immunol 2007;23:378-389. Kileng 0, Bergan V, Workenhe ST, Robertsen B. Structural and functional studies of an IRF-7-like gene from Atlantic salmon. Dev Comp Immunol 2009;33:18-27. Kochs G, Garcia-Sastre A, Martinez-Sobrido L. Multiple anti-interferon actions of the influenza A virus NS1 protein. J Virol 2007;81:7011-7021. Krug RM, Yuan W, Noah DL, Latham AG. Intracellular warfare between human influenza viruses and human cells: the roles of the viral NS1 protein. Virology 2003;309:181-189. Markussen T, Jonassen CM, Numanovic S, Braaen S, Hjortaas M, Nilsen H, Mjaaland S. 2008. Evolutionary mechanisms involved in the virulence of infectious salmon anaemia virus (ISAV), a piscine orthomyxovirus. Virology 2008;374:515-527. McBeath AJ, Collet B, Paley R, Duraffour S, Aspehaug V, Biering E, Secombes CJ, Snow M.. Identification of an interferon antagonist protein encoded by segment 7 of infectious salmon anaemia virus. Virus Res 2006;115:176-184. McBeath AJ, Snow M, Secombes CJ, Ellis AE, Collet B. Expression kinetics of interferon and interferon-induced genes in Atlantic salmon (Salmo salar) following infection with infectious pancreatic necrosis virus and infectious salmon anaemia virus. Fish Shellfish Immunol 2007; 22:230-241. Mjaaland S, Markussen T, Sindre H, KJ0glum S, Dannevig BH, Larsen S. Grimholt U. Susceptibility and immune responses following experimental infection of MHC compatible Atlantic salmon {Salmo salar L.) with different infectious salmon anaemia virus isolates. Arch Virol 2005;150:2195-2216. Pfaffl MW. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res 2001;29,9e45. Pichlmair A, Schulz O, Tan CP, Naslund TI, Liljestrom P, Weber F, Reis e Sousa C. RIG-I-mediated antiviral responses to single-stranded RNA bearing 5'-phosphates. Science 2006; 314: 997-1001. Randall RE, Goodbourn S. Interferons and viruses: an interplay between induction, signalling, antiviral responses and virus countermeasures. J Gen Virol 2008;89:1-47. Rimstad E, Biering E, Brun E, Falk K, Kibenge F, Mjaaland S, Snow M Winton J. Which risk factors relating to spread of Infectious Salmon Anaemia (ISA) require development of management strategies? Opinion of the Panel on Animal Health and Welfare of the Norwegian Scientific Committee for Food Safety 2007. Ritchie RJ, McDonald JT, Glebe B, Young-Lai W, Johnsen E, Gagne N. Comparative virulence of infectious salmon anaemia virus isolates in Atlantic salmon, Salmo salar L. J Fish Dis 2009;32:157-171. Robertsen B. The interferon system of teleost fish. Fish Shellfish Immunol 2006;20:172- 91. 178 Robertsen B. Expression of interferon and interferon-induced genes in salmonids in response to virus infection, interferon-inducing compounds and vaccination. Fish Shellfish Immunol 2008;25:351-357. Rekenes TP, Larsen R, Robertsen B. Atlantic salmon ISG15: expression and conjugation to cellular proteins in response to interferon, double stranded RNA and virus infection. Mol Immunol 2007;44:950-959. Ruiz S, Schyth BD, Encinas P, Tafalla C, Estepa A, Lorenzen N, Coll JM. New tools to study RNA interference to fish viruses: Fish cell lines permanently expressing siRNAs targeting the viral polymerase of viral hemorrhagic septicemia virus. Antiviral Res 2009;82:148-156. Schi0tz BL, Jorgensen SM, Rexroad C, GJ0en T, Krasnov A. Transcriptomic analysis of responses to infectious salmon anemia virus infection in macrophage-like cells. Virus Res 2008;136:65-74. Weber F, Wagner V, Rasmussen SB, Hartmann R, Paludan SR. 2006. Double-stranded RNA is produced by positive-strand RNA viruses and DNA viruses but not in detectable amounts by negative-strand RNA viruses. J Virol 2006;80:5059-5064. Wergeland HI, Jakobsen RA. A salmonid cell line (TO) for the production of infectious salmon anaemia virus (ISAV). Dis Aquat Org 2001;44:183-190. Yuan W, Krug RM. Influenza B virus NS1 protein inhibits conjugation of the interferon (IFN)-induced ubiquitin-like ISG15 protein. EMBO 2001;20:362-71. 179 6. Variation of host macrophage/dendritic-like cell line TO gene expression responses caused by different ISAV isolates assessed using genomic techniques* 6.1. SUMMARY Infectious salmon anaemia virus (ISAV) is a marine orthomyxovirus of significant interest not only as a cause of a fatal disease of farmed Atlantic salmon resulting in severe economic losses to the aquaculture industry, but also as the only poikilothermic orthomyxovirus. ISAV targets vascular endothelial cells and macrophages, and is known to influence the expression of both innate and adaptive immune response genes. ISAV isolates from different regions have been shown to vary considerably in their pathogenicity for Atlantic salmon. This study aimed to characterize the Atlantic salmon macrophage/dendritic-like TO cell responses to infection with a selection of ISAV isolates of different genotypes and pathogenicity phenotypes. The first TO infection trial used ISAV isolates NBISA01 and RPC/NB-04-085-1 of high and low pathogenicity respectively, and global gene expression analyses were carried out using ~ 16,000-gene (16K) salmonid cDNA microarrays to compare RNA samples extracted from TO cells harvested 24 and 72 hr post-infection versus time-matched uninfected controls. Over all, the microarray experiment showed that RPC/NB-04-085-l-infected cells had a higher total number of reproducibly dysregulated genes (88 genes: the sum of *Workenhe ST, Hori TS, Rise ML, Kibenge MJT, Kibenge FSB. Infectious salmon anaemia virus (ISAV) isolates induce distinct gene expression responses in the Atlantic salmon (Salmo salar) macrophage/dendritic-like cell line TO, assessed using genomic techniques. Molecular Immunology (in press). 180 genes greater than 2-fold up- or down-regulated in all 4 replieate microarrays of a given comparison) than the NBISA01-infected cells (10 genes) for the combined sampling points (i.e. 24 hr and 72 hr). The microarray experiment identified several salmon genes that were differentially regulated by NBISA01 and RPC/NB-04-085-1, and which may be useful as molecular biomarkers of ISAV infection. An initial QRT-PCR study involving 25 microarray-identified genes confirmed the differences in the level of dysregulation of host transcripts between the two ISAV isolates (i.e. NBISA01 and RPC/NB-04-085-1). A second TO infection trial was run using a selection of 4 clinical ISAV isolates (Norway- 810/9/99, a high pathogenicity isolate of European genotype; RPC/NB-04-085-1, a low pathogenicity isolate of European genotype; NBISA01, a high pathogenicity isolate of North American genotype; and RPC/NB-01-0593-1, an intermediate pathogenicity isolate of North American genotype), and UV inactivated RPC/NB-04-085-1, with sampling at 24, 36, 48, 72, 96, and 120 hr post-infection. The microarray-identified, QRT-PCR validated suite of 24 molecular biomarkers of response to ISAV was used in a second QRT-PCR experiment to assess the TO cell gene expression responses to the 4 ISAV isolates at all 6 time points in the infection. The QRT-PCR data showed that RPC/NB-04- 085-1 caused the highest fold changes of most immune-relevant genes, followed by Norway-810/9/99. NBISA01 and RPC/NB-01-0593-01 (both of North American genotype) showed low fold up-regulation of transcripts that were highly induced by RPC/NB-04-085-1 isolate. These findings show that ISAV isolates have strain-specific variations in their ability to induce immune response genes. 181 6.2. INTRODUCTION The immune response against a virus infection starts with the innate response, which is triggered by the recognition of the pathogen by germ-line encoded pattern recognition receptors, such as the toll-like receptors (TLRs)(Janeway and Medzhitov, 2002). Cells of the innate immune system respond by phagocytosis, secretion of cytokines and chemokines, as well as, by direct killing of infected cells (Janeway et al., 2005). One of the most well studied imiate immune responses to virus infection is the secretion of type I interferons (IFNs)(IFN-a/B). Most virus-infected cells use the cytoplasmic RNA helicases RJG-I and Mda5 or TLRs to sense viral nucleic acids. Binding of viral replication nucleic acid intermediates to RIG-I, Mda5, or TLR results in a coordinated activation of the transcription factors NF-KB, IFN regulatory factor 3 (IRF- 3) and IRF-9 (Randall and Goodbourn, 2008). These transcription factors in turn regulate the expression of hundreds of genes such as IFNs and IFN-stimulated genes, and proinflammatory cytokines and chemokines, which are involved in the orchestration of the adaptive immune response (Haller et al., 2006; Katze et al., 2008). As virus replication proceeds, antigen presenting cells display the antigens which have been bound to MHC class I molecules on the cell surface for detection by cytotoxic T lymphocytes. In addition, antigens are processed for the production of specific antibodies that are important in protection against viral infections (Janeway et al., 2005). Atlantic salmon cells/hosts infected with pathogenic ISAV isolates have been shown to up-regulate the expression of innate (IFN-a, Mx, ISG15, PKR) as well as adaptive (MHC class I genes) immune response genes (Jorgensen et al., 2007; Kileng et al., 2007; McBeath et al; 2007). None of these studies examined the variability of host 182 responses to ISAV isolates that differ in virulence properties and pathogenicities (Kibenge et al, 2006; 2007). It is known that the mechanisms by which human influenza A virus antagonizes the IFN-a/p response are virus-strain specific (Hayman et al, 2006; Kochs et al, 2007). Moreover, the NS1 protein of different human influenza virus strains (H1N1) have different mechanisms of antagonizing the host response (Kochs et al., 2007). Moreover, ISAV isolates NBISA01 and RPC/NB-04-085-1 which have differing pathogenicities and geographic origins (Kibenge et al, 2006) showed different endocytic properties, replication, and host immune responses when used to infect erythrocytes (Chapters 3, 4, and 5). This suggests the existence of ISAV isolate differences in the molecular aspects of disease pathogenesis and host responses. The responses of host cells to different virus isolates can be assessed using DNA microarrays, a widely used approach for high-throughput analysis of gene expression. To date, microarray-based analyses of host response to ISAV have been limited only to highly pathogenic virus isolates, such as European ISAV isolate 12 (Mjaaland et al, 2005) and ISAV Glesvaer/2/90 (Dannevig et al, 1995). The Glesvaer/2/90 isolate causes high mortalities in rainbow trout (Oncorhynchus mykiss) even with waterborne infection (Biacchesi et al, 2007). These investigations utilized a salmonid microarray containing only 1,800 different cDNAs selected for immune response and inflammation (SFA2.0 immunochip, GEO GPL6154)(j0rgensen et al, 2008; Schi0tz et al, 2008). The microarray technology in the present study utilized the consortium for Genomics Research on All Salmonids Project (cGRASP) ~ 16,000 gene (16K) salmonid microarray (GEO GPL2716)(von Schalburg et al, 2005) to identify and study the expression of Atlantic salmon genes differentially expressed in ISAV-infected macrophage-like cell 183 line TO. 6.3. MATERIALS AND METHODS 6.3.1. Viruses Four ISAV isolates (NBISA01, RPC/NB-04-085-1, Norway-810/9/99, RPC/NB- 0593-1) of differing genotypes and pathogenicity phenotypes were used for this study. NBISA01 is a highly pathogenic isolate belonging to the North American genotype. RPC/NB 04-085-1 is a lowly pathogenic isolate of the European genotype found in Eastern Canada. The HE protein of RPC/NB-04-085-1 places it in a unique, highly polymorphic region (HPR) group (Kibenge et al, 2006). Norway-810/9/99 is a highly pathogenic European genotype and RPC/NB-01-0593-1 is an intermediate pathogenicity of the North American genotype. NBISA01 and RPC/NB-01-0593-1 belong to HPR21 genotype while Norway-810/9/99 belongs to the HPR15. In a previous Atlantic salmon challenge experimental study the NBISA01 and Norway-810/9/99 isolates were shown to cause high cumulative mortalities of >90% (Kibenge et al, 2006). RPC/NB-01-0593-1 showed intermediate cumulative mortality of 50% whereas RPC/NB-04-085-1 was shown to cause low cumulative mortality of 18.2% (Kibenge et al, 2006). All viral isolates were propagated in TO cells and the lysates titrated in TO cells as previously described (Kibenge et at., 2001). All of the virus isolates used in the present study had been passaged less than 6 times in TO cells; continuous passage of a tick-transmitted orthomyxovirus, Thogotovirus, in cell culture is known to lead to loss of the ability to control IFN induction (Hagmaier et al., 2003) as a result of a mutation introduced by stuttering of the viral RNA polymerase during replication (Zheng et al, 1999). 184 6.3.2. UV inactivation of ISAV UV inactivation of RPC/NB-04-085-1 isolate was carried out with a germicidal UV lamp suspended in a biological safety cabinet (Class II A/B3 BSC, Thermo Forma) as described in section 4.3.2. Complete UV inactivation of the virus was confirmed by titration in TO cell monolayers (Kibenge et al., 2001) before use in the TO cell infection experiments. 6.3.3. Virus infection of TO cells 6.3.3.1. Virus Infection Trial 1 (used for the microarray and the first QRT- PCR validation experiment) The TO cell line (Wergeland and Jakobsen, 2001) was grown as decribed in section 2.3.2. The virus stocks of NBISA01 and RPC/NB-04-085-1 propagated in TO 50 cells were diluted to 10 TCID50/ml using HMEM with 2 raM L-glutamine, 1% non essential amino acids and 50 mg gentamicin and used to infect TO cells as described in section 2.3.2. Infected cells were sampled at 24 and 72 hr post-infection by freezing the plate at -80°C, until RNA extraction and QRT-PCR analysis. Microarray analysis was carried out on the 24 hr and 72 hr infected and time-matched uninfected controls. 6.3.3.2. Virus Infection Trial 2 (used for the second QRT-PCR experiment) The TO cell line was grown as for Infection Trial 1. The virus stocks of Norway- 810/9/99 (1065 TCIDso/ml), RP.C/NB-04-085-1, NBISA01, and RPC/NB-01-0593-1 875 50 (10 TCID50/ml) propagated in. TO cells were diluted to 10 TCID50/ml and virus infection were performed as for Infection Trial 1. Infected cells were sampled at 24, 36, 48, 72, 96, 120 hr post-infection by freezing the plate at -80°C, until RNA extraction and 185 QRT-PCR analysis. 6.3.4. RNA extraction and DNAse I treatment Total RNA from the TO cell monolayers was extracted by using 1.25 ml of TRIzol Reagent (Invitrogen) with minor modifications to the manufacturer's instructions. The extracted RNA was DNAse I-treated using the QIAGEN RNase-free DNase I following the manufacturer's procedures. DNAse I treated RNA samples were column- purified using the RNeasy MinElute Cleanup kit (QIAGEN). The integrity of the RNA samples was checked by running them in 1% agarose/ethidium bromide gels and the purity of the RNA was checked by using the A260/A230, and A260/A280 ratio of the UV spectrophotometer reading. 6.3.5. Array hybridization The microarray experiments were designed to comply with the Minimum Information About a Microarray Experiment (MIAME) guidelines (Brazma et al, 2001). Experiments were conducted using the cGRASP 16K array version 2.1 (von Schalburg et al, 2005). Microarray construction and fabrication were previously described (von Schalburg et al, 2005). Column-purified, DNAse I-treated RNA extracted from Infection Trial 1 TO cells harvested at 24 hr and 72 hr post-infection, and time-matched non- infected TO cells, were used for target synthesis using the Array 900 Detection Kit (Genisphere) and Superscript II (Invitrogen) following the manufacturer's instructions. Figure 6.1 represents a schematic of the microarray experimental design. Briefly, each viral isolate infected cell sample (I.e. NBISA01 and RPC/NB-04-085-1) was compared to its time-matched, non-infected control using 4 replicate microarrays that included 2 dye 186 swaps. The 16K arrays, obtained from the consortium for Genomic Research on All Salmonids Project (cGRASP) (http://web.uvic.ca/grasp/), were all from the same printing batch (EB017). Arrays were washed prior to hybridization 2 times for 10 minutes in 0.1% SDS (Ambion) at room temperature and 5 times for 1 minute in nuclease-free water (Gibco-Invitrogen), immersed in -95°C nuclease-free water for 3 minutes to denature the double stranded cDNA, centrifuged dry (2,000 rpm for 5 minutes at room temperature) in loosely-capped 50 ml conical tubes (BD Falcon), and stored at 50°C in a hybridization oven until hybridizations were performed. For each target synthesized, one microgram of column-purified DNAse I-treated total RNA was reverse-transcribed for 2 hours and 30 minutes at 42°C using 200 units of Superscript II and the provided 5X Superscript II buffer (Invitrogen) with specific primers for the different Cy3 and Cy5 Capture Reagent anchors (Genisphere). Complementary DNA (cDNA) from the different treatments, each containing an anchor for one of the Cy dye labeled Capture Reagents (Genisphere) were pooled (e.g. NBISA01 infected TO cell cDNA with a Cy5 anchor was pooled with Control non-infected TO cell cDNA containing a Cy3 anchor) and mixed with 2X formamide-based hybridization buffer containing bovine serum albumin (Vial 7 in the Array 900 Kit) and LNA dT as blocking agents following the manufacturer's protocol. All array washes were performed using sterile 50 ml conical tubes (BD Falcon) and all wash solutions were made with nuclease-free water (Gibco-Invitrogen). All hybridizations were performed using HybriSlips cover-slips (Grace Biolabs/Sigma Co) and Corning microarray hybridization chambers in a water bath at 50°C. Targets were hybridized to the arrays overnight (~16 hours) at 50°C. After this period cover-slips were floated off of the arrays in pre-warmed (50°C) 2XSSC/0.2%SDS (Ambion) and washed 187 for 15 minutes in the same solution with gentle agitation, followed by a 15-minute wash in 2XSSC (room temperature with gentle agitation) and a 15-minute wash in 0.2XSSC (room temperature with gentle agitation). After the washes, slides were centrifuged dry as before and stored in a hybridization oven at 50°C. The Capture Reagents (Array 900 Kit, Genisphere) containing the fluorescent dyes were combined and mixed with 2X formamide-based hybridization buffer and nuclease free water following the manufacturer's instructions. The Capture Reagent hybridizations were carried out as described previously for 4 hours at 50°C and slides were washed and dried as before. The arrays were scanned immediately at 10 um resolution using a Perkin Elmer ScanArray Express. The Cy3 and Cy5 cyanine fluorophores were excited at 543 and 633 nm, respectively, at 90% laser power and photomultiplier tube (PMT) settings of 70 for the Cy3 channel and 67 for the Cy5 channel for all microarrays involved in the study. 6.3.6. Microarray image analysis Fluorescence intensity data were extracted from TIFF images using ImaGene 5.6.1 software (BioDiscovery). All grids were manually aligned with the spots and the spot sizes were automatically adjusted using ImaGene. Spatial effects (e.g. dust particles) were manually flagged. Quality statistics (e.g. average signal-to-background ratios) were calculated in Excel, and background correction, Lowess normalization, and analysis of background corrected Lowess normalized (BCLN) data (e.g. fold change calculations) were performed in GeneSpring , GX 7.3 (Agilent Technologies). Transcripts with consistent > two-fold difference in expression between RNA samples in all 4 slides of a given comparison ( e.g. up-regulated in NBISA01 infected TO cells relative to non- infected control TO cells at the 72 hr time point) were identified in GeneSpring using 188 Venn diagrams to determine the intersection of all possible combinations between the 4 technical replicates including dye-swaps. Data were then thresholded to assess quality based on fluorescence signal strength using the BCLN signal of all 24 Arabidopsis cDNA features present in the 16K array (von Schalburg et al. 2005). Thresholds for each channel in each array were calculated as the average BCLN signal of all Arabidopsis features plus two standard deviations (von Schalburg et al, 2005). Reported dysregulated genes in Supplementary Tables 6.2a-6.2d (Appendix I) and Figure 6.2A-6.2D were identified in the highest stringency gene lists (i.e. 2 fold or higher dysregulation in all 4 arrays including 2 dye-swaps) while those presented in Supplementary Table 6.3a-6.3h (Appendix I) were identified in lower stringency gene lists (i.e. 2 fold or higher dysregulation in any 3 out 4 arrays including one dye-swap). Genes in either list had BCLN signal in the dominant channel (i.e. the channel with the highest signal in a given comparison) above threshold in at least 3 of the 4 technical replicate microarrays. 6.3.7. Quantitative reverse transcription-polymerase chain reaction The first QRT-PCR study, using Infection Trial 1 samples, was run to confirm the microarray results (i.e. the dysregulation of a selection of 25 microarray-identified genes in response to RPC/NB-04-085-1 and NBISA01 at 24 hr and 72 hr time points). The 24 out of the 25 microarray-identified genes for QRT-PCR were selected from the high stringency reproducibly dysregulated genes list based on level of up-regulation, and immune-relevant functional annotations associated with informative microarray features. The exception was importin subunit alpha-2 (CA043335) that was selected from a lower stringency gene list (i.e. genes dysregulated in any 3 out 4 replicate microarrays including one dye-swap). However, other feautres with the same annotation were present in the 189 high stringency gene lists (e.g. CB499584). Moreover, the selection was also intended to represent both up-regulated and down-regulated genes. The second QRT-PCR study, using Infection Trial 2 samples, was designed to survey the expression of the 24 microarray-identified, QRT-PCR confirmed ISAV-responsive genes in TO cells exposed to 4 different ISAV isolates and sampled at 6 time points post-infection (24, 36, 48, 72, 96, and 120 hr). For the QRT-PCR validation of the microarray observations, the Infection Trial 1 RNA samples of the three biological replicates (i.e. from three different cell-culture wells infected with a given ISAV isolate of interest at a particular time point post-infection) were used individually (i.e. RNA samples were not pooled) for cDNA synthesis. For studying the expression of candidate ISAV-responsive genes with QRT- PCR, the Infection Trial 2 RNA samples of the three biological replicates were pooled and samples were run in triplicate for QRT-PCR. The cDNA synthesis used 300 ng of total RNA and random hexamers as described in section 2.3.4. PCR primers for the genes of interest (GOI) were designed using either Primer3 (http://frodo.wi.mit.edu/) or Primer Express (Applied Biosystems) and are listed in Supplementary Table 6.1 (Appendix I). For determining amplification efficiency of each primer set, standard curves were generated using serial dilutions of cDNA run in triplicates for six consecutive dilutions. The LightCycler LC480 and LC480 SYBR Green master mix (Roche) were used for validating the microarray-identified dysregulated genes. The 20 ul reaction consists of 10 ul of SYBR Green I (2X), 7 ul of nuclease free water, and 0.5 uM of the forward and reverse primers. The PCR cycling consisted of a hot-start of 95°C for 10 minutes, followed by an amplification programme of 10 s at the annealing temperatures (56-60°C depending on primer pair) (see Appendix I, Supplementary Table 6.1), 15 s at 72°C and 190 detection at 80°C for 2 s. The Ct values were analyzed using the LC480 version 1.5 software, and technical replicates showing more than 0.5 Ct values difference were discarded as outliers (Nolan et ah, 2006). The stability of the 18S ribosomal RNA, used as endogenous reference gene, was strictly validated. The Ct values were then analyzed using the Pfaffl method (Pfaffl, 2001) to get the relative fold ratio as described in section 4.3.5. To test for statistical significance between the observed mean differences of relative fold up-regulation between the two virus isolates used in infection trial 1, Microsoft Excel was used for two tailed t-tests assuming normal distribution of the data and after running an F-test for homogeneity of variance. All the statistically significant mean differences mentioned in the results section indicate statistically significant higher fold induction by RPC/NB-04-085-1 compared to NBISA01 isolate. Quantitation of ISAV copy number equivalents and determination of ISAV titer from Ct value data were performed as described in Chapter 2. 6.4. RESULTS 6.4.1. Microarray analysis of global gene expression To characterize the transcriptome responses of TO cells to ISAV isolates of differing pathogenicities, cells infected with RPC/NB-04-085-1 or NBISA01 (infection trial 1) and time-matched uninfected controls were harvested at 24 and 72 hr post infection for RNA extraction and used for microarray and QRT-PCR analyses. These time points were chosen in order to span critical periods of infection for both the highly pathogenic NBISA01 (which was anticipated to start prior to 24 hr) and the lowly 191 pathogenic RPC/NB-04-085-1 (which was anticipated to start after 24 hr but before 48 hr). In the microarray analysis, transcripts of ISAV infected cells that showed > two-fold increase or decrease in background corrected Lowess normalized (BCLN) fluorescent signal (i.e. expression) in all 4 technical replicate microarrays (including two dye swaps) compared to the time-matched controls, and that passed the threshold signal in at least 3 out of 4 replicates, were considered reproducibly dysregulated (see Appendix I, Supplementary Tables 6.2a-6.2d). The 24 hr RPC/NB-04-085-1 infected TO cells had 15 reproducibly up-regulated genes and 1 reproducibly down-regulated gene. The 24 hr NBISA01 infected TO cells had no reproducibly up-regulated genes and 1 reproducibly down-regulated gene. The 72 hr-RPC/NB-04-085-1 infected TO cells had 65 reproducibly up-regulated genes and 7 reproducibly down-regulated genes. The 72 hr NBISA01 infected cells had 5 reproducibly up-regulated genes and 4 reproducibly down-regulated genes. The BLASTX/BLASTN (Altschul et al., 1997) hits and functional annotations for these reproducibly dysregulated genes are listed in Supplementary Tables 6.2a - 6.2d (see Appendix I). For both virus isolates and time points, less stringent informative gene lists (i.e., > two-fold dysregulation in any 3 out of 4 replicate microarrays) are available in Supplementary Tables 6.3a to 6.3h (see Appendix I). Only the absolutely reproducible microarray results (i.e. from supplementary Table 6.2a-6.2d (see Appendix I), containing genes that were informative in all 4 technical replicate slides of a given comparison) are presented hereafter. This results section does not consider genes in the less stringent gene lists (i.e. reproducibly dysregulated in any 3 out of 4 replicate microarrays, including one dye-swap) contained 192 in Supplementary Tables 6.3a to 6.3h (see Appendix I). At both the 24 hr and 72 hr sampling time points, RPC/NB-04-085-1 infected TO cells had up-regulation of immune- responsive genes such as Mxl protein (informative microarray feature representative EST GenBank dbEST accession number: CB516446), IFN-inducible protein Gigl (CA058271) and Gig2-like (CA050625), IFN-induced protein with tetratricopeptide repeats 5 (CA051350), galectin 9 (e.g. CA044879) and Galectin-3-binding protein precursor (CB515011), and several putative members of the TRIpartite Motif (TRIM) protein family (e.g. CA055205). Moreover, 14 of the 15 genes that were up-regulated by RPC/NB-04-085-1 at 24 hr were also up-regulated at 72 hr. QRT-PCR validation was carried out on selected genes from the reproducibly dysregulated gene lists (see Appendix I, Supplementary Tables 6.2a-6.2d). The QRT- PCR validation generally showed similar direction of gene expression response (up-/ down-regulation) as seen in the microarray experiment. The fold up-/down-regulation values were different between the microarray and the QRT-PCR, potentially due to differences in the sensitivity of the techniques, different methods of data analysis, and the use of separate sets of RNA samples for the microarray and the QRT-PCR experiments. Seventeen microarray-identified genes up-regulated by RPC/NB-04-085-1 (24 hr and/or 72 hr) [Mxl protein (CB516446), TRIM 16 protein (CA038906), TRIM 25 protein [CA042663 and CA060690, likely representing the same cDNA since they share 99% identity over 550 aligned nucleotides (E-value of 0.0) and 99% identity over 180 aligned predicted amino acids (E-value of 4e"114).], IFN induced protein with tetratricopeptide repeats 5 (CA051350), viperin (Radical S-adenosyl methionine domain-containing protein 2 - CA058263), beta-2-microglobulin precursor (CB489043), ubiquitin specific 193 protease 18-like (CA056962), pre-B cell enhancing factor (CA059978), MHC class lb antigen (CA043257), ubiquitin-like protein 1 (CB499972), Clone B225 VHSV-induced mRNA, VHSV induced protein-10, and VHSV-induced protein (CA054694, CA040505 and CA056844, respectively), E3 ubiquitin-protein ligase HERC4-like (CA052560), IFN induced protein Gigl-like (CA050625), Sacsin (CA053164), and CD9 antigen (CB515563)] were all consistently found to be up-regulated by QRT-PCR analysis of RPC/NB-04-085-1 samples (see Appendix I, Supplementary Tables 6.2a-6.2c). A microarray-identified gene up-regulated by the NBISA01 strain of ISAV (72 hr) [spermidine/spermine Nl-acetyltransferase (CA056199)] was confirmed as up-regulated using QRT-PCR of NBISA01 samples (see Appendix I, Supplementary Table 6.2d). Four microarray-identified genes down-regulated by RPC/NB-04-085-1 [importin subunit alpha 2 (CA043335; greater than 2-fold down-regulated in 3 out of 4 replicate microarrays, see Appendix I, Supplementary Table 6.3b), one unknown gene (CA059691), tryptophanyl-tRNA synthetase (CB512171) and glutamine synthetase (CB514092)] were also down-regulated in the QRT-PCR analysis of infection trial 1 RNA samples. Two microarray identified genes down-regulated by NBISA01 [ATP synthetase subunit g, mitochondrial (CA046558) and homeobox protein HoxB13ab (CA060050)] were down-regulated in NBISA01 infected TO cells, by 24 and 72 hr; respectively, and the same direction of fold change was observed by QRT-PCR validation. A different microarray feature (CB499584) with similar gene annotation of importin subunit alpha 2 was shown to be up-regulated in 72 hr RPC/NB-04-085-1 - infected TO cells by the microarray study. 194 Using the QRT-PCR validation data t-tests were carried out to identify mean fold changes that show statistically significant differences between the two isolates. Out of all the QRT-PCR validated genes, Mxl, three TRIM proteins, p"2 microglobulin, viperin, MHC class lb antigen, Ubiquitin specific protease 8, pre B cell enhancing factor, VHSV induced protein, IFN-induced protein with tetratricopeptide repeats 5, Clone B225 VHSV-induced mRNA, E3 ubiquitin-protein ligase, VHSV induced protein, IFN induced Gigl, Sacsin, and CD9 antigen had statistically significant higher mean induction in RPC/NB-04-085-1 compared to NBISA01 (P< 0.05). To ensure that the microarray and QRT-PCR validation observed transcript dysregulations corresponded with ISAV replication in TO cells, QRT-PCR with absolute quantitation of ISAV segment 8 transcripts was performed to estimate ISAV copy number equivalents/ ng of total RNA. Both RPC/NB-04-085-1 and NBISA01 infected TO cells showed a decrease in Ct value and therefore increase in infectious titer and ISAV copy number equivalents/ ng of total RNA from 24 hr to 72 hr (see Appendix I, Supplementary Table 6.4). 195 A • No genes up-regulated • 15 genes up-regulated • 5 genes up-regulated • 65 genes up-regulated • 1 gene down-regulated • 1 gene down-regulated •4 genes down-regulated • 7 genes down-regulated 24 hour 24 hour 72 hour 72 hour post-infection post-infection post-infection post-infection NBISApool RPCpool NBISA pool RPC pool Dye Swap Forward Dye Swap Dye Swap NBISA RPC RPC 2/ RPC Cy5 Cy3 24 hour pooled 72 hour pooled time control (non-infected cells) time control (non-infected cells) Figure 6.1. Overview of microarray experimental design and results. Experimental design and results of the microarray analysis carried out on 24 hr (A) and 72 hr (B) post infection samples. Arrows between samples represent microarrays with the base of the arrow on the Cy3-labeled sample and the arrow head on the Cy5-labeled sample. The number of replicate microarrays used in each comparison is shown next to the arrows. Number of genes (above each bracket) reported as reproducibly dysregulated (i.e. up- /down-regulated) had signal above threshold (i.e. average BCLN signal of all Arabidopsis features in the dominant channel plus 2 standard deviations) and exhibited higher or equal to 2- fold change in expression in infected relative to non-infected TO cells in all 4 replicate microarrays of a given comparison (e.g. 24 hr NBISA versus 24 hr Control) including 2 dye-swaps. For the comparison of samples collected 24 hr post infections with NBISA, there were no up- regulated genes that met the above criteria and therefore we report no up-regulated genes for that comparison. The pooling strategy is described in detail in the Materials and Methods section. NBISA= NBISA01 isolate, RPC=RPC/NB- 04-085-1 isolate. Detailed results are in Supplementary Tables 6.3a - 6.3h (see Appendix I), and in Figure 6.2. 196 72 Hour Figure 6.2. Hierarchical clustering of reproducibly dysregulated genes. Hierarchical clustering analysis of reproducibly dysregulated (i.e. more than two-fold dysregulated in all 4 replicate arrays of a given comparision) genes after infection of TO cells with NBISA01 (N) and RPC/NB-04-085-1 (R) isolates of ISAV, visualized as gene trees with heat maps. Mean background corrected, Lowess normalized infected/non-infected signal ratios for the 2 microarrays in each "forward" comparison (F: Cy3-labeled non-infected and Cy5-labeled infected; see Fig. 6.1) and the 2 microarrays in each dye swap (DS: Cy3- labeled infected and Cy5-labeled non-infected; see Fig. 6.1) are included. Genes shown were > 2-fold dysregulated by 24 hr (A and B), and 72 hr (C and D) in all 4 microarrays of a given comparison. 197 6.4.2. Expression of QRT-PCR validated genes of interest in response to four ISAV isolates The microarray and QRT-PCR validation data of infection trial 1 (presented in Appendix I, Supplementary tables 6.2a - 6.2d) confirmed that ISAV isolates induce differing host responses. NBISA01 and RPC/NB-04-085-1 have differences in their genotype, as well as, pathogenicity phenotype; consequently, it was difficult to interpret if the observations were associated with genotypic or phenotypic differences of the isolates. To further clarify the basis for the differences in dysregulation, Infection Trial 2 was set up to analyze expression of the 25 QRT-PCR validated genes in TO cells infected with NBISA01, RPC/NB-04-085-1, Norway-810/9/99 (high pathogenicity isolate of European genotype), RPC/NB-01-0593-1 (intermediate pathogenicity isolate of North American genotype), and UV inactivated RPC/NB-04-085-1 (used as a control for inoculum effects in gene expression), and samples collected at 24, 36, 48, 72, 96, and 120 hr post-infection. The UV inactivated virus infected TO cells showed cell death and the whole monolayer was lost by 96 hr as a result data for 96, and 120 hr UV-inactivated virus is missing for all the genes. Moreover, we did QRT-PCR for 25 genes listed in Appendix I, supplementary table 6.1; however, technical replicates showing more than 0.5 Ct value difference between 2 out of 3 triplicates were discarded. VHSV-induced protein (CA056844) had a lot of sampling points discarded as a result QRT-PCR for this transcript is not presented in this section. In general the QRT-PCR data of the 24 genes can be classified into four patterns of regulation. The first group of genes consists of transcripts that were highly induced by the European genotypes RPC/NB-04-085-1 and Norway-810/9/99 (up-regulation level of 198 greater than 20 relative fold units at least in two sampling points), and showed relatively low induction in response to North American genotypes NBISA01 and RPC/NB-01- 0593-1 (Fig. 6.3A-F). This group consists of CD9 antigen (CB515563)(Fig. 6.3A), E3 ubiquitin-protein ligase HERC4 '(CA052560)(Fig. 6.3B), IFN-inducible protein Gigl (CA050625)(Fig. 6.3C), Mxl protein (CB516446)(Fig. 6.3D), IFN-induced protein with tetratricopeptide repeats 5 (CA051350)(Fig. 6.3E), and viperin (Radical S-adenosyl methionine domain-containing protein - CA058263)(Fig. 6.3F) Except CD9 antigen, Most of these genes are virus responsive genes that have been shown to be IFN inducible. The second group of genes consists of transcripts that were moderately up- regulated by RPC/NB-04-085-1 (showed at least 3 sampling points with a relative fold unit of 5-20), and the same isolate shows the highest up-regulation in all sampling points compared to the other three isolates (Fig 6.3G-L). This group consists of Sascin (CA053164)(Fig. 6.3G), Tripartite motif-containing protein 16 (CA038906)(Fig 6.3H), ubiquitin-like protein 1 (CB499972)(Fig 6.31), VHSV-induced protein-10 mRNA (CA040505)(Fig 6.3J), ubiquitin specific protease 18 (CA056962)(Fig 6.3K), pre-B cell enhancing factor (CA059978)(Fig. 6.3L). Within this group Sascin and ubiquitin-like protein 1 showed unique expression in that in all sampling points up-regulation was observed only in RPC/NB-04-085-1 infected cells. The third group consists of seven genes that showed very low up-regulation (i.e. fold change of less than 5 in at least 5 sampling points) in RPC/NB-04-085-1 infected cells, and mixed up-/down-regulation in response to the other three ISAV isolates (Fig 6.3M-S). This group consists of beta-2 microglobulin (CB489043)(Fig 6.3M), importin subunit alpha-2 (CA043335)(Fig 6.3N), MHC class lb antigen (CA043257)(Fig 6.30), 199 Spermidine/Spermine Nl- acetyltransferase (CA056199)(Fig 6.3P), tripartite motif- containing protein (CA060690)(Fig 6.3Q), tripartite motif-containing protein (CA042663)(Fig 6.3R), VHSV-induced mRNA (CA054694)(Fig. 6.3S). The fourth group of genes consists of genes that were identified as down- regulated in the microarray analysis and showed similar pattern in the expression study in response to most of the virus isolates at most of the sampling points (Fig 6.3U-X). The group includes ATP synthase (CA046558)(Fig. 6.3T), tryptophanyl-tRNA synthetase (CB512171)(Fig.6.3U), glutaminc synthetase (CB514092)(Fig. 6.3N), unknown gene (CA059691)(Fig. 6.3W), and homeobox protein (CA060050)(Fig. 6.3X). The expression of ISAV segment 8 shows three profiles: (1) Norway-810/9/99 and RPC/NB-01-0593-1 have an increasing trend of ISAV segment 8 copy number until the last sampling point, (2) PvPC/NB-04-085-1 shows an increasing trend until 72 hr and a declining level thereafter until the last sampling point, and (3) NBISA01 shows an initial increasing level that peaks at 48 hr and then declines by 72 and 96 hr and again peaks to its maximum by 120 hr (Fig. 6.4). The time series expression of all the microarray reproducibly up-regulated genes in infection trial 2 was similar to the QRT-PCR validation data using samples from Infection Trial 1. Similarly most of the microarray reproducibly down-regulated genes showed similar trend of expression at most of the sampling points in the same expression study. However, homeobox protein HoxB13ab (CA060050) which was identified as down-regulated in NBISA01 infected cells by 72 hr upon microarray analysis and QRT- PCR validation using samples from Infection Trial 1 did not show down regulation by NBISA01 at 72 hr in the time series expression study. 200 B I RPC/NB-04-085-1 I Norway-810/9/99 I RPC/NB-01-0593-1 ] NBISA01 I UV inactivated I ujiin •a -1° 36 hr 48 hr 72 fir 96 hr 120 hr 36 hr 48 hr 72 hr 96 hr Sampling hours after ISAV infection Sampling hours after ISAV infection c D ••i RPC/NB-04-085-1 3 150 • •HI RPC/NB -04 -085-1 •• Norway-810/9/99 MM Norway-S 10/9/9 9 j 2000 ••1 RPC/NB-01-0593-1 g ••1 RPC/NB-01-0593-1 1 1 NBISA01 E 100 • 1 1 NBISA01 1 ^•1 UV Inactivated L •i UV Inactivated 1 i 1000 ^ 50- • i • i.i • L L 1 I i i L L I L m HI i» \^ m 36 hr 48 hr 72 hr 96 hr 36 hr 48 hr 72 hr 96 hr Sampling hours after ISAV infection Ssampling hours after ISAV infection E ^B RPC/NB-04-08S-1 260 • Mi Noiway-810/9/99 200 • ^H RPC/NB-01-0593-1 ^H RPC/NB-04-085-1 T 1 1 NBISA01 150 • ' ^•1 Norway-810/9/9 9 §•• UV Inactivated i 1000- Mi RPC/NB-01-0593-1 100 • I , 1 1 NBISA01 50 • ^^B UV Inactivated • i i 8, 500 B. L L L > • 1 ' - m i i L 36hr 48hr 72 hr 96hr Sampling hours after ISAV infection 36 hr 48 hr 72 hr 96 hr Sampling hours after ISAV infection 38hr 48hr 72hr 96hr 36 hr 48 hr 72 hr Sampling hours after ISAV infection Sampling hours after ISAV infection I RPC/NB-04-085-1 I RPC/NB-04-085-1 I Norway-810/9/99 I Norway-810/9/99 I RPC/NB-01-0593-1 I RPC/NB-01-0593-1 ] NBISA01 ] NBISA01 I UV Inactivated I UV Inactivated W V lit I w lU 36hr 48hr 72hr 96hr 120hr 38hr 48hr 72 hr 96hr 120br Sampling points after ISAV infection Sampling hours after ISAV infection K I RPC/NB-04-085-1 I Norway-810/9/99 I RPC/NB-01-0593-1 ] NBISA01 I UV Inactivated V VJ UrU I RPC/NB-04-085-1 I Norway-810/9/99 §" ° I RPC/NB-01-0593-1 ] NBISA01 I UV inactivated 24 hr 36 hr 48 hr 72 hr 96 hr 120 hr 24 hr 36 hr 48 hr 72 hr 96 hr Sampling hours after ISAV infection Sampling hours after ISAV infection N \ ^ 1 \ I \ •• RPC/NB-04-085-1 I •M Norway-810/9/99 lr ••I RPC/NB-01-0593-1 f- 36 hr 48 hr 72 hr 96 hr 24 hr 36 hr 48 hr 72 hr 96 hr 120 hr Sampling hours after ISAV infection Sampling hours after ISAV infection O •M RPC/NB-04-085-1 ••1 Norway-810/9/99 ••1 RPC/NB-01-0593-1 1 1 NBISA01 ••• UV Inactivated i 36 hr 48 hr 72 hr 96 hr 36 hr 48 hr 72 hr 96 hr Sampling hours after ISAV infection Sampling hours after ISAV infection Q R I RPC/NB-04-085-1 I Norway-810/9/99 I RPC/NB-01-0593-1 ] NBISA01 I UV Inactivated Lh I L ••1 RPC/NB-04-085-1 I ••INoiway-810/9/99 ••1 RPC/NB-01-0593-1 ' I 1 NBISA01 IMY •H UV Inactivated 36 hr 48 hr 72 hr 96 hr 24 hr 36 hr 48 hr 72 hr 96 hr 120 hr Sampling hours after ISAV infection Sampling hours after ISAV infection 203 I RPC/NB-04-085-1 I Norway-810/9/99 I RPC/NB-01-0593-1 -8 - / 10 •M RPC/NB-04-085-1 12 • •• Norway-810/9/99 •• RPC/NB-01-0593-1 14 • • NBISA01 I •Hi UV Inactivated 24 hr 36 hr 48 hr 72 hr 96 hr 120 hr 36 hr 48hr 72 hr 96 hr Sampling hours after ISAV infection Sampling hours after ISAV infection u ^ Hf a ^ • ^ I ^Af I RPC/NB-04-085-1 1 RPC/NB-04-085-1 I Norway-810/9/99 I Norway-810/9/99 I RPC/NB-01-0593-1 s I RPC/NB-01-0593-1 1 NBISA01 ] NBISA01 I UV Inactivated 1 I UV Inactivated 36hr 48hr 72hr 96hr 120hr 24hr 36hr 48hr 72hr 96hr 120hr Sampling hours after ISAV infection Sampling hours after ISAV infection w VlF rf^j ^F flf r~ I RPC/NB-04-085-1 •• RFC/NB-04-085-1 I Norway-810/9/99 ^H Norway-810/9/99 I RPC/NB-01-0593-1 MB RPC/NB-01-0593-1 ] NBISA01 1 1 NBISA01 I UV Inactivated ••• UV Inactivated 24hr 36hr 48hr 72hr 96hr 120hr 36hr 48hr 72 hr 96hr Sampling hours after ISAV infection Sampling hours after ISAV infection Figure 6.3. Expression of microarray identified and QRT-PCR validated genes after infection of TO cells with four ISAV isolates. Relative fold expression of the microarray identified and QRT-PCR validated genes in response to infection of TO cells with ISAV isolates RPC/NB-04-085-1 (black), Norway-810/9/99 (red), RPC/NB-01- 0593-1 (green), NBISA01 (yellow) and and UV-inactivated RPC/NB-04-085-1 (blue). Relative fold change of each sampling point are PCR efficiency-corrected fold changes 204 calibrated to their time-matched uninfected controls and normalized to the expression level of 18S ribosomal RNA. The transcripts studied include: CD9 antigen (A), E3 ubiquitin-protein ligase HERC4 (B), IFN-inducible protein Gigl (C), Mxl protein (D), IFN-induced protein with tetratricopeptide repeats 5 (E), and Viperin or Radical S- adenosyl methionine domain-containing protein (F), Sascin (G), Tripartite motif- containing protein 16 (H), ubiquitin-like protein 1 (I), VHSV-induced protein-10 mRNA (J), ubiquitin specific protease 18 (K), pre-B cell enhancing factor (L), Beta-2 microglobulin (M), importin subunit alpha-2 (N), MHC class lb antigen (O), Spermidine (P), tripartite motif-containing protein (Q), tripartite motif-containing protein (R), VHSV-induced mRNA (S), ATP synthase (T), tryptophanyl-tRNA synthetase (U), glutamine synthetase (V), unknown gene (W) and homeobox protein (X). Error bars are standard deviations of the QRT-PCR data and reflect technical rather than biological variability, since mean fold change values were derived from 3 technical replicates comparing the same pools of RNA samples. 6e+6 < IM RPC/NB-04-085-1 2 ^m Norway-810/9/99 3 5e+6 • ^m RPC/NB-01-0S93-1 B 1 1 NBISA01 o •H UV Inactivated 4e+6 • t-Et ? seg m 0 Ln k. <> 23 24 hr 36 hr 48 hr 72 hr 96 hr 120 hr Sampling hours after ISAV infection Figure 6.4. Absolute copy numbers of ISAV segment 8 per ng of total RNA 205 6.5. DISCUSSION AND CONCLUSIONS ISAV isolates have been shown to vary considerably in their cytopathogenicity in Atlantic salmon cells (TO, ASK-2, and CHSE-214) and pathogenicity for Atlantic salmon (Kibenge et al, 2006; 2007). Previous observations from in vivo challenge experiments indicated that a combination of virulence and host susceptibility are determining factors in ISAV infections in fish (Kibenge et al., 2006). The immune response is a key host susceptibility factor. Studies indicate that ISAV up-regulates the expression of both the innate and adaptive immune response genes of Atlantic salmon (Jorgensen et al, 2008; Schi0tz et al, 2008) and/or is resistant to host antiviral responses (Kileng et al., 2007). Because all these studies never accounted for differences in ISAV isolates, there is a paucity of information on the level and extent of dysregulation in the immune response genes. The current study analyzed the general transcriptome profile of Atlantic salmon TO cell line infected by ISAV isolates of high and low pathogenicities (i.e. NBISA01 and RPC/NB-04-085-1, respectively) and studied the expression of selected genes in response to four virus isolates. Such studies are essential to further our understanding of virus-host cell interactions and the capacity of ISAV isolates to modulate the immune system and this knowledge is necessary as a basis for the identification of virus virulence marker genes, as well as, potential targets for therapeutic interventions to reduce the level of disease. In infection trial 1 24 hr samples, the lowly pathogenic isolate-infected TO cells up-regulated the IFN induced antiviral Mxl protein (CB516446). This protein which has been shown to protect Atlantic salmon cells from IPNV infection (Larsen et al., 2004) had been previously reported to be unresponsive to ISAV infection (Jensen and 206 Robertsen, 2002). This study showed that Mx transcripts were highly up-regulated by the European genotype isolates (Norway-810/9/99 and RPC-04-085-1) at all sampling points of infection trial 2 and down-regulated or lowly up-regulated in response to the North American genotype isolates (NBISA01 and RPC/01-0593-1). The microarray data identified four up-regulated transcripts with high identity to TRIM proteins. TRIM proteins are characterized by the presence of tripartite motif, which consists of a RING domain, one or two B-box motifs and a coiled coil region (Borden et al., 1995; Reymond et al., 2001; Towers, 2007). Genes belonging to this family of proteins are implicated in a variety of processes such as development and cell growth, and are involved in several human diseases (Sardiello et al., 2008). TRIM5a has been implicated as a major factor restricting HIV-l replication during the early phase of infection (Brass et al., 2008). There is increasing evidence suggesting that TRIM 19, also known as promyelocytic leukemia (PML), may have antiviral activity. Antiviral activity of PML bodies has been reported for several viruses (Everett and Chelbi-Alix, 2007). Particularly TRIM25 can modify itself and other proteins by conjugating ISG15 (Zou and Zhang, 2006). TRIM25 interacts with the N-terminal CARDs of RIG-I to promote the K (63)-linked ubiquitination which is critical for the interaction of RIG-I with its downstream signaling partner IPS-1 (Gack et al., 2007). A large set of closely related genes and transcripts that contain three motifs typical of TRIM proteins has been identified in several teleost fish species, and they have been shown to be specifically induced by viruses and poly I:C (Van der Aa et al., 2009). In Atlantic salmon, previous microarray work has shown up-regulation of TRIM protein-like transcripts in ASK-2 cells and Atlantic salmon organs (tergensen et al, 2008; Schi0tz et al, 2008). In the 207 present study, 3 of the 4 microarray up-regulated TRIM protein-like transcripts were validated by QRT-PCR, and showed significant differences between the two ISAV isolates used. Moreover, several different features annotated as TRIM16 (e.g. CA038906) and TRIM25 (e.g. CA042663) were reproducibly up-regulated by infection with the less pathogenic ISAV isolate (RPC/NB-04-085-1). The microarray results also provide internal validation of the importance of this protein family in the response to viruses. In the serial time expression study involving 4 different ISAV strains and a UV-inactivated ISAV control (Infection Trial 2), all three QPCR studied TRIM-like transcripts (i.e. one TRIM16-like annotated feature and two TRIM25-like features that are likely to represent the same cDNA, see methods for details) showed up-regulation by RPC/NB-04-085-1 (between ~2 and -10 fold) followed by Norway-810/9/99 but presented no clear trend with regard to response to NBISA01 and RPC/NB-01-0593-1. By the 24 hr and/or 72 hr sampling time points the lowly pathogenic isolate (RPC/NB-04 085-1) was able to up-regulate several other transcripts involved in immune response including; viperin, Mxl, P-2 microglobulin type 2, MHC class lb antigen, and pre-B cell enhancing factor, IFN-induced protein with tetratricopeptide repeats 5, Oncorhynchus mykiss clone B225 VHSV-induced mRNA, E3 ubiquitin-protein ligase, and IFN induced Gigl. These findings were also validated by QRT-PCR. Viperin was one of the highly up-regulated (i.e. -100 or higher fold up-regulation with maximum fold induction of over 1000)(Figure 6.3F) transcripts in RPC/NB-04-085- 1 infected cells and to a lesser extent at 48 hr to 120 hr in Norway-810/9/99 infected TO cells. It presented an early (i.e. 24 hr and 36 hr) down-regulation and low later (i.e. 48 hr to 120 hr) up-regulation in response to NBISA01 and RPC/NB-01-0593-1. Viperin is an 208 evolutionarily conserved protein that is highly inducible by both type I and II IFNs (Chin and Cresswell, 2001). Many viruses induce the expression of viperin suggesting a role in antiviral response. Viperin has been shown to inhibit the release of influenza virus during budding in the virus replication cycle, as a result of viperin-induced disruption of lipid- raft micro-domains that play a role in the replication cycle of many viruses (Wang et al, 2007). Viperin in rainbow trout (vigl) is a rhabdovirus-induced antiviral gene (Boudinot et al., 1999), and it is up-regulated in Atlantic cod in response to the viral mimic dsRNA (poly I:C)(Rise et al, 2008). MHC class I molecules control the response of cytolytic lymphocytes to virus- infected cells (Janeway et al., 2005). P2-microglobulin expression level has previously been shown to be up-regulated in response to ISAV infection (Jorgensen et al, 2007; 2008; Schi0tz et al, 2008). The second MHC I related gene up-regulated in response to RPC/NB-04-085-1 infection is MHC class lb antigen (CA043257). Both genes did not show remarkable patterns of induction in response to different ISAV isolates. In addition to regulation of intracellular protein levels, protein ubiquitination regulates many aspects of the innate immune response, including signal transduction (for example activation of nuclear factor-tcB) and functions of the adaptive immune response, such as initiating tolerance (Liu et al., 2005). The IFN-regulated ubiquitin like protein response (ISGylation) is mediated by ISGs. ISG15 is a key player in the ISGylation process and the protein has two ubiquitin-like domains (Ritchie and Zhang, 2004). ISG15 is conjugated by a thiolester bond to cysteine residues of three enzymes: a ubiquitin activating enzyme (El), a ubiquitin conjugating enzyme (E2) and a ubiquitin ligase enzyme (E3), before being transferred to lysine residues of protein substrates (Welchman 209 et al., 2005). Many ISG15 putative targets have important roles in the type I IFN response, including JAK1, STAT1, RIG-I, MxA, PKR, and RNaseL (Zhao et al, 2005). Similar to ubiquitination, ISGylation is a reversible process, and several enzymes that catalyze the process have been identified (Sadler and Williams, 2008). Ubiquitin protease 18 is a de-ISGylating protease that removes ISG15 from proteins to which it was conjugated (Malakhov et al., 2002). The microarray data and QRT-PCR validation show that Ubiquitin protease 18-like (CA056962), and E3 ubiquitin ligase-like (CA052560) transcripts are highly inducible in TO cells infected with the RPC/NB-04-085-1 isolate compared to NBISA01. Similarly, the microarray data shows that several features annotated as ubiquitin-like protein 1 (e.g. CB499972) were up-regulated 72 hr after infection with the less virulent isolate of ISAV (RPC/NB-04-085-1). Moreover, this protein could be related to ISG15 since one of its best BLASTX hits is a salmonid ISG15-like transcript (AAX98145 - 127 identities over 156 aligned amino acids for an identity of 81%; E-value = le-65). Differential up-regulation of ubiquitin E3 ligase, ubiquitin protease 18 and ubiquitin like proteins at all sampling points in response to different ISAV isolates suggests differing activity of ISGylation and de-ISGylation (at a transcriptional level) upon infection with different ISAV isolates. These observations also support that similar to mammals, ubiquitination in fish is essential in regulating the innate immune response. Pre B-cell colony enhancing factor is an inflammatory mediator that is highly conserved in bacteria (Martin et al., 2001), fish (Fujiki et al., 2000), and mammals (McGlothlin et al., 2005). Pre B-cell colony enhancing factor has been induced by lectins and prevents apoptosis of neutrophils (Luk et al., 2008). Earlier microarray work using 210 ISAV showed up-regulation of the pre B-cell colony enhancing factor like gene (fergensen et ah, 2008). In the current study, pre B-celi colony enhancing factor (CA059978) transcripts were up-regulated by RPC/NB-04-085-1 at all sampling points while showing lower up-regulation or down-regulation in response to other isolates. IFN-induced protein containing multiple tetratricopeptide repeat (TPR) domains are highly IFN inducible genes (Sadler and Williams, 2008). Members of the group include ISG56 (also known as IFIT-1 or GARG-16), ISG54 (also known as IFIT-2 or GARG-39), and ISG49 (also known as IFIT-3 or GARG-49)(de Veer et ah, 1998). In cells, ISG49, ISG54, and ISG56 are rapidly induced by both type I and type II IFNs (Smith and Herschman, 1996; Terenzi et ah, 2005). The expression of ISG54 and ISG56 is also induced directly by the SeV as well as by dsRNA (Terenzi et ah, 2005). The human orthologues of ISG54 and ISG56 are also induced by IFN, dsRNA, and a range of viruses, including SeV, encephalomyocarditis virus, and cytomegalovirus (Guo et ah, 2001; Preston et ah, 2001). Murine ISG56 and ISG54 inhibited protein synthesis in vitro by binding to the "c", but not the "e", subunit of the translation initiation factor, eIF-3 (Terenzi et ah, 2005). The deduced sequence of virus induced gene 4 (Vig 4) in trout is homologous to the ISG56 family of mammals (Robertsen, 2008). The time series expression study of the IFN-induced protein with tetratricopeptide repeats 5 (CA051350) showed higher mean relative fold induction of IFN-induced protein with tetratricopeptide repeats 5 (CA051350) by the European isolates RPC/NB-04-085-1 and Norway-810/9/99 when compared to NBISA01 and RPC/NB-01-0593-1 infected cells. Crucian carp {Carassius carassius) blastulae (CAB) cells stimulated with UV- inactivated grass carp hemorrhagic septicemia virus (GCHV) has been shown to up- 211 regulate the transcription of two novel IFN stimulated genes Gigl, and Gig2 (Zhang and Gui, 2004). Atlantic salmon TO' cells infected with RPC/NB-04-085-1 showed up- regulation of Gigl- (CA050625) and Gig2-like (CA058271) transcripts as well. The expression study of Gigl shows high induction by the European isolates RPC/NB-04- 085-1 and Norway-810/9/99 when compared to the North American isolates NBISA01 and RPC/NB-01-0593-1. Interestingly, RPC/NB-04-085-1 caused high up-regulation of this transcript in all time-points in a bimodal fashion, with highest fold up-regulation at 48 hr and 120 hr. High up-regulation is not induced by Norway-810/9/99 until 48 hr and it steadily increases up to 120 hr, not showing the bimodal profile induced by RPC/NB- 04-085-1 . On the other hand the North-American genotypes (i.e. NBISA01 and RPC/NB- 01-0593-1) did not show high up-regulation of this transcript up until the last time point. Accurate translation of the genetic information into proteins is a complex process requiring essential cellular constituents such as the ribosome, messenger RNAs, aminoacylated tRNAs, and a host of additional protein and RNA factors. Aminoacyl- tRNA synthetases join amino acids with their cognate transfer RNAs in a high-fidelity reaction (Park et ah, 2004). In eukaryotic cells specific aminoacyl-tRNA synthetases play roles in amino acid biosynthesis, cell cycle control, RNA splicing, and export of tRNAs from nucleus to cytoplasm (Martinis et al., 1999; Francklyn et ah, 2002). A primary antiviral response of host cells to virus infection involves activation of PKR in response to viral dsRNA and thereby inhibition of viral and cellular protein synthesis (Schneider and Mohr, 2003). The observation of down-regulated Tryptophanyl tRNA synthetase (CB512171) by RPC/NB-04-085-1 infected cells in infection trial 1 and its down regulation at most of the sampling points in response to the four virus isolates used in 212 infection trial 2 suggest that TO cells down-regulate Tryptophanyl tRNA synthetase as part of the host induced protein synthesis shut off. This is consistent with the observed up-regulation of IFN-induced protein with tetratricopeptide repeats 5 (CA051350), which has been shown to inhibit protein synthesis (Terenzi et al, 2005). Conversly, mammalian Tryptophanyl tRNA synthetase is the only aminoacyl-tRNA synthetase that has been shown to be IFN-y responsive (Craven et al., 2004) and ISAV infection has been shown to up-regulate IFN-y (Jorgensen et al., 2007). This possibly suggests that fish Tryptophanyl tRNA synthetase are not IFN-y responsive. Among enzymes involved in metabolism, ATP synthetase subunit g (CA046558) and glutamine synthetase (CB511492) were down-regulated by both NBISA01 and RPC/NB-04-085-1 in infection trial 1 samples by 72 and 24 h, respectively. Microarray studies using white spot syndrome virus of shrimp (Wang et al., 2006) and West Nile virus (Koh et al., 2005) also showed down-regulation of genes involved in energy synthesis such as ATP synthetase, and cytochrome C oxidase. Glutamine synthetase is a multifunctional enzyme involved in amino acid balance, protein metabolism, nucleotide biosynthesis, neurotransmitter metabolism, as well as ammonia detoxification (Watford et al., 2000). Glutamine synthetase has been shown to be down-regulated in cultured embryonic chick neural retina cells by the addition of chick IFN preparation (Matsuno et al., 1976). The down-regulation of glutamine synthetase caused by ISAV may also be a part of the host induced protein synthesis shut off and/or be associated with virus-induced IFN production as evidenced from the IFN stimulated Mxl up-regulation. Genes belonging to group 3 and 4 (with the exception of importin alpha subunit 2 and spermidine), and genes such as pre B- cell enhancing factor, sascin, ubiquitin-like 213 protein 1 in group 2 showed a steep down-regulation by 96 hr post infection. This down- regulation is prominent in NBISA01 and RPC/NB-04-085-l.This might be associated with virus induced cytopathic effect that might have affected the host transcriptional machinery resulting in severe down regulation of genes. In general, the induction pattern of the immune responsive genes correlated with the replication of the different ISAV isolates in this study, as evidenced from the ISAV segment 8 RNA copy numbers. UV inactivated RPC/NB-04-085-1 showed lower expression of immune responsive genes when compared to the live RPC/NB-04-085-1, suggesting virus replication as the requirement for induction of immune responsive genes. The expression of most up-regulated genes in response to RPC/NB-04-085-1 and Norway-810/9/99 appears to have more than one phase of induction. This can be explained by the fact that most of the up-regulated genes are IFN inducible and the expression of type I IFNs in response to poly I:C had three sequential waves (Demoulins et al., 2009). Correlating the induction pattern of immune response genes and RPC/NB- 04-085-1 segment 8 copy number suggests that the virus induces most of the immune responsive genes to a very high level and possibly the protein products of those genes restricted the replication of the virus that shows declining viral copy numbers starting from 72 hr to 120 hr post infection. Infection Trial 2 (the QRT-PCR expression study) revealed differences in host responses to different ISAV isolates; specifically most of the genes that were highly up-regulated (group 1 genes in section 6.4.2 of the results) showed strain-specific differences in that the isolates of European genotype were potent inducers while isolates of North American genotypes showed low fold up-regulation. However, the molecular basis for these differences cannot be presently explained. 214 In conclusion, the microarray and QRT-PCR results indicate that ISAV isolates interact with the immune system of Atlantic salmon in different ways. The data show that ISAV isolates have virus strain-specific differences in their capacity to induce innate as well as adaptive immune response genes. The responses do not seem to relate with the level of ISAV pathogenicity in that both highly pathogenic-Norway-810/9/99 and lowly pathogenic isolate- RPC/NB-04-085-1 induce the immune responsive genes. Rather the European genotypes Norway-810/9/99 and RPC/NB-04-085-1 showed up-regulation of several genes when compared to the North American genotypes. Some of the observed variations could be related to intrinsic variations in virus virulence mechanisms that avoid the immune response, and others could be due to the differences in virus antagonistic proteins that counteract the host immune system, which is consistent with the fact that RNA viruses evade the host response at different levels by: interference with antigen presentation, inhibition of cytokine action, modulation of chemokine activity, modulation of apoptosis, and manipulation of humoral immunity (Mahalingam et ah, 2002). The current work used field ISAV isolates that have uncontrolled variations in the virulence factors. Further characterization of immune response antagonizing virulence factors of ISAV requires use of recombinant viruses generated by reverse genetics tools that enable to vary the ISAV virulence factors one at a time without changing the other viral proteins. Further study on molecular characterization of the antiviral activity of genes identified in this study is required. Appendix I Supplementary table 6.1. QRT-PCR primer sequences, efficiency and annealing temperature. 215 Supplementary Table 6.2a-6.2d. Reproducibly informative genes dysregulated in TO cells at 24 hr post-infection with the two ISAV isolates. Supplementary Table 6.3a-6.3h. Microarray-identified genes that were greater than 2- fold dysregulated in RPC/NB-04-085-1 and NBISA01 infected TO cells cells in any 3 out of 4 technical replicate microarrays (including at least 1 dye swap). Supplementary Table 6.4. Ct values, ISAV copy equivalents/ng of total RNA, and virus titer of NBISA01, and RPC/NB-04-085-1 infected TO cells. 216 6.6. REFERENCES Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res 1997;25:3389-3402. Biacchesi S, Le Berre M, Benmansour A, Bremont M, Quillet E, Boudinot P. Fish genotype significantly influences susceptibility of juvenile rainbow trout, Oncorhynchus mykiss (Walbaum), to waterborne infection with infectious salmon anaemia virus. J Fish Dis 2007;30:631-636. Boudinot P, Massin P, Blanco M, Riffault S, Benmansour A. vig-1, a new fish gene induced by the rhabdovirus glycoprotein, has a virus-induced homologue in humans and shares conserved motifs with the MoaA family. J Virol 1999;73:1846-1852. Borden KL, Lally JM, Martin SR, O'Reilly NJ, Etkin LD, Freemont PS. Novel topology of a zinc-binding domain from a protein involved in regulating early Xenopus development. EMBO J 1995;14:5947-5956. Brass AL, Dykxhoorn DM, Benita Y, Yan N, Engelman A, Xavier RJ, Lieberman J, Elledge SJ. Identification of host proteins required for HIV infection through a functional genomic screen. Science 2008;319:921-926. Brazma A, Hingamp P, Quackenbush J, Sherlock G, Spellman P, Stoeckert C, Aach J, Ansorge W, Ball CA, Causton HC, Gaasterland T, Glenisson P, Holstege FCP, Kim IF, Markowitz V, Matese JC, Parkinson H, Robinson A, Sarkans U, Schulze-Kremer S, Stewart J, Taylor R, Vilo J, Vingrcn M. Minimum information about a microarray experiment (MIAME) - toward standards for microarray data. Nat Genet 2001;29:365- 371. Chin KC, Cresswell P. Viperin (cig5), an IFN-inducible antiviral protein directly induced by human cytomegalovirus. Proc Natl Acad Sci, USA 2001;98:15125-15130. 217 Craven RA, Stanley AJ, Hanrahan,S, Totty N, Jackson DP, Popescu R, Taylor A, Frey J, Selby PJ, Patel PM, Banks RE. Identification of proteins regulated by interferon-a in resistant and sensitive malignant melanoma cell lines. Proteomics 2004;4:3998-4009. Dannevig BH, Falk K, Namork E. Isolation of the causal virus of infectious salmon anaemia virus (ISA) in a long-term cell line from Atlantic salmon head kidney. J Gen Virol 1995;76:1353-1359. de Veer MJ, Sim H, Whisstock JC, Devenish RJ, Ralph SJ. IFI60/ISG60/IFIT4, a new member of the human IFI54/IFIT2 family of interferon-stimulated genes. Genomics 1998;54:267-277. Demoulins T, Baron ML, Kettaf N, Abdallah A, Sharif-Askari E, Sekaly RP. Poly(LC) induced immune response in lymphoid tissues involves three sequential waves of type I IFN expression. Virology 2009;386:225-236. Everett RD, Chelbi-Alix MK. PML and PML nuclear bodies: Implications in antiviral defence. Biochimie 2007;89:819-830. Francklyn C, Perona JJ, Puetz J, FIou Y-M. Aminoacyl-tRNA synthetases: Versatile players in the changing theater of translation. RNA 2002;8:1363-1372. Fujiki K, Shin DH, Nakao M, Yano T. Molecular cloning and expression anal ysis of the putative carp (Cyprinus carpio) pre-B cell enhancing factor. Fish Shellfish Immunol 2000;10: 383-385. Gack MU, Shin YC, Joo CH, Urario T, Liang C, Sun L, Takeuchi O, Akira S, Chen Z, Inoue S, Jung JU. TRIM25 RING-finger E3 ubiquitin ligase is essential for RIG-I- mediated antiviral activity. Nature 2007;446:916-920. 218 Guo J, Peters KL, Sen GC. Induction of the human protein P56 by interferon, double- stranded RNA, or virus infection. Virology 2006;267:209-219. Haller O, Kochs G, Weber F. The interferon response circuit: induction and suppression by pathogenic viruses. Virology 2006;344:119-130. Hagmaier K, Jennings S, Buse J, Weber F, Kochs G. Novel gene product of Thogoto virus segment 6 codes for an interferon antagonist. J Virol 2003;77:2747-52. Hayman A, Comely S, Lackenby A, Murphy S, McCauley J, Goodbourn S, Barclay W. Variation in the ability of human influenza A viruses to induce and inhibit the IFN-p pathway. Virology 2006;347:52-64. Janeway CA, Medzhitov R. Innate immune recognition. Annu Rev Immunol 2002;20:197-216. Janeway CA, Travers P, Walport M, Shlomchik MJ. Immunobiology: the immune system in health and disease, 6th edition, 2005; Garland Press, New York and London. Jensen I, Robertsen B. Effect of double-stranded RNA and interferon on the antiviral activity of Atlantic salmon cells against infectious salmon anaemia virus and infectious pancreatic necrosis virus. Fish Shellfish Immunol 2002;13:221-241. J0rgensen SM, Afanasyev S, Krasnov A. Gene expression analyses in Atlantic salmon challenged with infectious salmon anemia virus reveal differences between individuals with early, intermediate and late mortality. BMC Genomics 2008;9:179. J0rgensen SM, Hetland DL, Press CM, Grimholt U, GJ0en T. Effect of early infectious salmon anaemia virus (ISAV) infection on expression of MHC pathway genes and type I and II interferon in Atlantic salmon (Salmo salar L.) tissues. Fish Shellfish immunol 2007;23:576-588. 219 Katze MG, Fornek JL, Palermo RE, Walters KA, Korth MJ. Innate immune modulation by RNA viruses: emerging insights from functional genomics. Nat Rev Immunol 2008;8:644-654. Kibenge FS, Garate ON, Johnson G, Arriagada R, Kibenge MJ, Wadowska D. Isolation and identification of infectious salmon anaemia virus (ISAV) from Coho salmon in Chile. Dis Aquat Org 2001;45:9-18. Kibenge FSB, Kibenge MJT, Groman D, McGeachy S. In vivo correlates of infectious salmon anemia virus pathogenesis in fish. J Gen Virol 2006;87:2645-2652. Kibenge FSB, Kibenge MJT, Wang Y, Qian B, Hariharan S, McGeachy S. Mapping of putative virulence motifs on infectious salmon anaemia virus surface glycoprotein genes. J Gen Virol 2007; 88:3100-3111. Kileng 0, Brundtland MI, Robertsen B. Infectious salmon anemia virus is a powerful inducer of key genes of the type I interferon system of Atlantic salmon, but is not inhibited by interferon. Fish Shellfish Immunol 2007;23:378-389. Kochs G, Garcia-Sastre A, Martinez-Sobrido L. Multiple anti-interferon actions of the influenza A virus NS1 protein. J Virol 2007;81:7011-7021. Koh W, Ng M. Molecular mechanisms of West Nile virus pathogenesis in brain cells. Emerg Infect Dis 2005; 11, 4. Larsen R, Rokenes TP, Robertsen B. Inhibition of infectious pancreatic necrosis virus replication by Atlantic salmon Mxl protein, J Virol 2004;78:7938-7944. Liu Y, Perminger J, Karin M. Immunity by ubiquitylation: a reversible process of modification. Nat Rev Immunol 2005;5:941-952. 220 Luk T, Malam Z, Marshall JC. Pre-B cell colony-enhancing factor (PBEF)/visfatin: a novel mediator of innate immunity. J Leuk Biol 2008;83:804-816. Mahalingam S, Meanger J, Foster PS, Lidbury BA. The viral manipulation of the host cellular and immune environments to enhance propagation and survival: a focus on RNA viruses. J Leuk Biol 2002;72:429-439. Malakhov MP, Malakhova OA, Kim KI, Ritchie KJ, Zhang DE. UBP43 (USP18) specifically removes ISG15 from conjugated proteins. J Biol Chem 2002;277: 9976- 9981. Martin PR, Shea RJ, Mulks MH. Identification of a plasmid-encoded gene from Haemophilus ducreyi which confers NAD independence. J Bacteriol 2001 ;183:1168- 1174. Martinis SA, Plateau P, Cavarelli J, Florentz C. Aminoacyl-tRNA synthetases: a family of expanding functions. EMBO J 1999;18:4591-4596. Matsuno T, Shirasawa N, Kohno S. Interferon suppresses glutamine synthetase induction in chick embryonic neural retina. Biochern Biophys Res Com 1976;70:310-314. McBeath AJ, Snow M, Secombes CJ, Ellis AE, Collet B. Expression kinetics of interferon and interferon-induced genes in Atlantic salmon (Salmo salar) following infection with infectious pancreatic necrosis virus and infectious salmon anaemia virus. Fish Shellfish Immunol 2007;22:230-241. McGlothlin JR, Gao L, Lavoie T, Simon BA, Easley RB, Ma SF, Rumala BB, Garcia JG, Ye SQ. Molecular cloning and characterization of canine pre-B-cell colony-enhancing factor. Biochern Genet 2005;43:127-141. 221 Mjaaland S, Markussen T, Sindre H, KJ0glum S, Dannevig BH, Larsen S, Grimholt U. Susceptibility and immune responses following experimental infection of MHC compatible Atlantic salmon (Salmo solar L.) with different infectious salmon anaemia virus isolates. Arch Virol 2005;150:2195-2216. Nolan T, Hands RE, Bustin SA. Quantification of mRNA using real-time RT-PCR. Nat Protoc 2006;1:1559-1582 Park SG, Schimmel P, Kim S. Aminoacyl tRNA synthetases and their connections to disease. ProcNatl Acad Sci, USA, 2004; 105:11043-11049. Pfaffl MW. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res 2001;29,9e45. Preston CM, Harman AN, Nicholl MJ. Activation of interferon response factor 3 in human cells infected with herpes simplex virus type 1 or human cytomegalovirus. J Virol 2001;75:8909-8916. Randall RE, Goodbourn S. Interferons and viruses: an interplay between induction, signalling, antiviral responses and virus countermeasures. J Gen Virol 2008; 89:1-47. Reymond A, Meroni G, Fantozzi A, Merla G, Cairo S, Luzi L, Riganelli D, Zanaria E, Messali S, Cainarca S, Guffanti A, Minucci S, Pelicci PG, Ballabio A. The tripartite motif family identifies cell compartments. EMBO J 2001;20:2140-2151. Rise ML, Hall J, Rise M, Hori T, Gamperl AK, Kimball J, Hubert S, Bowman S, Johnson SC. Functional genomic analysis of the response of Atlantic cod (Gadus morhua) spleen to the viral mimic polyriboinosinic polyribocytidylic acid (pIC). Dev Comp Immunol 2008;32:916-931. Ritchie KJ, Zhang DE. ISG15: the immunological kin of ubiquitin. Semin Cell Dev Biol 2004; 15:237-246. 222 Robertsen B. Expression of interferon and interferon-induced genes in salmonids in response to virus infection, interferon-inducing compounds and vaccination. Fish Shellfish Immunol 2008;25:351-357. Sadler AJ, Williams BRG. Interferon-inducible antiviral effectors. Nat Rev Immunol 2008;8: 559-568. Sardiello M, Cairo S, Fontanella B, Ballabio A, Meroni G. Genomic analysis of the TRIM family reveals two groups of genes with distinct evolutionary properties. BMC EvolBiol2008;8:225. Schi0tz BL, J0rgensen SM, Rexroad C, Gj0en T, Krasnov A. Transcriptomic analysis of responses to infectious salmon anemia virus infection in macrophage-like cells. Virus Res 2008;136:65-74. Schneider RJ, Mohr I. Translation initiation and viral tricks. Trends Biochem Sci 2003;28,3. Smith JB, Herschman HR. The glucocorticoid attenuated response genes GARG-16, GARG-39, and GARG-49/IRG2 encode inducible proteins containing multiple tetratricopeptide repeat domains. Arch Biochem Biophys 1996;330:290-300. Terenzi F, Pal S, Se GC. Induction and mode of action of the viral stress-inducible murine proteins, P56 and P54. Virology 2005;340:116-124. Towers GJ. The control of viral infection by tripartite motif proteins and cyclophilin A. Retrovirology 2007;12;4,40. van der Aa LM, Levraud JP, Yahmi M, Lauret E, Briolat V, Herbomel P, Benmansour A, Boudinot PA. A large new subset of TRIM genes highly diversified by duplication and positive selection in teleost fish. BMC Biol Feb 2009;5:7. 223 von Schalburg KR, Rise ML, Cooper GA, Brown GD, Gibbs RA, Nelson CC, Davidson WS, Koop BF. Fish and chips: various methodologies demonstrate utility of a 16,006- gene salmonid microarray. BMC Genomics 2005;6:126-144. Wang X, Hinson ER, Cresswell P. The interferon-inducible protein viperin inhibits influenza virus release by perturbing lipid rafts. Cell Host Microbe 2007;2:96-105. Wang B, Li F, Dong B, Zhang X, Zhang C, Xiang J. Discovery of the genes in response to white spot syndrome virus (WSSV) infection in Fenneropenaeus chinensis through cDNA microarray. Mar Biotechnol 2006;8:491-500. Watford M. Glutamine and glutamate metabolism across the liver sinusoid. J Nutr 2000;130:983-987. Welchman RL, Gordon C, Mayer R.T. Ubiquitin and ubiquitin-like proteins as multifunctional signals. Nat Rev Mol Cell Biol 2005;6:599-609. Wergeland HI, Jakobsen RA.. A salmonid cell line (TO) for the production of infectious salmon anaemia virus (ISAV). Dis Aquat Org 2001;44:183-190. Zhang YB, Gui JF. Identification of two novel interferon-stimulated genes from cultured CAB cells induced by UV-inactivated grass carp hemorrhage virus. Dis Aquat Org 2004; 60:1-9. Zhao C, Denison C, Huibregtse JM; Gygi S, Krug RM. Human ISG15 conjugation targets both IFN-induced and constitutively expressed proteins functioning in diverse cellular pathways, Proc Natl Acad Sci, USA 2005;102:10200-10205. Zheng H, Lee HA, Palese P, Garcia-Sastre A. Influenza A virus RNA polymerase has the ability to stutter at the polyadenylation site of a viral RNA template during RNA replication. J Virol 1999;73:5240-5243. 224 Zou W, Zhang DE. The interferon-inducible ubiquitin-protein isopeptide ligase (E3) EFP also functions as an ISG15 E3 ligase. J Biol Chem 2006;281:3989-3994. 7. GENERAL DISCUSSION 7.1. General Discussion and Conclusions Infectious salmon anaemia is a disease threat to the production of Atlantic salmon by contributing to significant economic losses of farmed Atlantic salmon. The disease is highly fatal killing Atlantic salmon within few days of exposure and shows rapid dissemination within farmed populations. Despite the implementation of specialized control and prevention measures the disease continues to be a challenge. Improvement of control and prevention regimes relies on the development of robust diagnostic tools, and detailed understanding of the complex molecular pathogenesis of ISA disease, and potential ISAV virulence and host susceptibility factors that modulate the interaction of ISAV with the Atlantic salmon. ISAV isolates have been shown to possess differing pathogenicities for Atlantic salmon (Kibenge et al., 2006; Ritchie et al., 2009), suggesting that the presence of virus virulence factors may play a role in the pathogenesis of the disease. Moreover, the virulence motifs in the HE and F proteins of ISAV have been recently identified (Kibenge et al., 2007; Rimstad et al., 2007; Markussen et al., 2008). There is no information on the putative IFN antagonistic proteins as virulence factors of ISAV; however, in influenza virus, that shares similar physical and biochemical properties with ISAV, the NS1 protein is a virulence factor in part due to its ability to antagonize the IFN-a/p response during infection (Garcia-Sastre et al., 1998; 2001; Krug et al., 2003). Generating information on ISAV virulence factors demands the use of in vitro cell culture systems as well as in vivo challenge experiments. Although cell culture observations are not simulating the actual interaction between ISAV and Atlantic salmon 226 hosts, they are essential for gathering information on the primary effects of virus infection on cells by avoiding the complex players of the in vivo system. In this thesis project we developed an absolute quantification QRT-PCR strategy that relates Ct value to the median tissue culture and used m vitro systems in order to understand the interaction of ISAV with erythrocytes, as well as, to study the immune responses of Atlantic salmon cell lines (TO and CHSE-214) to infection with ISAV isolates of differing genotypes and pathogenicity phenotypes. Earlier studies carried out to test the diagnostic performance of different tests suggest QRT-PCR to be the most sensitive in virus detection (Snow et al, 2003). As a result different applications of the RT-PCR method (Mjaaland et al, 1997; Bouchard et al, 1999; Rimstad et al, 1999; Devoid et al, 2000; Kibenge et al, 2000; 2001; Mikalsen et al, 2001) have been described for ISAV diagnostics, including applications using QRT-PCR methods (Munir and Kibenge, 2004; Mjaaland et al, 2005; Snow et al, 2006). In this study we compared SYBR Green I (Munir and Kibenge, 2004) as well as TaqMan methods (Snow et al, 2006) of QRT-PCR for the absolute quantitation of ISAV RNA copy number equivalents using in vitro transcribed RNA and pDNA standards (Chapter 2). It was apparent that the TaqMan detection method is more reliable in the detection of ISAV copy numbers in RNA samples of ISAV infected TO cells when compared to the SYBR Green I detection method. In addition, we developed standard curves that relate ISAV Ct value to median infectious tissue culture dose (TCID50) for isolates of high and low pathogenicity. This method is recommended for determining the level of viral genome load in clinical samples, and is an essential tool for identifying clinical and subclinical infections. This method has two limitations. First, the two isolates used 227 showed different standard curves Jinking Ct value to TCID50. This finding suggests that the method can only be used for isolates with a known standard curve relating Ct value to TCID50 and therefore limits the direct use of the method on new field isolates with differing growth properties in cell' culture. Second, the method relies on the hypothesis that ISAV RNA copy number in infected tissue or cells is linked to TCID50. The QRT- PCR method used detects different populations of ISAV RNA that include negative sense and positive sense viral genomic RNA, as well as, viral mRNA. As a result, it is very difficult to correlate the Ct values to the level of infectious virus. A better strategy would be to design negative strand specific QRT-PCR method that can be used to correlate the TCID50 with the ISAV genomic negative sense RNA level and infectious virus. This strategy would; however, fail to provide information on the ISAV replication transcript (mRNA) levels in infected cells and fish. A recent introduction of in vitro transcribed positive control RNA in the TaqMan detection method has been suggested to enhance the diagnostic capacity of the method (Snow et al., 2009). This positive control can be identified by the use of two fluorophore detectors that detect two probes labelled differently (one targeting ISAV specific sequence and another detecting a known introduced artificial sequence). This protocol allows the positive control RNA transcripts to be distinguished from true clinical positive material, thus facilitates easy tracking of contamination of clinical samples by the positive control. The positive control can be dually used as absolute quantitation standard by employing a known copy number of in vitro transcribed RNA preparations to construct an absolute quantitation standard curve. This curve can be used as an external standard curve by importing it into reactions that have been run along with low dilutions 228 of the external standard curve. The use of a low template dilution of the positive control is essential to satisfy the recommendation of Snow et al. (2009) that the use of a low template positive control with Ct value around 30 would minimize possible contamination of diagnostic samples. This strategy allows the positive control to be used for controlling the diagnostic efficiency of the PCR reaction, and estimating ISAV RNA copy numbers in unknown samples. Members of the family Adenoviridae, Orthomyxoviridae and Paramyxoviridae, among other families contain viral surface proteins that can bind to erythrocyte receptors resulting in the formation of a diffuse lattice that coats the well surface of a haemagglutination plate. In the absence of adequate virus particles to agglutinate erythrocytes, the cells will settle in the center of the well to form a button-like shape. This method is typically used for estimation of virus particles in a virus suspension (Flint et al, 2004). ISAV haemagglutination takes place as a result of the interaction of the viral haemagglutinin protein and the erythrocyte sialic acid receptors. ISAV has been shown to agglutinate erythrocytes of several fish species, but not of brown trout (Falk et al., 1997). Studies using influenza virus showed that haemagglutination of avian erythrocytes subsequently leads to pinocytosis of virus particles in a non-virus strain specific way (Bossart et al., 1973). Orthomyxoviruses require nuclear replication phase to complete their infection cycle (Nagata et al., 2008). Unlike chicken and fish erythrocytes mammalian erythrocytes are devoid of nucleus and thus would not be expected to support the replication of orthomyxovirus (Follett et al., 1974). Cook et al. (1979) showed the first account of de novo fowl plague infection and synthesis of viral components in chicken erythrocytes, but failed to recover progeny infectious virus. In the same study, 229 other cytoplasmic replicating enveloped viruses (NDV and SFV) were able to both infect erythrocytes and produce infectious virus suggesting that the erythrocytes are able to support the assembly of virions. In this study we used fish erythrocytes and showed ISAV genome transcription, and progeny virus production. The significance of haemagglutination-infection induced by the fowl plague strain of influenza virus in the pathogenesis of the disease process is not known (Cook et al, 1979). We hypothesize that haemagglutination infection induced by ISAV can be associated with the pathogenesis of the clinical ISA disease for Atlantic salmon erythrocytes, as our observation of ISAV endocytosis and replication are virus strain specific. We noted that the pathogenic isolate (NBISA01) was persistently attached to erythrocytes at initial sampling points during haemagglutination and this possibly favored receptor mediated endocytosis and full cycle of virus replication (Chapter 3 and 4). Whereas, the less pathogenic isolate (NB-04-085-1) was initially observed bound to erythrocytes but later dissolved the haemagglutination and failed to replicate within erythrocytes (Chapter 3 and 4). The differences in the endocytosis and virus replication properties between these isolates might be due to the differences in the number of amino acid deletions in the stem region of the HE protein (HPR) which may affect the binding of the haemagglutinin protein to its receptor and/or the activity of the RDE. To date it is not clear how the deletions in the HPR affect the haemagglutinin protein or the RDE. Clinical ISA disease is associated with anaemia (Evensen et al, 1991), which is due to hemorrhages and leakage arising from endothelial cell damage (Hovland et al., 1994; Jones et al, 1999; Rimstad et al, 1999; Moneke et al, 2005). During clinical disease it is possible for erythrocytes to be coated with ISAV (as it occurs in 230 haemagglutination) and a consequent uptake of virus-coated erythrocytes by immune cells may contribute to the minor anaemia during the initial stages of the disease (Dale and Falk, 2006). In a different scenario, we hypothesized that the endocytosed ISAV replicating in Atlantic salmon erythrocytes directly cause erythrocyte death contributing to the anaemia. To investigate if ISAV replication in erythrocytes can cause cell death, trypan blue dye exclusion and MTT assays were utilized. Neither of these methods provided the required information of erythrocyte death. Due to the limitation of both assays to measure erythrocyte viability we could not link ISAV replication to erythrocyte viability. Another important observation linked to haemagglutination-induced infection of fish erythrocytes is the capacity of erythrocytes to induce the expression of key type I IFN system genes of Atlantic salmon (Chapter 4). In the presence of UV inactivated Sendai virus nucleated chick erythrocytes can be fused with several types of human cells to form heterokaryons. Although chick erythrocytes alone cannot be stimulated by Sendai virus to produce interferon, fusion with a human cell results in heterokaryons in which the erythrocyte genome is activated and chick interferon is produced (Guggenheim et ah, 1968). The current observation of type I IFN system induction in Atlantic salmon erythrocytes infected with ISAV suggests that fish erythrocytes are transcriptionally active and immunologically competent to respond to a replicating virus. At a transcriptional level the induction of IFN-a was higher in the replicating highly pathogenic isolate compared to either the lowly pathogenic isolate, inactivated virus and even the dsRNA mimic polyLC. This observation suggests the lack of efficient membrane transport system and/or extracellular sensors of viral associated molecular 231 patterns to respond to the dsRNA viral mimic. In this regard it would be useful to determine if the innate immune response is triggered by pathogen recognition receptors which sense viral nucleic acids in erythrocytes. Identification in fish erythrocytes of an immune function, would be a unique observation. Support for this hypothesis has been shown in rainbow trout erythrocytes which can engulf Candida albicans without exerting any killing activity and subsequently interact with monocyte-macrophages which phagocytize the Candida albicans particles released by fish erythrocytes (Passantino et ah, 2002; 2004; 2007). In addition, it was determined that fish erythrocytes stimulated with Candida albicans were able to release cytokine like factors endowed with migration inhibitory factor and IFN-y-like activities leading Passantino et al. (2002; 2004) to consider fish erythrocytes as ancient antigen presenting cells. A similar observation was reported in avian erythrocytes (Passantino et al., 2007). The immune response against virus infections involves both the innate and adaptive components. The adaptive response is essential for recognition of viral antigens for mounting of antiviral responses via production of antibodies or through presentation of viral antigens for destruction of virus infected cells by cytotoxic lymphocytes. Whereas the innate immune system guards the host primarily from invasion first by protecting entry of viruses via membranes and once the virus is inside the host utilizes diverse germ-line encoded pattern recognition receptors to sense the pathogen associated molecular markers for induction of downstream antiviral action of innate as well as adaptive type (Janeway et al., 2005). Antiviral innate immune response, as well as, the mechanisms by which different viruses can evade the host response has been intensively studied. One of the potent innate antiviral defenses of vertebrates against viruses is the 232 type I IFN system (Issac and Lindemann, 1957; Samuel, 2001). IFNs provide fundamental cellular defense mechanisms against viral infections and are critically important for the health of animals and humans. The effect of IFNs is diverse ranging from their involvement in the innate immune response by inducing the transcription of several antiviral effector proteins to their ability to modulate the adaptive immune response. In the adaptive immune response IFNs play a role in the generation of primary antibody response, differentiation of Thl subset, modulation of the antigen processing through MHC pathway, accumulation of leukocytes at the site of pathogen invasion and activation of dendritic cells (Bracci et al., 2008). Due to the diverse antiviral roles and clinical effectiveness for limiting virus replication, IFNs have been licensed for the treatment of several viral diseases (Borden et al., 2007). The studies offish innate immune system suggest that the major players are similar to mammals (Robertsen, 2008). In the past few years studies of the innate immune response of fish against virus infections have provided valuable preliminary characterization and identification of type I IFN system genes in various species offish (Robertsen, 2006; 2008). In Atlantic salmon the key genes of the type I IFN system have been identified and their expression studied in response to viral mimics and ISAV infection (Robertsen, 2008). Functional antiviral studies on the type I IFN system genes have also shown the in vitro protection of cells from IPNV infection upon constitutive expression of Atlantic salmon Mxl protein (Larsen et al., 2004). Previous studies were valuable in providing immense immunological information, although they have not answered the question of the effect of ISAV strain variation on the inducibility of immune relevant genes of Atlantic salmon. The present research studied the mechanism of regulation of the immune system 233 genes in general, as well as, the type IIFN system genes using ISAV isolates of differing pathogenicity phenotypes and genotypes. The intent of the study was to characterize the initial events of virus host interaction to understand the immunology and pathogenesis of virus infection that is essential for design of effective antiviral drugs. Initially the expression of key type I IFN system genes in TO and CHSE-214 cells was studied upon poly I:C stimulation and infection with a highly pathogenic (NBISA01) and lowly pathogenic ISAV (RPC/NB-04-085-1) isolates. The two isolates showed remarkable differences in their capacity to induce the expression of IFN-a, Mx, ISG15, and STAT1 (Chapter 5). This work was expanded by investigating the transcriptome responses of Atlantic salmon TO cells in response to the two ISAV isolates. A further study was carried out to investigate the expression of selected microarray dysregulated immune relevant genes in response to four ISAV isolates and UV inactivated preparation. One highly pathogenic and one lowly pathogenic isolate both belonging to European genotype showed a very high to moderate induction of the immune responsive genes, whereas, one highly pathogenic and one lowly pathogenic North American genotypes showed very low induction to down regulation of genes highly up-regulated by the other isolates (Chapter 6). Similar studies carried out on influenza virus show that different isolates show variations in their ability to induce the IFN-|3 pathway that is strain specific (Hayman et ah, 2006). The UV inactivated virus showed very low up-regulation of immune responsive genes suggesting that ISAV replication is a requirement for detection of viral associated molecular patterns and mounting of antiviral response. The microarray data identified several novel immune responsive genes that were validated by QRT-PCR and thoroughly studied for their time series expression. The 234 expression study shows that several immune responsive genes such as TRIM proteins, viperin, several genes involved in ISGylation and delSGylation were up-regulated in response to two virus isolates. In mammalian systems protein ubiquitination in general and ISGylation in particular modulate innate immune response pathways. The current observation of enhanced ISGylation and delSGylation in response to ISAV infection shows the important role of ISGylation and delSGylation process in the fish innate immune response. Despite the significant progress in cloning and functional characterization of the type I IFN system genes of Atlantic salmon (Robertsen, 2008), there needs to be continued study on identification of host virus sensors and downstream signaling partners. UV inactivated GCHV infected CAB cell system was reported to be an effective system for identification of antiviral genes (Zhang and Gui, 2004). Atlantic salmon lacks in vitro ISAV infection model for the study of virus induced genes, and most of the study utilizes dsRNA mimic poly I:C. This work shows that the induction pattern of RPC/NB- 04-085-1 at a TCID50 of 105 is very similar to poly I:C induced activation of the IFN system of Atlantic salmon. Based on the induction pattern of several immune response genes by microarray and QRT-PCR, the RPC/NB-04-085-1 isolate is suggested as a suitable in vitro model for study of Atlantic salmon antiviral genes. ISAV replicates in the presence of a potent type I IFN system of Atlantic salmon and that suggests the involvement of virus-induced evasion of the host responses. ISAV segment 7 ORF1 is identified as having type I IFN system antagonizing properties (Chapter 5 of this thesis; McBeath et al, 2006; Garcia-Rosado et al., 2008) although the detailed mechanism of evasion has not been elucidated yet. Attempts to use chemically 235 synthesized siRNAs for silencing of the ISAV segment 7 ORF1 protein and evaluate the innate immune response and also the replication potential of the virus were unsuccessful. In conclusion this study has developed an absolute quantitation method that can be used for quantitation of ISAV copy number equivalents in unknown clinical samples and allows estimation of median tissue culture infectious dose from Ct value data. Additionally, virus strain specific fish orthomyxovirus endocytosis, replication and induction of immune response against the replicating virus in Atlantic salmon erythrocytes were demonstrated. This study also showed that ISAV isolates mount differing levels of key type I IFN system gene expression and ISAV segment 7 ORF1 is an IFN antagonistic protein. Last but not least, microarray analysis was used to identify ISAV replication induced novel antiviral genes. More importantly the expression study of selected immune response genes showed that the different ISAV isolates induce the innate immune response genes quite differently in strain specific manner. 7.2. Future directions This PhD research project looked into molecular aspects of ISAV interaction with the innate immune system of Atlantic salmon erythrocytes, and cell lines TO and CHSE- 214. The research has answered some questions and generated more biological questions on the interaction of ISAV and Atlantic salmon. This study showed that unlike the lowly pathogenic isolate (RPC/NB-04-085-1) the highly pathogenic ISAV isolate (NBISA01) showed virus endocytosis, replication and significant induction of IFN-a. The question of how the differences in the number of amino acid deletions in the HPR between the two isolates affect the receptor binding and esterase activity of the HE protein requires further 236 study using the three dimensional (3D) structure of ISAV HE protein and its interaction with its receptor for a better•«. understanding of receptor binding properties of haemagglutinin protein and the receptor destroying activity of the esterase protein. Resolving the 3D structure of HE. can utilize a functionally active purified HE protein recently produced using a, baculovirus expression system (Muller et al., 2008). Performing the above study using, ISAV isolates of differing amino acid deletions in the HPR will certainly identify which portion of the HE protein is affected by the amino acid deletions in the HPR. Further studies also require the use of reverse genetics tools to generate recombinant ISAV with differing deletions in the HPR that can be used to reveal how the number of amino acid deletions in the HPR affects endocytosis and replication of ISAV isolates. Reverse genetics is critically essential in addressing ISAV virulence factors by varying only one of the ISAV virulence factor while keeping the other factors similar. This is lacking from studies utilizing field isolates with different combinations of the virulence factors in a single virion. The above studies should be done both in vivo and in vitro to generate information on the relevance of ISAV replication in erythrocyte viability and its relation with the anaemia in clinical disease. Similar information is essential to understand the possible clinical implication of ISAV replication in erythrocytes and its link to the pathogenesis of ISA disease. It has been shown that ISAV evades the host response by unknown mechanisms. As a result future studies should attempt to gather information on the mechanism of evasion of the immune system of Atlantic salmon by ISAV encoded protein(s). Similar studies can utilize protein-protein interaction assays such as yeast two-hybrid system to screen cDNA library of Atlantic salmon to identify novel interaction partners of ISAV 237 suspected antagonistic proteins. Moreover, the power of reverse genetics system can be used to generate recombinant ISAV with inactivating mutations on the suspected type I IFN system antagonistic proteins. This is essential in understanding which protein(s) of ISAV antagonize the immune response and at what level of the type I IFN system signaling that ISAV antagonizes the host response. Similar studies are required for the development of effective antiviral drugs. Apparently this is critical in ISAV because currently used inactivated ISAV vaccines do not provide full protection against ISA disease. Along with this line the potential role of IFNs to modulate the adaptive immune response can be used to enhance the efficacy of the current vaccination regimens. As a matter of fact, type I IFNs have been recently advocated for their adjuvant activity and several clinical and preclinical studies are investigating the role of IFNs to enhance the efficacy of viral vaccines (Tovey et ah, 2006). Investigation of the transcriptome responses of ISAV infected cells have showed dysregulation of several genes that have high similarity to mammalian immune responsive proteins, and other unknown transcripts that do not have significant similarity to known genes of mammals. Further study on the molecular characterization and antiviral activity of those genes is required. 238 7.3. REFERENCES Borden EC, Sen GC, Uze G, Silverman RH, Ransohoff RM, Foster GR, Stark GR. Interferons at age 50: past, current and future impact on biomedicine. Nat Rev Drug Discov 2007;6:975-990. Bossart W, Meyer J, Bienz K. Electron microscopic study on influenza virus hemagglutination: pinocytosis of virions by red cells. Virology 1973;55:295-298. Bouchard DA, Keleher W, Optiz HM, Blake S, Edwards KC, Nicholson BL. Isolation of infectious salmon anaemia virus from Atlantic salmon in New Brunswick, Canada. Dis AquatOrg 1999;35:131-137. Bracci L, La Sorsa V, Belardelli F, Proietti E. Type I interferons as vaccine adjuvants against infectious diseases and cancer. Expert Rev Vaccines 2008;7:373-381. Cook RF, Avery J, Dimmock NJ. Infection of chicken erythrocytes with influenza and other viruses. Infect Immunol 1979;25:396-402. Dale OB, Falk K, Kvellestad A. An overview of Infectious Salmon Anemia pathology and suggested pathogenesis. Abstr Fifth International Symposium on Aquatic Animal Health, California USA, 2006. Devoid M, Kross0y B, Aspehaug V, Nylund A. Use of RT-PCR for diagnosis of infectious salmon anaemia virus (ISAV) in carrier sea trout Salmo trutta after experimental infection. Dis Aquat Org 2000;40:9-18. Evensen O, Thorud KE, Olsen YA. A morphological study of the gross and light microscopic lesion of infectious salmon anemia in Atlantic salmon {Salmo salar L.). Res VetSci 1991;51:215-222. 239 Falk K, Namork E, Rimstad E, Mjaaland S, Dannevig BH. Characterization of infectious salmon anemia virus, an orthomyxo-like virus isolated from Atlantic salmon (Salmo salar L.). J Virol 1997;71:9016-9023. Flint SJ, Enquist LW, Krug RM, Racaniello VR, Skalka AM. Principles of Virology: Molecular biology, pathogenesis, and control of animal viruses. ASM Press, Washington, DC, 2004. Follett EAC, Pringle CR, Wunner WH, Skehel JJ. Virus replication in enucleate cells: vesicular stomatitis virus and influenza virus. J Virol 1974;13:394-399. Garcia-Rosado E, Markussen T, Kileng 0, Baekkevold ES, Robertsen B, Mjaaland S, Rimstad E. Molecular and functional characterization of two infectious salmon anaemia virus (ISAV) proteins with type I interferon antagonizing activity. Virus Res 2008;133:228-238. Garcia-Sastre A. Inhibition of interferon-mediated antiviral responses by influenza A viruses and other negative-strand RNA viruses. Virology 2001;279:375-384. Garcia-Sastre A, Egorov A, Matassov D, Brandt S, Levy DE, Durbin JE, Palese P, Muster T. Influenza A virus lacking the NS1 gene replicates in interferon-deficient systems. Virology 1998;252:324-330. Guggenheim MA, Friedman RM, Rabson AS. Interferon: production by chick erythrocytes activated by cell fusion. Science 1968;159:542-543. Hagmaier K, Jennings S, Buse J. Weber F, Kochs G. Novel gene product of Thogoto virus segment 6 codes for an interferon antagonist. J Virol 2003;77:2747-2752. Hayman A, Comely S, Lackenby A, Murphy S, McCauley J, Goodbourn S, Barclay W. Variation in the ability of human influenza A viruses to induce and inhibit the IFN-J3 240 pathway. Virology 2006;347:52-64. Hovland T, Nylund A, Watanabe K, Endresen C. Observations of infectious salmon anaemia virus in Atlantic salmon, Salmo salar L. J Fish Dis 1994;17:291-296 . Issac A, Lindemann J. Virus Interference. Proc R Soc London Ser. B 1957;147:258-267. Janeway CA, Travers P, Walport M, Shlomchik MJ. Immunobiology: the immune system in health and disease, 6th edition Garland Press, New York and London, 2005. Jones SRM, MacKinnon AM, Groaian DB. Virulence and pathogenicity of infectious salmon anemia virus isolated from farmed salmon in Atlantic Canada. J Aquat Anim Health 1999;11:400-405. Kibenge FSB, Kibenge MJT, Groman D, McGeachy S. In vivo correlates of infectious salmon anemia virus pathogenesis in fish. J Gen Virol, 2006;87:2645-2652. Kibenge FSB, Lyaku JR, Rainnie D, Hammell KL. Growth of infectious salmon anaemia virus in CHSE-214 cells and evidence for phenotypic differences between virus strains. J Gen Virol 2000;81:143-150. Kibenge FSB, Garate ON, Johnson G, Arriagada R, Kibenge MJT, Wadowska D. Isolation and identification of infectious salmon anemia virus from Coho salmon in Chile. Dis Aquat Org 2001;45:9-18. Kibenge FSB, Kibenge MJT, Wang Y, Qian B, Hariharan S, McGeachy S. Mapping of putative virulence motifs on infectious salmon anaemia virus surface glycoprotein genes. J Gen Virol 2007;88:3100-3111. 241 Krug RM, Yuan W, Noah DL, Latham AG. Intracellular warfare between human influenza viruses and human cells: the roles of the viral NS1 protein. Virology 2003;309:181-189. '' * Larsen R, Rokenes TP, Robertseri B. Inhibition of infectious pancreatic necrosis virus replication by Atlantic salmon MxT protein. J Virol 2004;78:7938-7944. Markussen T, Jonassen CM, Numanovic S, Braaen S, Hjortaas M, Nilsen H, Mjaaland S. Evolutionary mechanisms involved in the virulence of infectious salmon anaemia virus (ISAV), a piscine orthomyxovirus. Virology 2008;374:515-527. McBeath AJ, Collet B, Paley R, Duraffour S, Aspehaug V, Biering E, Secombes CJ, Snow M.. Identification of an interferon antagonist protein encoded by segment 7 of infectious salmon anaemia virus. Virus Res 2006; 115:176-184. Mikalsen AB, Teig A, Helleman A-L, Mjaaland S, Rimstad E. Detection of infectious salmon anaemia virus (ISAV) by RT-PCR after cohabitant exposure in Atlantic salmon Salmo salar. Dis Aquat Org 2001;47:175-181. Mjaaland S, Rimstad E, Falk K, Dannevig BH. Genomic characterization of the virus causing infectious salmon anemia m Atlantic salmon (Salmo salar L.): an orthomyxo-like virus in a teleost. J Virol 1997;71:7681-7686. Mjaaland S, Markussen T, Sindre II, Kjoglum S, Dannevig BH, Larsen S. Grimholt U. Susceptibility and immune responses following experimental infection of MHC compatible Atlantic salmon {Salmo solar L.) with different infectious salmon anaemia virus isolates. Arch Virol 2005;150:2195-2216. Moneke E, Groman DB, Wright GM, Stryhn H, Johnson GR, Ikede BO, Kibenge FSB. Correlation of virus replication in tissues with histologic lesions in Atlantic salmon 242 experimentally infected with infectious salmon anemia virus.Vet Pathol 2005;42:338- 349. Miiller A, Solem ST, Karlsen CR, J0rgensen T0. Heterologous expression and purification of the infectious salmon anemia virus hemagglutinin esterase. Protein Expr Purif 2008;62:206-215. Munir K, Kibenge FS. Detection of infectious salmon anemia virus by real-time RT- PCR. J Virol Methods 2004;117:37-47. Nagata K, Kawaguchi A, Naito T. Host factors for replication and transcription of the influenza virus genome. Rev Med Virol 2008;18:247-260. Passantino L, Altamura M, Cianciotta A, Patruno R, Tafano A, Jirillo E, Passantino GF. Fish immunology. I. Binding and engulfment of Candida albicans by erythrocytes of rainbow trout (Salmo gairdneri Richardson). Immunopharmacol Immunotoxicol 2002; 24:665-678. Passantino L, Altamura M, Cianciotta A, Jirillo F, Ribaud MR, Jirillo E, Passantino GF. Maturation of fish erythrocytes coincides with changes in their morphology, enhanced ability to interact with Candida albicans and release of cytokine-like factors active upon autologous macrophages. Immunopharmacol Immunotoxicol 2004;26:573-585. Passantino L, Massaro MA, Jirillo F, Di Modugno D, Ribaud MR, Modugno GD, Passantino GF, Jirillo E. Antigenically activated avian erythrocytes release cytokine-like factors: a conserved phylogenetic function discovered in fish. Immunopharmacol Immunotoxicol 2007;29:141-152.- Rimstad E, Biering E, Brun E, Falk K, Kibenge F, Mjaaland S, Snow M Winton J. Which risk factors relating to spread of Infectious Salmon Anaemia (ISA) require development 243 of management strategies? Opinion of the Panel on Animal Health and Welfare of the Norwegian Scientific Committee for Food Safety 2007. Rimstad E, Falk K, Mikalsen AB; Teig A. Time course tissue distribution of infectious salmon anaemia virus in experimentally infected Atlantic salmon Salmo salar. Dis Aqua Org 1999;36:107-112. Ritchie RJ, McDonald JT, Glebe B, Young-Lai W, Johnsen E, Gagne N. Comparative virulence of infectious salmon anaemia virus isolates in Atlantic salmon, Salmo salar L. J Fish Dis 2009;32:157-171. Robertsen B. The interferon system of teleost fish. Fish Shellfish Immunol 2006;20:172- 191. Robertsen B. Expression of interferon and interferon-induced genes in salmonids in response to virus infection, interferon-inducing compounds and vaccination. Fish Shellfish Immunol 2008; 25:351-357. Samuel CE. Antiviral actions of interferons. Clin Microbiol Rev 2001;14:778-809. Snow M, McKay P, Matejusova I. Development of a widely applicable positive control strategy to support detection of infectious salmon anaemia virus (ISAV) using TaqMan real-time PCR. J Fish Dis 2009;32:151-156. Snow M, McKay P, McBeath AJ, Slack J, Doig F, Kerr R, Cunningham CO, Nylund A, Devoid M. Development, application and validation of a TaqMan real-time RT-PCR assay for the detection of infectious salmon anaemia virus (ISAV) in Atlantic salmon (Salmo salar). Dev Biol 2006;126:133-145. Snow M, Raynard RS, Murray AG, Bruno DW, King JA, Grant R, Bricknell IR, Bain N, Gregory A. An evaluation of current diagnostic tests for the detection of infectious 244 salmon anaemia virus (ISAV) following experimental water-borne infection of Atlantic salmon, Salmo salar L. J Fish Dis 2003;26:135-145. Tovey MG, Lallemand C, Meritet JF, Maury C. Adjuvant activity of interferon alpha: mechanism(s) of action. Vaccine 2006;24 Suppl 2:S46-S47. Zhang YB, Gui JF. Identification of two novel interferon-stimulated genes from cultured CAB cells induced by UV-inactivated grass carp hemorrhage virus. Dis Aquat Org 2004;60:1-9. Zheng H, Lee HA, Palese P, Garcia-Sastre A. Influenza A virus RNA polymerase has the ability to stutter at the polyadenylation site of a viral RNA template during RNA replication. J Virol 1999;73:5240-5243. 245 APPENDICES Appendix I Supplementary Table 4.1. Sequence and amplification efficiency of the QRT-PCR primers amplifying Atlantic salmon IFN, Mx, 18S, ISG15, STAT1 and PKZ genes .... 247 Supplementary Table 5.1. QRT-PCR primers used to quantify key type I IFN system genes and viral mRNA levels 248 Supplementary Table 5.2. Down-regulation of type I IFN system gene transcripts, and STAT1 in CHSE-214 cells infected withRPC/NB-04-085-1 isolate of ISAV 249 Supplementary Table 5.3. Down-regulation of ISAV transcripts in CHSE-214 cells infected with RPC/NB-04-085-1 isolate of IS AV 250 Supplementary Table 6.1. QRT-PCR primer sequences, efficiency and annealing temperature 251 Supplementary Table 6.2a-6.2d. Reproducibly informative genes dysregulated in TO cells at 24 hr post-infection with the two ISAV isolates 253 Supplementary Table 6.3a-6.3h. Microarray-identified genes that were greater than 2- fold dysregulated in RPC/NB-04-085-1 and NBISA01 infected TO cells cells in any 3 out of 4 technical replicate microarrays (including at least 1 dye swap) 263 Supplementary Table 6.4. Ct values, ISAV copy equivalents/ng of total RNA, and virus titer of NBISA01, and RPC/NB-04-085-1 infected TO cells 287 Supplementary Figure 2.1. Agarose gel electrophoresis picture of the QRT-PCR products of ISAV segment 8 288 Supplementary Figure 4.1. Agarose gel electrophoresis and melting curves of QRT-PCR of products of ISAV segment 8 using RNA from haemagglutination samples 289 246 Supplementary Table 4.1. Sequence and amplification efficiency of the QRT-PCR primers amplifying Atlantic salmon IFN, Mx, 18S, ISG15, STAT1 and PKZ genes Primer Primer sequence (5' to 3' sequence) Efficiency IFNa F-TGCAGTATGCAGAGCGTGTG 1.83 R-TCTCCTCCCATCTGGTCCAG Mx F-TGCAACCACAGAGGCTTTGAA 1.88 R-GGCTTGGTCAGGATGCCTAAT 18SrRNA F-TGTGCCGCTAGAGGTGAAATT 1.86 R-GCAAATGCTTTCGCTTTCG ISG15 F-CTGAAAAACGAAAAGGGCCA 1.83 R-GCAGGGACTCCCTCCTTGTT STAT1 F-TGTCTGTTGGCTCAGTTGCG 1.82 R-GAAATTGATGCTGTGGCGTCT PKZ F-AGATAGCGAAGGCTGTTGGA 1.913 R-TGGTTTGTCTGGTGTTGCAT Supplementary Table 5.1. QRT-PCR primers used to quantify key type IIFN system genes and viral mRNA levels Gene name Sequence (5' to 3') Efficiency PCR annealing Tm ISAV Segment 3 F- GAACAAGGGGTCTCMAAACA 1.948 59 R- TTGCCAGATGCTCATTTCAC ISAV Segment 7 F- TCACCAAAGTGTATGGTGTGC 1.903 58 ORF1 R- MAMTCCRGACATGTTYTGAA ISAV Segment 7 F- ACAAGGTAGCTTCTTTCCTGTCG 1.838 59 ORF1/2 R- TCTGTCRTAGAATCGTTGATTGA ISAV Segment 8 F- CCATGCATGAGAGAAGCAAA 1.972 59 R- TTCACCATTTTCCCTTCTGG IFN F- TGCAGTATGCAGAGCGTGTG 1.83 59 R- TCTCCTCCCATCTGGTCCAG Mx F- TGCAACCACAGAGGCTTTGAA 1.88 59 R- GGCTTGGTCAGGATGCCTAAT 18SrRNA F- TGTGCCGCTAGAGGTGAAATT 1.86 59 R- GCAAATGCTTTCGCTTTCG ISG15 F- CTGAAAAACGAAAAGGGCCA 1.83 59 R- GCAGGGACTCCCTCCTTGTT STAT1 F- TGTCTGTTGGCTCAGTTGCG 1.82 59 R- GAAATTGATGCTGTGGCGTCT PKZ F- AGATAGC.GAAGGCTGTTGGA 1.913 60 R- TGGTTTGTCTGGTGTTGCAT Chinook salmon F- AGTGTGACGTGGACATCCGTAA 1.939 59" beta-actin R- GAGGTGATCTCCTTCTGCATCCT 18SrRNA F- TGTGCCGCTAGAGGTGAAATT 1.86 56' R- GCAAATGCTTTCGCTTTCG The annealing temperatures used are for the EC480 Supplementary Table 5.2. Down-regulation of type IIFN system gene transcripts, and STAT1 in CHSE-214 cells infected with RPC/NB-04-085-1 isolate of ISAV. Sampling IFN ISG15 STAT1 PKR point DayO 1.00±0.00 1.00±0.00 1.00±0.00 1.00±0.00 Day 1 -3.99±1.84 -5.66+4.02 -2.04±1.03 -3.34±2.76 Day 2 -9.89±11.50 -410.09±508.40 -2.69±2.88 -3.24±1.66 Day 3 -3.24±2.21 - -14.86±12.64 -2.29±1.83 -5.33±1.55 Day 4 -8.31±3.53 -6.55±3.25 -1.89±1.41 -2.07±1.05 Day 5 -4.93±2.12 -9.30±3.07 -4.08±2.27 -16.40±6.63 Day 7 -18.43±14.84 -75.09±114.41 -8.4U6.91 -20.97±22.00 Day 10 -21.76±8.36 -23.98±14.29 -9.67±3.73 -11.23±4.20 Supplementary Table 5.3. Down-regulation of ISAV transcripts in CHSE-214 cells infected with RPC/NB-04-085-1 isolate of ISAV. Sampling Seg8 Seg7 Seg3 Seg7 point ORF1/2 ORF1 DayO 1.00±0.00 1.00±0.00 1.00±0.00 1.00±0.00 Day 1 -2.78±0.30 -1.2U0.04 -1.87±0.59 -2.96±0.55 Day 2 -4.22±0.64 -2.19±0.15 -5.61±2.07 -3.94±0.04 Day 3 -3.38±0.47 -1.94±0.22 •4.06±1.72 -4.71±1.42 Day 4 ^_6.19±0.74 -3.24±0.58 -6.53±1.98 -8.90tl.42 Day 5 -7.91±0.88 -3.49±0.22 -6.96±1.52 -9.76±0.46 Day 7 -9.87±0.73 -3.30±0.25 -11.20±2.13 -9.73±0.47 Day 10 -9.15±1.93 -4.10±0.92 -12.75±3.15 -10.04±1.29 Supplementary Table 6.1. QRT-PvJR primer sequences, efficiency and annealing temperature Gene name Sequence (5' to 3') Efficiency PCR annealing Tm CA038906 Tripartite motif- F-CTGTGTTTGGGTCCAGTGTG 1.919 58 containing protein 16 [Salmo salar] R- GGACCAAGATCTCCCCTACAG CA059691 unknown F- GGGGTGTGTGTCTGAAACCT 1.907 56 R- GCCCTGCGTGAAATTCTATG CA046558 ATP synthase subunit g, F-CGTATCCAACAATGCCTCCT 1.866 58 mitochondrial [Salmo salar] R- TGGACAGACGACAGTGAAGG CA042663: similar to tripartite F- ATAGGACCCTGCCTTCACCT 1.845 58 motif-containing protein [Salmo salar] R- CTGGAGACTGGAGCACACTG CA043335 Importin subunit alpha-2 F-GACTGCAGAGCCTCGATCCT 1.897 58 [Salmo salar] R-TGGAGAAGCTGTGCTTGATGA CA060690.1|CA060690 : similar to F-ATAGGACCCTGCCTTCACCT 1.811 58 Tripartite motif-containing protein 25 [Salmo salar] R -CTGGAGACTGGAGCACACTG CA056199 Spermidine/Spermine F- TCTGCAACGACGCAATGGTA 1.844 58 Nl- acetyltransferase R- ATGGAAGAGCAGGTCATCTTGAC CBS 12171 Tryptophanyl-fRNA F- TGGCGTAGTCCTGTCGGATT 1.876 58 synthetase, cytoplasmic[.Da/«o rerio] R- GTGTCCTTTATGTACCTGACCTTCTTC CB514092-Glutamine F-TCCAGGTCAACGTGCATAAA 1.811 58 synthetase[5a/mo salar] R-TTGATCTCGCGTTTCCTACC CA059978 - pre-B cell enhancing F-AAGCAGATCTGGACCGTATTCC 1.861 58 factor [Cyprinus carpio] R-CACCAACAGGAGACTTTGTGACA CA043257 - MHC class lb antigen F-ACCTGAAGAGAGCGACATGGA 1.854 58 [Oncorhynchus mykiss] R-CCCTTCCCACTTCATTTTGGA CA056962 - similar to ubiquitin F-GCCTCCACTCTTTATCCCTTTAGC 1.857 58 specific protease \S[Danio rerio] R-GAACCCCAGAGGGAAAGCA CB489043 - beta-2 microglobulin F-CG GATTGGACAACCACAGATG 1.870 58 (B2m) mRNA, [Oncorhynchus R- CCTGGGAGGCAGATATGTAAGG mykiss] CA060050 Homeobox protein F-CA ATGAGACGAGATTAGAGATGTGGTT 1.884 58 HoxB13ab (HoxB13ab) [Salmo R-GCAATGCTTCTTGTGAATAGCAA salar] CA058263 Radical S-adenosyl F-TCGTCAAAGCCACTGAACTGA 1.903 60 methionine domain-containing protein [Salmo salar] R- AGGAAAGATCCATCCAAGTCCAT 18S rRNA [Salmo salar] F-TGTGCCGCTAGAGGTGAAATT 1.863 56 R- GCAAATGCTTTCGCTTTCG CB516446 Mxl protein [Salmo F- TGCAGCTGGGAAGCAAACT 1.852 58 salar] R-CAACGTTTGGCTGATCAGATTC CB499972 Ubiquitin-like protein 1 F-GA.CTGATGTTGTTCCCATTGACA 1.861 56 [Salmo salar] R-GAGTCTGATCAAGCAACACTTTGG CA051350 Interferon-induced F-TCAGAGGCCTCGCCAACT 1.857 58 protein with tetratricopeptide repeats R-GCTGGGAAGAAGCTTAAGCAGAT 5 [Salmo salar] CA054694 Clone B225 VHSV- F-GCTTCCGTCCCTCTCTTTGC 1.96 58 induced mRNA, partial sequence R-TCAAGGGTGACTGTTGTCTATGTGT [Oncorhynchus mykiss] CA052560 Similar to Probable E3 F-GGGCCACCGCCTCTTT 1.98 58 ubiquitin-protein ligaseHERC4 (HECT domain and RCCl-like R-ATCCCTTACCTGCCACTTCCTACT domain-containing protein 4) [Danio rerio] F-TC AGC AACTCTTGGTTTCC AAT AA 1.871 60 CA056844 VHSV-induced protein [Oncorhynchus mykiss] R-TGGACCCAAACCAAGTCAATG CA050625 Similar to interferon- F-TCATGCTGGGTCACATAAACCT 1.91 60 inducible protein G\g\[Danio rerio] R-TGGACCGCCTCATCATCAG CA053164 Sacsin [Mus musculus] F-GGAGATGGAGCTGTCTTTGTAATAATG 1.955 58 R-GTACATCAGGCCGTGGAGAAG CB515563 CD9 antigen [Salmo F-CAGGACATGTTTTTCTGACCAAGA 1.966 58 salar] R-CTGTCCATGTTCCACAATGTGTT CA040505 VHSV-induced protein- F-TG A AACC AGGGCAGAGGAAA 1.82 56 10 mRNA, complete cds [Oncorhynchus mykiss] R-CC ATGAG GTCCCTTAATAAGTGCTT Supplementary Table 6.2a-6.2d. Reproducibly informative genes dysregulated in TO cells at 24 hr post-infection with the two ISAV isolates. Supplementary Table 6.2a. Reproducibly informative3 genes dysregulated in TO cells at 24 hr post-infection with the low pathogenic ISAV isolate RPC/NB-04-085-1 Microarray BLASTX or BLASTN(") identification' of QRT-PCR mean feature informative microarrav features Microarray (SE) fold change' representative Length mean (SE) EST accession Gene name [Species align. Functional fold number of best BLAST hit] (%I») E-value annotation11 changeb RPC' NBISA" Up-regulated genes CA055102 Transmembrane 68/139 le-43 Integral to membrane 52.00 Not Not protein 106B [Salmo (48%) (CC)8 (49.23) done done salar] CA061046 Unknown na'" na na 47.24 Not Not (22.64) done done CA057633 Clone B143 VHSV- 63/34 3e-53 28.63 Not Not induced mRNA, (75%) (11.10) done done partial sequence (Oncorhynchus mykiss) CA051350 Interferon-induced 141/141 le-75 Binding (MF)f 26.88 17.27 -1.75 protein with (100%) (6.91) (0.72)° (0.07)p tetratricopeptide repeats 5 [Salmo salar] CA062838 Unknown Na na na 13.53 Not Not (4.62) done done CB516446 Mxl protein [Salmo 202/202 2e-105 GTP binding (MF), 10.94 19.76 -2.51 salar] (100%) GTPase activity (MF) (6.91) (1.26)° (0.11)p CA044879 Galectin-9 [Salmo 101/101 6e-55 Sugar binding (MF)C 6.01 Not Not salar] (100%) (1.23) done done CA055205 Tripartite motif- 84/125 2e-39 nf 4.83 Not Not containing protein 16 (67%) (0.53) done done [Salmo salar] CA038906 Tripartite motif- 68/78 9e-30 Zinc ion binding 4.22 2.28 -1.77 containing protein 16 (88%) (MF)g, (0.51) (0.13)° (0.06)D [Salmo salar] cytoplasm (CC)k CA060690 Tripartite motif- 238/238 2c-134 nf 4.04 1.99 0.78 containing protein 25 (100%) (0.36) (0.08)° (0.03) [Salmo salar] CA042663 Tripartite motif- 170/172 Se-92 nf 3.95 1.44 -1.78 containing protein 25 (98%) (0.59) (0.07)° (0.05)p [Salmo salar] CA054622 VHSV-induced 24/31 8e-14 Nucleus (CC)f, 3.86 Not Not protein-10 (77%) Regulation of (0.91) done done [Oncorhynchus transcription, DNA mykissf dependent (BP)f CA040401 Tripartite motif- 119/147 6e-62 nf 3.67 Not Not containing protein 16 (80%) (0.64) done done [Salmo salar] 253 CA052520 Galectin-9 [Salmo 95/95 le-49 Sugar binding (MF)e 2.76 Not Not salar]1 (100%) (0.25) done done CA044359 Cytochrome P450 104/105 le-56 Oxidoreductase activity 2.40 Not Not 1A1 [Salmo salar) (99%) (MF) (0.20) done done Oxidation reduction (BP) Down-regulated genes CA059691 Unknown Na -4.95 -2.34 -2.90 (0.74) (0.04)p (0.15)p aTwo fold or greater up-/down-regulated in 1SAV infected TO cells relative to non-infected time-matched controls in all 4 replicate microarrays. For less stringent lists (> 2 fold up- or down-regulated in ISA infected TO cells relative to non-infected time-matched controls in any 3 out of 4 replicate arrays), see online Supplementary Tables 2a and S2b. bDenotes a BLASTN hit gene identification that was used in cases where no significant BLASTX hit was found. The BLASTX hit with the lowest E-value and a gene name (e.g. not predicted or hypothetical) is shown. BLAST statistics were collected on the 10th of December of 2008 and reflect the entries on the nr protein database up to that date. %ID = percent identity of amino acid residues or nucleotides over length of alignment (length align.). dFunctional annotation associated with the salmonid cDNA's best BLAST hit or an annotated putative ortholog from Danio rerio (e), Homo sapiens (f) or Mus musculus (s). Gene ontology (GO) categories: Biological Process (BP), Molecular Function (MF) and Cellular Component (CC). hMicroarray fold-change was calculated as the average of the BCLN signal ratios (R) between RPC infected samples and control samples from all 4 replicate microarrays, including 2 dye-swaps. Standard errors (SE) for microarray data reflect technical rather than biological variability, since mean fold change values were derived from 4 technical replicate microarrays comparing the same pools of samples. Where necessary, fold down- regulation was calculated as the inverse of fold up-regulation. 'QRT-PCR fold-change values were calculated as described in the methods section and refer to the first QRT-PCR study that surveyed gene expression only in NBISA01 and RPC/NB-04-085-1 infected TO cells. Standard errors (SE) for QRT-PCR data reflect technical and biological variability. jRPC = low pathogenicity ISA isolate (RPC/NB-04-085-1) kNBISA = high pathogenicity ISA isolate (NBISA01) 'Synonyms for gene names obtained from a BLASTX hit of Salmo salar with similar E-value or from Swiss-Prot Knowledgebase based on the putative ortholog with functional annotation: VHSV-induced protein-10: Poly [ADP-ribose] polymerase 14, PARP-14, B aggressive lymphoma protein 2 Galectin-9: Novel protein similar to vertebrate galectins mna: Not-applicable nnf: No functional annotation found for best BLAST hit or any putative orthologs. "Statistically significant differences between the two virus isolates (p<0.05). pDown-regulated genes in which case the mean and (SEM) indicate the fold down-regulation calculated by taking the inverse of relative fold up-regulation calculated using the Pfaffl (2001) equation. 254 Supplementary Table 6.2b. Reproducibly informative3 genes dysregulated in TO cells at 24 hr post-infection with the highly pathogenic ISAV isolate NBISA01 Microarray BLASTX or BLASTN(") Identification' of QRT-PC1f t Mean feature informative microarray features (SE) fold change8 representative Length Microarray NI/I EST accession Gene name [Species align. E- Functional mean (SE) 1 11 number of best BLAST hit] (%ID) value annotation * fold change' NBISA RPC Down-regulated genes CA046558 ATP synthetase 100/103 3e-51 Mitochondrial -2.79 -2.07 -1.63 subunit g, (97%) membrane (CC)C, (0.39) (o.ny (0.12)1 mitochondrial [Salmo ATP synthesis coupled salar] proton transport (BP)C aTwo fold or greater up-/down-regulated in ISAV infected TO cells relative to non-infected time-matched controls in all 4 replicate microarrays. For less stringent lists (> 2 fold up- or down-regulated in ISA infected TO cells relative to non-infected time-matched controls in any 3 out of 4 replicate arrays), see online Supplementary Tables 2c and S2d. b- cRefer to footnotes in Table 1 dFunctional annotation associated with the salmonid cDNA's best BLAST hit or an annotated putative ortholog from Danio rerio (e) Gene ontology (GO) categories: Biological Process (BP), Molecular Function (MF) and Cellular Component (CC). fMicroarray fold-change values were calculated as the average of the background corrected Lowess normalized (BCLN) signal ratios (R) between NBISA infected samples and control samples from all 4 replicate microarrays, including 2 dye-swaps. Where necessary, fold down-regulation was calculated as the inverse of fold up-regulation. Standard errors (SE) for microarray data reflect technical rather than biological variability, since mean fold change values were derived from 4 technical replicate microarrays comparing the same pools of samples. gQRT-PCR fold-change values were calculated as described in the methods section and refer to the first QRT-PCR study that surveyed gene expression only in NBISA01 and RPC/NB-04-085-1 infected TO cells. Standard errors (SE) for QRT-PCR data reflect technical and biological variability. hRPC = low pathogenicity ISA isolate (RPC/NB-04-085-1) 'NBISA = high pathogenicity ISA isolate (NBISA01) 1 Down-regulated genes in which case the mean and (SEM) indicate the fold down-regulation calculated by taking the inverse of relative fold up-regulation calculated using the Pfaffl (2001) equation. 255 Supplementary Table 6.2c. Reproducibly informative3 genes dysregulated in TO cells at 72 hr post-infection with the low pathogenic ISAV isolate RPC/NB-04-085-1 Microarray BLASTX or BLASTN(b) Identification of QRT-PCR Mean feature informative mienrarray features Microarray (SE) Fold Change' representative Length mean (SE) EST accession Gene name [Species of align. Functional fold number best BLAST hit] (%SD) E-value Annotation*1 change11 RPCj NBISAk Up-regulated genes CA038906 Tripartite motif- 69/78 9e-30 Intracellular (CCf, 169.43 Not done Not done containing protein 16 (88%) protein binding (MF)' (157.98) [Salmo salar] CA061919 Galectin-9 [Salmo salar] 59/60 5e-29 Sugar binding (MF)1 167.22 Not done Not done (9S%) (142.61) CK990445 Unknown nam na na 138.79 Not done Not done (101.25) CA061238 Serum 46/51 le-06 nf 55.78 Not done Not done paraoxonase/arylesterase (90%) (12.68) 2 (pon2)b CB499972 Ubiquitin-like protein ] 155/156 2e-82 Protein binding (MF)' 40.41 9.21 -1.15 [Salmo salar] (99%) (22.70) (0.90)° (0.12)p CA064176 Ubiquitin-like protein 1 115/117 4e-59 Protein binding (MF)1 37.44 Not done Not done [Salmo salar] (98%) (12.11) CA044879 Galectin-9 [Salmo salar] 101/101 6e-55 Sugar binding (MF)' 37.09 Not done Not done (100%) (13.93) CA051350 Interferon-induced 141/141 le-75 Binding (MF)' 30.24 100.28 -1.75 protein with (100%) (8.70) (4.22)° (0.07)p tetratricopeptide repeats 5 [Salmo salar] CK990223 Unknown Na na na 29.74 Not done Not done (11.47) CB516446 Mxl protein [Salmo 202/202 2e-105 GTP binding (MF), 29.55 217.22 1.13 salar] (100%) GTPase activity (MF) (8.03) (12.77)° (0.05) CA057098 Barrier-to-autointegration 77/97 8e-38 DNA binding (MF)* 27.94 Not done Not done factor [Salmo salar] (79%) (6.64) CA056962 Similar to ubiquitin 25/41 le-06 Ubiquitin 25.41 18.62 -1.10 specific protease 18 (60%) thiolesterase (14.87) (0.29)° (0.02)p [Danio rerio] activity (MF), ubiquitin-dependent protein catabolic process (BP) CA054858 Arginine/serine-rich 59/71 5e-25 nf 24.09 Not done Not done coiled-coil 2 [Danio (83%) (10.60) rerio] CA058263 Radical S-adenosyl 91/91 8e-47 Endoplasmic 21.41 794.82 1.19 methionine domain- (100%) reticulum (CC), (10.89 (46.56)° (0.02) containing protein 21 catalytic activity (synonym: viperin) (MF), response to [Salmo salar] virus (BP) CA054694 Clone B225 VHSV- 363/416 2e-147 nf 20.98 1.92 -1.58 induced mRNA, partial (37%) (5.67) (0.08)° (0.14)p sequence [Oncorhynchus mykissf CA061046 Unknown Na na na 17.71 Not done Not done (9.67) CA052560 Similar to Probable E3 65/107 4e-31 Intracellular (CCf, 16.61 383.86 -2.09 ubiquitin-protein ligase (60%) ubiquitin-protein (3.59) (38.79)° (0.09)° HERC4 (HECT domain ligase and RCCl-like domain- activity (MFJ, containing protein 4) ubiquitin cycle (BPf [Danio rerio] CA054622 VHSV-induced protein- 24/31 8e-14 Nucleus (CC)P, 16.05 Not done Not done 10 [Oncorhynchus (77%) regulation of (6.14) mykiss]1 transcription, DNA 256 dependent (BP)P CA040010 Clone ssal-rgf-540-239 653/666 0.0 nf 14.41 Not done Not done Tripartite motif- (98%) (4.79) containing protein J 6 putative mRNA, complete cds [Salmo salarf CA050625 Similar to interferon- 39/95 2e-ll nf 14.24 786.54 2.85 inducible protein (41%) (2.53) (35.53)° (0.39) Gigl [Danio rerid] CA062838 Unknown Na na na 13.56 Not done Not done (4.32) CA042663 Tripartite motif- 170/172 le-91 nf 13.25 Not done Not done containing protein 25 (98%) (1.64) [Salmo salar] CA056844 VHSV-induced protein 104/109 5e-55 Receptor activity 13.24 4682.93 3.34 [Oncorhynchus mykiss) (95%) (MF)1, (2.50) (287.9)° (0.31) ribonuclease activity (MF)1, RNA binding (MF)1 CA056191 Neurogranin,TIP41-like 133/148 le-46 nf 12.97 Not done Not done protein (TIP41),MHC (89%) (4.99) class II antigen beta chain (Sasa-DBB), MHC class II antigen alpha chain (Sasa-DBA), leucine rich repeat' containing 35-like protein, and alpha- tectorin-like protein genes, complete cds [Salmo salarf CA058271 Interferon-inducible 106/131 2e-55 nf 12.97 Not done Not done protein Gig2-like [Salmo (80%) (3.70) salar] CB494193 VHSV-induced protein-3 122/122 5e-63 Protein modification 12.79 Not done Not done [Oncorhynchus mykiss] (100%) process (BP) (4.53) CA057633 Clone B143 VHSV- 358/396 9e-152 nf 12.61 Not done Not done induced mRNA, partial (90%) (3.72) sequence [Oncorhynchus mykissf CA052004 Unknown Na na na 10.14 Not done Not done (3.39) CA053164 Sacsin (synonym: spastic 43/116 7e-14 ATP binding (MF), 9.55 40.24 -1.68 ataxia of Charlevoix- (37%) heat shock protein (3.32) (2.89)° (0.17)p Saguenay) [Mus binding (MF) musculus] CB515563 CD9 antigen [Salmo 234/235 234/235 Integral to membrane 9.45 421.02 -1.18 salar] (99%) (99%) (CC) (2.06) (30.03)° (0.10)p CA052520 Galectin-9 [Salmo salar]" 95/95 le-49 Sugar binding (MF)* 9.08 Not done Not done (100%) (2.28) CA064247 Clone ssal-rgf-516-278 712/715 0.0 nf 8.91 Not done Not done CD9 antigen putative (99%) (2.22) mRNA, complete cds [Salmo salarf CB516202 Clone 261P24 interferon- 296/393 7e-70 8.77 Not done Not done inducible GTPaseb and (75%) (2.69) interferon-inducible GTPase_a genes, complete cds; and TCR- gamma constant region locus [Salmo salarf CA050461 Unknown Na na na 8.77 Not done Not done (4.21) CA055205 Tripartite motif- 84/125 2e-39 nf 8.08 Not done Not done containing protein 16 (67%) (1.47) [Salmo salar] CA057036 Clone ssal-rgf-540-239 377/388 0.0 nf 7.99 Not done Not done Tripartite motif- (97%) (2.54) containing protein 16 putative mRNA, complete cds [Salmo salar? CA060690 Tripartite motif- 238/238 2e-134 nf 7.82 Not done Not done containing protein 25 (100%) (3.88) [Salmo salar] CB517062 Clone ssal-rgf-540-239 316/345 2e-134 nf 7.61 Not done Not done Tripartite motif- (91%) (2.62) containing protein 16 putative mRNA, complete cds [Salmo salar? CAO40505 VHSV-induced protein- 493/581 0.0 nf 6.77 7.53 -1.44 10 mRNA, complete cds (84%) (2.66) (0.62)° (0.16)p [Oncorhynchus mykiss] CB498971 Clone ssal-rgf-531-067 708/715 0.0 nf 6.59 Not done Not done Tripartite motif- (99%) (2.52) containing protein 16 putative mRNA, complete cds [Salmo salar? CB517430 Unknown Na na na 6.16 Not done Not done (1.47) CA044358 Galectin-9 [Salmo salar} 83/83 6e-42 Sugar binding (MF' 6.08 Not done Not done (100%) (2.87) CB515011 Galectin-3-binding 198/198 4c-86 Protein binding 5.76 Not done Not done protein precursor [Salmo (100%) (MF)>, (1.05) salar] scavenger receptor activity (MF)1 CB516789 Clone ssal-rgf-504-007 618/620 0.0 nf 5.74 Not done Not done Ornithine decarboxylase (99%) (3.25) 1 putative mRNA, complete cds [Salmo salar? CA049872 Clone ssal-rgf-531-067 578/589 0.0 nf 5.67 Not done Not done Tripartite motif- (98%) (1.39) containing protein 16 putative mRNA, complete cds [Salmo salar? CA043257 MHC class lb antigen 190/227 6e-110 MHC class I proteiin 5.66 4.08 -1.08 [Oncorhynchus mykiss] (83%) complex (MF), (1.70) (0.16)° (0.03)p antigen processing and presentation (BP), immune response (BP) CB500108 60S ribosomal protein 123/123 2e-49 Ribosome (CCj, 5.48 Not done Not done L35 [Salmo salar] (100%) structural constituent (1.61) of ribosome (MF)*, negative regulation of cell cycle (BP)1 CB511792 Unknown Na na na 5.45 Not done Not done (2.14) CA040401 Tripartite motif- 119/147 6e-62 nf 5.40 Not done Not done containing protein 16 (80%) (2.24) [Salmo salar] CB512373 Barrier-to-auto integration 52/68 le-21 DNA binding (MF? 5.28 Not done Not done factor [Salmo salar] (76%) (1.84) CA059978 Pre-B cell enhancing 134/154 4e-74 Cytoplasm (CC)', 5.14 5.07 -1.33 factor [Cyprinus carpio]1 (87%) nicotinamide (1.14) (0.21)° (0.04)p phospho- ribosyltrasfersase activity (MF)1, NAD biosynthetic process (BP)1 CA044387 MHC class I (UBA) 685/698 0.0 nf 4.61 Not done Not done mRNA, UBA*0301 (98%) (2.30) allele, complete cds [Salmo salar]b CB499584" Importin subunit alpha-2 203/213 9e-101 Nuclear pore (CC)*, 4.54 2.00 -1.13 [Salmo salar]' (95%) protein transport (0.80) (0.05) (0.02)p activity (MF)*, protein import into the nucleus (BP)' CB511632 Proteasome subunit beta 177/177 le-95 Proteasome core 4.52 Not done Not done type-9 [Salmo salar] (100%) complex (1.11) (CC), threonine-type endopeptidase activity (MF), immune response (BP), ubiquitin-dependent protein catabolic process (BP) CB499451 CD9 protein 677/677 0.0 nf 4.40 Not done Not done (LOC100136380), (100%) (1.17) mRNA [Salmo salarf CA051735 Unknown Na na na 4.15 Not done Not done (0.58) CA041367 Clone ssal-evf-572-211 428/430 0.0 nf 4.07 Not done Not done Beta-2-microglobulin (99%) (1.55) precursor putative mRNA, complete cds [Salmo salar]b CB497413 Reproduction regulator 2 44/110 8e-14 nf 3.98 Not done Not done [Epinephelus coioides] (40%) (1.08) CB500763 Clone ssal-rgb2-510-275 548/552 0.0 nf 3.69 1.98 1.20 Beta-2-microglobulin (99%) (2.04) (0.09) (0.06) precursor putative mRNA, complete cds [Salmo salarf CA051372 Proteasome subunit beta 145/145 4e-77 Proteasome core 3.55 Not done Not done type-9 [Salmo salar] (100%) complex (1.15) (CC), threonine-type endopeptidase activity (MF), immune response (BP), ubiquitin-dependent protein catabolic process (BP) CA064302 Proteasome subunit beta 139/139 7e-74 Proteasome core 3.42 Not done Not done type-9 [Salmo salar] (100%) complex (0.84) 259 (CC), threonine-type endopeptidase activity (MF), immune response (BP), ubiquitin-dependent protein catabolic process (BP) CB511439 Endoplasmic reticulum to 41/58 9e-18 Endoribonuclease 3.18 Not done Not done nucleus signaling 2 (70%) activity, producing (0.81) [Xenopus tropicalis] 5'- phosphomonoesters (MF), protein amino acid phosphorylation (BP) CA060011 Barrier-to-autointegration 96/97 5e-50 DNA binding (MF)" 3.04 Not done Not done factor [Salmo salar] (98%) (0.80) CB509315 Unknown Ma na na 2.70 Not done Not done (0.63) CB501070 Clone ssal-rgf-528-084 704/704 0.0 nf 2.69 Not done Not done Cytochrome P450 1A1 (100%) (0.59) putative mRNA, complete cds [Salmo salarf Di jwn-regul ated genes CA059375 mRNA for putative 603/604 0.0 nf -5.48 Not Not done ISG12(3) protein (99%) (1.58) done (isgl2(3) gene) [Salmo salarf CA058274 Ribosomal protein LI5 204/204 2e-108 Ribosome (CC), -4.59 Not Not done [Salmo salar] (100%) structural (2.11) done constituent of ribosome (MF), translation (BP) CB511186 Retinoic acid receptor 471/472 0.0 nf -3.33 Not Not done gamma b (Rargb) gene, (99%) (0.62) done partial cds [Salmo salarf CB514092 Glutamine synthetase 27/27 6e-08 Glutamate- -3.19 -1.40 -1.27 [Salmo salar] (100%) ammonia (0.64) (0.03)° (0.08)p ligase activity (MF), glutamine biosynthetic process (BP) CA037505 Snrpb2 protein [Danio 39/41 9e-14 Nulceotide -3.02 Not Not done rerio] (95%) binding (0.58) done (MF)1 CB515569 MYG1 protein [Bos 132/212 le-73 nf -2.68 Not Not done taurus] (0.13) done CB512171 Tryptophanyl-tRNA 85/103 8e-44 Cytoplasm (CC), -2.62 -1.13 -1.23 synthetase [Danio rerio] (82%) tryptophan-tRNA (0.69) (0.02)° (0.04)p ligase activity (MF), trytophanyl-tRNA aminoacylation (BP) aTwo fold or greater up-/down-regulated in ISAV infected TO cells relative to non-infected time-matched controls in all 4 replicate arrays. For a less stringent list refer to online Supplementary Tables 2e and S2f (2 fold or greater up-or down-regulation in ISA infected TO cells relative to non-infected time-matched controls in any 3 out of 4 replicate arrays). b,c-Refer to footnotes in Table 1 dFunctiona l annotation associated with the cod cDNA's best BLAST hit or an annotated putative ortholog from Danio rerio (e), Homo sapiens (f) or Mus musculus (8). Gene ontology (GO) categories: Biological Process (BP), Molecular Function (MF) and Cellular Component (CC). 260 hMicroarray fold-change was calculated as the average of the BCLN signal ratios (R) between RPC infected samples and control samples from all 4 replicate microarrays, including 2 dye-swaps. Where necessary, fold down- regulation was calculated as the inverse of fold up-regulation. Standard errors (SE) for microarray data reflect technical rather than biological variability, since mean fold change values were derived from 4 technical replicate microarrays comparing the same pools of samples. '•'•''Refer to footnotes in Table 1. 'Synonyms for gene names obtained from an BLASTX hit of Salmo salar with similar E-value or from Swiss-Prot based on the putative ortholog with functional annotation: Radical S-adenosyl methionine domain-containing protein 2: Virus inhibitory protein, endoplasmic reticulum- associated, interferon-inducible, Viperin VHSV-induced protein-10: Poly [ADP-ribose] polymerase 14, PARP-14, B aggressive lymphoma protein 2 VHSV-induced protein: Novel protein, possible orthologue of human peroxisomal proliferator-activated receptor A interacting complex 285 PRIC285 VHSV-induced protein-3: Ubiquitin-like protein 1 Pre-B cell enhancing factor: Nicotinamide phosphoribosyltransferase, Visfatin Importin subunit alpha-2: Karyopherin alpha 2 Snrpb2 protein: Signal peptide peptidase-like 2A m' "•"' pRefer to footnotes in Table 1. qPrimers for this gene were designed based on the sequence of the informative feature of same annotation from the 24 hr experiment (i.e. CA043335). BLASTX analysis of these 2 ESTs reveal that they share the same top BLASTX hit and therefore are likely to represent the same transcript. 261 Supplementary Table 6.2d. Reproducibly informative3 genes dysregulated in TO cells at 72 hr post-infection with the highly pathogenic ISAV isolate NBISA01 Microarray BLASTX or BLASTN(") Identification' of QRT-PCR Mean feature informative microarray features (SE) Fold Change* representative Length Microarray EST accession Gene name [Species align. E- Functional mean (SE) NBISAh RPC number of best BLAST hit] (%ID) value Annotation11 fold change' Up-regul ated genes CA037733 RNase2 91/132 2e-46 Nucleic acid binding 4.10 Not Not [Oncorhynchus (68%) (MF) (0.58) done done masou formosanus] CB489043 beta-2 microglobulin 410/419 0.0 nf 3.87 1.98 1.20 (B2m) mRNA, (97%) (1.14) (0.09) (0.06) [Oncorhynchus mykiss ]b CA050381 Unknown nak na na 3.72 Not Not (0.83) done done CA056199 Spermidine/spermine 149/170 5e-84 N-acetyltranferase 3.47 2.48 2.36 Nl-acetyltransferase (87%) activity (MF), (0.74) (0.20) (0.17) [Danio rerio] metabolic process (BP) CA043660 Nuclear receptor 532/533 0.0 nf 3.19 Not Not subfamily 0 group B (99%) (0.97) done done member 2 (nr0b2) [Salmo salarf Down-regulated genes CA060050 Homeobox protein 421/471 2e-171 nf -5.46 -1.08 -1.27 HoxB13ab (89%) (2.43) (0.03y (0.06)* (HoxB13ab)[SWmo salarf CA062564 Unknown Na na na -5.15 Not Not (2.18) done done CA060971 Signal peptide 39/60 5e-15 Integral to membrane -3.57 Not Not peptidase-like 2A (65%) (CC)e, (1.10) done done [Gallus gallus] aspartic-type endopeptidase activity (MF)C CB492839 Altantic salmon 369/428 2e-139 nf -2.44 Not Not ependymin (SS-II) (86%) (0.17) done done gene, complete cds [Salmo salar] aTwo fold or greater up-/down-regulated in ISAV infected TO cells relative to non-infected time-matched controls in all 4 replicate arrays. For a less stringent list refer to online Supplementary Table 2g and S2h (2 fold or greater up-regulation in ISA infected TO cells relative to non-infected time-matched controls in any 3 out of 4 replicate arrays). b' cRefer to footnotes in Table 1 ^Functional annotation associated with the salmonid cDNA's best BLAST hit or an annotated putative ortholog from Homo sapiens (e). Gene ontology (GO) categories: Biological Process (BP), Molecular Function (MF) and Cellular Component (CC). fMicroarray fold-change values were calculated as the average of the background corrected Lowess normalized (BCLN) signal ratios (R) between NBISA01 infected samples and control samples from all 4 replicate microarrays, including 2 dye-swaps. Where necessary, fold down-regulation was calculated as the inverse of fold up-regulation. Standard errors (SE) for microarray data reflect technical rather than biological variability, since mean fold change values were derived from 4 technical replicate microarrays comparing the same pools of samples. g,h'',iRefer to footnotes on Table 2. kna: Not-applicable 'nf: No functional annotation found for best BLAST hit or any putative orthologs. 262 Supplementary Table 6.3a-6.3h. Microarray-identified genes that were greater than 2- fold dysregulated in RPC/NB-04-C85-1 and NBISA01 infected TO cells cells in any 3 out of 4 technical replicate microarrays (including at least 1 dye swap). Supplementary Table 6.3a. Microarray-identified genes that were greater than 2-fold up- regulated in RPC/NB-04-085-1 infected TO cells (24 h sampling point) relative to non- infected control TO cells ,(24 h sampling time point) in any 3 out of 4 technical replicate microarrays (including at least 1 dye swap). Salmonid EST Gene name of top BLASTX or Length E value for Average Fold SEM accession TBLASTx hit (% identity) BLAST hit Change number (representing microarray feature) CA055102 Transmembrane protein 106B [Salmo 68/139 (48%) le-43 52.00 49.23 salar] CA057633 Clone B143 VHSV-induccd mRNA, 63/84 (75%) 3e-53 28.63 18.65 partial sequence [Oncorhynchus mykiss] CA056335 Unknown NA NA 5.08 1.68 CA054622 VHSV-induced protein-10 24/31 (77%) 8e-14 3.86 0.91 [Oncorhynchus mykiss] CB510930 Unknown NA NA 1.75 0.43 CK991347 Procollagen C-endopeptidase enhancer 35/73 (47%) 6e-15 3.24 1.34 1 precursor CA055205 Tripartite motif-containing protein 16 84/125 (67%) 2e-39 4.83 0.53 [Salmo salar] CA052004 Unknown NA NA 3.98 1.20 CA051350 Interferon-induced protein with 141/141 le-75 26.88 11.10 tetratricopeptide repeats 5 [Salmo salar] (100%) CA054017 Unknown NA NA 2.06 0.51 CA062838 Unknown NA NA 13.53 4.62 CA044359 Cytochrome P450 1A1 [Salmo salar] 104/105 le-56 2.40 0.20 (99%) CA057036 clone ssal-rgf-540-239 Tripartite motif- 120/129 9e-117 3.14 0.90 containing (93%) protein 16 putative mRNA, complete cdsfSalmo salar] CA061046 Unknown NA NA 47.24 22.64 CB516446 Mxl protein [Salmo salar] 202/202 2e-105 10.94 6.91 (100%) CB512819 succinate dehydrogenase complex 144/144 3e-110 2.21 0.13 subunit A flavoprotein [Salmo salar] (100%) CA044879 Galectin-9 [Salmo salar] 101/101 6e-55 6.01 1.23 (100%) CA042663 Tripartite motif-containing protein 25 170/172 8e-92 3.95 0.59 [Salmo salar] .-: (98%) CA038906 Tripartite motif-containing protein 16 68/78 (88%) 9e-30 4.22 0.51 [Salmo salar] 263 CA048886 clone Ots.u6.23.15 genomic 32/32(100%) 2e-69 2.69 0.61 sequence[Oncorhynchus Ishawytscha ] CA060690 Tripartite motif-containing protein 25 238/238 2e-134 4.04 0.36 [Salmo salar] (100%) CA052520 Galectin-9 [Salmo salar] 95/95 (100%) le-49 2.76 0.25 CA045465 similar to dynein, light chain, LC8-type 91/110(82%) 5e-46 2.23 0.63 2 [Ornithorhynchus anatinus] CB510047 basic leucine zipper and W2 domains 1 a 60/69 (86%) 2e-28 2.70 0.56 [Danio rerio] CB517062 clone ssal-rgf-540-239 Tripartite motif- 58/59 (98%) 4e-108 3.96 1.14 containing protein 16 putative mRNA, complete cds[Salmo salar] CB506143 Keratinocytes-associated protein 2 83/83 (100%) 6e-34 2.01 0.38 [Salmo salar] CA040401 Tripartite motif-containing protein 16 119/147 6e-62 3.67 0.64 \Salmo salar] (80%) CB498940 clone ssal-rgf-531-067 Tripartite motif- 241/250 8c-157 3.33 0.86 containing protein 16 putative mRNA, (96%) complete cdsfSalmo salar] CB496850 clone ssal-eve-544-186 NTF2-related 22/30 (73%) 2e-43 4.11 1.51 export protein 2 putative mRNA, complete cdsfSalmo salar] CBS10024 D-dopachrome decarboxylase [Salmo 24/24(100%) 3e-05 6.17 3.90 salar] CB511181 Myosin light polypeptide 6B [Salmo 197/198 2e-134 2.62 0.80 salar] (99%) CA043744 Prostaglandin E synthase 3 [Salmo 153/153 6e-88 3.63 1.63 salar] (100%) CB487801 subunit alpha type-4 [Salmo salar] 135/135 3e-71 5.47 2.34 (100%) CA040505 VHSV-induced protein-10 28/33 (84%) 4e-60 2.51 0.55 [Oncorhynchus mvkiss] CA059243 nucleoporin 133kDa [Homo sapiens] 119/183 2e-64 2.80 0.65 (65%) CB515838 Unknown NA NA 2.73 0.84 CB496363 Unknown NA NA 4.29 2.00 CA048582 Hepatocellular carcinoma-associated 94/95 (98%) 7e-32 2.68 0.70 antigen 127 [Salmo salar] CB492364 Heterogeneous nuclear 59/68 (86%) 3e-40 2.64 0.89 ribonucleoprqtein Al [Salmo salar] CA064237 Unknown NA NA 3.51 1.38 CK991044 Cytochrome c oxidase polypeptide Vic 73/76 (96%) le-28 2.03 0.22 precursor [Salmo salar] ' • CA053970 Unknown 1.82 0.40 CK991150 similar to Heat shock cognate 71 kDa 6e-04 18/24(75%), 2.33 0.55 protein (Heat shock 70 kDa protein 8) [Canis lupus familiaris] CB516594 Unknown NA NA 1.81 0.25 CA058187 Krueppel-like factor 6 [Salmo salar] 137/137 6e-80 3.11 1.04 (100%) CB497413 reproduction regulator 2 [Epinephelus 44/110(40%) 9e-14 2.95 0.59 coioides] CB492825 zgc:56310 [Danio rerio] 89/168 (52%) le-30 3.42 1.20 CA050082 Unknown NA NA 3.93 2.01 CK991334 60S ribosomal protein L7 [Salmo salar] 159/163 4e-88 2.22 0.56 (97%) CB514461 beta-actin [Myxocyprinus asiaticus] 51/51 (100%) 5e-22 1.89 0.50 CN442555 cytochrome c oxidase subunit I [Salmo 119/128 2e-61 2.14 0.49 salar] (92%) NA: not applicable. 265 Supplementary Table 6.3b. Microarray-identified genes that were greater than 2-fold down-regulated in RPC/NB-04-085-1 infected TO cells (24 h sampling point) relative to non-infected control TO cells (24 h sampling time point) in any 3 out of 4 technical replicate microarrays (including at least 1 dye swap). Salmonid EST Gene name of top BLASTX or Length E value for Average Fold SEM accession number TBLASTx hit (% identity) BLAST hit Change (representing microarray feature) CA049302 globoside alpha- 1,3-N 51/84(60%) 8e-21 -2.97 1.22 acetylgalactosaminyltraiisferase 1, like 1 [Danio rerio] CB493506 ADP-ribosylation-like factor 6 74/93 (79%) 2e-25 -1.92 0.47 interacting protein 4 [Danio rerio] CA060872 similar to Gamma-enolase (2- 88/91 (96%) le-44 -1.93 0.36 phospho-D-glycerate hydro-lyase) (Neural enolase) (Neuron-specific enolase) (NSE) (Enolase 2) [Equus caballus] CB493018 Vacuolar ATP synthase 16 kDa 153/153(100%) 2e-63 -3.57 1.45 proteolipid subunit [Salmo salar] CA767944 similar to ATP synthase. H+ 101/109(92%) 6e-34 -4.66 2.14 transporting, mitochondrial FO complex, subunit c (subunit 9) [Danio rerio] CB499653 enhancer of mP-NA-decapping 134/174 (77%) le-57 -1.93 0.32 protein 4 [Danio rerio] , CA059691 Unknown NA NA -4.95 0.74 CK990216 ribosomal protein SI3 [Salmo 95/104(91%) 2c-45 -2.66 0.79 salar] CB494172 simple type II keratin K:8a 145/146 (99%) le-94 -2.09 0.29 [Oncorhynchus mykiss j CA041970 40S ribosomal protein S16 [Salmo 146/146(100%) 2e-77 -2.37 0.81 salar] CA038049 60S ribosomal protein L31 [Salmo 124/124(100%) 5e-57 -4.17 2.35 salar] CB498513 heterogeneous nuclear 48/66 (72%) 3c-19 -4.70 3.12 ribonucleoprotein L [Danio rerio] CA043298 Cytochrome c oxidase polypeptide 70/70(100%) 2e-32 -3.10 0.94 VHI-heart, mitochondrial precursor [Salmo salar] CA045453 PREDICTED: similar to 40S 52/54 (96%) le-21 -2.76 0.83 ribosomal protein S28 [Homo sapiens] CK990614 Na/K ATPase alpha subunit 29/40 (72%) 9e-24 -2.17 0.37 isoform 2[Oncorhynchiis mykiss J CB509719 clone ssal-eve-565-204 C-C motif 159/159(100%) 4e-104 -2.21 0.23 chemokine 25 precursor putative mRNA, complete cds[Salmo salar] CA058820 chromatin modifying protein 2a 29/32 (90%) 3e-09 -3.30 1.59 (Chmp2a), male-specific lethal-1- like protein (Hampin), gastric inhibitory polypeptide (Gip), EAP30 subunit of ELL complex b (Eap30b), and nuclear domain 10 protein 52b (Ndp52b) genes, complete cds; BAC05032 (BAC05032) pseudogene, partial sequence; HoxBSbb (HoxB8bb) pseudogene, complete sequence; homeobox protein HoxB6bb (HoxB6bb) and homeobox protein HoxB5bb (HoxB5bb) genes, complete cds; and HoxB3bb and HoxBlbb pseudogenes, complete sequence [Salmo salar] CB496706 clone ssal-evf-558-15fUl small 94/102 (92%) 4e-102 -2.40 0.60 nuclear ribonucleoprotein C putative mRNA, complete cds \Salmo salar] CB507526 Unknown NA NA -2.40 0.29 CA060656 Unknown NA NA -2.60 0.92 CA057484 deoxyuridine triphosphatase [Mus 133/167(79%) 4e-68 -2.50 0.72 muscuius] CA051620 Integral membrane protein 2B 58/58(100%) le-26 -4.29 1.36 [Salmo salar] CA042407 disulfide-isomerase A6 precursor 235/235 (100%) 4e-120 -2.60 0.63 \Salmo salar] CA043335 Importin subunit alpha-2 [Salmo 169/169(100%) 2e-89 -5.30 3.02 salar] CK990592 metallothionein B [Oncorhynchus 58/60 (96%) 6e-10 -1.93 0.34 mykiss] CA037333 Guanine nucleotide-binding protein 68/68(100%) 4e-30 -4.32 2.61 GI/GS/GO subunit gamma-5 precursor [Salmo salar] BU965677 NADH dehydrogenase subunit 5 46/50 (92%) 2e-18 -2.60 0.73 [Procypris rabaudi] CA060078 Unknown NA NA -2.53 0.81 CK990974 60S ribosomal protein 1.35 [Salmo 113/122(92%) 8e-42 -2.26 0.73 salar] The negative signs in front of the average fold changes indicate down regulation compared to their time matched uninfected control samples. NA: not applicable. Supplementary Table 6.3c. Microarray-identified genes that were greater than 2-fold up-regulated in NBISA01 infected TO cells (24 h sampling point) relative to non-infected control TO cells (24 h sampling time point) in any 3 out of 4 technical replicate microarrays (including at least 1 dye swap). Salmonid EST Gene name of top BLASTX or Length E value for Average Fold SEM accession number TBLASTx hit (% identity) BLAST hit Change (representing microarray feature) CA057617 clone ssal-rgf-538-330 Surfeit 245/246 6e-158 10.20 8.27 locus protein 4 putative mRNA, (99%) complete cds[Salmo salar] CB510664 Fatty acid-binding protein, brain 129/132 2e-68 5.69 3.62 [Salmo salar] (97%) CB503917 potassium channel tetramerisation 189/197 4e-104 2.12 0.59 domain containing 10[Danio (95%) rerio] CA051116 flap structure-specific 162/184 6e-92 2.14 0.59 endonuclease 1 \Danio rerio] (88%) CB494633 Unknown NA NA 2.38 0.36 CB508354 THO complex kubunit ? homolog 125/126 2e-64 2.53 0.85 [Salmo salar] (99%) CB498107 Unknown NA NA 2.45 0.70 CA056402 clone ssal-rgf-530-070 Voltage- 231/231 2e-166 2.67 0.67 dependent anion-selective channel (100%) protein 2 putative mRNA, complete cds[Salmo salar] CB497247 NADH dehydrogenase iron-sulfur 155/156 6e-87 1.81 0.37 protein 3, mitochondrial precursor (99%) [Salmo salar] CK990242 High mobility group protein 19/28 le-13 5.67 3.80 YS2[Salmo salar] (67%) CB497475 UPF0527 membrane protein 137/137 3e-73 2.34 0.43 [Salmo salar] (100%) CK990336 clone ssal-evd-534-240 Myosin 38/47 2e-42 2.29 0.28 light polypeptide 6 (80%) putative mRNA, complete cds[Salmo salar] CB496898 clone ssal-evf-521-177 Barrier-to- 60/66 8e-90 1.71 0.38 autointegration (90%) factor putative rnRNA, complete cds[Salmo salar] CA050304 ATP-binding cassette, sub-family 81/86 3e-42 4.87 1.18 F (GCN20), member 2f Danio (94%) rerio] CA043419 Apoptosis inhibitor 5 [Salmo 33/53 2e-42 2.38 0.77 salar] (62%) CB488123 Selenium-binding protein 136/163 4e-84 1.90 0.52 \[Salmo salar] (83%) CB507200 Unknown NA NA 4.28 1.49 CB497307 biotinidase fragment 1 110/114 3e-57 3.48 1.38 [Oncorhynchus mykissj (96%) CA058849 clone ssal-eve-520-046 Nuclear" 230/234 6e-159 2.11 0.60 transport factor 2 putative mRNA, (98%) 268 complete cds[Salmo salar] CB497857 26S proteasome non-ATPase 37/46 le-61 3.57 1.69 regulatory subunit 8 (80%) [Salmo salar] CB502665 UPF0527 membrane protein 24/28 6e-04 2.65 0.42 [Salmo salar] (85%) CB492567 solute carrier family 25 member 52/54 7e-25 2.39 0.88 3[Salmo salar] (96%) CA045229 H3 histone, family 3B (H3.3B) 39/39 2e-30 3.68 1.75 [Pan troglodytes] (100%) CB490715 genes, MHC class I b region, 94/106 4e-66 2.95 0.91 complete cds[Oncorhyiichus (88%) mykissj CA042956 Isoamyl acetate-hydrolyzing 146/146 6e-70 3.38 1.45 esterase 1 homolog (100%) [Salmo salar] CB511588 Trypsin [Salmo salar] 180/180 6e-107 5.44 2.88 (100%) CA057533 Cleavage and polyadenylation 111/111 2e-60 2.26 0.53 specificity factor subunit 5 [Salmo (100%) salar] CB497381 Nucleoside diphosphate kinase A 150/151 2e-82 1.98 0.43 [Salmo salar] (99%) CK991042 somatolactin [Salmo salar] 102/104 4e-64 2.15 0.40 (98%) CK991031 Ferritin, middle subunit [Salmo 79/90 le-37 2.35 0.68 salar] (87%) CB500237 RPL41 mRNA for ribosomal 26/33 le-06 3.18 0.99 protein L41, complete cds [Solea (78%) senegalensis] NA: not applicable. Supplementary Table 6.3d. Microarray-identified genes that were greater than 2-fold down-regulated in NBISA01 infected TO cells (24 h sampling point) relative to non- infected control TO cells (24 h sampling time point) in any 3 out of 4 technical replicate microarrays (including at least 1 dye swap). Salmonid EST Gene name of top BLASTX or Length (% E value for Average SEM accession number TBLASTx hit identity) BLAST hit Fold (representing Change microarray feature) CB515462 Unknown NA NA -2.05 0.27 CB515892 60 kDa heat shock protein, 58/58 (100%) 4e-24 -1.93 0.38 mitochondrial precursor [Salmo salar] CA044917 Cytochrome c oxidase 78/80 (97%) 9e-36 -4.87 1.36 polypeptide Vlla-liver/heart, mitochondrial precursor [Salmo salar] CB496703 SMC4 protein [Takifugu 114/118(96%) 2e-83 -2.51 0.75 rubripes] CB493908 translocase of inner 75/81 (92%) 2e-37 -2.15 0.45 mitochondrial membrane 9 homolog [Danio rerio] CB496359 Anaphase-promoting complex 88/88 (100%) 4e-43 -5.64 2.38 subunit CT)C26[Salmo salar] CA046558 ATP synthase subunit g, 100/103 (97%) 3e-51 -2.79 0.40 mitochondrial [Salmo salar] CA043808 Troponin C-akin-1 protein 132/135 (97%) 6e-74 -4.18 1.61 [Salmo salar] CB503450 40S ribosomal protein S10 171/171 (100%) 2e-77 -2.80 1.00 [Salmo salar] CB490484 prostaglandin E synthase 3 120/175 (68%) 3e-57 -3.01 1.32 (cytosolic) [Danio rerio] CA056394 60S acidic ribosomal protein P0 224/224(100%) 7e-94 -3.12 1.00 [Salmo salar] CB499462 immunoglobulin heavy chain 211/211 (100%) 3e-119 -2.14 0.66 constant region [Salmo salar] CB502879 differentially regulated,trout 86/88 (97%) le-44 -7.56 5.09 protein 1 [Oncorhynchus mykiss] CB510883 Glutathione S-transferase theta-1 163/163 (100%) 4e-89 -3.37 1.23 [Salmo salar] CA038748 SJCHGC09650 protein 35/45 (77%) 3e-08 -1.72 0.41 [Schistosoma japonicum] CA053678 Tobl [Salmo salar] 137/139 (98%) 2e-58 -2.79 0.45 CA051810 hypothetical protein 42/58 (72%) 3e-56 -3.79 1.58 LOC\0QU6765[Oncorhynchus mykiss] CB493710 Unknown NA NA -3.01 1.15 CA055066 wu:fc56h05 [Danio rerio] 75/93 (80%) 2e-35 -3.25 0.88 CA046581 ribosomal protein L34 {Salmo 117/117(100%) 9e-60 -2.02 0.50 salar] CB493119 ribosomal protein S13 [Salmo 89/89 (100%) 7e-43 -2.22 0.37 salar] CA037914 40S ribosomal protein 20S 119/119(100%) 6e-61 -2.48 0.66 pwtem-\ike[Oncorhynchus mykiss] | 270 CK990478 40S ribosomal protein S17 126/134 (94%) 3e-59 -2.79 0.63 [Ictalurus punctatus] CK990639 Cytosolic non-specific 38/39(97%) le-14 -2.26 0.18 dipeptidase \Salmo salar] CB515635 Gl to S phase transition 1 75/78 (96%) 5e-35 -1.72 0.39 [Gallus gallus] CB498654 selenoprotein T, \a.[Ddnio 95/104 (91%) le-46 -2.02 0.40 rerio] CB516703 proteasome 26S subunit ATPase 197/199(98%) le-105 -2.10 0.58 5-\iks[Taeniopygia guttata] CA036801 clone ssal-rgf-517-087 34/44 (77%) le-31 -3.50 1.32 Heterogeneous nuclear ribonucleoprotein A/B putative mRNA, complete cds[Salmo salar] CA057879 Cytochrome b reductase 1 108/129 (83%) 3e-54 -2.34 0.66 [Salmo salar] CA036813 PEST proteolytic signal- 35/38 (92%) 8e-17 -2.40 0.61 containing nuclear protein[&/mo salar] CB496449 Peroxiredoxin-5, mitochondrial 163/166(98%) 5e-88 -3.77 1.39 precursor [Salmo salar] CB511254 hypothetical protein 100/130(76%) le-54 -2.76 0.80 LOC100194683/Sa/mo salar] CA037053 Unknown NA NA -3.17 1.07 CA058307 DNA sequence from clone 32/69 (46%) le-10 -3.18 1.24 DKEY-264K15' in linkage group 4 Contains the asclla gene for achaete-scute complex-iike la (Drosophila) [Danio rerio] CA052848 vesicle amine transport protein 1 179/203 (88%) 2e-101 -2.47 0.41 homolog [Danio rerio] CB492670 ATP synthase, H+ transporting, 139/139(100%) 2e-57 -2.95 1.04 mitochondrial F0 complex, subunit c-3 [Salmo salar] CB494472 Unknown NA NA -2.49 0.89 CA062494 Unknown NA NA -2.36 0.78 CA041277 Unknown t NA NA -1.93 0.58 CB514449 Cytochrome c oxidase subunit 114/114(100%) le-62 -4.12 2.39 5B, mitochondrial precursor [Salmo salar] CB517783 Heterogeneous nuclear 203/203 (100%) 2e-106 -2.08 0.35 ribonucleoprotein M[Salmo salar] CB517871 Follistatin-related protein 1 220/220 (100%) 7e-146 -2.18 0.20 [Salmo salar] CK990539 GTP-binding protein 27/28 (96%), 8e-08 -6.84 4.31 [Oncorhynchus tshawytscha] CA059557 protein phosphatase 1 catalytic 55/55(100%) 4e-25 -2.73 1.07 subunit gamma isoform,-[5a/mo salar] CK990228 Transient receptor potential 207/209 (99%) 5e-107 -1.85 0.43 cation channel subfamily V member 1 [Salmo salar] CB488435 Unknown NA NA -2.35 0.74 CA063477 Disabled homolog 2 [Salmo 92/129(71%) 3e-40 -4.48 2.72 salar] CK990675 ribosomal protein S17 [Ictalurus 71/83 (85%) 9e-33 -3.64 1.35 punctatus] 271 CB500946 Unknown NA NA -2.54 0.82 CB501863 Unknown NA NA -2.62 0.76 The negative signs in front of the average fold, changes indicate down regulation compared to their time matched uninfected control samples. NA: not applicable. 272 Supplementary Table 6.3e. Microarray-identified genes that were greater than 2-fold up- regulated in RPC/NB-04-085-1 infected TO cells (72 h sampling point) relative to non- infected control TO cells (72 h sampling time point) in any 3 out of 4 technical replicate microarrays (including at least 1 dye swap). Salmonid EST Gene name of top BLASTX or Length (% E value Average Fold SEM accession TBLASTx hit identity) for Change number BLAST (representing hit microarray feature) CA038906 Tripartite motif-containing protein 16 69/78 (88%) 9e-30 169.43 157.98 [Salmo salar] CA061919 Galectin-9 [Salmo salar] 59/60 (98%) 5e-29 167.22 142.61 CK990445 Unknown NA NA 137.79 101.25 CA061238 Serum paraoxonase/arylcsterase 2 46/51 (90%) le-06 55.78 12.68 (pon2) CB499972 Ubiquitin-like protein 1 [Salmo salar] 155/156(99%) 2e-82 40.41 22.70 CA064176 Ubiquitin-like protein 1 [Salmo salar] 115/117(98%) 4e-59 37.44 12.11 CA044879 Galectin-9 [Salmo salar j 101/101 (100%) 6e-55 37.09 13.93 CA051350 Interferon-induced protein with 141/141 (100%) le-75 30.24 8.70 tetratricopeptide repeats 5 [Salmo salar] CK990223 Unknown NA NA 29.74 11.47 CB516446 Mxl protein [Salmo salar] 202/202 (100%) 2e-105 29.55 8.03 CA057098 Barrier-to-autointegration factor 77/97 (79%) 8e-38 27.94 6.64 [Salmo salar] CA056962 Similar to ubiquitin specific protease 25/41 (60%) le-06 25.41 14.87 18 [Danio rerio] CA054858 Arginine/serine-rich coiled-coil 2 59/71 (83%) 5e-25 24.09 10.50 [Danio rerio] CA064171 similar to interferon-induced protein 164/228(71%) 2e-77 24.04 13.80 44-like [Danio rerio] CA058263 Radical S-adenosyl methionine 91/91 (100%) 8e-47 21.41 10.89 domain-containing protein 28 [Salmo salar] CA054694 Clone B225 VHSV-induced mRNA, 363/416 (87%) 2e-147 20.98 5.67 partial sequence [Oncorhynchus mykiss] CA061046 Unknown NA NA 17.71 4.84 CA052560 Similar to Probable E3 ubiquitin- 65/107 (60%) 4e-31 16.61 3.59 protein ligaseHERC4 (HECT domain and RCCl-like domain-containing protein 4) [Danio rerio] CA054622 VHSV-induced protein-10 24/31 (77%) 8e-14 16.05 6.14 [Oncorhynchus mykiss] CA040010 Clone ssal-rgf-540-239 Tripartite 653/666 (98%) 0.0 14.41 4.79 motif-containing protein 16 putative mRNA, complete eds [Salmo salar] CA050625 Similar to interferon-indncible 39/95(41%) 2e-ll 14.24 2.53 protein Gig\[Danio rerio] CA062838 Unknown NA NA 13.56 4.32 CA042663 Tripartite motif-containing protein 25 170/172(98%) le-91 13.25 1.64 273 [Salmo salar] CA056844 VHSV-induced protein 104/109(95%) 5e-55 13.24 2.50 [Oncorhynchus mykiss] ' CA056191 Neurogranin, TLP41-like protein 133/148 (89%) le-46 12.97 4.99 (TIP41), MHC class II antigen beta chain (Sasa-DBB), MHC class II antigen alpha chain (Sasa-DBA), leucine rich repeat containing 35-like protein, and alpha-tectorin-like protein genes, complete cds [Salmo salar] CA058271 Interferon-inducible protein Gig2-like 106/131 (80%) 2e-55 12.97 3.70 [Salmo salar] CB494193 VHSV-induced protein-3 122/122 (100%) 5e-63 12.79 4.53 [Oncorhynchus mykiss] CA057633 Clone B143 VHSV-induced mRNA, 358/396 (90%) 9e-152 12.61 3.72 partial sequence [Oncorhynchus mykiss] CA052004 Unknown NA NA 10.14 3.39 CA053164 Sacsin [Mus musculus] 43/116(37%) 7e-14 9.55 3.32 CB515563 CD9 antigen [Salmo salar] 234/235 (99%) 234/235 9.45 2.06 (99%) CB497626 SRA stem-loop-interacting RNA- 80/81 (98%) 4e-41 9.34 7.07 binding protein, mitochondrial precursor [Salmo salar] CA052520 Galectin-9 [Salmo salar] 95/95 (100%) le-49 9.08 2.28 CA064247 Clone ssal-rgf-516-278 CD9 antigen 712/715(99%) 0.0 8.91 2.22 putative mRNA, complete cds [Salmo salar] CB516202 Clone 261P24 interferon-inducible 296/393 (75%) 7e-70 8.77 2.59 GTPaseb and interferon-inducible GTPase a genes, complete cds; and TCR-gamma constant region locus [Salmo salar] CA050461 Unknown NA NA 8.77 4.21 CA055205 Tripartite motif-containing protein 16 84/125 (67%) 2e-39 8.08 1.47 [Salmo salar] CA057036 Clone ssal-rgf-540-239 Tripartite 377/388 (97%) 0.0 7.99 2.54 motif-containing protein 16 putative mRNA, complete cds [Salmo salar] CA060690 Tripartite motif-containing protein 25 238/238(100%) 2e-134 7.82 1.94 [Salmo salar] CB517062 Clone ssal-rgf-540-239 Tripartite 316/345(91%) 2e-134 7.61 2.62 motif-containing protein 16 putative mRNA, complete cds [Salmo salar] CA040505 VHSV-induced protein-10 mRNA, 493/581 (84%) 0.0 6.77 2.56 complete cds [Oncorhynchus mykiss] CB498971 Clone ssal-rgf-531-067 Tripartite 708/715 (99%) 0.0 6.59 2.52 motif-containing protein 16 putative mRNA, complete cds [Salmo salar] CB499762 Tripartite motif-containing protein 31/41 (75%) 3e-05 6.46 1.54 16 [Salmo salar] CA768235 Ubiquitin carboxyl-terminal 35/35 (100%) le-13 6.40 3.99 hydrolase 5 [Salmo salar] CA061258 X-ray repair complementing defective 63/100 (63%) 2e-28 6.22 2.66 repair in Chinese hamster cells 5 [Danio rerio] CB517430 Unknown NA NA 6.16 1.47 274 CA044358 Galectin-9 [Salmo salar] 83/83 (100%) 6e-42 6.08 2.87 CB515011 Galectin-3-tainding protein precursor 198/198(100%) 4e-86 5.76 1.05 [Salmo salar] CB516789 Clone ssal-rgf-504-007 Ornithine 618/620(99%) 0.0 5.74 3.25 decarboxylase 1 putative mRNA, complete cds [Salmo salar] CA049872 Clone ssal-rgf-531-067 Tripartite 578/589 (98%) 0.0 5.67 1.39 motif-containing protein 16 putative mRNA, complete cds [Salmo salar] CA043257 MHC class lb antigen 190/227(83%) 6e-110 5.66 1.70 [Oncorhynchus mykiss] CB500108 60S ribosomal protein L35 [Salmo 123/123 (100%) 2e-49 5.48 1.61 salar] CB511792 Unknown NA NA 5.45 2.14 CA040401 Tripartite motif-containing protein 16 119/147(80%) 6e-62 5.40 2.24 [Salmo salar] CB512373 Barrier-to-autointegration factor 52/68 (76%) le-21 5.28 1.84 [Salmo salar] CA059978 Pre-B cell enhancing factor [Cyprinus 134/154(87%) 4e-74 5.14 1.14 carpio] CA044387 MHC class I (UBA) mRNA, 685/698 (98%) 0.0 5.02 2.30 UBA*0301 allele, complete cds [Salmo salar] CB499584 Importin subunit alpha-2 [Salmo 203/213 (95%) 9e-101 4.54 0.80 salar] CB511632 Proteasome subunit beta type-9 177/177(100%) le-95 4.52 1.11 [Salmo salar] CB499451 CD9 protein (LOCI00136380), 677/677(100%) 0.0 4.40 1.17 mRNA [Salmo salar] CA048886 clone Ots.u6.23.15 genomic sequence 32/32(100%) 2e-69 4.31 1.52 [Oncorhynchus tshawytschaj CA051735 Unknown NA NA 4.15 0.58 CA041367 Clone ssal-evf-572-211 Beta-2- 428/430 (99%) 0.0 4.07 1.55 microglobulin precursor putative mRNA, complete cds [Salmo salar] CB511456 Apolipoprotein-L3 [Salmo salar] 113/113(100%) le-61 4.02 1.24 CA059360 Proteasome subunit beta type-6 109/109(100%) le-48 4.00 1.62 precursor [Salmo salar] CB497413 Reproduction regulator 2 44/110(40%) 8e-14 3.98 1.08 [Epinephelus coioides] CN442498 rRNA intron-encoded endonuclease 33/62 (53%) 2e-06 3.96 1.91 [Thermoproteus sp. IC-062] CA037319 clone BAC CHORI214-30C23, 34/66(51%) le-11 3.90 0.88 complete sequence/5a/wo salar J . CA044615 Alcohol dehydrogenase class-3 66/67 (98%) le-31 3.83 1.32 [Salmo salar] CA056335 Unknown NA NA 3.75 1.16 CB500763 Clone ssal-rgb2-510-275 Beta-2- 548/552 (99%) 0.0 3.69 1.02 microglobulin precursor putative mRNA, complete cds [Salmo salar] CB493112 Transmembrane protein 85 [Salmo 167/167(100%) 5e-93 3.67 1.46 salar] CB510084 similar to mCG 1046517 [Danio 33/48 (68%) 4e-14 3.62 1.24 rerio] CA041995 clone BAC CHORI214-8I14, 39/47 (82%) 2e-21 3.61 1.37 complete sequence[Saliho salar] 275 CA051372 Proteasome subunit beta type-9 145/145 (100%) 4e-77 3.55 1.15 [Salmo salar] CB497839 clone 249L01 TCR-alpha/delta locus, 24/31 (77%) 5e-10 3.46 1.32 genomic sequence/5a/mo salar] CA064302 proteasome subunit beta iype-9a 139/139 (100%) 7e-74 3.42 0.84 [Salmo salar] BU965805 clone ssal-evf-563-041 60S acidic 21/21 (100%) le-06 3.39 1.64 ribosomal protein P2 putative mRNA, complete cdsfSalmo salar] CB498021 heat shock protein hsp9C 123/138(89%) le-61 3.31 1.15 [Oncorhynchus tshawytscha] CB492685 Barrier-to-autointegration factor B 61/66(92%) le-34 3.30 1.42 [Salmo salar] CA052500 transport-associated protein [Salmo 101/102(99%) 3e-43 3.26 0.90 salar] CB511439 Endoplasmic reticulum to nucleus 41/58(70%) 9e-18 3.18 0.91 signaling 2 [Xenopus tropicalis] CA054061 Unknown NA NA 3.17 1.06 CB489716 MHC class I heavy chain precursor 164/166(98%) le-136 3.16 0.95 (Onmy-UBA) mRNA, Onmy- UBA*201 allele, complete cds[Oncorhynchns mykiss / CA060011 Barrier-to-autointegraticn factor 96/97 (98%) 5e-50 3.04 0.80 [Salmo salar] CA053983 clone ssal-rgf-525-067 Voltage- 239/242 (98%) le-152 2.98 1.02 dependent anion-selective channel protein 1 putative mRNA, complete cdsfSalmo salar] CA044472 MHC class I heavy chain [Salmo 156/183(85%) 3e-77 2.96 0.81 trutta] CK990626 beta-2 microglobulin [Salmo salar] 180/184(97%) 6e-115 2.94 0.99 CA058088 Salmo salar clone 39N03 TCR- 22/28 (78%) le-17 2.90 0.92 alpha/delta locus; genomic sequence[Sa/«w salar] CA055186] Proteasome subunit beta type-7 117/118(99%) 3e-51 2.85 0.91 precursor [Salmo salar] CA057329 Unknown NA NA 2.82 0.89 CB517632 clone ssal-rgb2-611-368 Peripheral 200/201 (99%) le-128 2.82 0.75 myelin protein 22 putative mRNA, complete cds[Salmo salar] CA054194 Unknown NA NA 2.79 0.65 CA046860 Mitochondrial 28S ribosomal protein 49/49 (100%) 3e-22 2.78 0.67 S21 [Salmo salar] CA051402 pyruvate kinase [Salmo salar] 113/113(100%,) 9e-106 2.77 0.55 CA056199 Spermidine/spermine Nl - 149/170 (87%) 5e-84 2.77 1.05 acety[transferase [Danio rerio] CA037557 Apolipoprotein C-I [Salmo salar] 75/87 (86%) 4e-27 2.71 1.11 CB509315 Unknown NA NA 2.70 0.63 CB501070 Clone ssal-rgf-528-084 Cytochrome 704/704 (100%,) 0.0 2.69 0.59 P450 1A1 putative mRNA, complete eds [Salmo salar] CB514406 similar to mitochondrial 109/121 (90%) 3e-49 2.67 0.50 NAD+isocitrate dehydrogenase 3 beta [Equus caballus] CA063301 Periphilin-1 [Salmo salar] 26/26(100%) 5e-07 2.64 3.17 CA060239 caspase 8, apoptosis-related cysteine 44/87 (50%) le-18 2.63 0.77 peptidase [Bos taurus] CB498596 Cytochrome c oxidase polypeptide 70/76 (92%) 3e-27 2.63 1.00 Vic precursor [Salmo sdlar] CB510980 Barrier-to-autointegration factor B 97/97 (100%) 2e-50 2.57 0.67 [Salmo salar] CB505698 Barrier-to-autointegration factor B 97/97 (100%) 2e-50 2.55 0.60 [Salmo salar] CN442510 NADH dehydrogenase subunit 1 193/202(95%) 2e-77 2.55 0.62 [Salmo salar] CB508432 Unknown NA NA 2.54 0.62 CA048447 clone ssal-rgf-531-067 Tripartite 192/197(97%) 4e-125 2.52 0.72 motif-containing protein 16 putative mRNA, complete cds[Sa!mo salar] CB493889 transducin (beta)^like 2 [Danio rerio] 127/168 (75%) 5e-71 2.46 0.79 CA050178 clone BAC CHORI214-92104, 200/201 (99%) 2e-132 2.44 0.61 complete sequence/Sa/mo salar] CB512350 Unknown NA NA 2.42 0.75 CA043808 Troponin C-akin-1 protein/Sa/mo 132/135 (97%) 6e-74 2.42 0.56 salar] CA044286 CMP-sialic acid transporter [Salmo 128/140(91%) 8e-66 2.39 0.83 salar] CA049957 novel protein with a FKBP-type 88/98 (89%) 2e-46 2.39 0.49 peptidyl-prolyl cis-trans isomerase domain (zgc:73373) [Danio rerio] CB 5 095 76 Apolipoprotein C-I [Salmo salar] 75/87 (86%) 4e-27 2.38 0.85 CB511962 SJCHGC04011 protein [Schistosoma 30/49 (61%) 6e-09 2.36 0.56 japonicum] CB488274 beta-2 microglobulin type 2 25/25 (100%) 6e-10 2.35 0.64 [Oncorhynchus mykiss] CA059570 Chain D, The Crystal Structure Of 93/124 (75%) 5e-52 2.34 0.69 The Natural Fl 121 Human Sorcin CB501401 beta-2 microglobulin [Salmo salar] 25/25 (100%) 3e-07 2.34 0.55 CB516899 Unknown NA NA 2.33 0.52 CN442511 similar to ReO_6 [Danio rerio] 127/238 (53%) le-63 2.31 0.51 CK990459 40S ribosomal protein SI5a [Salmo 124/130 (95%) 4e-65 2.27 0.78 salar] CB488520 Barrier-to-autointegration factor 29/34 (85%) 2e-10 2.20 0.53 [Salmo salar] CB490371 putative H3 histone family 3B variant 71/79(89%) 5e-34 2.19 0.51 1 [Taeniopygia guttata] CA058488 reproduction regulator 2 [Epinephelus 43/82 (52%) 5e-14 2.18 0.46 coioides] CB496905 cytoplasmic dynein light chain [Aedes 88/101 (87%) 7e-46 2.18 0.63 aegypti] CA056204 Unknown NA NA 2.06 0.49 CK990356 Salmo salar clone ssal-evd-529-261 120/124(96%) 3e-79 2.05 0.50 Mitochondrial 28S ribosomal protein S6 putative mRNA, complete eds CA055070 cytochrome P450 [Diceritrarchus 89/112 (79%) 5e-47 2.03 0.38 labrax] CB505740 Fas (TNFRSF6) binding factor 1 19/26(73%) 9e-04 2.03 0.92 [Rattus norvegicus] CA768293 retinol binding protein 2a, cellular 22/27 (81%), le-05 2.03 0.20 [Danio rerio] CA041110 protein arginine methyltfansferase 1 13/15(86%) le-06 2.01 0.34 [Salmo salar] 277 CN442545 ATP synthase FO subunit 6 [Salmo 214/225 (95%) le-85 1.93 0.48 salar] CB496654 Barrier-to-autointegration factor B 63/68 (92%) 7e-31 1.91 0.42 [Salmo salar] CB498283 C18orf32 homolog [Salmo salar] 44/47 (93%) 4e-05 1.84 0.49 CK990562 procathepsin L [Oncorhynchus 87/92 (94%) 8e-46 1.80 0.21 mykiss] NA: not applicable. 278 Supplementary Table 6.3f. Microarray-identified genes that were greater than 2-fold down-regulated in RPC/NB-04-085-1 infected TO cells (72 h sampling point) relative to non-infected control TO cells (72 h sampling time point) in any 3 out of 4 technical replicate microarrays (including at least 1 dye swap). Salmonid EST Gene name of top BLASTX or Length (% E value for Average SEM accession number TBLASTx hit identity) BLAST hit Fold Change (representing microarray feature) CB501478 ATPase, Na+/K+ transporting, beta 1 26/34 (76%) 4e-07 -6.87 4.33 polypeptide [Mus musculus] CB493600 40S ribosomal protein S30 122/133 (91%) 3e-53 -5.65 3.86 [Hippocampus comes] CA059375 mRNA forputative ISG12(3) protein 603/604 (99%) 0.0 -5.48 1.58 (isgl2(3) gene) [Salmo salar] CA769476 Osteoclast-stimulating factor 1 215/216(99%) le-145 -5.05 2.93 [Salmo salar] CA054307 clone ssal-rgf-506-367 S- 220/220 2e-166 -4.74 1.72 adenosylmethionine synthetase (100%) isoform type-2 putative mRNA, complete cds[Salmo salar] CA058274 Ribosomal protein LI5 [Salmo salar] 204/204 2e-108 -4.59 2.11 (100%) CA052126 clone ssal-rgf-529-363 Serine 213/213 2e-140 -4.26 0.91 incorporator 1 putative mRNA, (100%) complete eds [Salmo salar] CA037938 Unknown NA NA -3.96 1.90 CA057485 Unknown NA NA -3.82 1.17 CA055834 clone ssal-rgb2-602-173 Ankyrin 204/204 2e-149 -3.72 1.25 repeat domain-containing protein 46 (100%) putative mRNA, complete eds [Salmo salar] CA051852 proteasome (prosome, rnacropain) 171/171 6e-91 -3.59 1.22 26S subunit, ATPase la [Salmo (100%) salar] CA063108 60S ribosomal protein LI5 [Salmo 191/191 le-99 -3.52 1.02 salar] (100%) CB501647 Zinc finger protein ZPR1 [Danio 83/96 (86%) 7e-41 -3.49 1.10 rerio] CA062451 Carassius auratus beta-catenin 19/22 (86% 5e-27 -3.43 0.63 mRNA, complete eds CB498008 clone ssal-rgf-523-240 NEDD4 33/37 (89%) 5e-78 -3.35 0.88 family-interacting protein 1 putative mRNA, complete cds[Salmo salar] CB511186 Retinoic acid receptor gamma b 471/472 (99%) 0.0 -3.33 0.62 (Rargb) gene, partial eds [Salmo salar] CB515564 novel protein similar to vertebrate 122/173 (70%) 3e-61 -3.19 0.94 myosin IC (MYGTC) [Danio rerio] CB514092 Glutamine synthetase [Salmo salar] 27/27 (100%) 6e-08 -3.19 0.64 CB501749 Unknown NA NA -3.16 1.58 CB501418 homeobox protein [Salmo salar] 32/37 (86%) 5e-24 -3.14 0.87 CB493908 Mitochondrial import inner 75/81 (92%) 2e-37 -3.03 1.27 membrane translocase subunit Tim9 279 [Danio rerio] CA037505 Snrpb2 protein [Danio rerio] 39/41 (95%) 9e-14 -3.02 0.58 CB514577 Reticulon-3 [Salmo salar] 149/149 7e-70 -3.00 0.88 (100%) CB515194 Vacuolar proton pump subunit H 148/148 9e-121 -2.95 0.87 [Salmo salar] (100%) CB514438 clone ssal-rgf-501-003 Hematological 294/296 (99%) 0.0 -2.84 1.01 and neurological expressed 1-like protein putative mRNA, complete cds[Salmo salar] CA056895 Overexpressed breast tumor protein 66/66(100%) 2e-31 -2.83 0.85 homolog [Salmosalar]'. CA770032 procathepsin B [Oncorhynchus 107/110(97%) 6e-59 -2.82 0.35 mykiss] CA046335 Cytochrome c oxidase polypeptide 70/70(100%) 2e-32 -2.78 0.80 VHI-heart, "mitochondrial precursor [Salmo salar] CB492678 clone ssal-rgf-540-101 Profilin-2 41/44(93%) 2e-100 -2.68 0.75 putative mRNA, complete cds[Salmo salar] CB515569 MYG1 protein [Bos taurus] 132/212 le-73 -2.68 0.07 CB497735 similar to alpha-aminoadipate 94/111(84%) 7e-51 -2.66 0.56 aminotransferase [Danio rerio] CB505625 Beta-galactoside-binding lectin 70/71 (98%) 2e-36 -2.65 0.49 [Salmo salar] CK991058 Unknown NA NA -2.63 0.71 CA047152 60S ribosomal protein L3 [Salmo 117/117 8e-61 -2.62 1.03 salar] (100%.) CB512171 Tryptophanyl-tRNA synthetase 85/103 (82%) 8e-44 -2.62 0.35 [Danio rerio] CA061499 clone 242N16 formin-binding protein 28/30 (93%) 2e-ll -2.60 0.51 1 gene, partial sequence and TCR gamma locus region[Sa/mo salar] CA061499 26S proteasome non-ATPase 165/213 (77%) 3e-68 -2.60 0.84 regulatory subunit SfSa'mo salar] CA767960 60S ribosomal protein LI 1 [Salmo 170/170 3e-94 -2.55 0.79 salar] (100%.) CB498513 zgc:55429 [Danio rerio] 47/66(71%) 2e-20 -2.55 0.61 CB502512 mannan-binding lectin HI precursor 123/128 (96%) 7e-67 -2.54 0.51 [Oncorhynchus mykiss]. CB510397 Galectin-3 [Salmo salar] 118/118 2e-63 -2.43 0.83 (100%) CB499653 enhancer of mRNA-decapping 134/174(77%) le-57 -2.40 0.74 protein 4 [Danio rerio]' CN442524 cytochrome c oxidase subunit 2 120/134 (89%) 6e-55 -2.38 0.37 [Salmo salar] CB516179 Na/K ATPase alpha subunit isoform 75/89 (84%.) 3e-92 -2.36 0.56 3 mRNA, complete cds [Oncorhynchus mykiss] CN442488 clone OSU IL-8 receptor (IL-8R) 55/60(91%) 9e-31 -2.31 0.80 mRNA, complete cds CA061499 CA043734 Copper transport protein ATOX1 50/50 (100%) 4e-20 -2.29 0.53 [Salmo salar] CB498465 glutathione.peroxidase 4b [Salmo 140/144(97%) le-79 -2.28 0.62 salar] CB512667 Unknown NA NA -2.28 0.32 CB500536 Methionine aminopeptidase 1 [Salmo 29/40 (72%) 7e-24 -2.28 0.41 280 salar] CB498630 Unknown NA NA -2.23 0.58 CB497664 NADH dehydrogenase 1 beta 181/183(98%) 7e-94 -2.22 0.55 subcomplex subunit 5, mitochondrial precursor [Salmo salar] CA057987 Triosephosphate isomerase 62/62 (100%) Se-21 -2.20 0.51 Triosephosphatc isomerase [Salmo salar] CA060235 Glucose-6-phosphate isomerase 93/117(79%) 3e-46 -2.19 0.43 [Plecoglossus altivelis altivelis] CB497346 Transcobalamin-2 [Salmo salar] 112/131 (85%) 4e-56 -2.18 0.08 CA055202 Unknown -2.16 0.70 CB494495 clone HM4J3203 malate 50/67 (74%) 8e-77 -2.12 0.42 dehydrogenase 1 (mdhlb) mRNA, complete cds[Salmo salar] CA061342 Paralichthys olivaceus microsatellite 17/21 (80%) 5e-07 -2.09 0.57 OF 102 sequence CA061817 Unknown NA NA -2.08 0.06 CB497719 clone ssal-rgf-522-184 Cold- 145/146 (99%) le-91 -2.00 0.62 inducible RNA-binding protein putative mRNA, complete eds [Salmo salar] CA044335 transposase [Pleuronecics platessa] 49/100 (49%) 4e-15 -1.98 0.38 CA042503 similar to UPF0466 protein 54/86 (62%) le-20 -1.95 0.58 C22orf32,mitochondrial [Danio rerio] CA058192 Unknown NA NA -1.90 0.52 CB516686 peripheral-type benzodiazepine 127/129 (98%) 2e-73 -1.89 0.47 receptor [Oncorhynchus mykiss] CA043413 Unknown NA NA -1.87 0.52 CA058100 clone ssal-eve-561-380 Stathmin 28/41 (68%) 2e-28 -1.86 0.24 putative mRNA, complete cds[Salmo salar] CK990313 clone ssal-eve-521-008 164/167 (98%) 5e-105 -1.85 0.52 Polyadenylate-binding protein- interacting protein 2 putative mRNA, complete cds[Salmo salar] CK990376 Unknown NA NA -1.82 0.46 CA062276 clone ssal-rgf-534-304 Pyruvate 142/142 2e-109 -1.78 0.36 dehydrogenase El component subunit (100%) beta, mitochondrial precursor putative mRNA,complete cds[Sa/mo salar] CB496941 transposable element tel transposase 25/64 (39%) 2e-06 -1.77 0.48 [Lycosa singoriensis] CA051628 cyclin I [Salmo salar] 180/180 le-96 -1.74 0.49 (100%) The negative signs in front of the average fold changes indicate down regulation compared to their time matched uninfected control samples. NA: not applicable. Supplementary Table 6.3g. Microarray-identified genes that were greater than 2-fold up- regulated in NBISA01 infected TO cells (72 h sampling point) relative to non-infected control TO cells (72 h sampling time point) in any 3 out of 4 technical replicate microarrays (including at least 1 dye swap). Salmonid EST Gene name of top BLASTX or Length E value for Average Fold SEM accession TBLASTx hit (% identity) BLAST hit Change number (representing microarray feature) CA041540 Drosophila odd-skipped related 2 149/173 (86%) 6e-102 11.01 8.52 [Homo sapiens] CB496669 Prefoldin subunit 1 {Salmo salarj 38/38 (100%) 8e-13 4.36 2.41 CA037733 RNase 2 [Oncorhynchus masou 91/132(68%) 2e-46 4.10 0.94 formosanus] CB497809 Cysteine-rich protein 1 [Salmo 76/78 (97%) le-42 3.88 1.72 salar] CB489043 beta-2 microglobulin (B2m) 410/419 (97%) 0.0 3.87 1.40 mRNA, [Oncorhynchus my kiss ]n CA050381 Unknown NA NA 3.72 1.19 CA055146 Vasodilator-stimulated 153/153 5e-98 3.64 1.70 phosphoprotejn [Salmo salar] (100%) CA039238 Connective tissue growth factor 76/77 (98%) le-75 3.49 1.08 [Salmo salar] CA056199 spermidine/spermine Nl- 149/170 (87%) le-83 3.47 1.06 acetyltransferase [Danio rerio] CB507515 Fatty acid-binding protein, heart 134/135(99%) 2e-71 3.19 1.02 [Salmo salar] CA043660 Nuclear receptor subfamily 0 group 532/533 (99%) 0.0 3.19 1.21 B member 2 (nr0b2) [Salmo salar]" CA058330 Salmo salar clone ssal-rgf-528-144 87/98 (88%) 2e-104 3.02 0.66 ADP-ribosylation factor 1 putative mRNA, complete cds[Sal."no salar] CB491069 42Sp50 [Oryzias latipes] 80/98 (81%) 5e-38 2.95 0.85 CB494414 ATP synthase subunit b, 152/156(97%) 5e-80 2.84 0.66 mitochondrial precursor [Salmo salar] CB514489 Unknown 2.83 1.05 CB491826 Glyceraldehyde-3-phosphiite 161/162(99%) le-85 2.83 0.71 dehydrogenase [Salmo salar] CB492525 Finkel-Biskis-Reiily murine 132/133 (99%) 2e-58 2.75 0.57 sarcoma virus ribosomal protein S30 [Salmo salar] CA052268 Histone H2A.X [Salmo salar] 100/100 2e-49 2.65 0.68 (100%) CB492774 S-formylglutathione hydrolase 119/122(97%) 4e-65 2.64 0.99 [Salmo salar] CB512083 Unknown NA NA 2.63 0.96 CA058804 clone ssal-evf-516-263 ARMET 240/240 4e-158 2.60 0.68 precursor putative mRNA, (100%) complete cds[Salmo salar] CB514460 Glyceraldehyde-3-phosphate 200/200 le-110 2.59 0.75 dehydrogenase [Salmo salar] (100%) CB493939 Gamma-aminobutyric acid 68/76 (89%) 9e-95 2.56 0.92 282 receptor-associated protein-like 1 [Salmo salar] CA042013 similar to MGC85016 protein 41/55 (74%) 2e-16 2.56 0.80 [Danio rerio] CB503155 Splicing factor, arginine/serine-rich 92/92(100%) 6e-39 2.43 0.66 2 [Salmo salar] CA060968 60S ribosomal protein LI8a [Salmo 175/176(99%) 6e-100 2.43 0.98 salar] CN442538 cytochrome c oxidase subnnit I 161/186 (86%) 4e-78 2.41 0.90 [Salmo salar] CB499584 Importin subunit alpha-2 [Salmo 203/213 (95%) 9e-101 2.40 0.60 salar] CK991270 tryptophanyl-tRNA synthetase 22/31 (70%) 3e-05 2.31 0.50 [Xenopus laevis] CB511647 clone ssal-rgb2-649-244 Enhancer 255/259 (98%) 0 2.29 0.51 of yellow 2 transcription factor homolog putative mRNA, complete cds[Salmo salar] CA057148 Uroporphyrinogen decarboxylase 112/112 4e-117 2.27 0.78 [Salmo salar] (100%) CA052125 Pyridoxal phosphate phosphatase 247/247 3e-162 2.17 0.75 PHOSPH02 (100%) [Salmo salar] CA769281 Unknown 2.14 0.50 CA061234 Aquaporin-1 [Salmo salar] 238/239 (99%) 3e-165 2.09 0.42 CK991141 Unknown NA NA 2.08 0.49 NA: not applicable. Supplementary Table 6.3h. Microarray-identified genes that were greater than 2-fold down-regulated in NBISA01 infected TO cells (72 h sampling point) relative to non- infected control TO cells (72 h sampling time point) in any 3 out of 4 technical replicate microarrays (including at least 1 dye swap). Salmonid EST Gene name of top BLASTX Length (% E value for Average SEM accession or TBLASTx hit identity) BLAST hit Fold number Change (representing microarray feature) CB517144 aldolase a, fructose- 43/48 (89%) 4e-17 -67.35 65.49 bisphosphate, \Danio rerio] CA060846 Unknown -17.36 14.70 CB497409 transposase-like [Salmo salar] 22/29 (75%) 9e-15 -6.37 3.14 CA060050 Homeobox protein HoxB13ab 421/471 (89%) 2e-171 -5.46 2.43 (HoxB13ab) [Salmo salar]" CA062564 Unknown NA NA -5.15 2.18 CA042562 Calcyclin-binding protein 205/205 (100% 2e-138 -4.89 1.60 [Salmo salar] CA056760 EAP30subunitofELL 33/39 (84%) 4e-22 -4.82 2.16 complex a (Eap30a), [Salmo salar] CK990829 cloneBACCH189M18, 28/33 (84%) 2e-43 -4.69 1.64 complete sequence[&3/mo salar] CB502787 Lysosomal protective protein 250/252 (99%) 4e-168 -4.56 1.74 [Salmo salar] CB511955 AP-2 complex subunit mu-1 245/249 (98%) 5e-169 -4.33 2.61 [Salmo salar] CA060959 Tripeptidyl-peptidase 1 [Salmo 219/220(99%) 6e-149 -4.31 1.91 salar] CA061434 26S proteasome non-ATPase 129/129(100%) le-92 -4.20 1.26 regulatory subunit 7 like 2 [Salmo salar] CA059530 clone ssal-rgf-514-256 34/46 (73%) 4e-12 -3.96 1.56 Galectin-9 putative mRNA, complete cds[Salmo salar] CA057475 clone ssal-rgf-530-169 147/147 (100%) le-102 -3.89 1.26 Eukaryotic translation initiation factor 5A-1 putative mRNA, complete cds[Salmo salar] CB509631 Unknown NA NA -3.89 1.63 BU965677 NADH dehydrogenase subunit 46/50 (92%) 2e-18 -3.73 1.11 5 [Procypris rabaudi] CA055066 myelin transcription factor 1 75/93 (80%) le-34 -3.58 1.65 [Gallus gallus] CA060971 Signal peptide peptidase-like 39/60 (65%) 5e-15 -3.57 1.10 2A [Gallus gallus] CA047553 familial mediterranean fever 19/21 (90%) 4e-04 -3.50 1.03 locus genomic sequenceftfomo sapiens] CK990571 Unknown NA NA -3.19 1.03 CK990796 osteopontin-like protein 36/49 (73%) 9e-45 -3.18 1.05 [Oncorhynchus mykiss] CA055608 Splicing factor, arginine/serine- 182/183 (99%) 5e-132 -3.15 0.75 rich 16 [Salmo salar] CA056601 Unknown NA NA -3.12 1.25 CB492136 cystatin [Oncorhynchus 104/106(98%) 3e-46 -3.12 0.87 mykiss] CA044190 clone 63110 growth hormone 2 20/25 (80%) 2e-28 -3.11 1.01 gene, complete cds; [Salmo salar] CA037513 ribosomal protein L34 [Salmo 115/117(98%) 2e-58 -2.86 1.01 salar] CK991263 NADH dehydrogenase 1 beta 183/192(95%) 3e-101 -2.79 0.70 subcomplex subunit 8, mitochondrial precursor [Salmo salar] CB496545 clone ssal-rgf-514-227 155/161 (96%) le-108 -2.79 0.94 Ubiquitin-conjugating enzyme E2 D2 putative mRNA, complete cds [Salmo salar] CK990857 Nuclear transcription factor Y 22/46 (47%) 5e-19 -2.65 0.75 subunit alpha [Salmo salar] CK990552 Unknown NA NA -2.61 0.67 CB516922 60S ribosomal protein L7 153/153 (100%) 4e-113 -2.60 0.55 [Salmo salar] CB502406 Salmo salar clone BAC 48/71 (67%) le-69 -2.57 0.69 CHORI214-523M19, complete sequence CB488577 H3 histone, family 3A [Homo 133/133 (100%) 5e-68 -2.55 0.94 sapiens] CA769476 Osteoclast-stimulating factor 1 215/216(99%) le-145 -2.54 0.30 [Salmo salar] CB509513 similar to Tubulin beta-6 chain 205/233 (87%) 5e-110 -2.47 0.68 (Beta-tubulin class-VI) [Danio rerio] CB492839 Altantic salmon ependymin 369/428 (86%) 2e-139 -2.44 0.17 (SS-II) gene, complete cds [Salmo salar] CB516715 Pyruvate kinase muscle 35/37 (94%) 6e-66 -2.44 0.48 isozyme [Salmo salar] CA043166 CD63 protein [Oncorhynchus 69/70 (98%) 3e-32 -2.42 0.73 mykiss] CB492804 heat shock protein 90, beta 36/39 (92%) 2e-ll -2.42 0.50 (grp94), member 1 [Danio rerio] CB498204 Unknown NA NA -2.41 0.36 CA055935 clone ssal-evd-553-374 35/46 (76%) 3e-23 -2.41 0.44 Probable protein BRICK! putative mRNA, complete cds[Salmo salar] CK991026 myelin expression factor 2 67/78 (85%) 3e-33 -2.40 0.62 [Danio rerio] CA053992 Mps one binder kinase 122/123 (99%) 3e-69 -2.39 0.68 activator-like 2A [Salmo salar] CA043014 SJCHGC03009 protein 31/37(83%) le-13 -2.36 0.65 [Schistosoma japonicum] CA051772 similar to FHA domain, 49/100(49%) 2e-15 -2.34 0.40 putative [Ornithorhynchus anatinus] CB510047 basic leucine zipper and \V2 60/69 (86%) 2e-2S -2.31 0.65 domains la [Danio rerio] CN442497 cytochrome c oxidase subunit 199/211 (94%) 6e-98 -2.30 0.70 III [Oncorhynchus mykiss] CA050722 X72950 X.laevis H31 gene for 24/30 (80%) le-04 -2.24 0.68 histone H3 [Xenopus .laevis/ CA057015 Unknown NA NA -2.22 0.35 CB496471 Actin-related protein 2/3 146/150(97%) 4e-82 -2.22 0.33 complex subunit 3 [Salmo, salar] CB515170 Protein FAM128 [Xenopus 34/70 (48%) le-05 -2.20 0.71 (Silurana) tropicalis] CA040587 Ras association (RalGDS/AF- 115/135(85%) 2e-58 -2.19 0.55 6) domain family 8 [Danio rerio] CA060931 Unknown NA NA -2.16 0.63 CB514790 Elongation factor 2 [Salmo 158/166(95%) 6e-89 -2.16 0.46 salar] CB514430 DEAD (Asp-Glu-Ala-Asp) box 171/207(82%) 2e-72 -2.12 0.63 polypeptide 21 [Salmo salar] CK990253 clone ssal-rgf-506-303 105/121 (86%) le-60 -2.10 0.32 disulfide-isomerase A3 precursor putative mRNA, complete cdsfSalmo salar] CB510944 clone ssal-rgf-521-309 48/65 (73%) 2e-57 -2.06 0.22 Plasminogen activator inhibitor 1 RNA-binding protein putative mRNA, complete cdsfSalmo salar] CB497796 Cystatin precursor [Salmo 96/114 (84%) le-44 -2.02 0.40 salar] CB507526 Unknown NA NA -2.01 0.49 CA057711 cysteine-rich with EGF-uke 51/91 (56%) 6e-29 -2.00 0.38 domains 2 [Callus gallusj CB494613 zgc: 136474 [Danio rerio] 25/72 (34%) 5e-05 -1.99 0.23 CB511988 Signal peptidase complex 128/130(98%) 2e-68 -1.94 0.47 subunit 3 [Salmo salar] CK990334 F-box protein 9 [Danio rerio] 44/54(81%) le-18 -1.92 0.48 CA056895 Overexpressed breast tumor 66/66 (100%) 2e-31 -1.85 0.47 protein homolog [Salmo salar] CN442545 ATP synthase F0 subunit 6 214/225 (95%) le-85 -1.81 0.38 [Salmo salar] The negative signs in front of the average fold changes indicate down regulation compared to their time matched uninfected control samples Supplementary Table 6.4. Cl values, ISAV copy equivalents/ng of total RNA, and virus titer of NBISA01, and RPC/NB-04-085-1 infected TO cells. Sampling point Ct value ISAV copy number TCIDso/wellofcell (Average±SD) equivalents/ng of total monolayer(Average±SD) RNA(Average±SD) 24 hr RPC/NB- 13.38±0.33 290052±62990 10*±U1 04-085-1 24hrNBISA01 16.72±0.21 29779±3901 IQ10.3±0.07 72 hr RPC/NB- 11.55±0.35 827395±207800 ,Q 8.5±0.11 04-085-1 72hrNBISA01 10.82±0.23 1419115±270356 i Q 12.2±0.07 287 Supplementary figures MM 12 3 4 5 6 Supplementary Figure 2.1. Agarose gel electrophoresis picture of the QRT-PCR products of ISAV segment 8. Agarose gel electrophoresis of the QRT-PCR product of the day 6 ISAV infected TO cell samples primed for cDNA synthesis using three primer types (1= oligo-dT, 2= oligo-dT, 3= gene specific primer, 4= gene specific primer, 5=random hexamer, 6= random hexamer). 288 MM 0 1 2 5 *•*•« Supplementary Figure 4.1. Agarose gel electrophoresis and melting curves of QRT- PCR of products of ISAV segment 8 using RNA from haemagglutination samples. Agarose gel electrophoresis and melting curves of QRT-PCR targeting a 220-bp product on ISAV segment 8 using total RNA from haemagglutination tests at different sampling points. (A) agarose gel picture of QRT-PCR products of NBISA01 HA reactions resolved on 1% agarose gel electrophoresis and visualized by ethidium bromide staining ( MM= molecular marker, 0= non template control, 1 and 2= day 0 samples, 3 and 4= day 3 samples, 5 and 6= day 5 samples). (B) QRT-PCR melting curve of the NBISA01 HA reactions. (C) Agarose gel picture of QRT-PCR products of RPC/NB-04-085-1 HA reactions resolved on 1% agarose gel electrophoresis and visualized by ethidium bromide staining (order of the lanes is the same as in A). (D) QRT-PCR melting curve of the RPC/NB-04-085-1 HA reactions. (E) Agarose gel picture of noninfected control erythrocyte QRT-PCR product resolved on 1% agarose gel electrophoresis and visualized by ethidium bromide staining( MM=molecular marker, 0= non template control, l=day 0 samples, 2=day 3 samples, 3=day 5 samples). (F) QRT-PCR melting curve of noninfected control erythrocytes. 289 Appendix II Authors' Contribution of the Thesis Authors' Contribution for Chapter 2 Workenhe ST conducted all the experiments and wrote the manuscript. Kibenge MJ assisted in the TaqMan QRT-PCR runs and edited the manuscript. Iwamoto T assisted in the in vitro transcription, and edited the manuscript. Kibenge FS conceived the study, coordinated the research efforts, contributed in the designing, writing stages and edited the manuscript. Authors' Contributions for Chapter 3 Workenhe ST conducted all the experiments and wrote the manuscript. Wadowska DW and Wright GM instructed Workenhe ST in the use of the electron microscope, interpretation of election micrographs, and edited the paper. Kibenge MJT assisted with running the real-time RT-PCR assays. Kibenge FSB conceived the study, coordinated the research efforts and edited the paper. Authors' Contributions for Chapter 4 Workenhe ST conducted all the experiments and wrote the manuscript. Kibenge MJT helped in designing the experiments and writing the manuscript. Wright GM and Wadowska DW helped in the initial stages of conceiving the study and edited the manuscript. Groman DB helped in designing the experiments and edited the manuscript. Kibenge FSB conceived the study, coordinated the research, and helped in designing the experiments, writing and editing the manuscript. 290 Authors' Contributions for Chapter 5 Workenhe ST conducted all the experiments and wrote the manuscript. Kibenge MJT contributed in the designing of the study and provided technical guidance to Workenhe ST. Kibenge FSB coordinated all the research efforts contributed in the designing and editing of the manuscript. Authors' Contributions for Chapter 6 Workenhe ST conducted all the experiments and data analysis, and wrote the manuscript. Hori TS and Rise ML did the microarray hybridization and analysis on RNA samples provided by Workenhe ST. Hori TS and Rise ML contributed significantly to the writing and editing of the manuscript. Kibenge MJT edited the manuscript, and provided technical guidance to Workenhe ST. Kibenge FSB conceived the study, coordinated the research efforts, helped in designing the experiments, writing and editing the manuscript. 291