Exploring Nsr100/SRRM4 As a Therapeutic Target for Autism Spectrum Disorder in Mice

Exploring nSR100/SRRM4 as a therapeutic target for autism spectrum disorder in mice

Juli Wang

A thesis submitted in conformity with the requirements for the degree of Master of Science

Department of Molecular Genetics University of Toronto

I Exploring nSR100/SRRM4 as a Therapeutic Target for ASD in Mice

Juli Wang

Master of Science

Department of Molecular Genetics University of Toronto

2019

Abstract

Misregulation of nSR100 and its target microexons are common in a large proportion of ASD patients and cause ASD-associated features in mice. This thesis explores nSR100 and its target splicing program as a potential therapeutic target using a conditional knockout allele, nSR100GT. I show that nSR100 protein is effectively depleted in the cortical regions of nSR100GT mutant mice at E17.5, E18.5, and P2 stages, which correlates with phenotypes overlapping with all core behavioral domains of ASD. I show that tamoxifen-mediated rescue in prenatal nSR100GT animals restores nSR100 protein and microexon inclusion levels comparable to those observed in wildtype mice. Collectively my thesis research shows that the nSR100GT mouse strain holds the promise for examining phenotypic effects of nSR100 reactivation in ASD-like mice at different developmental stages, and complimentary models are also to be considered for investigating the therapeutic potential of targeting nSR100 in the context of ASD.

II Acknowledgments

I wholeheartedly thank for the tremendous support and educational experiences I have received from my mentors, Dr. Sabine Cordes and Dr. Benjamin Blencowe, as well as my committee members, Dr. Julie Lefebvre and Dr. John Calarco. Collectively, they have helped me forging realistic ideas about how research is like as a career, which further strengthens my belief that pursuing research will bring the best out of me – that is, providing meaningful and logical answers and, more importantly, inspirations for future endeavors to follow so that the world of biology is not only to be appreciated with awes but to be predicted and/or manipulated by mortal beings with some humble but growing certainties.

I sincerely thank for members from the labs and colleagues in the Department of Molecular Genetics who have given me hands-on and/or hands-off guidance with sincerity and generosity. Specifically, I thank Dr. Mathieu Quesnel Vallières, a highly inspiring and visionary scientist, for providing me a great amount of knowledge, encouragement, and supervisions. Not only did he offer me valuable trainings on numerous mouse-related experimental skills, he has been kind to remind me the importance of learning how to navigate between different colleagues, designing experiments with a clear vision of what questions are to be addressed, and most importantly, listening to my passion instead of my fear so as to never let any adversity to get the best of me. I also thank Dr. Serge Gueroussov and Dr. Thomas Gonatopoulos Pournatzis, two highly prolific and knowledgeable scientists who were always open to share their own experiences during our conversations throughout my four years of research experience that initiated at Dr. Blencowe’s lab, which not only helped me troubleshoot my experiments but also realize what it means to keep moving forward against all odds. Furthermore, I have benefited greatly from many stimulating scientific discussions with Dr. Ulrich Braunschweig, Dr. Robert Weatheritt, Eesha Sharma, and Mingkun Wu, four highly intellectual and erudite scientists from whom I have learned the merit of being the most critical person when it comes to judging my own data as well as evaluating the validity of other people’s arguments. Finally, I feel truly grateful to Sabine and Ben who not only try their best to provide me an inspiring research environment but also faithfully believe that everyone has his/her unique talent that deserves a chance to

III develop. Collectively, all these educational supports will keep me company throughout my scientific career path, which I will strive to pay forward at my every step forward and hence contribute very humbly but faithfully to the propagation of such noble spirit.

I feel fortunate and grateful for being a member of my family, where everyone has his/her unique temperaments but converges on one of the characteristics that unify us as a cohesive unit – that is, to enjoy the challenge of never taking the easy way out, especially with regard to finding our ways to contribute to scientific discoveries with what we are gifted for. Furthermore, I would like to thank my grandmother who has been providing me the strongest spiritual support and helping guard my moral compass so I can practice virtuousness and righteousness to my best ability when coping with inevitable cultural differences.

Last but not least, I salute to the billions of neurons and trillions of synapses, as well as all species of molecules in my body that work and collaborate with each other not only diligently but voluntarily. Not only do they strive to be always up and running in their autonomous and disciplined manners, they also share my daily endeavors and philosophies of making our existence worthwhile. I wholeheartedly wish to pay forward this favor by learning in depth about their microscopic but powerful “daily rituals” throughout my career life.

IV Table of Contents

ABSTRACT...... II ACKNOWLEDGMENTS...... III TABLE OF CONTENTS...... V LIST OF TABLES...... VII LIST OF FIGURES...... VIII LIST OF ABBREVIATIONS…...... IX

CHAPTER 1 INTRODUCTION ...... 1

1.1 AUTISM SPECTRUM DISORDERS ……………………………………………………………………...... 2

1.1.1 Clinical overviews ...... 2

1.1.2 Formulating the mode of inheritance of ASD...... 3

1.1.3 Neurological features in ASD brain s...... 6

1.1.4 Reversal of ASD-associated phenotypes in adults...... 11

1.2 TRANSCRIPTOMIC FEATURES IN POST-MORTEM ASD BRAINS…...... 12

1.2.1 Diverse RNA species implicated in ASD ...... 12

1.2.2 Spatiotemporal dynamics of the transcriptome rooted in the brain and implicated in ASD...... 13

1.2.3 Alternative splicing in the nervous system...... 16

1.2.4 Misregulation of microexon splicing and nSR100/SRRM4 in ASD...... 21

1.2.5 NSR100/SRRM4 as a molecular hub for ASD-associated abnormalities...... 22

1.3 THESIS OBJECTIVES: EXPLORING NSR100 AS A THERAPEUTIC TARGET IN MICE...... 23

1.3.1 ASD-associated features observed in nSR100+/D7-8 mice...... 23

1.3.2 The nSR100D7-8 allele and the nSR100 knockout-first allele...... 23

1.3.3 Exploration of nSR100 as a therapeutic target for ASD using mice that carry the nSR100 knockout-first allele (nSR100lox or nSR100GT)...... 25

CHAPTER 2 CHARACTERIZATION OF NSR100GT MUTANT MICE AND TAMOXIFEN-

MEDIATED REACTIVATION OF NSR100...... 28

2.1 MATERIAL AND METHODS ...... 29

2.1.1 Mouse strain and genotyping...... 29

2.1.2 RT-PCR and RT-qPCR...... 30

2.1.3 Western blotting...... 30

V 2.1.4 Tamoxifen-mediated prenatal and neonatal restoration of nSR100...... 30

2.1.5 Behavior tests...... 31

2.1.6 Open field...... 32

2.1.7 Marble burying assay ...... 32

2.1.8 Reciprocal interaction ...... 33

2.1.9 Startle response and prepulse inhibition of startle response..…...... 33

2.1.10 Three-chamber social test...... 33

2.2 RESULTS ...... 35

2.2.1 Knockout-first allele (nSR100GT) disrupts nSR100 expression and target microexons in mice ...... 37

2.2.2 nSR100GT/GT mice have reduced post-weaning survival rates……………….……...... 49

2.2.3 nSR100GT mutant mice have altered behaviors that are associated with ASD...... 51

2.2.4 Tamoxifen treatment restores nSR100 levels and wildtype-like inclusion levels of microexons in prenatal mice...... 59

CHAPTER 3 DISCUSSION AND FUTURE DIRECTIONS ...... 67

3.1 SUMMARY OF KEY FINDINGS...... 68

3.2 COMPARISON BETWEEN NSR100GT AND NSR100D7-8 ALLELES ...... 71

3.2.1 Comparison at the DNA sequence level...... 72

3.2.2 Comparison at the nSR100 transcript and protein levels as well as at the microexon AS levels...... 77

3.2.3 Comparison of survival rates...... 79

3.2.4 Comparison at the behavioral level...... 79

3.3 THE ADVANTAGES AND DISADVANTAGES OF USING THE NSR100GT ALLELE FOR CHARACTERIZATION OF nSR100 AND FOR CONDITIONAL RESCUES...... 82

3.4 ALTERNATIVE MODELS FOR STUDYING NSR100 IN THE CONTEXT OF ASD...... 83

3.4.1 CRISPR SpCas9-mediated inactivation of nSR100, Srrm3, and/or nSR100-regulated and ASD-affected microexons in adult mouse brains...... 86

3.4.2 An alternative model for re-activation of nSR100 in nSR100-deficient mice...... 93

REFERENCES ...... ….96

VI List of Tables

Table 1. Chi-square test to assess post-weaning survival rate of nSR100GT/GT mice...... 49

Table 2. Animals survived weaning-age that are used for behavioral assay after neonatal rescue (Protocol I) ...... 66

Table 3. Animals survived weaning-age that are used for behavioral assays after neonatal rescue (Protocol II) ...... 66

Table 4a. Scores for 3’ splice site strength...... 76

Table 4b. Hypothetical protein isoforms produced by the nSR100GT (GT) and nSR100D7-8 (D7-8) alleles...... 76

Table 5. Comparison between nSR100GT and nSR100D7-8 allele at the nSR100 transcript and protein levels...... 78

Table 6. Comparison between nSR100GT and nSR100D7-8 alleles with respect to the percent- spliced-in (PSI) values of nSR100-regulated microexons...... 78

Table 7. Comparison between nSR100GT and nSR100+/D7-8 mice at the behavioral levels...... 81

VII List of Figures

Figure 1. Depletion of full-length nSR100 transcript and protein in the E17.5 cortices from nSR100GT/GT and nSR100D7-8/ D7-8mice...... 39

Figure 2. Examination of nSR100 transcript and protein levels in nSR100GT/GT E18.5 and P2 cortices...... 42

Figure 3. Technical reproducibility in RT-PCR assay and semi-quantification ...... 46

Figure 4. PSI values of nSR100-regulated microexons in nSR100GT/GT E18.5 and P2 mouse cortex...... 48

Figure 5. Locomotion and habituation are not affected by the presence of the nSR100GT allele in mice.……………………………...... 54

Figure 6. Repetitive behaviors in nSR100GT mutant mice...... 55

Figure 7. Social choice test and social novelty test...... 56

Figure 8. Reduction in reciprocal interactions between nSR100GT/GT male mice...... 58

Figure 9. Sensory Hypersensitivity of nSR100+/GT and/or nSR100GT/GT and Attenuated Sensitivity to Pre-Stimulus...... 58

Figure 10. Protocols for prenatal and neonatal rescue in nSR100GT mutant mice...... 62

Figure 11. Prenatal rescue restores nSR100 full-length protein levels and PSIs of nSR100- regulated microexons in nSR100GT/GT ...... 65

Figure 12. Schematic of multiplex gene (or exon) targeting using Streptococcus pyogenes Cas9 (SpCas9) system in adult mouse brains...... 92

VIII List of Abbreviations

AAV: adeno-associated virus

ABR: auditory brainstem response

AChR: acetylcholine receptor

AS: Alternative Splicing

ASD: autism spectrum disorder

CRISPR: clustered regularly interspersed short palindromic repeats

dPSI: change in percent spliced in

DZ: dizygotic

E/I: excitatory-inhibitory ratio

EdU: 5-ethynyl-2´-deoxyuridine

EEG: electroencephalogram

EEJ: exon-exon junction syndrome

EGFP: enhanced green fluorescent protein

EUCOMM: European conditional mouse mutant resource

FDA: Food and Drug Administration

FISH: fluorescent in situ hybridization

Flp: Flipase

fMRI: functional magnetic resonance imaging

FXS: Fragile X

GO: gene-ontology

GT: genetrap construct (in texts)

GT: the knock-out-first allele, or the nSR100GT allele (in figures)

GWAS: Genome-wide association studies hnRNP: heterogeneous nuclear ribonucleoprotein

IDR: intrinsically disordered regions

IF: immunofluorescent

InDel: insertion-deletion

IP: intraperitoneal iPSC: induced pluripotent stem cell

IRES: internal ribosome entry site

KO: knockout lncRNA: long noncoding RNA

LoF: loss of function

MEG: magnetoencephalographic miRNA: micro RNA

MZ: monozygotic

NeoR: neomycin resistant

NMD: nonsense-mediated decay

nt: nucleotide

Patch-seq: patch clamp recording combined with single-cell sequencing

PAS: polyadenylation signal

PKU: Phenylketonuria

PPI: prepulse inhibition

PPI: protein-protein interaction

PSI: percent spliced in

PV: parvalbumin

RACE: rapid amplification of cDNA ends

RDn: rare and/or de novo variant

RTT: Rett syndrome

SA: splice acceptor

ScISOr-Seq: single-cell isoform RNA sequencing sgRNA: single guide RNA

SNP: single nucleotide polymorphism

SNV: single nucleotide variant ss: splice site

SST: somatostatin

TSC: Tuberous sclerosis complex

UTR: untranslated region

Chapter 1 Introduction

1.1 Autism Spectrum Disorders

1.1.1 Clinical Overview

Autism spectrum disorder (ASD) describes a set of neurodevelopmental conditions that affect more than 1% of children under the age of 8 in North America (Wingate et al, 2014), and it clinically unifies three diagnoses: autistic disorder, Asperger’s disorder, and pervasive developmental disorder–not otherwise specified (PDD-NOS). The diagnoses of ASD are based on the presence of symptoms that overlap with three behavioral domains, including defective social interactions and communications, repetitive and stereotyped behaviors, and sensory hyper- or hyposensitivity (de la Torre-Ubieta et al, 2016). High clinical heterogeneity is present in the ASD population, which is manifested by widely varied phenotypic profiles seen among ASD individuals who either display different severity of the core behavioral symptoms or different combinations of co-morbidities. In relation to the latter, comorbidities prevail collectively in 50% of ASD populations (Kohane et al, 2012), including gastrointestinal disorder, motor delay and/or deficits, epilepsy, intellectual disability, and anxiety (Geschwind, 2009; Volkmar and McPartland, 2014; Geschwind and State, 2015). Some of these comorbidities are shared between ASD and other neuropsychiatric disorders, including attention deficit-hyperactivity disorder, schizophrenia, and obsessive-compulsive disorder (de la Torre-Ubieta et al, 2016; Lundstrom et al, 2015). Furthermore, individuals with monogenic conditions and/or Mendelian syndromes such as Rett syndrome (RTT), Fragile X syndrome (FXS), Angelman syndrome, Tuberous sclerosis complex (TSC), Timothy Syndrome (TS), and cortical dysplasia-focal epilepsy syndrome are frequently seen to develop as autistic individuals. Therefore, these conditions are also considered as syndromic ASDs (syn-ASD; de la Torre- Ubieta et al, 2016).

1.1.2 Formulating the mode of inheritance of ASD.

A role of genetic factors in the etiology of ASD was first proposed in the late 1960s based on reports of familial aggregations of ASD (Folstein et al, 2001; Folstein and Rutter, 1998), soon after which the earliest evidence for a genetic basis in ASD etiology emerged from twin studies, in which environmental variations are largely excluded. These studies showed that the co-occurrence of ASD is higher in monozygotic (MZ) twins than dizygotic (DZ) twins (Folstein and Rutter, 1997; Rutter, 1995; Steffenburg, 1989) and spurred the early form of association studies in ASD, where chromosomal abnormalities were sought after in ASD patients using G-banded chromosome analysis and in situ hybridization studies (Bergbaum and Ogilvie, 2016). By the end of the 20th century, however, despite up to 80 different cytogenetic abnormalities seen in ASD patients and assignments to almost all chromosomes with the exception of 12, 14, and 20 (Gillberg, 1998), the ASD liabilities of these chromosomal features were not clear. This was primarily due to the limit on sample sizes inherent in these studies. The association of some of these abnormalities with ASD has been only recently established, owing to the information about the human genomic landscape uncovered by the human genome project, the routine assessment of genomic variations made possible by the advancement of microarray technologies, and the accessibility to large cohorts of patient samples (Marshall et al, 2008; Vorstman et al, 2005; Shen et al, 2010).

On the other hand, studies that focused on rare syn-ASD cases scored first in the gene- hunting arena by establishing causal links for allele variants with syn-ASD. The Mendelian condition that was first linked to ASD is Phenylketonuria (PKU), which was characterized as an autosomal recessive and metabolic condition even before the first case of autistic patient was described (Kanner, 1943; Foiling 1934). The linkage of ASD to PKU was inferred from the observations that autistic symptoms were pervasive in these patients and that the metabolic deficit-rescuing diet used to treat PKU populations abolished autistic symptoms in these patients (Folstein and Rutter, 1988). Later on, many more monogenic syndromes were successively associated with ASD, and linkage studies followed by research on mouse models collectively established the causalities between many syndromes and particular genes. Among these, syndromes that display high ASD-penetrance (i.e. a

high percentage in the syndromic population that develops ASD, de la Torre-Ubieta, 2016) include but are not limited to tuberous sclerosis complex (associated with ASD in 1980; displays 45% penetrance; accounted for by TSC1/2; Rosenberg and Pettegrew, 1980), Fragile X syndrome (1984, 45% penetrant, FMRP, August and Lockhart, 1984), Rett syndrome (1987, 30% penetrant, MECP2, Witt-Engerstrom and Gillberg, 1987; Wulffaert et al, 2009), Angelman Syndrome (1996, 65% penetrant, UBE3A, Steffenburg et al, 1996). However, because these rare syndromes make up only ~5% of ASD populations (de la Torre-Ubieta, 2016), the syn-ASD-causing variants were not considered risk factors that universally contribute to the occurrence of ASD contractions. Instead, a polygenic mode of ASD inheritance was most popularly hypothesized due to the prevalent notion of the “common disease-common variant theory” which dates back to the beginning of the 20th century (Galton, 1872; Fisher, 1918; Falconer, 1965; McClellan and King, 2010). The examination of this theory has been only made possible in the past two decades thanks to the development of next-generation sequencing, and the mode of ASD inheritance has now evolved to one that consists of common variants (~49% liability), rare and/or de novo variants (~10% liability), and environmental and/or currently genetically unaccountable factors (~41% liability, de la Torre-Ubieta, 2016).

In addition to the above-mentioned coarse breakdown of ASD liabilities, additional insights regarding ASD genetics provided by studies from the past two decades include the following. Firstly, the genetic architecture of ASD populations is highly heterogeneous and consists of variants that are diverse in frequency (i.e. common versus rare variants that are found in >1% and <1% of all populations, respectively, De Rubeis and Buxbaum, 2015), origin (inherited versus de novo), molecular nature (single nucleotide polymorphism that is common [SNP] or rare [SNV], insertion-deletion of <1000 nt segments [InDel], or copy number variations of >1000 nt segment [CNVs]), and phenotypic manifestations (eg. dominant, recessive, or additive; high or low expressivity; high or low penetrance, Gaugler et al, 2014). Secondly, despite the widely accepted estimation that as much as ~41% of ASD liabilities are accounted for by accumulations of high numbers of common variants each with a small disease-causing effect (Klei et al, 2012; Lee et al, 2013), the identification of such variants has been challenged by the high occurrence rates of common variants in the normal population and, subsequently, by demands for greater population size

(Geschwind and State, 2015). Thirdly, ASD-associated rare and/or de novo (RDn) variants, on the contrary, have much lower occurrence rates in normal populations and have been readily detected with statistical significance, leading different studies to converge on the following conclusions.

The ASD-associated RDns variants mainly consist of two classes: 1) CNVs often cluster at particular chromosomal segments, including 1q21, 7q11.23, 15q11-13, 16p11.2, and 22q11.2, as well as at particular genetic loci, including NRXN1, PTCHD1/PTCHD1AS, SHANK2, SHANK3, NLGN3, and NLGN4X (Weiss et al, 2008; Marshall et al, 2008; Devlin and Scherer, 2012). 2) Variants on smaller molecular scales, SNVs and small InDels, are frequently found in genes involved in synaptic biology, Wnt signaling, and translation- associated pathways. In relation to 1), accumulations of multiple rare CNVs in ASD patients correlate with more severe autistic symptoms than patients with fewer copy accumulative rare CNVs; in relation to the 2), the vast majority of ASD-associated SNVs and small InDels are rare loss-of-function (LoF) or likely gene-disrupting mutations.

Collectively, a century of accumulative effort has pivoted people’s view of ASD etiology from being the mere results of neurobiological abnormalities and/or environmental exacerbations to a spectrum of conditions, subgroups of which can be explained by genetic variations. These genetic factors are not everything, however, because unidentified factors theoretically contribute to at least 41% of ASD liability and potentially act beyond genetic interactions of risk variants. The identifications of these factors, including environmental exacerbations that add to genetic liabilities during the development of ASD symptoms, the unique network properties of the nervous system that confer efficient information exchange and circuit plasticity but also susceptibility to miswirings that can be caused, in theory, by even a few somatic abnormalities (i.e. somatic mosaicism, McConnell et al, 2017; Linker et al, 2017), and interconnections between experience-dependent processes at the molecular, cellular, synaptic, circuitry, and other network levels, can open promising avenues to the understanding of ASD etiology and the development of therapeutic interventions.

1.1.3 Neurological features in ASD brains. Two major and, to a certain extent, interrelated areas of neurological features predominate in the catalogue of ASD endophenotypes (Geschwind and State, 2015), which are defined as quantifiable and inheritable components of a complex neurological condition. One is noisy, unstable, and/or epileptiform neuronal activities in the cortical regions of ASD patients (Veliskova et al, 2018; Rubenstein and Merzenich, 2003). The other is alterations of certain neuronal network features (O’Reilly et al, 2017; Mohammad-Rezazadeh et al, 2016). In relation to the first area, a theory that has gained most appreciation is that shift of excitatory/inhibitory (E/I) ratio in synaptic activities and/or altered synaptic plasticity can contribute to the alterations in neuronal activity; however, relevant evidence has been mostly coming from molecular and cellular based experiments (Rubenstein and Merzenich, 2003; Nelson and Valakh, 2015). In relation to the second area, even less is known regarding factors that contribute to relevant abnormalities, as mechanisms underlying proper neuronal network development and maintenance remain elusive. Indeed, involvement of synapse-mediated local circuits, axon-dependent long-range connectivity, and progressive (eg. synapse formation and elaboration, axon myelination) and regressive (axon collateral and synaptic pruning) neurogenesis events have all been implicated but wait to be integrated into a synthesized theory. Mechanistic elucidation of a functioning neuronal network and of the multifaceted heterogeneities seen in ASD may make it possible to build such theory (Vogel et al, 2010; Cowan et al. 1984; Luo and O’Leary 2005).

Altered levels of neuronal activity were first described in ASD patients from electroencephalographic (EEG) and magnetoencephalographic (MEG) experiments that assay the neuronal activities of ASD patients during sleep, where frequent and random “sharp spikes” were observed in their activity profiles (Veliskova et al, 2018; Rubenstein and Merzenich, 2003). Because these EEG and MEG observations are direct readouts of postsynaptic activities elicited by pyramidal cells as opposed to observations from complementary techniques such as functional magnetic resonance imaging (fMRI) which infers neural activities indirectly from hemodynamic readouts (Mohammad-Rezazadeh et al, 2016), these observations led to a popular theory that the altered and/or epileptiform neuronal activities characteristic of ASD are accounted for by elevated excitatory synaptic activities and/or reduced inhibitory synaptic activities (i.e. disturbed E/I synaptic

homeostasis, Rubenstein and Merzenich, 2003). This theory was in line with the subsequent observations of reduced GABAergic neurons and/or related markers in both ASD live and post-mortem brains (Cellot and Cherubini, 2014). Additionally, similar to most non- syndromic forms of ASD, syndromic ASD patients also frequently display hyperactivities and seizure, which spurred studies using syndromic ASD mouse models to examine the mentioned E/I imbalance theory (Nelson and Valakh, 2015, de la Torre-Ubieta et al, 2016). As a result, changes in excitatory and/or inhibitory synaptic transmission indeed have been reported from multiple mouse studies that model ASD syndromic genes, including FMRP1, MECP2, TSC1/2, and UBE3a (Bear et al, 2004, Chao et al, 2010, Viemari et al, 2005, Wong and Crino, 2012; Wallace et al, 2012). These studies, together with sequencing studies, collectively suggest that 1) function-disrupting variants in synaptic genes, including CACNA1C, SHANK3, SYNGAP1, SCN2A, NRXN1, NLGN, and ANK2 may contribute to ASD etiology and that 2) additional key player genes are involved in various pathways, including post-synaptic translation and transcription, which not only response to neuronal activities but also, in turn, affect synaptic plasticity and homeostasis (Nelson and Valakh, 2015; Fernandez and Scherer, 2017).

In accordance with the above-mentioned genomic and animal model studies, assessing E/I balance in live ASD patients by examining features of gamma oscillations as readouts has recently become possible, owing to the establishment of our knowledge that proper gamma oscillation depends on well-orchestrated local synaptic homeostasis (Hughes, 2008). Although mixed findings of both increased and reduced neuronal activities in the form of altered local gamma oscillation profiles, as well as reduced global synchronization of gamma rhythm, have been reported, they support the theory that synaptic activities are altered in ASD patients (Veliskova et al, 2018; Cornew et al, 2012; Orekhova et al, 2007). Because of these collective observations, the theory that ASDs are synaptopathies has become a most popular one among hypotheses of ASD etiology. Nonetheless, whether and how alterations at the synapse-mediated microcircuit levels are associated with changes in neuronal activities at the global and macroscopic neuronal network level are pressing questions to address before a more holistic theory of ASD etiology can be proposed.

Altered global patterns of neuronal activity, or altered functional connectivity of a neuronal network, as an endophenotypic domain, has been recently gaining ground among hypotheses of ASD etiology. Thanks to the progress made by imaging studies coupled with network analyses, numerous global features of neuronal activity in the human brain have been uncovered both in developmental and disease contexts. Parameters usually examined in cohort studies primarily include statistical correlations between neuronal activities that occur in different cortical regions within defined timeframes, the causality or directedness between activities in different brain regions, the integration and segregation of regions that are connected, and small-world-ness (discussed below) (Vogel et al, 2010; O’Reilly et al, 2017).

An adult human brain can be seen as a network consisting of an estimated 86-billion neurons and trillions of synapses (von Bartheld et al, 2016; Micheva et al, 2010; Mouton et al, 1997), which are the building blocks of neuronal nodes between which information is passed across structures that vary widely in size from, for example, cortical columns and functional arears (eg. visual area 1 – 6) to functional systems (eg. somatosensory systems). Effective orchestrations of the delivery and processing of information between nodes can be simulated by mathematical models, many studies of which suggest that a neurotypical brain employs network connectivity patterns that fit the small-world model, in which an optimized number of connections and interconnections between nodes defined at a microscopic and/or macroscopic scale, as well as a balance of the global distributions of both long-range communications and short-range communications between nodes, are achieved so that the average steps for information to reach from one node to any other one is minimized both locally and globally (Vogel et al, 2010; O’Reilly et al, 2017). To make things more complex, brains may employ different network patterns depending on whether the context of interest is of a developmental stage or adult stage and of a resting state or a task performing-related state.

In ASD patients, a reduced long-range connectivity has been consistently observed; mixed findings of both increased and reduced local connectivity have been reported (O’Reilly et al, 2017; Mohammad-Rezazadeh et al, 2016). Upon integration of these findings via methodical models, a common trend in ASD emerged in which small-world-like features are compromised in ASD brains. Additionally, lateralization of neuronal activities has also 8

been reported from multiple studies showing higher connectivity and/or neural activities in the left hemisphere of ASD brain as compared to that in the right hemisphere. Evidence of such atypical lateralization at the network level is in line with the observations that ASD patients often display confused preferences for handedness as well as the commonly known compromised language abilities, the proper function of which has been predominantly associated with the left hemisphere (Lindel and Hudry, 2013).

The missing link between neuronal activities at the microscopic and macroscopic levels, or how local circuitries from anatomically distant regions are integrated into a functional network, is important to address for a comprehensive understanding of ASD etiology and the development of therapeutic interventions. Although a wide variety of factors have been associated with the establishment of a proper neuronal network, including regressive and progressive developmental events at the synaptic and axonal levels, these associations are broad generalizations of the roles of distinct functional units at the subcellular levels in neuronal network functioning and sometimes fall short in explaining observations from imaging studies that show, for example, ASD-associated changes of functional networks at the global level without any microscopic and/or anatomical abnormalities (at the synaptic or axonal levels, Fair et al, 2009; Dosenbach et al, 2010). To link knowledge of local anatomical and/or neuronal activity features with observations of global network activities in the context of ASD, combining mouse genetics and neural imaging studies in ASD models may be a winning approach to target anatomical structures and/or circuits in vivo under different spatiotemporal contexts with high precision relative to alternative, causal studies performed in EEG experiments that rely on external and physical stimuli, and to provide more genetic rationales for neurological properties at the network level that are affected in ASD patients.

Indeed, recent neuroimaging studies have revealed features of neuronal networks that are highly conserved between mouse and human particularly those at the cortical and subcortical regions, that have been frequently implicated in ASD (Gozzi and Schwarz, 2016). Subsequently, in the past three years, mouse genetics combined with neuroimaging studies have reported abnormalities in the neuronal network of Fmr1-/y, Cntnap2, and BTBR mutant mice (Liska and Gozzi, 2016). Specifically, all three mouse models reproduced the reduced long-ranged connectivity frequently seen in ASD patients, and neurological 9

correlates at different levels were identified in these studies, including altered anatomical properties of the corpus callosum (in Fmr1-/y and BTBR mutant mice, Haberl et al, 2015; Sforazzini et al, 2016), imbalanced interconnections between local and long-range connectivity in the cingulate and prefrontal regions (in Cntnap2 mutant mice, Liska et al, 2016), as well as E/I imbalance (in BTBR mice, Sforazzini et al, 2016).

In addition to the three individual ASD-risk genes discussed above (genes that have been reported to carry high ASD-risk variants), pathways highly implicated in ASD have also been probed for their roles in the neuronal network using similar interdisciplinary approaches. For example, misregulation of synaptic pruning was recently shown to cause impaired long-range functional connectivity in Cx3cr1 mutant mice (Liska and Gozzi, 2016; Pagani et al, 2014). Another example is related to the fact that specific modules of immune genes and glial markers are differentially regulated in ASD brains (Voineagu et al, 2011) and that neuroinflammation is commonly seen in ASD patient brains (Veliskova et al, 2018). In relation to these observations, an ASD mouse model deficient in interferon-γ, a key signaling protein for immune functioning, was recently reported to display altered neuronal activities and connectivity in the prefrontal cortex regions (Filiano et al, 2016). Similarly, another ASD mouse model with defective microglia-specific autophagy displays both altered synaptic density and impaired network connectivity (Kim et al 2016). These two models both display altered behaviors that are ASD-like and hence provide separate lines of evidence that immune dysfunction has potential roles in ASD-associated network abnormalities. Collectively, these discoveries have shown that an interdisciplinary approach combining mouse and neuroimaging studies represents a novel and promising avenue to start addressing causal links between molecular abnormalities and ASD-associated alterations of neuronal circuitries at both microscopic and macroscopic levels. In particular, genes that are involved in E/I homeostasis, neuronal activity, activity-dependent signaling cascades, neuronal cell adhesion, and axon formation and maintenance (Berg and Geschwind, 2012; Rubenstein and Merzenich, 2003; Fernandes and Scherer, 2017) may be good candidates for modeling in mice so as to probe for their roles in establishing and/or maintaining certain neuronal network properties that are affected in ASD.

1.1.4 Reversal of ASD-associated phenotypes in adults.

ASD has been described as a spectrum of neurodevelopmental disorders, based on the observations of early onsets of core behavioral symptoms as well as atypical neurophysiological features during infancy, where developmental events are still actively altering the anatomical and functional networks in the human brain (Vogel et al, 2016; O’Reilly et al 2017; Orekhova et al 2014). However, causal links between these developmental deficits and ASD core behaviors have been unclear and challenging to address by studying human patients. On the other hand, several syndromic ASD or ASD high risk variants, when introduced to mouse postnatally, are sufficient to reproduce ASD- related core behaviors seen in permanent knockout (KO) mouse models, including Nrxn (reduced sociality and increased repetitive behavior, Rabaneda et al, 2014), Tsc1(same as in Nrxn mutants, McMahon et al, 2015), and Mecp2 (same as in Nrxn mutants with increased anxiety and hypersensitivity reported as well, Chen et al, 2001; Gemelli et al, 2006) mutant mice. Conversely, rescues of ASD-associated social deficits, repetitive behavior, and/or hypersensitivity have been achieved by genetic or pharmaceutical manipulations specifically carried out in adult ASD mouse models, including BTBR, Fmr1, Tsc2, Scn1a, Cntnap2, Shank2, and Shank3 mutant mice (Silverman et al, 2010; de la Torre-Ubieta et al, 2016), as well as maternal immune activation-induced ASD-like mice (Naviaux et al, 2014). In the case of pharmaceutical manipulations, compounds that were shown to successfully reverse ASD-associated behaviors include those that interfere with activity-dependent translation (i.e. Rapamycin, 5-hydroxytryptamine; dopamine) and purine metabolism (i.e. antipurinergics), mGluR5 metabotropic glutamate receptor (i.e. MPEP), post-synaptic signaling (i.e. D-cycloserine, TAT-p-cofilin, CDPPB), Na+ channel (Clonazepam), as well as FDA-approved drugs with no known mechanism of action (eg. Risperidone). Interestingly, among the three ASD core behavioral domains, the social deficit domain has been most frequently rescued in these studies as opposed to the stereotyped behavior and communication deficits, as well as hyper-sensitivity. Specific examples include Clonazepam-rescued Scn1a mutant mice, CDPPB and DCS rescued Shank2 mutant mice, and rapamycin-rescued Tsc2 mutant mice (Penagarikano et al, 2011; Han et al, 2012; Won et al, 2012; Tang et al, 2014; Ehninger et al, 2008; de la Torre-Ubieta et al, 2016). Coinciding with behavioral rescues, alleviations of neuronal activity-related abnormalities

were seen in many of these mutant mice. Collectively, these lines of evidence not only suggest an intimate link between neuronal activities and ASD-associated social deficits but also imply reversals of certain ASD-associated symptoms may be achieved in adults.

1.2 Transcriptomic features in post-mortem ASD brains

1.2.1 Diverse RNA species implicated in ASD

The transcriptome plays an essential role in the central dogma of molecular biology (Crick et al, 1970) and contributes to various processes that underlie the organization of genetic information in a biological system. On the one hand, it serves to deliver information, often in the form of spliced transcripts in human, across the genome to the proteome. On the other hand, it provides a platform on which an additional symphony of regulatory layers cross-talk with each other as a result of well-orchestrated interactions among various RNA species and their interaction partners. These regulatory layers include but are not limited to transcriptional regulations, RNA splicing, RNA modification and other forms of epigenetic regulation, and RNA degradation, localization, and transport, as well as enzymatic activities of ribonucleoprotein, organelle-like and/or higher order protein assemblies, and regulated chromosomal organization. Key players in these regulated processes, either acting in trans or cis, include micro RNA (miRNA), small nuclear RNA (snRNA), small nucleolar RNA (snoRNA), ribosomal RNA(rRNA), transfer RNA (tRNA), heterogeneous nuclear RNA (hnRNA), long non-coding RNA (lncRNA), and likely other species (eg. circular RNA). Recently, RNA-sequencing and microarray studies have uncovered multiple species of RNAs that are widely affected in ASD brains. This was recently reviewed systematically by Quesnel-Vallières et al. (2018), who highlight alterations of miRNA, snoRNA, and lncRNA regulation in the context of ASD etiology. Together with risk genes implicated from genomic association studies, neuroimaging studies, and mouse research, these transcriptomic findings have expanded the endophenotype catalogue of ASD. These findings have helped provide further insight into the molecular basis for ASD, identify

pathways that converge on ASD-associated abnormalities, and propose candidate targets for therapeutic interventions.

1.2.2 Spatiotemporal dynamics of the transcriptome rooted in the brain and implicated in ASD

Investigation of the spatiotemporal dynamics of the transcriptome in the brains of human and/or non-human primates during the past decade has not only deepened our understanding of brain development and functioning with molecular bases but also helped fit ASD-associated molecular changes (eg. alterations in the genome, epigenome, transcriptome, and proteome) in specific neurodevelopmental contexts, as well as implicating spatiotemporally defined therapeutic windows in which ASD-associated pathways can be targeted. For example, the neocortex is a region in which many areas have been frequently implicated in ASD studies (Ecker et al, 2012; Amaral et al, 2011; Rubenstein, 2011; Geschwind, 2011; Voineagu et al, 2011). Each area of the cortical region is organized along two axes, the tangential and the radial axis. Cytoarchitectural units that layer along the radial axis form a cortical column, which is repeated along the tangential axis to form functional areas such as the primary somatosensory cortex, primary motor cortex, and primary visual cortex (Lein et al, 2017). Transcriptomic studies of the human and non-human primate neocortices collected from various fetal and postnatal stages have provided great insights into the spatiotemporal dynamics of the transcriptomes in the cortical regions, including spatial differences of transcriptomic profiles being most dramatic along the radial axis (i.e. across laminae), temporal differences being most dramatic across fetal stages relative to postnatal stages, and long windows of transcriptomic transition during cortical maturation to establish an adult-like profile (Colantuoni et al, 2011; Kang et al, 2011; Bakken et al, 2016). More importantly, in the context of ASD, these studies provided rich sources of data (the BrainCloud, BrainSpan, and the NIH Blueprint Non- human Primate Atlas database) from which co-expression modules can be derived with in integrated developmental and spatial contexts. These modules are then examined for enrichment of ASD gene expression, results from which can infer whether certain molecular exacerbations and/or variations seen in ASD converge on specific spatiotemporal windows.

One of the initial studies that employed this approach was done by Parikshak and colleagues (2013), in which they reported distinct co-expression modules and inferred roles of these co-expressed gene groups in particular biological processes. For example, one module (M2 from Parikshak et al, 2013) consists of genes associated with transcriptional regulation functions, upregulated in early fetus stages, and specifically expressed in laminae that contain post-mitotic neurons. Another module (M3) shares a similar expression trajectory and developmental timelines and gene-ontology (GO)-associated functions with M2 but contains genes that are upregulated in laminae enriched in neural progenitor cells. Some other modules share the same regional specificity as M2 but display a reversed expression dynamic across the developmental timeline and are associated with functions related to synaptic or axonal maturation. Interestingly, by matching ASD-associated genes, which have been reported to either harbour ASD risk variants and/or are differentially regulated in ASD brains, to those in these modules they were able to conclude: 1) there is a list of genes that fall into two distinct networks, one containing mostly transcriptional regulators (eg. MEF2A, MEF2C, SATB1) and the other a translational regulation network with FMRP as the hub that are particularly active during early fetal development and specifically in laminae containing excitatory neurons that are frequently altered in ASD patients at the transcriptomic and/or DNA levels; and 2) there is similarly a network of synaptic formation and maturation genes that is particularly active during late fetal stages and specifically in superficial cortical layers (Parikshak et al, 2013). Furthermore, these networks are specifically enriched in ASD-risk genes and/or differentially expressed genes but not in intellectual disability (ID)-associated genes. Collectively, these results suggest that specific molecular pathways in distinct local circuits across the radial axis that are under the regulation of neocortical development may be sources of convergence for ASD- associated abnormalities and that such abnormalities distinguish ASD from ID.

Apart from the associations between ASD and specific gene modules mentioned above that are defined partially by their transcriptional dynamics along the radial axis, the global transcriptomic dynamics across the tangential axis is also altered in ASD patients. Recently, RNA-seq-based analyses of post-mortem brains revealed that attenuations of differential transcriptomic dynamics across the tangential axis between cortical areas as well as between different brain regions prevail in ASD brains (Voineagu et al, 2011; Parikshak et al,

2016). Indeed, in a typical developed human brain, the transcriptomic profiles vary widely across different brain regions, according to studies that are based on data compiled in the Allen Human Brain Atlas (Hawrylycz et al. 2012, 2015). Similarly, at the cortical level, transcriptomic profiles across different cortical areas have also been shown to vary to a milder extent but consistently so among independent studies (Bernard et al. 2012, Hawrylycz et al. 2012, Kang et al. 2011). Interestingly, although the molecular underpinning for such transcriptomic differences are largely unknown, Parikshak and colleagues (2016), aiming to study the ASD-differential transcriptome by transcriptomic profiling combined with network analysis, has linked misregulation of SOX5, a transcription factor involved in neuronal fate specification, SOX5 targets, and a list of lncRNAs to the attenuation of regional and areal transcriptomic dynamics. Similarly, Voineagu and colleagues (2011) reported a loss of frontal- and temporal-differential transcriptional dynamics not only in ASD-risk genes but also genes involved in immune responses, thereby highlighting immune genes as a source of non-genetic contributions to ASD etiology. More focused studies on specific ASD-affected transcripts will be required to evaluate the causal contributions for ASD and its progression, as well as their relations with the maintenance of a spatially differential transcriptomic profile. Collectively, these are fascinating examples of how studies with a translational drive can help infer functional properties, within a disease context, of certain molecular dynamics rooted in the brain, a profoundly conserved and complex machine that reflects the footprint of evolution across more than 500 million years (Park et al, 2018, Zhuravlev and Wood, 2018).

Despite the growing practice of multimodal studies that integrate molecular, cellular, circuit, spatial, developmental, and/or disease-related features captured in patient brains to study ASD, it has been challenging to address questions such as 1) how normally established features of these biological modes are interconnected to give rise to a system as functionally optimized and robust as a normal brain and 2) which modes, when altered, contribute to specific disease-related features as opposed to a sea of other endophynotypes, given the high phenotypic heterogeneity of ASD. A major source of challenges, specifically in the context of transcriptomic studies, is the still limited spatiotemporal resolution and a lack of neurophysiological context. For example, findings from the network and transcriptomic studies mentioned are all inferred from RNA samples pooled from multiple

cells spanning regions that overlap with multiple, at best, cortical layers or areas. Recently, neural imaging studies have led to an unprecedented appreciation of how extensively the human brain is parcellated, at least at the functional and/or structural connectivity levels (Fan et al, 2016; Glasser et al, 2016). This suggests that the vast majority of these uncharacterized and likely functional units may adopt distinct transcriptomic features that have been overlooked by transcriptomic studies performed on bulk tissues of ASD patients and human brains in general. Indeed, only recently, certain neuroimaging-identified functional units have been associated with distinct transcriptomic features, some of which have also been implicated in ASD patients (Richiardi et al, 2015; Wang et al, 2015). However, the rationality and reliability of assigning certain transcriptomic features to any neuronal circuitry units, from microscopic to macroscopic scales, still require systematic validation at high anatomical resolution as well as under neurophysiological contexts. To tackle this challenge, single-cell RNA sequencing of human brain at different developmental stages, efforts in developing and/or maturing techniques such as fluorescent in situ hybridization (FISH)-based sequencing of intact tissue sections, and patch-clamp recording combined with single-cell sequencing (Patch-seq) may help reveal a new spectrum of transcriptomic features and their implications in ASD, a set of neurological disorders with extensive neurophysiological and genetic heterogeneity.

1.2.3 Alternative splicing in the nervous system

Alternative splicing (AS) of pre-mRNA represents another layer of post-transcriptional regulation and is particularly conserved and widespread in the mammalian nervous system (Barbosa-Morais et al, 2012; Jelen et al, 2007; Merkin et al, 2012). Proteomic expansion in human is dramatically non-proportional to the number of coding genes as compared to other non-primate vertebrates; and this has been widely hypothesized to be primarily the result of highly extensive AS events that primates have evolved (Nilsen and Graveley, 2010). Recently, this hypothesis has been corroborated particularly in the context of mammalian brains by at least three lines of evidence. Firstly, human and mouse have at least 2,500 splicing inclusion or exclusion events that are differentially enriched in the brain (Irimia et al, 2014). Secondly, at least 50% of neural differential events are frame

preserving (Irimia et al, 2014). Thirdly, at least 75% of transcripts that adopt alternative isoforms detected by RNA-seq analysis are also occupied by ribosomes in various tissue types, including human and mouse brain, and among these transcripts, 65% of them are frame preserving (Weatheritt et al, 2016). These results collectively suggest that the brain encompasses at least ~1,200 tissue-specific splicing events that are likely translated into proteins and hence contribute to an expanded diversity of the brain proteome. Furthermore, the presence of complex splicing events in genes harboring multiple alternative exons, which allow the generation of an ensemble of isoforms, each resulting from a different combination of inclusion and/or exclusion events across all alternative splice sites (ss), has recently been postulated and validated in mouse neuro2A (N2a) cells (Stern-Weiler et al, 2018). This suggests that the contribution of AS events to the expansion of transcriptomics and, hence, likely of proteomics may be beyond a linear progression (i.e. the actual transcriptomic diversity may be higher than that predicted from a linear correlation between alternative exon numbers and transcript variants, Stern-Weiler et al, 2018).

Despite the implications of AS for proteomic expansion, evidence for the functional significance of alternatively spliced exons in human has only started to accumulate from case studies. For example, a systematic interrogation of how alternatively spliced coding exons may affect protein-protein interactions showed that the brain-specific exon in Bridging Integrator 1 (Bin1) is required for the protein-protein interaction (PPI) between Bin1 and Dynamin 2 (Dnm2), which facilitates endocytosis in N2a cells (Ellis et al, 2012). This study also revealed that tissue-specific cassette exons often encode residues that are enriched in intrinsically disordered regions (IDR) that are important for the modulations of PPIs, which is in line with what has been reported from a recent transcriptomic study on the human brain (Irimia et al, 2014). Recently, a study on two families of heterogeneous nuclear ribonucleoprotein (HNRNP) genes also showed that alternatively spliced exons harbored by specific HNRNP genes encode amino acid stretches that overlap with IDRs enriched in glycine/tyrosine repeats, which facilitate tyrosine-dependent multivalent assembly of hnRNPs (Gueroussov et al, 2017).

In addition to the appreciation that certain AS events act to modulate PPIs, the question of what roles AS plays in higher biological contexts such as neurodevelopment has also been addressed in multiple studies (Stamm et al, 2005; Kelemen et al, 2013; Raj and Blencowe, 17

2015). One such study shows that expressing a neural-specific exon in Unc13b is sufficient to rescue the neurite outgrowth defect of primary cortical neurons that were derived from mice deficient in the neural-specific Unc13b transcript isoform (Quesnel-Vallières et al, 2015). Two other fascinating examples are studies that employed similar approaches and uncovered essential roles of the neuronal-specific isoforms of Zfyve2 (Ohnishi et al, 2014) and Disabled-1 (Yano et al, 2010). The neural-specific exon in Zfyve27, which encodes Protrudin, can facilitate the interaction between Protrudin and vesicle-associated membrane protein-associated protein (VAP) and is required for proper neurite extension (Ohnishi et al, 2014); the neural-specific isoform of Disabled-1 is required for the neuronal migration in mouse cortices (Yano et al, 2010). Finally, in vitro studies on a splicing regulator discovered in the Blencowe lab, the neural-specific Ser/Arg related protein of 100kDa (nSR100/SRRM4, Calarco et al, 2009), also uncovered important neuronal roles of nSR100- regulated and neural-specific exons, including exon 10 in polypyrimidine tract binding protein 2 (PTBP2) and a 16 nucleotide (nt)-long exon in REST/NRSF (Calarco et al, 2009; Raj et al, 2011). PTBP2 is a splicing suppressor that is essential for embryonic development and has been shown to regulate the onset of neurogenesis in mice. The activation of PTBP2 is dependent on the inclusion of exon 10, which is activated by nSR100 and prevents otherwise the nonsense-mediated decay (NMD) of Ptbp2 transcript (Licatalosi et al, 2012). REST is an essential gene that encodes a master transcription factor, which represses the expression of neuronal upregulated genes in non-neuronal tissues. Inactivating the repressive activities of REST in neuronal cells, which is required for neuronal differentiation in vitro (Su et al, 2006; Xue et al 2013), requires the inclusion of neural- specific 16nt-long exon promoted by nSR100, an event that leads to the production of a truncated isoform REST4 with much reduced repressive activities (Raj et al, 2011). It would be interesting to examine the functional roles of these two nSR100-regulated exons by introducing them in an established nSR100-deficient mouse model (Quesnel-Vallières et al, 2015), results from which may provide validations for and/or insights into how these two neural-specific exons contribute to the essential functions of PTBP2 and REST in tightly regulated neurodevelopmental processes.

In addition to functional studies of individual neural-specific exons in vivo, studies that deplete neural-specific or -enriched splicing regulators in cell lines and/or animal models,

in which the global and neuronal splicing profile is altered as a consequence of genetic manipulations, have generally implicated for important roles for AS in the nervous system (Raj and Blencowe, 2015; Quesnel-Vallières et al, 2015; Ohnishi et al, 2014; Yano et al, 2010). Indeed, the regulation of AS depends on both trans-acting regulators and cis-acting sequence elements, the latter of which provide sites for the binding of splicing regulators of assembly of spliceosome complexes and/or serve as splicing enhancers or silencers (Barash et al, 2010). Known splicing factors identified in mice that regulate different subgroups of neuronal exons include Nova1/2, Rbfox1/2/3, Ptbp2, Elavl/Hu, Mbnl, Celf, TDP43, Slm1/2, Sam68, and nSR100 (Raj and Blencowe, 2015; Traunmuller et al, 2016; Chawla et al, 2009; Calarco et al, 2009), among which human Rbfox1/2, NOVA1, and nSR100 are frequently misregulated in ASD patients (Parikshak et al, 2016; Irimia et al, 2014). In the case of nSR100, nSR100-regulated targets are also widely mis-spliced in ASD patients (which will be discussed in the next section). In relation to RBFOX1, ASD-risk variants have also been found at the RBFOX1 loci (Parikshak et al, 2013), and mouse models have shown essential roles for RBFOX1 in the central nervous system, specifically at the levels of the AS of synaptic genes, synaptic transmission and membrane excitability, and of trans-synaptic signaling (Gehman et al, 2011; Aoto et al 2013; Li et al, 2015). Although Rbfox1 mutant mice have not been examined for ASD-associated social behaviors, the molecular and neurophysiological processes described above are often seen in established ASD mouse models. Furthermore, a very recent mouse study carried out an in-depth investigation of the relationship Rbfox1-regulated AS and ASD-associated synaptic abnormalities at a resolution defined by specific interneuron subtypes (Wamsley et al, 2018). In this study, Rbfox1 was shown to differentially affect splicing with regards to both the direction of splicing change and to the make-up of its target populations in two subtypes of cortical interneuron, parvalbumin (PV) and somatostatin (SST) interneurons. This study also showed that RBFOX1-deficiency leads to differential effects on the efferent synaptic connectivity in these two types of interneurons and likely does so through interfering with Rbfox1-regulated AS. Although evidence collected from this study is not enough to rule out that the observed AS changes are an indirect consequence of RBFOX1 depletion but a direct one of altered neuronal activities (Iijima et al, 2011; Vuong et al, 2016; Maze et al, 2015), this study nonetheless provides a fascinating example of how the dynamics of the AS network can be differentially regulated under distinct neurophysiological and/or 19

circuitry contexts and likely also contribute to the molecular basis that underlie these neurological properties.

Finally, just as the brain transcriptome adopts differential profiles across both spatial and temporal dimensions (discussed in 1.2.1), AS profiles may inherit certain spatiotemporal features on a global anatomical scale. However, studies that address such questions have been lacking due to technical difficulties shared with other transcriptomic studies. Nonetheless, a very recent study done by Gupta and colleagues has developed single-cell isoform RNA-seq (ScISOr-Seq), a method to detect complex splicing events at single-cell levels across brain regions by sequencing the full-length mRNA transcripts in cells that are collected from mouse brain without cell sorting (Gupta et al, 2018). In addition to the identification of 16,872 novel isoforms that harbour one or more AS events as a result of complex AS, the study also revealed that the multiple spliced isoforms of many genes are not only neural-specific but also display brain region-specific enrichment, including in the external granular layer (i.e. layer II in the cerebral cortex), Purkinje cell layer, and deep cerebellar nuclei. A specific example was Bin1, a gene that undergoes complex AS to generate numerous isoforms including ones that are separately specific to a particular brain regions mentioned above as well as those that are broadly expressed across all types of neurons; however, very few alternative exons harboured by Bin1 are widely expressed in non-neuronal cell types such as astrocytes, microglia, and oligodendrocyte precursors. This suggests the fascinating possibility that additional splicing regulatory mechanisms are present to differentiate neural-specific AS events further into groups of neuronal subtype- enriched events; this also raises the question of what could be the biochemical and functional differences between the various mRNA and protein isoforms derived from a single gene that undergoes regulated complex AS. In conclusion, underappreciated and/or unexplored spatiotemporal dynamics of splicing regulation may be uncovered with the advancement of molecular and biological techniques and contribute to a more comprehensive understanding of what roles AS plays in the nervous system.

1.2.4 Misregulation of microexon splicing and nSR100/SRRM4 in ASD

ASD is one of the many disorders that have been linked to mis-splicing (Scotti et al, 2016; Parikshak et al, 2016; Parras et al, 2018), and AS in ASD was first systematically examined by the Blencowe lab, which has led to the following discoveries (Irimia et al, 2014). First, mis-splicing of microexons is widespread in one-third of ASD postmortem brains, which is correlated with a significant reduction in nSR100 transcript levels (Irimia et al, 2014). Secondly, the neural- and vertebrate-specific splicing regulator nSR100 regulates more than 50% of neuronal-specific microexons. In relation to the latter, microexons are a class of 3- 27nt-long exons that are most highly conserved between mouse and human and are largely frame-preserving. Thirdly, as compared to the mostly longer cassette exons that encode residues that overlap with IDR regions (as mentioned in 1.2.2), microexons encode residues that are more concentrated in modular domains that are involved in cellular signaling, enriched in charged residues, highly surface accessible, and/or enriched in lipid binding sites, suggesting roles of microexon-encoded residues in cellular signaling, PPIs, and folding of adjacent protein domains. Fourthly, GO term analysis revealed that microexons are most highly enriched in genes associated with axogenesis and synapse biology (Irimia et al 2014), both of which have been widely hypothesized to affect local and/or global neuronal activity and network connectivity, a neurological aspect frequently implicated in ASD (Vogel et al, 2010). Finally, microexons are also enriched in ASD-risk genes or their interacting partners. For example, highly implicated ASD-risk genes such as ANK2, CASK, CADPS, and SHANK2 all harbour microexons, and these exons are frequently mis-spliced in a large proportion of ASD patients; MEF2C harbours a microexon and is a molecular hub that connects multiple gene modules that are enriched in ASD-affected genes (Voineagu et al, 2011; Parikshak et al, 2013); EIF4g harbours a microexon and encodes EIF4g which interacts with EIF4e to form a translation initiation complex. With relation to the latter, EIF4e is genetically linked to ASD, and altered EIF4e activities have been observed in ASD mouse models (Santini et al, 2013; Gkogkas et al, 2013). Of note, all of the individual microexons mentioned above are mis-spliced in ASD and, together with all other ASD-affected microexons, overlap significantly with the microexon population regulated by nSR100 (Quesnel-Vallières et al, 2016). Recently, a causal role of mis-splicing of a single microexon encoded in gene CPEB4 in ASD etiology has been identified and

validated in a mouse model (Parras et al, 2018), and this microexon is nSR100-regulated (Irimia et al, 2014). Collectively, these findings contribute to the growing evidence that misregulation of microexon AS and/or nSR100 seen in ASD may causally contribute to ASD-associated phenotypes.

1.2.5 nSR100/SRRM4 as a molecular hub for ASD-associated abnormalities

Through in vivo studies by the Blencowe and Cordes lab that examined the role of nSR100 and its AS network in ASD, a causal link between nSR100-deficiency and ASD has been established (Quesnel-Vallières et al, 2015; Quesnel-Vallières et al, 2016). In these two studies, mice carrying an nSR100 conditional-knock-out allele (referred to as nSR100Δex7-8) were generated. Remarkably, nSR100Δex7-8 heterozygotes expressing 50% normal levels of nSR100 displayed core behavioral features of ASD, including hypersensitivity, reduced sociality and reciprocal interaction, and increased social novelty avoidance. At the neuronal activity level, these mice also display altered synaptic density and morphologies, reduced transmission frequencies of both inhibitory and excitatory synapses, and reduced excitability, which collectively contribute to a disturbed E/I balance. RNA-seq was done in the whole brain of mutant and wt mice and revealed widespread microexon mis-splicing. On the other hand, rapid loss of nSR100 protein and a shift of nSR100 transcripts to non- productive isoforms can be induced in response to neuronal hyperactivity.

Network studies have proposed that ASD-associated molecular abnormalities converge on activity-dependent transcription, translation, and protein turnover-associated regulatory pathways (de la Torre-Ubieta et al, 2013; Geschwind and Berg, 2012). This raises the question of whether nSR100 serves as a molecular hub that is sensitive to ASD-associated changes of neuronal activities but also contributes to the multifaceted and ASD-linked alterations in splicing, synaptic activity, behavioral, and other levels. In conclusion, manipulating nSR100 and the nSR100-regulated splicing network may represent a promising avenue for ASD-associated therapeutic intervention.

1.3 Thesis objectives: exploring nSR100 as a therapeutic target in mice

1.3.1 ASD-associated features observed in nSR100+/D7-8 mice.

As discussed in the previous section, nSR100+/D7-8 mutant mice that carry one wildtype nSR100 (see Figure 1A for detailed genetic layout on page 38) and one nSR100D7-8 allele (Figure 1D) display ASD-associated features, including auditory hypersensitivity and attenuated pre-pulse inhibition (shown in pre-pulse inhibition assay), reduced sociality and increased social novelty avoidance (3-chamber assay), and decreased nose-to-nose interactions with strangers (reciprocal interaction assay, Quesnel-Vallières et al, 2016). These phenotypes overlap with two of the core behavior domains of ASD including social deficits as well as sensory hypersensitivity. The study prior to the behavioral characterization that was done in the Blencowe and Cordes labs also examined nSR100 D7- 8/D7-8 mice (Quesnel-Vallières et al, 2015), which are 85% perinatal lethal and display defects in various neurodevelopmental processes that are implicated in ASD, including abnormally early onset of neurogenesis, disrupted cortical layering, impaired neurite outgrowth in the diaphragm, and failure of callosal axons to cross the midline in the forebrain.

1.3.2 The nSR100D7-8 allele and the nSR100 knockout-first allele

The generation of the nSR100+/D7-8 mice is illustrated in Figure 1. Firstly, mice carrying a conditional knockout-first-allele, nSR100lox (also referred to as the genetrap allele, nSR100GT, or GT, see Figure 1C for detained genetic layout on page 38) were generated from embryonic stem cells obtained from European Conditional Mouse Mutagenesis Program (EUCOMM, Quesnel-Vallières et al, 2015). The nSR100GT allele contains a

genetrap construct (GT) downstream of exon 6, which consists of a splice acceptor followed by an IRES- β-galactosidase (or lacZ reporter) construct and a polyadenylation signal (PAS). The GT construct is upstream of a neomycin resistance construct, and the rest of the downstream sequence is largely identical to the endogenous sequence starting from exon 7. Of note, exons 7-8 and the genetrap are flanked by frt and loxP recombination sites, respectively, which are essential for genetic reactivation of nSR100 (main object of this study that is discussed in the next section) and the generation of nSR100D7-8. Secondly, nSR100GT is crossed with mice that express CMV-driven Cre, which leads to the ubiquitous and Cre-mediated removal of exons 7-8 to generate the nSR100D7-8 allele. The removal of exons 7-8 induces a frameshift and a downstream premature stop codon at exon 9, which theoretically leads to NMD of nSR100 transcripts. The integration of nSR100GT and the removal of exon7-8 was confirmed by southern blot. A western blot on lysate prepared from the whole brain of E17.5 nSR100D7-8 mutant embryos was also done, in which depletion of full-length nSR100 protein in nSR100 D7-8/D7-8 was confirmed.

In the same study, the embryos carrying the nSR100GT allele were also used to characterize the spatiotemporal regulation of nSR100 transcription across different prenatal developmental stages, which was achieved by X-Gal staining and immunofluorescent staining using anti-β-galactosidase antibody. Together with in situ RNA hybridization assay performed on wt embryos, these experiments collectively show that 1) nSR100 transcription occurs in the brain and neural tubes as early as E8.5 and is neural-specific and 2) nSR100 transcripts localize specifically to neurons throughout development stages spanning from E8.5 until at least E17.5, a stage that is two days prior to birth. Collectively, these results suggest that nSR100 expression is maintained throughout neurodevelopment in embryos.

The nSR100GT allele, in theory, can also function as a KO construct in the nSR100GT/GT animals. This is due to the presence of the PAS downstream of the lacZ reporter construct that leads to premature termination of transcription and hence depleted full-length nSR100 transcripts and full-length nSR100 protein. This allele will be used in this thesis study for the purpose of genetically reactivating nSR100 in nSR100-deficient mice, as will be discussed in detail below.

1.3.3 Exploration of nSR100 as a therapeutic target for ASD using mice that carry the nSR100 knockout-first allele

Based on our knowledge about ASD and the ASD-like nSR100+/D7-8 mice, as discussed in the previous sections, nSR100-deficiency can cause ASD-associated phenotypes and may be a molecular hub for ASD convergence. To explore the therapeutic potential of manipulating nSR100 and/or nSR100-regulated microexons, a key question should be addressed: At which developmental time point, including the adult stage, can enhanced nSR100 activity rescue ASD-like features in ASD mouse models? As mentioned in section 1.1.4, both gene reactivation and chemical interventions that were performed specifically at adult stages have been shown to successfully rescue ASD-associated social deficits in certain ASD mouse models. Therefore, it is of significant relevance to test if reactivation of nSR100 at different stages in an nSR100-deficient and ASD-like mouse model can rescue certain ASD-like features.

The conditional nSR100GT allele can address the question mentioned above for two reasons. Firstly, mice that are heterozygous or homozygous for the nSR100GT allele should have lower levels of nSR100 proteins than wt, similar to the nSR100+/D7-8 mice, and hence may display the ASD-associated behavior seen in nSR100+/D7-8 mice. Secondly, the nSR100GT allele is convenient for genetic reactivation of the full-length nSR100 transcript and hence protein, owing to the presence of frt sites that flank the GT construct, which can be removed by Flipase (Flp)-mediated recombination, allowing the restoration of wt-like levels of nSR100 transcripts. Accordingly, I aimed to address the following two specific questions.

Aim 1: Determine whether mice carrying nSR100GT alleles express nSR100 levels and display ASD-like behaviors similar to those seen in nSR100+/D7-8mice.

In order to determine if the nSR100GT allele can efficiently deplete nSR100 full-length transcripts and proteins, western blot and RT-qPCR are applied to samples collected from E17.5, E18.5, and P2 cortices to assess nSR100 protein and transcript levels, respectively. To test if the nSR100GT allele can induce skipping of nSR100-regulated microexons, RT- PCR assays were performed to test the percent-spliced-in (PSI) values for a set of 25

microexons that were seen to undergo significant skipping in nSR100D7-8 mutant mice (Quesnel-Vallières et al, 2015; Quesnel-Vallières et al, 2016). Finally, the nSR100+/GT and nSR100GT/GT mice are characterized at the behavioral level to test if they are ASD-like. As was done in the previous study carried out in the lab, the three-chamber social test, reciprocal interaction assay, and pre-pulse inhibition assay are done on these mutant animals in parallel with wt. Animals are also tested in the open field assay to examine if they display normal locomotion and habituation. Additionally, repetitive behaviors of these mutant mice are examined in a marble-burying assay to determine if nSR100-deficient mice can reproduce the motor stereotypical and repetitive behavior seen in ASD.

If the hypothesis that nSR100GT mutant mice can reproduce ASD-associated behaviors and other molecular features seen in nSR100D7-8 mutant mice is true, the above-mentioned molecular and behavioral assays in nSR100GT mutant mice should result in a phenotypic profile, in which lethalities occur at a high rate perinatally, nSR100 full-length protein and transcript are depleted, nSR100-regulated microexons are significantly more skipped in the brain, sociality and social novelty avoidance are reduced and increased, respectively, reciprocal interactions are reduced, startle responses are exaggerated, pre-pulse inhibition is frequently attenuated, and stereotypic digging behaviors are exaggerated.

Aim 2: Determine whether tamoxifen administration, at prenatal or postnatal stages, in nSR100GT mutant mice carrying Rosa26-FlpERT2 alleles can restore nSR100 levels and rescue ASD-associated phenotypes.

As will be described in detail in the Results section (see also Figure 10 on page 64), this question is addressed by tamoxifen-induced activation of Flp in nSR100GT mutant mice, which should facilitate the removal of the frt-flanked GT construct and restore normal levels of nSR100 full-length transcript and protein. This thesis explores the feasibility of using intraperitoneal (IP) injection of pregnant and fostering mothers to administer tamoxifen to embryos and neonatal pups, respectively. This thesis also examines the effectiveness of tamoxifen mediated rescue by performing western blot and RT-PCR assays on cortical samples collected from tamoxifen-treated versus oil-treated animals.

If the hypothesis that tamoxifen can successfully rescue nSR100 levels in animals through a Flp-dependent mechanism is true, restoration of nSR100 transcript and protein, as well as microexon inclusion levels, should occur in nSR100GT mutant mice that express Flp but not in Flp-negative mice and such restorations would only occur upon treatment with tamoxifen but not with the oil that was used to dissolve tamoxifen before administration.

Chapter 2 Characterization of nSR100GT Mutant Mice and Tamoxifen- Mediated Reactivation of nSR100

hapter 2 of the main bo begins here.

2 « Hea1-9 for thesis body: Heading 1 » 2.1 Material and methods

2.1.1 Mouse strains and genotyping

Mice used in this thesis carry the conditional nSR100lox, or nSR100GT allele, which is identical to the model used in the previous study conducted in the lab (Quesnel-Vallières et al, 2015). All mice used in this study were of the C57Bl/6 background. All experiments were conducted in compliance with the Animals for Research Act of Ontario and the Guidelines of the Canadian Council on Animal Care. The Centre for Phenogenomics (TCP) Animal Care Committee reviewed and approved all procedures conducted on animals at TCP. Genotyping was performed either by Transnetyx company or manually by extracting mouse tail and/or ear clips. Tissues collected from each mouse were digested with 400ul of lysis buffer and protease K (1:100) overnight at 55°C. 75ul potassium acetate (8M) and 500ul of chloroform were then added followed by 5 minutes of centrifuging at 13 krpm. Liquid from top aqueous phase was then transferred to new tubes, and 1ml of 100% EtOH was added to each tube. Tubes were then inverted followed by 2 min of centrifuging at 13 krpm. Supernatant was removed from each tube and pallet rinsed with 160ul of 70% EtOH. After a final centrifugation for 2 min at 13 krpm, EtOH was removed from each tube and the pellet was dried. Finally, 100ul H2O was added to dissolve the extracted DNA. 1ul of dissolved DNA was used for genotyping by polymerase chain reaction (PCR). PCR was performed in a total volume of 20ul PCR mix, containing 2.5ul Taq Buffer, 0.5ul dNTPs (25mM each), 5ul primer mix (5um each), 1ul MgCl2, 0.25ul Taq, and 2.75ul H2O. The following thermal cycler conditions were used to carry out amplification: 94°C 3min, 94°C 30sec, 65°C 30sec, 72°C for 1min, the last three of which are repeated for 24 cycles, followed by 72°C for 10min. The following primers were used: SRRM4-forward: TGGCTTGGGGACTCGGGAGG; SRRM4-reverse: TTCCAGCTGCCAGCCGATGC; SRRM4ko-forward: AACCTCCCACACCTCCCCCTG; Flpe-forward: CACTGATATTGTAAGTAGTTTGC; Flpe-reverse: CTAGTGCGAAGTAGTGATCAGG

2.1.2 RT-PCR and RT-qPCR

Semi-quantitative RT-PCR was performed using the QIAGEN One-Step RT-PCR kit, following the manufacturer’s instructions. 20 ng of total RNA template was used per 10 µl reaction, and run on 1.5%~ 4% agarose gels. Bands were quantified using ImageJ. For qRT-PCR, RNA was converted into cDNA using the Maxima H Minus First Strand cDNA Synthesis kit (Thermo scientific), following the manufacturer’s instructions. Real- time PCR was performed in technical triplicates using the SensiFAST SYBR No-ROX Kit (Bioline) and 2 ng cDNA per reaction. Primer sequences for PSI quantification of splicing events as well as those for quantification of nSR100 full-length transcript are identical to those published in previous studies from the lab (Quesnel-Vallières et al, 2015; Quesnel- Vallières et al, 2016).

2.1.3 Western blotting

Cortices were dissected from E17.5, E18.5, and P2 brains from embryos, lysed in Tris lysis buffer (10 mM Tris, 150 mM NaCl, 1% NP-40 and 10% glycerol) and sonicated. Protein samples were immunoblotted with an anti-nSR100 polyclonal rabbit antibody (Calarco et al., 2009) diluted at 1:5,000 overnight at 4°C. Mouse anti-tubulin (T6074, Sigma) was used at 1:5,000 and incubated for 2-3 h at room temperature. Horseradish peroxidase-conjugated anti-rabbit and anti-mouse antibodies were used at 1:5,000 and incubated for 1-2 h at room temperature.

2.1.4 Tamoxifen-mediated prenatal and neonatal restoration of nSR100

The detailed protocol is described and illustrated in Figure 10. Briefly, for prenatal rescue, nSR100+/GT; FlpERT2/FlpERT2 mice were intercrossed and tamoxifen was administered via intraperitoneal (IP) injection on day E9.5, E10.5, E11.5, E12.5 daily from 8-10 am. Tamoxifen was diluted in corn oil with 2.5% EtOH at 10mg/ml by mixing tamoxifen with

EtOH first, which is then added to corn oil. Daily doses of either 3mg or 1.5mg were performed in parallel in the first and second trial, respectively. In the third trial, the same protocol was repeated only with the 1.5mg dosage (i.e. 150ul tamoxifen injection) and on both FlpERT2 expressing and negative mice. For all three trials, embryos are harvested on E18.5, followed by dissection of cortices, which were subsequently used for western blots and RT-PCR assays.

For neonatal rescue, mating was set up similarly to prenatal rescue, followed by two different protocols. In the first protocol, following birth, each mother was IP injected with tamoxifen at 2.25mg/30g body on every third day from P2 to P20 before the body weight is recorded (i.e. a total of 7 injections of each mouse) in the morning. Brains from all tamoxifen-treated mice were harvested either upon natural death or after behavioral assays. One hemisphere of each brain was fixed and frozen in cryostat for X-Gal staining of brain sections. Cortex was dissected from the other hemisphere of each brain to assess nSR100 transcript rescue. In the second protocol, a similar experiment layout was repeated, but the injection in this trial/protocol was performed only on P12-P16 and repeated twice daily (once in the morning and once during the evening). The dosage was 3mg/30g body weight for each injection. Tamoxifen-treated animals that grew into adults were tested for their behavior and brains were harvested in the same manner as in the first neonatal rescue protocol.

2.1.5 Behavior tests

All behavior assays were performed following the same protocol described in the previous study (Quesnel-Vallières et al, 2016) and were performed on wild-type and mutant progenies resulting from the intercross between nSR100+/GT animals and were fostered by nSR100+/Δ7-8 females. All subject mice were handled daily for two weeks each for 20 seconds. Such acclimation was practiced for every cohort prior to behavioral testing. Only males or only females were tested on a given day. All apparati were disinfected with Clidox-S (Pharmacal) and washed with water between subjects for the open field assay, pre-pulse inhibition assay, and 3-chamber test assay. A clean cage was used for marble

burying and the reciprocal interaction assay. All behavioral tests were conducted between 10:00 am and 2:00 pm and were video recorded while the experimenter was monitoring the trials from a separate room, with the exception of pre-pulse inhibition assay. Behavior was either scored automatically with tracking software or manually by the observer blind to the genotype of the subject mice. In the case of marble burying, marble burying quality was assessed by two observers; the results were then compared and the average taken. Open field, 3-chamber, reciprocal interaction, marble burying, and pre-pulse inhibition tests were performed using standard protocols. During the three-chamber assay, subjects were given ten minutes to interact with an object or a stranger bait mouse that is wt (bait) for the social choice test, immediately followed by an additional ten minutes to interact with a familiar or a new stranger bait (both wt) for the social novelty test. Measurements for the pre-pulse inhibition of the startle response were acquired following the International Mouse Phenotyping Resource of Standardized Screens protocol: (https://www.mousephenotype.org/impress).

2.1.6 Open field

Mice were placed in a 40 cm X 40 cm chamber illuminated at 200 lux and left undisturbed for 20 minutes. Their movements were tracked using the VersaMax software (Accuscan Instruments) on two consecutive days to assess habituation.

2.1.7 Marble burying assay

Mice were each acclimated in separate cages for 30min before being individually placed in a clean cage that is identical to a home cage but with higher levels of accumulated bedding for digging activities. In the cage, twenty marbles were laid on top of each cage such that all marbles are equally spaced. Each subject mouse is allowed to stay in the cage and interact with bedding or marbles for 30 min, after which they are taken out and the degree to which marbles were buried was assessed. Both the number of marbles that are half covered by bedding and that of marbles fully buried under bedding are visually determined

by two observers. The numbers of marbles buried by each subject was then averaged from the two observers to generate the final data.

2.1.8 Reciprocal interaction

Two stranger mice of the same genotype and sex were placed together at the same time in a clean cage identical to their home cages and allowed to interact for 10 minutes. Trials were video recorded and then scored manually using the open-source software Boris (Friard and Gamba, 2016) by an observer blind to the genotype of subjects. Prior to the test, each subject was socially isolated for at least 30 minutes in a clean cage.

2.1.9 Startle response and pre-pulse inhibition of the startle response

The startle response and the pre-pulse inhibition of the startle response were assessed using the SR-LAB system (San Diego Instruments) and followed the International Mouse Phenotyping Resource of Standardised Screens protocol. After an acclimation period of 5 minutes, each subject was presented with 20 ms pre-pulses of varying intensities (70, 75, 80 and 85 dB) alone or preceding a 120 dB, 40-60 ms pulse by 50-120 ms. Each pre-pulse and pre-pulse-pulse trial was presented 6-10 times at 20-30 ms intertrial intervals in a pseudorandom order for a total of 30 min. Constant background noise was present at 65 dB throughout the test.

2.1.10 Three-chamber social test First, subject mice were placed in the middle (empty) chamber of a 60 cm X 40 cm three- chamber apparatus with no access to other chambers for a 5-minute acclimation period. Subjects were then allowed to move freely for 10 minutes between chambers containing either a novel object (small orange cup within containment cup), a stranger mouse (wildtype mouse of the same sex and genetic background as the subject, contained in a cup allowing physical interactions) or the middle (empty) chamber for the social choice test. Subjects were then returned to the middle chamber with no access to other chambers. Urine

and feces from the bait were removed, and the bait was moved with its containment cup to the opposite chamber. A novel mouse was inserted in a clean containment cup in the chamber where the original stranger was located for the social choice test. Access to all chambers was restored and subjects were allowed to explore freely for 10 minutes for the social novelty test. Movements were tracked using the Ethovision XT software and data were analyzed with the same custom script and tracking coordinates as that set up in the previous study (Quesnel-Vallières et al, 2016). The time of direct interaction was measured as the amount of time the nose of the subject was located at the sniffing zone, an area within 5 cm radius around the cup containing a novel mouse, a stranger mouse or an object.

2.2 Results

2.2.1 Knockout-first allele (nSR100GT) disrupts nSR100 expression and nSR100-regulated microexons in mice.

Previous analyses established that Cre expression in nSR100GT carrying mice led to a successful removal of the exon7-8 region flanked by loxP sites (Figure 1) (Quesnel- Vallières et al, 2015). These conclusions rest on an observed shift of the AseI-digested DNA fragment from 16.5Kb, which corresponds to the nSR100GT allele (Figure 1C), to 21.4Kb, which corresponds to nSR100D7-8, as detected by Southern blot (Figure 1D). Furthermore, positive signals from X-gal staining suggest that the LacZ reporter is co- +/GT expressed with endogenous nSR100 in nSR100 mice (Quesnel-Vallières et al, 2015).

GT To address whether, as expected, the nSR100 allele leads to depletion of nSR100 transcripts and protein in the embryonic cortex region, which in wildtype (wt) E17.5 embryos expresses high levels of nSR100 protein and mRNA (Quesnel-Vallières et al, 2015), I analyzed nSR100 protein and mRNA levels in tissue, which I had freshly harvested for these experiments. First, I performed RT-qPCR assays to assess how efficient nSR100GT is at depleting full-length nSR100 transcripts in E17.5 cortices by using primers that anneal to exons 6 and 8 in nSR100GT/GT mice (referred to as primer set ex6-8, purple arrowheads in Figure 1). These primers should only generate amplicons from full-length nSR100 transcripts derived from wt nSR100 alleles. As a negative control, I also tested nSR100D7- 8/D7-8 mice using the same set of primers. Since knockout efficiency at the nSR100 transcript level has not been examined in nSR100D7-8/D7-8 mice at E17.5, I repeated RT-qPCR on these mice with primers that anneal to exons 6 and 9 (referred to as primer set ex6-9, blue arrowheads in Figure 1) and expected no positive signals to be generated due to the presence of the GT construct. Indeed, no signal was detected from primer set ex6-8 in nSR100D7-8/D7-8 mice. However, positive signal with primer set ex6-9 (157bp-long) in nSR100D7-8/D7-8 mice was as high as 27.4% (SEM=3.41%) wt level on average at E17.5 stage, which is not in line with the reported depletion of the nSR100 transcript signal in

GT/GT E16.5 whole brain seen in the previous study (Figure 1E). For nSR100 mice, a positive signal with primer set ex6-8 was also detected and was on average 13.5% (SEM=1.7%) of wt levels. It has been previously confirmed in the lab from RT-qPCR standard curve assays that these two sets of primers have amplification efficiencies within the 1.8-2.0 range, which suggest the observed signals resulted from efficient amplification of template DNAs. However, the RT-qPCR products were not analyzed via agarose gel electrophoresis to confirm amplicon sizes or the overall integrity of the RT-qPCR reactions (neither was this down for the products of all other RT-qPCR assays that are described in the following sections of this thesis). Such analyses should be performed in the future. If results from the gel show that the signal indeed comes from amplicons spanning exons 6-9 (with deleted exons 7-8) and exons 6-8 in the case of nSR100D7-8/D7-8 and nSR100GT/GT mice, respectively, it is likely that leaky expression from these two alleles and cryptic splice sites downstream of exon 8 are being used to generate longer transcripts. Support for the existence of such cryptic splice sites comes from our previous analyses of nSR100 mutant mice lacking both the IRES-LacZ-HbactP-neo cassette (referred to as the LacZ-neo cassette) and exons 7-8

(Quesnel-Vallieres 2015).

Additional future experiments that can help address this question include RT-PCR assays using primers that amplify 1) regions spanning exon 6 and part of the lacZ construct, 2) regions spanning lacZ, the PAS, and part of the downstream sequence (with a ‘no reverse transcription’ control to confirm that the signal originates from RNA instead of genomic DNA), and 3) regions spanning two or more exons that are upstream of the GT construct integration site, as well as comparing the relative levels of these amplicons. If the nSR100GT allele is functional and produces no leaky-expression, signals are expected to come from (1) but not from (2). If leaky-expression is present in E17.5 brains, amplification from (2) will likely occur and generate amplicons with the expected size on agarose gels.

An alternative and more definitive assay to analyze the mRNAs arising from the nSR100 mutant alleles would be to perform northern blots or rapid-amplification of cDNA ends (RACE) followed by sequencing. Additionally, these assays should be repeated in E16.5 brains, which were previously tested by RT-PCR assays in the lab. The presence of such nSR100 transcripts in E17.5 but not in E16.5, if observed, would suggest that the nSR100 transcript in nSR100D7-8 mice may be differentially regulated at E16.5 versus E17.5 stages 36

and perhaps at other developmental stages. Finally, results from these proposed experiments would also help infer if the relative full-length nSR100 transcript levels are significantly different between nSR100GT and nSR100D7-8 mice, which can provide explanations for behavioral discrepancies seen between the two strains (which will be described in 2.2.3).

Next, I assessed the levels of nSR100 protein in nSR100GT/GT E17.5 cortices by performing WB analyses using an antibody raised against the N-terminal end of 82 amino acids of human nSR100 protein (Calarco et al, 2009). As a control, I included samples from wt and nSR100D7-8/D7-8 mice. In these Western blots, the antibody recognized an array of bands between 70kDa and 130kDa with largely reduced signal intensities in nSR100D7-8/D7-8 as compared to wt (indicated by the vertical bar and the horizontal arrow in Figure 1F). This is consistent with previous detection of nSR100 full-length protein. Additionally, the blotting result reproduced the non-specific bands that migrate at ~130kDa and slightly below ~70kDa seen in the previous study, although the signals are much more prominent and even stronger than those seen in bands corresponding to the nSR100 full-length protein. Such discrepancies may come from differences in freeze-thaw cycles or other factors not specified in the WB protocol and might be addressed by repeating WB assays on more biological replicates in the future. If artifacts are ruled out from these proposed assays, the discrepancy may also stem from the fact that WB was performed on whole brain lysates in the previous study, whereas for this thesis cortical lysates were analyzed, and the proteins that antibodies bind non-specifically may be more enriched in cortical lysates. For nSR100GT/GT mice, the full-length nSR100 protein is also largely reduced, although a trace but persistent level is seen at the 100kDa migrating zone (lanes 3-6), which is more prominent than those seen in nSR100D7-8/D7-8 mice (last four lanes). In the future, WB on serial dilutions of the lysate samples or affinity-purification coupled to mass spectrometry (AP-MS) should be performed to reach a statistically robust quantification of the percent depletion of nSR100 full-length in both nSR100D7-8/D7-8 and nSR100GT/GT mutant mice. Collectively, these results show that the nSR100GT allele strongly reduces the nSR100 full- length protein level in nSR100GT/GT E17.5 embryos at the cortical regions.

Figure 1. Depletion of full-length nSR100 transcript and protein in the E17.5 cortices from nSR100GT/GT and nSR100D7-8/ D7-8mice. (A and C) Maps of the wildtype (wt) nSR100 and the knockout-first conditional (also referred to as genetrap or GT) allele, and (B and D) schematics of tamoxifen mediated genetic rescue on nSR100GT mice and of the generation of D7-8 allele from nSR100GT mice. Sizes of all elements on the four maps reflect the relative length of regions from exon 3 to exon 9 and include exons (black bars), introns (blank lines between exons), AseI restriction sites (grey vertical arrow), Southern blot probe (grey solid bar) used in the previous study (Quesnel-Vallières et al, 2015), Frt (flagged by yellow circle) and LoxP (flagged by blue rectangular) recombination sites, lacZ reporter (green bar) containing the genetrap construct with an upstream splicing acceptor and downstream polyadenylation signal (SA and pA, both highlighted in red). Primers used for RT-qPCR to assess nSR100 transcript depletion in nSR100GT mice anneal to exons 6 and 8 (purple arrowheads) and those in nSR100D7-8 mice (blue arrowheads) to exons 6 and 9. (B) Rescue in nSR100GT mice is performed by crossing it with mice expressing a CAG promoter-driven FlpERT2 gene followed by administration of tamoxifen, which leads to functional FlpERT2 and subsequently FlpERT2-dependent recombination at the frt sites. Consequently, the gene trap is removed and wt transcript levels of nSR100 should be restored. (D) The nSR100D7-8 mice established in the previous study that show autistic-like features were generated by crossing nSR100GT mice with mice expressing CMV promoter- driven Cre recombinase that acts on loxP sites and consequently removes exon7-8. Consequently, a downstream frameshift is introduced and leads to the production of a premature stop codon that contributes to the depletion of nSR100 full-length protein. (E) RT-qPCR assay comparing the depletion efficiency of full-length nSR100 transcripts was performed with the above-mentioned primers that generate amplicons of 159bp and 157bp long, respectively, from nSR100GTand nSR100D7-8 homozygotes in parallel with wt counterparts. N (+/GT off-spring) = 3 wt and 3 GT/GT mice; N (+/D7-8 off-spring) = 2 wt and 4 D7-8/ D7-8 mice; Error bars = standard error of the mean (S.E.M.) (F) Western blotting on lysates from E17.5 cortical tissue using an antibody against nSR100. Full-length nSR100 protein migrates between 70kDa and 130kDa (vertical bar) in wt and is strongly depleted in both nSR100GT/GT and nSR100D7-8/D7-8 with the exception of bands migrating at 100kDa (arrow) where a trace level remains in some of the biological replicates of nSR100GTmice.

I repeated RT-qPCR and WB assays on E18.5 and P2 mice, results from which are relevant for the aim of this thesis to rescue nSR100 both prenatally and postnatally. Semi- quantification of protein levels was performed, based on films of different exposure lengths to avoid comparisons between bands with saturated signals. Results from WB assays show that the level of full-length nSR100 protein is strongly reduced but not totally depleted in nSR100GT/GT mouse cortices at both E18.5 and P2 (Figure 2A and 2B) stages, which express on average ~6% and ~5% wt protein levels, respectively. The remaining signals from these homozygous animals mainly come from bands migrating at 100kDa, similar to what was seen in the E17.5 cortices (Figure 1F). For heterozygous animals, full-length nSR100 levels are reduced to ~40% and ~50% of wt level, respectively, in E18.5 and P2 animals (Figure 2C). In P2 mice, interestingly, additional bands migrating at ~25 kDa and ~35kDa that are specific to mice that carry the nSR100GT and wt alleles, respectively, are observed. Whereas the former band has been reported from the previous study as the N-terminal fragment encoded by the first 6 exons of nSR100 upstream of the GT construct in nSR100GT mice, the 35kDa band has not been reported. One simple possible explanation of the presence of the 35kDa band could be a degraded fragment of nSR100 that largely encompasses the N- terminal region and can be recognized by the antibody. Alternatively, a more interesting explanation might be a shorter nSR100 transcript that contains the initial 5’exons but lacks certain internal exons that are frame-preserving. The RACE analyses proposed previously combined with follow-up analyses (e.g. RNase protection) would reveal whether such transcripts may be present.

Results from the RT-qPCR assay suggest that the transcript levels of nSR100, on the other hand, are less affected by the presence of the nSR100GT allele in both E18.5 and P2 mice (Figure 2C). In homozygous mutants, amplicon signals detected from primer set ex6-8 remain at, on average, ~50% and ~85% of wt levels in the cortices of E18.5 and P2 mice, respectively. As discussed, the exact nature and amounts of such residual transcripts remain to be determined by assays such as RT-PCR followed by sequencing, northern blots, and RACE analysis. If results show that full-length nSR100 transcripts indeed remain at substantial levels, this would suggest that the depletion effect of the nSR100GT allele is more prominent on the full-length nSR100 protein levels than on the transcript levels in the cortices of E18.5 and P2 mice. One possible explanation for such a differential effect on the

nSR100GT allele is that AS at the splice acceptor in the GT construct can lead to transcripts that harbor one or more stop codons shortly downstream of exon 6 and, subsequently, to fusion proteins lacking the region encoded by exons downstream of nSR100 exon 6. Such a possibility is in line with the observations that protein fragments migrating at ~25kDa (which is close to the predicted size of the N-terminal fragment encoded by nSR100 exons 1-6) are present in nSR100GT (Figure 2B) and nSR100D7-8 (Figure 1D from Quesnel- Vallières et al, 2015) mice but not in wt mice. The specific sequence position of nSR100GT- dependent translation termination can be tested by RT-PCR assays using primers that anneal to the exon immediately upstream of the GT construct integration site (i.e. exon 6) and to a region immediately downstream of the splice acceptor signal region, which is then followed by sequencing to determine the exact splice site and, subsequently, the exact position of the stop codon and the protein product.

A comparison made on the RT-qPCR results between cortical samples harvested from different stages (Figure 1E and Figure 2C) suggests that the depletion effect of the nSR100GT allele on nSR100 full-length transcript may weaken from E17.5 (87% reduction, Figure 1E) to E18.5 (47% reduction) and even further to P2 (15% reduction). If future assays confirm a stage-differential effect of the allele on nSR100 transcript levels, one possible explanation for such a decreased effect of the nSR100GT allele may stem from the fact that nSR100 transcript undergoes dramatic decreases starting from late embryonic stages and are low in mature neurons (Raj et al, 2014; Hubbard et al, 2013). In such a scenario, a low depletion efficiency of the nSR100GT allele at later stages (Figure 2) can be explained by the intrinsically low nSR100 transcript levels in E18.5 and P2 mice, which renders further depletion of nSR100 transcripts difficult and, subsequently, the effect of the nSR100GT allele less prominent.

Figure 2. Examination of nSR100 transcript and protein levels in nSR100GT/GT E18.5 and P2 cortices. (A and B) Western blotting on lysates from E18.5 and P2 cortical tissues using an antibody against nSR100. Full-length nSR100 protein is completely lost in homozygous mutants. (C) RT-qPCR assay comparing the depletion efficiency of full-length nSR100 transcript with the same primer set ex6-8 defined in Figure 1 was done on RNA samples prepared from the same cortical tissues used for western blots. Error bars = S.E.M. The numbers of biological replicates of each genotype used for statistical analysis are identical to those shown in A and B.

Finally, I examined whether the nSR100GT allele can affect the function of nSR100 with respect to the regulation of microexon AS. Microexons have been previously found to undergo more skipping in mice that carry one or two nSR100D7-8 alleles. Therefore, I asked whether the nSR100GT allele can also reduce the percent-spliced-in (PSI) values of nSR100- regulated events to a similar extent by carrying out RT-PCR assays followed by semi- quantifications using the software ImageJ. All RT-PCR events mentioned below have only been assayed in multiple biological replicates but not in technical replicates. Because of this and as a proxy for the technical reproducibility of RT-PCR assays as well as semi- quantifications conducted in this thesis, I analyzed the PSI data I obtained my during undergraduate studies from technical replicates of thirty events in N2a cells. Results show that PSI values from technical replicates correlate robustly (R2=0.99) with each other (Figure 3A), which indicates that technical replicates are not required in the following RT- PCR assays to achieve sufficient accuracy of PSI assessments.

First, to reproduce the PSI reductions seen in nSR100D7-8 E18.5 cortex, I performed RT- PCR on three nSR100-regulated events in nSR100D7-8 homozygotes, heterozygotes, and wt E18.5 cortex. Semi-quantifications show that PSI values obtained in this thesis strongly correlate (R2=0.97) with those reported from the previous study (Figure 3B). Next, I looked at whether these events undergo similar DPSIs in nSR100GT/GT animals as seen in nSR100D7- 8 mutant mice (Figure 4). As expected, all three events (Figure 4, labeled with red asterisks) undergo significant PSI reductions in homozygotes. Specifically, the DPSI values of Ppfia2 and Nbea are -21% and -32%, respectively, which is comparable with or greater than the DPSI values in nSR100D7-8/D7-8 mice both presented in this thesis (-18% and -28%, Figure 3B) and reported from the previous study (-24% and -23%, Figure 1B from Quesnel- Vallières et al, 2016). On the other hand, the DPSI of Ptprt (-14.4%) in nSR100GT/GT was not as dramatic as compared to that in nSR100D7-8/D7-8 mice (DPSI= -27%, Figure 4B). Biological replicates of nSR100D7-8/D7-8 mice should be examined in the near future and may confirm these findings with statistical significance. Next, I tested an additional fourteen nSR100-regulated events specifically in nSR100GT/GT mice, and the resulting PSI values are compared to those that were reported from nSR100D7-8/D7-8 mice in the previous study (Quesnel-Vallières et al, 2016). Among these events, eight displayed DPSIs in nSR100GT/GT

that are comparable (with a cut-off for similarity of 10% DPSI) to those in nSR100D7-8/D7-8 mice (Figure 4A,), whereas the other six events undergo more moderate PSI reductions (Figure 4B). Collectively, these data suggest that both nSR100D7-8 and nSR100GT promote skipping of nSR100-regulated microexons and that nSR100D7-8 alleles likely act more potently in reducing the PSIs of nSR100-regulated exons than nSR100GT alleles do. In addition, it is worth noting that PSIs seen in wt progeny of nSR100+/GT mice, in certain events, are much higher (Itsn1, Unc13b, Taf1, Dync2h1, and Arvcf, Figure 4B) or lower (Nbea, Figure 4A, and Ptprd, Figure 4B) than those reported from the wt counterparts descended from nSR100+/D7-8 mice. It is worth performing RT-PCR assay in the near future on progeny derived from nSR100+/GT and nSR100+/D7-8 mice to confirm if such differences are significance. Significant discrepancies, if seen between wt mice fostered by mothers of different genotypes, raise the possibility that maternal effects on nSR100-regulated AS are present at E18.5 or preceding stages and that this maternal effect is differentially regulated by nSR100D7-8 versus nSR100GT alleles. This is not necessarily impossible because neurogenesis occurs as early as E9.5, and one way to further test this hypothesis is to perform RT-PCR on E18.5 wt mice derived from wt, nSR100+/D7-8, and nSR100+/GT mothers and to examine the PSIs of nSR100-regulated events in these mice.

In addition to assessing the effect of nSR100GT on microexon splicing at E18.5, I asked whether the effect of the nSR100GT allele on PSIs of nSR100-regulated events persists at neonatal stages by examining P2, which is one of the stages where tamoxifen-mediated rescue (which will be discussed in 2.2.4) is carried out in this thesis. Four events were tested, which all undergo significant PSI reductions in P2 homozygous mice and two events (Itsn1 and Zmynd8) in heterozygotes (Figure 4C). Because the depletion efficiencies of nSR100 full-length protein in E18.5 and P2 homozygotes are comparable (Figure 2), I compared the DPSI of these four events between these two stages. The DPSI values of all four events are comparable between the two stages among homozygotes, with the exception of Slit2, which displays DPSIs of 21% and 13% in E18.5 and P2, respectively. Another interesting observation is that the PSI is significantly higher in P2 wt than that in E18.5 in the case of Zmynd8 (student’s t-test, p=0.0202) and Slit2 (p=0.0025) by 14% and 12%, respectively, whereas the other two events do not show differential PSIs between the two stages. This suggests that among nSR100-regulated splicing events, some are potentially 44

regulated by additional factors that confer developmental-differential PSI values and that these factors, if indeed present, may selectively control certain but not all nSR100-regulated events. In fact, a quite recent study conducted in the lab has provided evidence that is in line with such a hypothesis (Gonatopoulos-Pournatzis et al, 2018), which shows that additional factors exist and regulate with sets of ASD-associated microexons that overlap with those regulated by nSR100.

Figure 3. Technical reproducibility in RT-PCR assay and semi-quantification. (A) Correlation of the PSI values from semi-quantifications of RT-PCR results obtained from biological replicates obtained during my undergraduate studies. Each colored dot represents one event assayed in N2a cells. (B) PSI values of three events in E18.5 mouse cortical regions obtained in this thesis and from the previous study (Quesnel-Vallières et al, 2016) are compared. Each dot represents one event assayed in a particular genotype. The correlation coefficient is shown as r2 that corresponds to the dotted trend line. The solid line represents the diagonal.

Figure 4. PSI values of nSR100-regulated microexons in nSR100GT/GT E18.5 and P2 mouse cortex. (A) Events that undergo PSI reduction (DPSI) to similar extents in nSR100GT/GT and nSR100D7-8/D7-8 mice when compared to wt PSI values. (B) Events that undergo more moderate PSI reduction in nSR100GT/GT than in nSR100D7-8/D7-8 mice. Images of agarose gels show results from RT-PCR using primers that anneal to consecutive exons flanking the nSR100-regulated exons of interest. Two-tailed student’s t-test was performed to test significance. The difference in PSI values are between wt and nSR100GT/GT, which are indicated by black asterisks (*) in brackets (*p<0.05, **p<0.01, ***p<0.001). In the plot next to each gel, comparison between PSI values in nSR100GT progeny (blue solid circles) and nSR100D7-8 progeny (yellow triangle), the latter of which are data reported from Quesnel-Vallières et al, 2015 (with data of only wt and homozygotes) and Quesnel- Vallières et al, 2015 (with data of wt, heterozygotes, and homozygotes). Error bars = S.E.M. N=4 for wt and nSR100GT/GT mice. Three red asterisks (*) mark the three events reproduced in nSR100D7-8 progenies shown in Figure 3B. (C) Same as A and B, RT-PCR assays were done on P2 mouse cortex and student’s t-test was performed the significance of DPSI seen in nSR100+/GT and nSR100GT/GT mice relative to wt is indicated. DPSI values of these events in E18.5 mice from (A, B) are listed on the right side of each gel image for comparison. 48

2.2.2 nSR100GT/GT mice have reduced post-weaning survival rates

Due to the discussed discrepancies between nSR100GT/GT and nSR100D7-8/D7-8 mice, particularly at the splicing level, I asked whether phenotypes beyond the molecular levels are also differentially affected by the knockout-first (nSR100GT) and the permanent knockout (nSR100D7-8) alleles. One phenotype that can be readily examined is viability. In the case of nSR100D7-8/D7-8 mutants, a perinatal lethality as high as 85% was reported in the previous study (Quesnel-Vallières et al, 2016), which was in accordance with the observations of multiple developmental defects both in the brain and diaphragm regions. Although I was not able to determine the perinatal lethality rate of nSR100GT/GT mice, I have determined that nSR100GT/GT mice have a ~60% post-weaning survival rate with statistical confidence (Table I). This suggests that nSR100GT/GT mice have much higher perinatal survival rates than nSR100D7-8/D7-8 mice do; therefore, nSR100GT/GT mice are hypomorphs as compared to nSR100D7-8/D7-8 mice with regard to viability. For other neurodevelopmental processes affected in nSR100D7-8/D7-8 mice (Quesnel-Vallières et al, 2015), subjecting nSR100GT/GT mice to assays that were carried out in the previous study on nSR100D7-8/D7-8 mice (i.e. examinations of cortical layering, midline crossing, axon-guidance, neurite outgrowth in motor neurons) are required to determine whether the nSR100GT allele leads to hypomorphic phenotypes in mutant mice during development. Specifically, comparisons between nSR100GT/GT, nSR100D7-8/D7-8, and nSR100GT/D7-8 can help address this question.

Table 1. Post-weaning survival rate of nSR100GT/GT mice. The first column shows that progeny obtained from test- and intercrosses are both examined. The observed number of mice for each genotype that survived weaning age (in black) is followed by the predicted number of these mice (in brackets and in red), inferring from Mendelian inheritance. N=75 and 116 for test-cross and inter-cross progeny, respectively. Chi-squared test was performed to test significance. Differences between observed frequency and predicted frequency are significant both in the case of the test-cross (p=0.0126) and inter-cross (p=0.0018).

2.2.3 nSR100GT mutant mice have altered behaviors that are associated with ASD

Because the aim of this thesis was to examine whether the nSR100GT allele can lead to ASD-like behaviors and whether removal of the LacZ-neo cassette can reverse any ASD- associated phenotypes, I performed an array of behavioural tests on adult nSR100+/GT, nSR100GT/GT, and wt mice. These tests included the open field assay, marble-burying assay, three-chamber social tests, startle response and pre-pulse inhibition assay, and the reciprocal interaction assay. Because of a lack of sufficient numbers, nSR100+/D7-8 mice were not tested in parallel. However, all behavioral assays carried out in this thesis followed the same protocols described in the previous study (Quesnel-Vallieres et al 2016), with the exception of the marble burying assay, which has not yet been performed on nSR100+/D7-8 mice.

Open field assay: no significant effect the of nSR100GT allele on locomotion and habituation.

Because functional locomotion is essential for mice to actively participate in many behavioral assays (eg. 3-chamber test and reciprocal interaction test) and hence for valid interpretations to be drawn from the behaviors of subject mice, I performed open field test to assess their ability to translocate voluntarily in open areas that are comparable to a 3- chambers test setting and are larger than a reciprocal interaction test setting. Additionally, this assay was done on two consecutive days to assess the habituation behavior of mice, where traveling less distance within the same open field chamber is expected if mice become habituated to the environment on the second day. Results suggest that neither locomotion nor habituation behaviors are significantly altered in either nSR100+/GT or nSR100GT/GT mutants (Figure 5), similar to the observations reported from nSR100+/D7-8 in the previous study (Quesnel-Vallières et al, 2016).

Marble burying assay: elevated repetitiveness in the behavior of nSR100GT mutants.

The core behaviors of ASD include defective social interactions and communication, sensory hyper- or hyposensitivity, and restricted and repetitive behaviors. In relation to the

last one, one simple way to assess motor stereotypical and repetitive behavior in mice is by carrying out marble burying assays. Unlike in other assays I have mentioned, mice engaged in burying activities require limited smelling, hearing, or long-range locomotive abilities, all of which require additional assays to assess. Therefore, I first performed this marble burying assay. nSR100GT/GT mice of both sexes were more engaged in digging than wt, resulting in significantly more marbles covered with bedding, and a similar phenotype was seen also in nSR100+/GT mice that are males (Figure 6).

3-Chamber social test: Reduced locomotion of nSR100GT mutant mice in females convolutes the interpretations of mouse social behaviors.

An ASD core phenotype is reduced sociality, which can be modeled in mice via the 3- chamber social test and reciprocal interaction assays. Because the sample sizes of wt subjects (5 in female and 6 in male in the case of nSR100+/GT) were low, whether the variations among these populations are normally distributed cannot be concluded statistically. Therefore, comparisons between the mean values of different parameters of interest are done with statistical tests that do not assume normal distributions among nSR100+/GT off-spring. Such analyses have low statistical power and confers high false- negative rates. Therefore, results discussed here should be considered as preliminary, and repeating these assays with expanded cohorts is necessary for reaching any statistically confident conclusions regarding the sociality indices (i.e. social preference index and social novelty avoidance index, which are discussed below) of nSR100GT mutant mice.

During the assay, the protocol was strictly followed so that all steps and set-ups were identical to those done in the previous study. After the assay was performed and recorded, I scored the video recording of each trial on nSR100GT mice and also re-scored the videos generated from nSR100+/D7-8 mice from the previous study (Quesnel-Vallières et al, 2016). Results from my re-scoring reproduced the previously reported significant decrease and increase, respectively, in the sociality index and novelty avoidance index of nSR100+/D7-8 mice (Figure 7C, yellow diamonds). Next, I examined the behavior of progeny derived from nSR100+/GT mice. Unexpectedly, female heterozygous and homozygous mutants displayed significantly reduced locomotion during both tests and often preferred to stay immobile at certain locations instead of actively exploring all chambers (Figure 7A), and a

similar phenotype was seen in nSR100+/GT males during the social novelty test (Figure 7B, bottom panel). Because such behavior compromises the interpretation power of the three- chamber test, here I report only the sociality indices and novelty avoidance indices of male mice that actively participated in the assay and showed no significant alterations in their locomotion relative to wt (Figure 7A; Figure 7B top panel). In the case of mutant males, statistical analyses fail to detect significant deviations from wt-like behaviors with regard to their choices between a novel mouse versus an inanimate object (Figure C upper panel) or their preferences for interacting with a familiar over a stranger mouse (Figure C bottom panel).

In summary, these preliminary results show that the nSR100GT allele can affect active locomotion in female mice subjected to a 3-chamber setting, which interferes with any further interpretation of their preference towards socializing with (inferred from sociality index) or avoiding stranger mice (inferred from social avoidance index). Secondly, in the case of male nSR100GT mutants, it is not possible to conclude from the data collected in this thesis whether nSR100-deficiency impacts either the sociality index or social novelty index of mutant mice due to the limited sample sizes examined and also due to the low power inherent in the statistical tests performed here. Furthermore, similar to the fact that impaired locomotion interferes with the interpretation of social-related behaviors in mice (because it greatly reduces the chance of encounters between subjects and other mice or an inanimate object in a large open area as that in a 3-chamber setting), any aversive effects of the nSR100GT on, for example, olfaction, hearing, vision, context-dependent urination, and anxiety level, might also render the interpretations from 3-chamber assays invalid (Silverman et al, 2010). Therefore, assays such as the food retrieving test, auditory brainstem response assay, electroretinography, urinary scent marking assay, light-dark box assay, and the plus maze should be performed to assess if these primary functions are normal in nSR100GT mutants. If these behaviors are not impaired in mice carrying the nSR100GT allele, then repeating the 3-chamber assay with expanded cohorts of nSR100+/GT progeny should be conducted to reach confident conclusions regarding the sociality of nSR100GT mutant mice.

Figure 5. Locomotion and habituation are not affected by the presence of the nSR100GT allele in mice. (A and B) Normal locomotion and habituation of female (A) and male (B). The total distance each mouse traveled was calculated by summing distance traveled from each time bin, which is then compared between two days to determine the habituation index (day1/day2). Locomotion assay: Repeated measures two-way ANOVA after Bonferroni’s post hoc test; females-day 1: F (2, 46) = 0.07; females-day 2: F (2, 46) = 0.04; males-day 1: F (2, 38) = 1.91; males-day 2: F (2, 38) = 0.89. Habituation assay: D‘Agostino & Pearson omnibus normality test followed by one-way ANOVA (Dunn’s Multiple Comparison Test) N (females) = 8 wildtype, 17 nSR100+/GT, and 24 nSR100GT/GT. N (males) = 8 wildtype, 18 nSR100+/GT, and 17 nSR100GT/GT. *P < 0.05; **P < 0.005.

Figure 6. Repetitive behaviors seen in nSR100GT mutant mice. The number of ~50% covered and ~100% buried marbles are compared separately between the three pairs of genotype in females (A) and males (B). D‘Agostino & Pearson omnibus normality test followed by two-tailed Mann Whitney test was performed, from which significant differences are reported as *P < 0.05; **P < 0.005. N= 8 wt, 15 nSR100+/GT, 18 nSR100GT/GT in females. N= 7 wt, 7 nSR100+/GT, 8 nSR100GT/GT. Whiskers indicate the 10th and 90th percentiles in all box plots.

Figure 7. Social choice test and social novelty test. (A, B) Reduced activeness in female (A) and but not in male (B) progenies of nSR100+/GT mice during social choice (upper panel) and social novelty (bottom panel) tests. (C) Sociality index (upper panel, time spent with bait/time spent with inanimate object in the sniffing zones) and novelty avoidance index (bottom panel, time spent in arear absent of the stranger mouse/time spent with the stranger mouse) are determined. D’Agostino-Pearson omnibus test on all groups each followed by two-tailed t-test between each pairs of genotypes in nSR100+/D7-8 off-springs and by two- tailed Mann Whitney test in nSR100+/GT off-springs was done. *P < 0.05; **P < 0.005. s, seconds. Error bars, SEM. Orange diamonds represents progenies raised by nSR100+/D7-8 mice and tested in the previous study (Quesnel-Vallières et al, 2016), and blue circles by nSR100+/GT mice and tested in this thesis. N (female, nSR100+/D7-8 raised) =17 wt and 25 nSR100+/D7-8; N (female, nSR100+/GT raised) = 5 wt, 10 nSR100+/GT, and 11 nSR100GT/GT; N (male, nSR100+/D7-8 raised) = 23 wt, 15 nSR100+/D7-8; N (male, nSR100+/D7-8) = 6 wt, 18 nSR100+/GT, 28 nSR100GT/GT.

Reciprocal interactions assay: reduced reciprocal interactions in nSR100GT mutants.

Four wt females developed cataracts and/or corneal opacities (causes for these conditions are largely genetic) before the reciprocal interaction test was carried out. As a result, the control sample size was not large enough to perform statistically relevant analyses. Thus, only males were assayed for their reciprocal interactions. In this test, I found that nSR100GT/GT male mutants engage significantly less often in reciprocal interactions including anogenital sniffing, following behavior, aggressive tail tapping, and fighting (Figure 8A-D) relative to wt type animals. They also frequently push over and/or crawl under the other subject (Figure 8E), which is believed to be a readout for being insensitive to the presence of the other subject (Silverman et al, 2010). Rearing, which is regarded as a possible readout for anxiety, is done also more frequently by nSR100GT/GT male than in wt mice (Figure 8F). However, with respect to nose-to-nose sniffing, which was detected less frequently in nSR100+/D7-8 mice (Quesnel-Vallières et al, 2016), no significant difference was seen between nSR100GT/GT males versus wt counterparts. Since nose-to-nose sniffing is a transient behavior that is difficult to distinguish from random contact between two paired objects that are constrained within a limited space (in a housing cage) that encourages random nose-to-nose contacts, increasing the sample size, enlarging the interaction space to larger enclosures, and/or extending the monitoring time period may further test if there is indeed no significant difference in this behavior between nSR100GT/GT and wt mice.

Pre-pulse inhibition (PPI) assay: Hypersensitivity and attenuated PPI in nSR100GT mutants.

Finally, to test if the nSR100GT allele affects the auditory sensitivity and gating in mice, I carried out startle response and PPI assays, respectively. Similar to nSR100+/D7-8 mice, which displayed an elevated startle response towards auditory stimuli, significant hypersensitivity is also seen in nSR100GT/GT male homozygotes (Figure 9, box and whisker plots). Secondly, both female and male nSR100GT/GT mutants display significantly attenuated PPI as compared to wt counterparts (Figure 9, asterisk marks in the line charts). Collectively, these results suggest that the deficiency in nSR100 protein levels achieved in nSR100GT/GT but not in nSR100+/GT mice can be translated into elevated auditory sensitivity and reductions in sensory filtering.

Figure 8. Reduced reciprocal interactions between nSR100GT/GT male mice. Reciprocal interactions are monitored between pairs of isogenic mice that are not littermates. Activities of each subject as monitored continuously over 20min and the number of incidents for each behavioral category of interest (A-F) was determined. N=6 wt and 8 nSR100GT/GT males. D’Agostino-Pearson omnibus test followed by two-tailed Mann Whitney test was done in each behavioral category. *P < 0.05; **P < 0.005. s, seconds. Error bars= S.E.M. Whiskers indicate the 10th and 90th percentiles in all box plots.

Figure 9. Sensory Hypersensitivity of nSR100+/GT and/or nSR100GT/GT and Attenuated Sensitivity to Pre-stimulus. In female (A) and male (B) mice, response to auditory pre- stimuli (left panel) and percent pre-pulse inhibition (%PPI) were compared between wt and mutant mice heterozygous or homozygous for the nSR100GT allele. The startle response: D‘Agostino & Pearson omnibus normality test followed by one-way ANOVA (Dunn’s Multiple Comparison Test); the pre-pulse inhibition of the startle response: Repeated measures two-way ANOVA after Bonferroni’s post hoc test, F (1, 14) = 6.07 in female and F (1, 22)=12.76 in male for nSR100+/+ vs. nSR100GT/GT. *P < 0.05; **P < 0.005. a.u. arbitrary units; dB, decibels. N = 8 wt, 10 nSR100+/GT, 11 nSR100GT/GT females. N = 12 wt, 8 nSR100+/GT, 12 nSR100GT/GT males. Whiskers indicate the 10th and 90th percentiles in all box plots.

2.2.4 Tamoxifen treatment restores nSR100 levels and wildtype-like inclusion levels of microexons in prenatal mice.

A functional nSR100GT allele that can be used for inducible rescue in mice should not only be able to KO nSR100 and recapitulate ASD-like features but also to restore nSR100 levels and functions in response to tamoxifen-activated FlpERT2 activities. Therefore, I asked whether I could restore via tamoxifen administration nSR100 levels at prenatal and neonatal stages by activating FlpERT2 in FlpERT2 expressing mice that are either heterozygous or homozygous for nSR100GT alleles. Tamoxifen should promote translocation of FlpERT2 recombinase from the cytoplasm to the nucleus and consequently cause excision of the LacZ-neo cassette, which is flanked by Frt sites in the GT allele. FlpERT2 expressing mice used in this thesis are homozygous for an allele that has a CAG-FlpERT2 construct inserted into the widely expressed Rosa26 locus. As negative controls, oil administration (carried out in prenatal rescue only) and FlpERT2 negative animals (carried out in both prenatal and post-natal rescues) were included to validate the dependence of rescue effect on tamoxifen and on FlpERT2 alleles, respectively.

Prenatal rescue using tamoxifen in FlpaseERT2(FlpERT2) expressing animals restores nSR100 levels and microexon inclusion levels.

To carry out prenatal rescue, nSR100+/GT mice that are FlpERT2 positive were intercrossed to generate wt, heterozygous, and homozygous off-spring, and pregnant dams received tamoxifen injections for four consecutive days from E9.5 to E12.5 (Figure 10A). E9.5 was chosen to be the 1st day of the serial injections because nSR100 expression is known to initiate at E9.5 and be sustained throughout neurodevelopment. Three trials were performed, in which the first two trials included oil treatment, while the third included FlpERT2 negative animals as negative controls. In the first trial, which was in collaboration with Mathieu Quesnel-Vallières who generously trained me on tamoxifen administration through intraperitoneal (IP) injection, a daily dosage of 3mg tamoxifen injection in the prenatal period led to successful restoration of nSR100 protein levels but also high toxicity, which was inferred from the observation that 14 of 20 harvested pups were severely malformed and therefore excluded from the WB assay (Figure 11, A and C). In the second trial, I repeated the same protocol with both 3mg and 1.5 mg of tamoxifen daily injection. Toxicity 59

was observed in both 3mg (61.1% malformed or aborted, N=18) and 1.5mg (52% malformed, N=25) treated embryos but none in oil-treated embryos. Sufficient numbers of normal-looking animals treated with 1.5mg tamoxifen (but not ones treated with 3.0mg tamoxifen) were obtained for statistical quantification of the rescue effect. Results showed that nSR100 full-length protein in both nSR100+/GT and nSR100GT/GT mice is restored to levels comparable to the wt (Figure 11, B and D). RT-PCR on six microexons event also showed that AS is rescued in all these nSR100-regulated microexons (Figure 11E). Finally, I performed a third trial where I included FlpERT2 negative mice and harvested the tamoxifen-treated embryos, followed by either cryostat sectioning of harvested brains to assay for rescue regarding cortical layering or RNA and protein purifications to assay for rescues in nSR100 protein levels and microexon AS. The toxicity was comparable in both FlpERT2 positive (56% malformed, N=18) and FlpERT2 negative animals (49%, N=57%, N=14). Because the numbers of harvested wt and nSR100GT/GT mice that are FlpERT2 positive and FlpERT2negative, respectively, were not enough for statistical analysis, further repeats of this protocol are required to validate if the rescue effect seen in the first two trials acts through a FlpERT2-dependent manner.

Neo-natal rescue led to premature death of neonates potentially due to toxic effects of tamoxifen.

For neo-natal rescue, two trials were performed successively, first using the protocol of Kamiya et al. (2010) and then that of Weber et al. (2009). In the first trial (schematic in Figure 10B), 26 mating pairs were set up with half being FlpERT2 positive and half FlpERT2 negative mice so as to aim for generating around 8 females and 8 males for each genotype (six in total), rescuing them at neonatal stages, assaying the rescue effect at behavioral levels in adults, and finally assessing the restoration efficiency of nSR100 transcript and protein levels in adult brains. As a result, the 26 pregnant females gave birth, collectively, to 156 pups, 20 of which died within two days before tamoxifen injection was performed. During the 20-day injection period, tamoxifen was administered through IP injections once every three days from P2 to P20 for a total of 7 times on each pregnant mother. Although no abandonment behavior was observed in mothers, which has been reported in a neonatal rescue study (Weber et al, 2009), many pups developed runty morphologies, a readout of malnourishment, and died before weaning (i.e. 21 days). Only 41 of the 156 pups grew into 60

adults and were used for behavioral assays, including digital gaiting analysis, open field, and fear conditioning (Table 2). Preliminary data from these assays are not reported in this thesis. The high lethality rate may be due to inhibitory effects on the lactation of pregnant mothers, as tamoxifen has been reported to prohibit proper functioning of progenitor cells and promote apoptosis in the mammary gland of adult mice (Shehata et al, 2014).

To try reducing the negative impact of tamoxifen treatment on the survival rates of neonates, I repeated the rescue with an alternative protocol (Weber et al, 2009; Figure 10C), in which the first injection is as late as P12 and in which pups are presumably able to acquire normal levels of nutrition and maternal care from fostering mothers. Unfortunately, a high toxic effect of tamoxifen was still present in the second trial, in which only 38% of the tamoxifen-treated pups survived to weaning-age and grew into adults for behavioral assays, although this protocol was proven to be slightly less invasive, as only 26.3% of tamoxifen- treated pups survived weaning-age in the 1st neonatal trial (Table 2 and Table 3). Brains from all mice (136 and 11 brains from the 1st and 2nd trials, respectively) that were treated with tamoxifen were harvested either upon natural death or after behavioral assays. One hemisphere of each brain was fixed and frozen in cryostat reagent for future X-Gal staining of brain sections to validate tamoxifen-induced removal of the lacZ reporter-containing GT. Cortices were dissected from the other half of each brain for future assessment of whether nSR100 transcripts and microexon AS were rescued in prenatally treated mice. Although these future experiments may provide information regarding whether reactivation of nSR100 can be achieved neonatally by tamoxifen-induced FlpERT2 activities in nSR100GT mutant mice, this rescue approach requires further optimization using serial titration of tamoxifen (which will be further discussed in 3.3). Analyses of the behaviors of tamoxifen- treated animals from this study, if performed in the future, require cautions. This is because the toxic effects of tamoxifen on the infant development of these mice may interfere with the interpretation of behavioral assays performed on similarly treated animals. Indeed, preliminary observations suggest that wt mice treated with tamoxifen at neonatal stages have reduced locomotion (in open field assays) and abnormal gaiting patterns (in digital gaiting analysis) as compared to untreated wt mice.

Figure 10. Protocols for prenatal and neonatal rescue in nSR100GT mutant mice. Schematic representation of prenatal rescues (A) and neonatal rescues adopting the protocol of Kamiya et al (B) or Weber et al (C). (A) nSR100+/GT; FlpERT2/FlpERT2 mice were intercrossed, which was followed by daily plug check at 7 am or earlier. If a plug is confirmed, the pregnant mouse is separated from the male and is administered tamoxifen via intraperitoneal (IP) injection on days E9.5, E10.5, E11.5, E12.5 during the period of 8 - 10 am. Tamoxifen was diluted in corn oil with 2.5% EtOH at 10mg/ml by mixing tamoxifen with EtOH first, which is then added to corn oil. In the first trial, each mouse was injected with 300ul (i.e. 3mg was administered). The second trial was similar to the first with the addition that half the pregnant mice were treated with half the dosage of tamoxifen (i.e. equal numbers of mice were either injected with 150ul or 300ul 10mg/ml tamoxifen daily for four consecutive days). In these two trials, pregnant mice treated only with oil in place of tamoxifen were also included as negative control. In the third trial, the same protocol was repeated only with the 1.5mg dosage (i.e. 150ul tamoxifen injection) in pregnant mice. In parallel, nSR100+/GT mice that do not express FlpERT2 alleles were included as negative controls. For all three trials, embryos were harvested on E18.5, which is theoretically 12 hours before birth. Both trials 2 and 3 were performed after Mathieu Quesnel Vallières left. (B) Mating was set up similarly to prenatal rescue (A). Both nSR100+/GT; FlpERT2/FlpERT2 and nSR100+/GT mice were intercrossed. Following birth, each mother was IP injected with tamoxifen at 2.25mg/30g body on every third day from P2 to P20 before the body weight was recorded (i.e. a total of 7 injections of each mouse) during the period of 8~10am. Tamoxifen was prepared as described in (A). Pups that survive post-weaning age were assayed for their behaviors. Finally, brains from all tamoxifen-treated mice were harvested either upon natural death or after behavioral assays. One hemisphere of each brain was fixed and frozen in cryostat reagent for X-Gal staining of brain sections. Cortex was dissected from the other half hemisphere of each brain to assess nSR100 transcript rescue in the future. (C) Mating was set up identically to the first neonatal trial (B). The difference was that the injection in this trial/protocol was performed only on P12-P16 but repeated for a second time each day during the period of 5-7pm. The dosage was 3mg/30g body for each injection. Therefore, each 30g mouse received 6mg of tamoxifen in total per day for five consecutive days. Tamoxifen animals that grew into adults were tested for their behavior and brains were harvested for the same purpose described in (B).

Figure 11. Prenatal rescue restores nSR100 full-length protein levels and PSIs of nSR100-regulated microexons in nSR100GT/GT. (A and B) Western blotting on lysates of brains harvested from tamoxifen-treated embryos in the 1st (A) and 2nd (B) trial of prenatal rescue. (C) Toxicity of tamoxifen. Aborted and malformed embryos were recovered from tamoxifen-treated pregnant mothers (left picture) but not from oil-treated mothers (right picture). (D) Quantifications of the prenatal rescue by the lower tamoxifen dosage (1.5mg) treatment that are based on low exposure of multiple blots. D’Argostino-Pearson omnibus test followed by student’s t-test or two-tailed Mann Whitney test was performed. N (oil- treated) = 4 wt, 3 nSR100+/GT, and 8 nSR100GT/GT mice; N (tamoxifen-treated) = 3 wt, 3 nSR100+/GT, and 3 nSR100GT/GT mice. (E) RT-PCR assay and PSI semi-quantification of 6 nSR100-regulated events in the cortical regions of animals harvested from the second trial of prenatal rescue. Mean PSI value of each event is compared between different treatments and genotypes, which shows that the PSI reduction seen in oil-treated (orange triangle connected with solid line) nS100GT/GT mice is reversed in tamoxifen-treated (black lined triangles connected with dotted line) counterparts, which are shown in the graphs to the right of each gel image. All error bars = S.E.M.

Table 2. Animals surviving weaning age that were used for behavioral assay after neonatal rescue (Protocol I). Out of the 159 pups resulting from tamoxifen treated mice, 20 died within first two days before injection. 95 died during the period of injection (i.e. before P21). 41 survived post weaning age. The brains of all 136 mice that survived up to the second injection were harvested either upon natural death or after behavioral assay, fixed, and frozen in cryostat reagent.

Table 3. Animals surviving weaning age that were used for behavioral assays after neonatal rescue (Protocol II). 13 out of 29 pups survived weaning age. 20 out of 29 brains are harvested either upon death date or after behavioral assays, fixed, and frozen in cryostat reagent.

Chapter 3 Discussion and Future Directions

« Heading styles 1-9 for thesis body: Heading 1 »

3.1 Summary of key findings

This thesis shows that the knockout-first genetrap allele nSR100GT can efficiently deplete the full-length nSR100 proteins in homozygous animals at multiple stages examined, including E17.5, E18.5, and P2, down to <6% wt levels (the 100kDa band will be discussed in 3.2.2). The KO effect on nSR100 protein levels is also prominent in nSR100+/GT, where nSR100 full-length protein is reduced to ~35% at E18.5 and ~55% at P2, as a rough estimate to be further validated by WB assay with serial dilution. In accordance with nSR100 depletion, significantly more skipping of nSR100-regulated microexons occurs in the cortical region of homozygous mutants relative to wt mice (in E18.5 and P2), as shown in RT-PCR assays. In mutant animals that simultaneously express nSR100GT and FlpERT2 alleles, administrations of tamoxifen restored nSR100 protein levels and inclusion of microexons to those comparable with wt siblings (at least in E18.5 cortices), whereas oil treatment of embryos does not have similar effects on nSR100 protein levels or nSR100- regulated AS of microexons. These results are in line with expectations for a functional nSR100GT allele, in which the frt-flanked LacZ-neo cassette can be removed by tamoxifen- activated FlpERT2 recombinase to restore wt-like sequences at the nSR100 locus and wt-like expression of nSR100 transcripts. To test whether tamoxifen exerts rescue effects in a FlpERT2-dependent manner, future analysis of brain samples from embryos that are FlpERT2 negative and tamoxifen-treated is required. Additionally, RT-qPCR assays should be performed to test if nSR100 transcript levels also respond to tamoxifen-induced and FlpERT2-dependent rescue. Finally, X-Gal staining and southern blots can be performed to provide additional validation of successful removal of the GT construct. If the removal of the GT construct is successful, reduction or , in the case of nSR100GT/GT mice, loss of X-Gal staining should be seen in tamoxifen-treated and FlpERT2 expressing mutant embryos in comparison with oil-treated or FlpERT2 negative animals; southern blotting (with the same probe used in the previous study) of AseI digested DNA extracted from rescued animals should result in a shift of nSR100GT-specific bands from 16.5kB to the 6.9kb migrating zone.

It is unclear from results collected in this thesis how nSR100GT alleles act to deplete nSR100 full-length protein. Theoretically, this allele acts by inducing transcription termination at a PAS site downstream of the LacZ reporter and upstream of exons 7-8, which should lead to transcripts that are fusions of the first six nSR100 exons and the downstream lacZ construct and that are depleted of sequences encoded in exons 7-13 at the transcript level. However, preliminary results from the RT-qPCR assays suggest that substantial residual levels of transcripts containing nSR100 exons 6-8 remain in E18.5 and P2 cortical regions (Figure 2). The exact nature and amounts of such residual transcripts remain to be determined by RT-PCR followed by sequencing, 5’ RACE assay, or northern blotting (as mentioned in 2.2.1). Positive results would suggest the presence of leaky- expression of nSR100 in these mutant animals. It is also worth repeating these assays on nSR100D7-8 mutant mice, because positive RT-qPCR signals in cDNA prepared from both nSR100D7-8 (i.e. exon 9) and nSR100GT (i.e. exon 8) mutant mice were detected (Figure 1E). Definitively determining what nSR100 mRNAs are present in these two mutant models as well as in the ‘rescued’ (or tamoxifen-treated) nSR100GT-expressing mice may help to interpret the phenotypic variations seen among mice that are subjected to the effects of these alleles and/or chemical treatment (which will be discussed in 3.2).

On the other hand, this thesis shows that the nSR100GT-induced deficiency of nSR100 full- length protein strongly correlates with certain ASD-associated and behavioral alterations with statistical confidence. Firstly, nSR100GT mutants recapitulate a core ASD feature, namely stereotypical and repetitive behavior, in the marble burying assay, in which marbles are covered by bedding often as a result of persistent digging behavior by the mice. The significantly higher numbers of marbles buried by nSR100GT/GT mice relative to wt littermates seen in this study may be explained by the preliminary observation of highly active digging behaviors that persist almost throughout the entire test period (20min), whereas wt mice are more often engaged in exploratory behaviors (i.e. sniffing and strolling) and rarely in digging. Significantly higher numbers of ~100% buried marbles are also seen in heterozygous males, from which persistent digging was also observed but was restricted within only one or two cage corners in the case of several subjects. In general, the difference between mutant and wt is more prominent in the numbers of ~100% buried marbles, which is more likely to occur only when aggressive digging occurs, whereas

numbers of the ~50% covered marbles reported in this thesis are, in some cases, results of random strolling. In the future, quantifying the accumulated duration each subject mouse spends in digging and exploring will be worthwhile. Performing different variations of the test by reducing or increasing the distance between marbles and the area of the cage setting in general may also add higher resolution to these behavioral analyses. Additionally, more ASD-associated motor stereotypes in these mutants such as digging, jumping, and repetitive grooming are worth examining.

Secondly, with regard to the sociality of nSR100GT carrying mutants, male nSR100GT/GT mice display significantly reduced or no social and reciprocal interactions with peer strangers with regard to anogenital sniffing, following, aggressive tail tapping, and fighting behaviors. Moreover, more frequent rearing is seen in these mutants, which may suggest elevated anxiety levels in the presence of peers (Ennaceur, 2014). These results are reminiscent of another core ASD feature, low sociality, and ASD comorbid anxiety. In relation to the latter, the anxiety level of nSR100GT mutants is worth examining in the future via the urinary scent marking assay (Lehmann et al, 2013), as well as the plus-maze and light-dark exploration assays, because elevated anxiety can complicate the interpretation in certain social tests such as 3-chamber social test (Silverman et al, 2010; discussed in the following). On the other hand, results from the 3-chamber test collected in this thesis indicated reduced locomotion among female nSR100GT mutant subjects, which renders the interpretation of their sociality from this assay invalid. In the case of male mutants, the limited sample size employed in this study also made it impossible to conclude whether significant alterations in social preference and social novelty avoidance are present in mutant mice. To address the question of whether altered sociality is present in nSR100GT mutants, the following two kinds of assays should be performed on mutant mice in the near future. First, repetition of the 3-chamber assay with an expanded cohort should be performed to reach statistically significant conclusions. Second, as mentioned in 2.2.3, because normal primary functions, such as olfaction, hearing, and vision, are required for a test subject to distinguish between inanimate objects and peers as well as between stranger and familiar peers, abnormalities in any of these primary functions can interfere with interpretations of sociality from 3-chamber assays (Silverman et al, 2010). Therefore, nSR100GT mutants should be assessed for normal performance of these functions in assays

such as the food retrieving test, auditory brainstem response assay, electroretinography, and light-dark box assay.

Finally, the pre-pulse inhibition assay conducted in this study shows that nSR100GT/GT mutants are hypersensitive to auditory stimuli and display significantly attenuated pre-pulse inhibition as compared to wt littermates (discussed in the next session), which has been frequently seen in ASD patients (de la Torre-Ubieta et al, 2013).

Collectively, the nSR100GT-induced behavioral features overlap with all ASD behavioral domains, with the exception of defective communication that has not been assessed in nSR100GT mutant mice. Whether the communication of nSR100-deficient mice is impaired is worth addressing, which can be done by subjecting them to the ultrasonic vocalization (USV) assay, a behavioral paradigm that has been used for modeling ASD-like communication deficits in many mouse models (Wöhr, 2013). Altered vocalization, if observed in these mice, would not only imply functions of nSR100 in communications but also might provide an assay to assess the effect of any rescue strategies, because the USV assay provides robust and quantitative readouts of vocal features in mice (Kurejova et al, 2010), as opposed to high levels of variations and/or ambiguities in the observation and interpretation of subtle behaviors that compromise the power of relevant behavioral assays (eg. extent to which a marble is buried, nose-to-nose sniffing, and peer-induced anxiety in the case of marble burying assay, reciprocal interactions, and 3 chamber social test, respectively).

3.2 Comparison between nSR100GT and nSR100D7-8 alleles

Characterization of and comparison between allelic variants of the same genetic locus can provide insights on the function of genes in the context of development and/or response- regulated processes, genetic and biochemical interactions, modulations of cell signaling, etc. Examples abound in model studies in the case of, for example, let-23 (the C. elegan 71

orthologue of EGF-receptor-family transmembrane tyrosine kinase) in the context of programmed cell death (Aroian, and Sternberg, 1991), c-Myb in hematopoietic stem cell proliferation and differentiation (Sandberg et al, 2004), Scn8a (sodium voltage-gated channel alpha subunit 8) in intellectual disability (O’Brien and Meisler, 2013), Wnt/Wg signaling genes in embryo patterning and adult structural development (Jenny and Basler, 2014), and Clk (Drosophila Clock) in circadian rhythm regulation (Lerner et al, 2015; Allada et al, 2003). In a similar vein, close examination of the differences in phenotypes between two alleles, nSR100D7-8 and nSR100GT, may provide insights into how differences in the nSR100 loci at the chromosomal level translate to altered splicing regulation (Quesnel-Vallières et al, 2016; West et al, 2016, which will be also discussed in 3.2.1), neuronal developmental and functional regulation, activity and circuitry regulation, and finally behavioral regulation.

3.2.1 Comparison at the DNA sequence level

The knockout-first, or nSR100GT, allele contains a GT construct that theoretically promotes transcription termination at the PAS site immediately downstream of the lacZ construct and upstream of exon 7 (Figure 1). The nSR100D7-8 allele (Figure 1D) is largely identical to the nSR100GT allele (Figure 1C) at the sequence level, except that it lacks a ~3.2kb long region (which is flanked by two loxP sites and comprises the LacZ-neo cassette, exons 7-8, and parts of introns 6, 7, and 8). In theory, both alleles can knock out nSR100 full-length transcripts in mice due to the presence of the GT construct that contains PAS sites upstream of exon 7. Therefore, phenotypic differences between the two alleles (detailed phenotypic comparisons will be made in sections 3.2.2 - 3.2.4) are not to be expected. Neither can phenotypic differences be explained by the hypothetical scenario whereby leaky expression (which has been reported in multiple GT carrying models such as in Thorey et al, 2012; Soriano, 1999) occurs in these two alleles, with the presumption that nSR100 exon 6 would splice exclusively to the SA of the GT construct in both alleles. This is because, although nascent transcripts resulting from leaky expression in these two alleles would differ in lengths and sequences (by ~3.2kb), identical protein fragments are expected to be produced from these two alleles due to the presence of stop codons (resulting from splicing at the SA) 72

being 36 nt downstream of exon 6 in both alleles. Of note, such protein fragments that comprise the N-terminal fragment of nSR100 have a predicted size similar to the protein isoforms that migrate at ~25kDa seen in WB assays performed on both the nSR100D7-8 allele (Quesnel-Vallières et al, 2015) and the nSR100GT allele (Figure 2B). These lines of observation collectively argue that identical nSR100 proteins fragments should be produced from the two alleles whether or not leaky expression occurs, which conflicts with the phenotypic variations seen between the nSR100GT and the nSR100D7-8 alleles. In attempting to address what potential molecular variations between these two alleles may be present and account for the phenotypic differences, the following discussion examines the 1) possibility for cryptic splicing events that lead to the exclusion of the GT construct to occur in these two alleles and 2) how such hypothetical splicing events can contribute to the distinct transcript populations between the alleles.

Cryptic splicing has been implicated in an nSR100 mouse model lacking exons 7-8 that was derived from the nSR100GT model and examined in the previous study (nSR100DGT-ex8, Quesnel-Vallières et al, 2015). In this mouse model, the removal of nSR100 exons 7-8 was expected to generate transcript isoforms in which exon 6 and exon 9 are spliced together, leading to frameshifts in downstream sequences and truncated proteins with an estimated size of 25.9kDa. However, in these mutant mice, unexpected protein isoforms migrating at ~90kDa that are recognized by the nSR100 antibody were seen in these mutant mice but not in wt (Figure S9B from Quesnel-Vallières et al, 2015), indicating that alternative and cryptic transcript isoforms may have been produced. This is because the 5’ most stop codon in such an isoform should be at least 750bp downstream of the 5’ss of exon 6 (based on a conservative assumption that amino acids encoded by sequence downstream of exon 6 in this transcript are all tryptophan, the amino acid with a highest molecular weight) in order to produce proteins of 90kDa, indicating the possibility that such transcripts comprise multiple internal and frame-preserving exons downstream of exon 8 (i.e. of note, all nSR100 internal exons, except for exon 8 and 9, are frame-preserving).

Because cryptic splicing has been implicated in the mentioned nSR100DGT-ex8 allele and also reported in other mouse models carrying GT constructs (West et al, 2016), the possibility of such unintended splicing activities cannot be excluded in the nSR100D7-8 and nSR100GT

alleles. Furthermore, if leaky-transcription and cryptic splicing co-occur in these alleles, distinct transcript populations may be produced and contribute to the molecular variations between these two alleles. Such a hypothesis stems from the following three lines of observation. Firstly, the 3’ ss strength of all nSR100 exons (analyzed according to the method of Yeo and Burge, 2004) downstream of the GT construct are stronger than the SA (Table 4a, see also Figure 1B for the genetic construct layout), suggesting the possibility for competition to occur between the splicing at the 3’ ss of exons downstream of lacZ (exon 8, 9, 10, 11 in the case of nSR100GT and exon 9, 10, 11 in the case of nSR100D7-8) and at the SA of the GT construct. Such competition may lead to the exclusion of the GT construct and to different downstream exons being spliced to the 3’ss of nSR100 exon 6. Of note, most of these hypothetical isoforms do not contain pre-mature stop codons due to the frame-preserving nature of most nSR100 exons and would be actively translated (Table 4b). Secondly, among these hypothetical transcript variants, two are unique to the nSR100GT allele (first two columns of Table 4a). One of these unique variants is identical to the nSR100 wt full-length transcript. The other hypothetical isoform comprises the C-terminal 155 residues required for RNA binding activity and splicing regulation (based on unpublished evidence from the lab). Thirdly, as mentioned, the nSR100GT allele differs from the nSR100D7-8 allele by a ~3.2kb long region (which is unique to the nSR100GT allele that is flanked by two loxP sites). Due to the presence of two additional canonical 5’ss (of exon 7 and 8) and other sequences in this region that are unique to the nSR100GT allele, the splicing regulation of the nascent transcripts derived from these two alleles may highly vary, leading to potential variations at both the sequence and abundance levels of transcript isoforms. Indeed, even minor changes at the RNA sequence level can alter the outcome of AS by affecting processes such as the recruitment of splicing regulators, the establishment of exon definition, and the kinetics of splicing machineries (Sibley et al, 2016; Gueroussov et al, 2017; Braunschweig et al, 2013).

Collectively, these lines of observation encourage the execution of 5’ RACE assays to examine 1) if leaky transcription occurs in these two alleles and 2) if non-canonical transcript variants with coding sequences that correspond to functional regions of nSR100 proteins (eg. the C-terminal 155 residues that confer nSR100 with splicing activities) are present and differentially so in the nSR100GTand the nSR100D7-8 alleles. Positive results may

provide guidance for further assays to be performed in order to address what molecular variations between these two alleles may account for their phenotypic variations observed in this thesis.

Table 4a. Scores for 3’ splice site strength in the nSR100GT allele for nSR100 exons downstream of lacZ. Three different scoring systems are used to evaluate the strength of the 3’ss (Yeo and Burge, 2004) of all nSR100 exons that are downstream of exon 6 (the 8 rows above the doubled-line). The scores for En2 3’ss (Skarnes et al., 1992), which is the splice acceptor (SA) designed to contribute to the gene-trapping function of the GT construct is shown in the last row. * the 16nt microexon that is localized in the canonical exon 8 and was shown to be more frequently included in KCl-treated neurons. In blue shows the scores of 3’ss in nSR100 exons that are lower than the counterparts in the SA. The last column provides information with regard to whether each exon of interest is frame- preserving (i.e. with length that is a factor of 3nt).

Table 4b. Hypothetical protein isoforms produced in the nSR100GT(GT) and nSR100D7- 8 (D7-8) allele. Each column shows a hypothetical protein isoform based on the assumption that leaky expression occurs in both alleles, and the possibilities of each possible exon being spliced with exon 6 is discussed in each column.

3.2.2 Comparison at the nSR100 protein and transcript levels as well as at the microexon AS levels

As shown in Table 5 and Table 6, this thesis reproduces the depletion effect of the nSR100D7-8 allele on nSR100 full-length protein in nSR100D7-8/D7-8 E17.5 embryos (in comparison with the study by Quesnel-Vallieres et al., 2015); it also suggests that a comparable depletion efficiency is achieved in nSR100GT/GT mice at this stage from WB assays (Figure 1). However, it is worth noting that the 100kDa band is often present in both wt and mutants (with reduced signal intensities in mutant mice, Figure 1F, Figure 2A and 2B), which raises the possibility that part of these signals results from non-specific binding of nSR100 antibodies with proteins that are not encoded by nSR100 but coincide with nSR100 wt proteins. Therefore, to confirm with certainty whether efficient depletions of nSR100 are achieved and comparably so in nSR100D7-8/D7-8 and nSR100GT/GT mice, AP-MS using the same antibody should be carried out. Significant differences in nSR100 levels between these two mutant models, if seen from quantitative analysis of AP-MS results, may provide a molecular basis for the behavioral discrepancies observed between these mice (which will be discussed shortly below). Secondly, this thesis shows that nSR100GT/GT mice undergo significant PSI reductions in tested microexon events, but the PSI change is not as dramatic as seen in nSR100D7-8/D7-8 for ~ 50% of the tested events (Figure 4). Thirdly, this thesis shows that low levels of nSR100 transcript containing sequences downstream of exon 6 remain in both nSR100D7-8/D7-8 (27.4%) and nSR100GT/GT (13.5%) at E17.5 (Figure 1), which is not expected because nSR100 transcripts were reported to be fully depleted at E16.5 in nSR100D7-8/D7-8 mice (Quesnel-Vallieres et al., 2015). To address whether nSR100 transcripts in nSR100D7-8/D7-8 can be fully silenced at some stages (eg. E16.5) but not others (eg. E17.5) and whether there are significant differences in the knockout effect on nSR100 transcripts between the two alleles, 5’ RACE assays, northern blots, or RT-PCR followed by sequencing (as discussed in 2.2.1 and 3.1) can be performed on nSR100D7-8/D7-8 and nSR100GT/GT cortices that are harvested from embryos at different stages such as E16.5, E17.5, and E18.5.

Table 5. Comparison between nSR100GT and nSR100D7-8 allele at the nSR100 transcript and protein levels. Characterizations of the knockout effect at nSR100 transcript levels in the cortical tissues of E17.5, E18.5 and P2 mice are shown in the first three columns. The effects at the nSR100 protein level of the two alleles are shown in the last three columns. In red are quantifications. In purple are phenotypes shown in the previous study (Quesnel-Vallieres et al., 2015) that are reproduced in this study. This is a summary of data shown in Figure 1 (E & F), Figure 2, and Figure 11(A & B).

Table 6. Comparison between nSR100GT and nSR100D7-8 allele with respect to the percent-splice-in (PSI) values of nSR100-regulated microexons. This is a summary from data shown in Figure 3 (B), Figure 4, and Figure 11 (E). In purple are phenotypes shown in the previous study (Quesnel-Vallieres et al., 2015) that are reproduced in this study.

3.2.3 Comparison of survival rates

In relation to viability, although both alleles lead to elevated lethality in homozygous animals as compared to wt, this effect is more dramatic in nSR100D7-8, which results in the death of 85% of homozygous animals at perinatal stages (Quesnel-Vallieres et al., 2015) as compared to nSR100GT that tolerates a post-weaning survival rate as high as ~ 60% in homozygotes. It is worth testing at which stage the nSR100GT allele exerts negative effects on survival rate and whether any allele-differential effects are present in various neurodevelopmental processes that have been implicated in nSR100D7-8 mutant mice (Quesnel-Vallieres et al., 2015) (which will be discussed in detail in 3.3).

3.2.4 Comparison at the behavioral level

At the behavioral level (Tables 7a and 7b), a few features observed in the nSR100+/D7-8 mice (Quesnel-Vallieres et al., 2015) are reproduced in the nSR100GT mutant mice, including normal locomotion (seen in both heterozygous and homozygous, or het and homo), normal habituation (het and homo), hyperactivity towards auditory stimuli (male but not female), and reduced percent pre-pulse inhibition (homo but not het). In relation to the latter two features, only homozygous but not heterozygous mutants display significant alterations, which is in contrast with nSR100+/D7-8 mice that were reported to have both hypersensitivity and attenuated PPI phenotypes, suggesting that nSR100GT is likely a hypomorph as compared to nSR100D7-8 with regard to their effects on the functioning of the auditory sensory system. Another interesting observation is the sexual dimorphism in the behaviors of nSR100GT mutant mice during the startle response assay, showing that males are likely more susceptible of being hypersensitive than females upon loss of nSR100. Similar sexual dimorphism was also seen in nSR100+/D7-8 mice, specifically in the case of the 3-chamber assay where male but not female mice display altered sociality.

In relation to sociality, data collected in this thesis in the 3-chamber social test, as discussed, could not address whether nSR100+/GT or nSR100GT/GT mice can reproduce the reduced sociality and heightened novelty avoidance seen in nSR100+/D7-8 mice.

In relation to nose-to-nose sniffing as a readout for sociality, which was seen to be elevated in nSR100+/D7-8 mice, this thesis also cannot reach any conclusion to address whether nSR100GT mutants are significantly different from wt,. However, the analyses of multiple types of reciprocal interactions suggest that the nSR100GT-carrying mice indeed have ASD- associated alternations in social behaviors. This is because, apart from nose-to-nose contact, many other social behaviors are significantly reduced in nSR100GT/GT versus wt during the reciprocal interaction assay (Figure 8), including anogenital sniffing, following, tail-tapping, and fighting. These behaviors have been widely found altered in multiple ASD models such as Fmr1 (Spencer et al, 2005), Shank3 (Peça et al., 2011 and Zhou et al, 2016; interestingly, both studies also report no difference in nose-to-nose sniffing frequencies), Engrailed2 (Brielmaier et al 2012), Btbr (Jones-Davis, 2013), Mecp2 (Tantra et al, 2014), Cofilin1 (Sungur et al, 2018) and 16p11.2 deletion mutant mice (Stoppel et al, 2018). Furthermore, many studies do not focus on single reciprocal activities (eg. nose-to-nose interaction per se) but score the sociality of an animal based on the cumulative occurrences of multiple activities mentioned above (Han et al, 2012; Yang et al, 2012, Silverman et al, 2013). Therefore, a comprehensive assessment of the differences at the social behavioral levels between the nSR100GT and the nSR100+/D7-8 mice requires 1) subjecting these mutant mice carrying either allele type to these assays in parallel and 2) comparing the above-mentioned multiple reciprocal activities. Finally, the marble burying assay should also be carried out in nSR100+/D7-8 mice, as observations of nSR100GT mutant mice suggest that nSR100- deficiency may lead to higher levels of insistent and stereotypic behaviors in mice.

In conclusion, the nSR100GT allele resembles the nSR100D7-8 allele with respect to the depletion efficiency of nSR100 full-length protein in E17.5 embryos, to sensory gating defects, and to a sexual dimorphic representation of certain behaviors; however, nSR100GT is likely a hypomorph with regards to its effect on nSR100-regulated AS of microexons, survival rate, and the auditory sensory system. It is worth addressing what are the molecular and neurological bases of these phenotypic variations using methods that will be discussed in 3.3 (in the context of the advantages of the nSR100GT allele).

Table 7a. Comparison between nSR100GT mutants and nSR100+/D7-8 mice at the behavioral levels. Comparisons between results in open field, marble burying, and 3- chamber assays are shown in Table 7a, and reciprocal interaction as well as pre-pulse inhibition in Table 7b. In purple are the indicated phenotypes in nSR100+/GT and/or nSR100GT/GT mice that resemble those seen in nSR100+/D7-8 mice. In green are highlighted the specific changes reproduced in nSR100GT mutant mice, whereas in yellow highlighted the reduced active locomotion seen in female nSR100GT mutants. NA= not applicable due to low activeness. Asterisks mark questionable conclusions and should be addressed by either expanding the cohort (in 7a under “3-chamber; velocity” column) or standardizing the monitoring protocol (in 7b under “reciprocal interaction; nose to nose sniffing” column). ↑, ↓, and ns = significant increase, decrease, and non-significant, respectively. Question marks are ASD-related phenotypes seen in nSR100GT mutant mice and should be tested in nSR100+/D7-8 mice in the future.

Table 7b. Comparison between nSR100GT mutants with nSR100+/D7-8 mice at the behavioral levels. Similar to Table 7a, phenotypes observed in reciprocal interaction and pre-pulse inhibition assays are compared between nSR100 or nSR100GT mutants and nSR100+/D7-8 mice.

3.3 The advantages and disadvantages of using the nSR100GT allele for characterization of nSR100 and for conditional rescues

Previous studies have established a causal link between nSR100 and ASD and provided multiple lines of evidence for nSR100 being a molecular hub that interests multiple ASD- affected pathways (Irimia et al, 2014; Quesnel-Vallières et al, 2016). To assess nSR100 as a potential therapeutic target in the context of ASD etiology, two main questions need to be addressed. First, is nSR100 required in post-natal brains to support normal levels of social behaviors? Second, can ASD-associated features in nSR100-deficient mice or other ASD mouse models be reverted in response to enhancements of nSR100 activities in postnatal stages? Whereas the first question is best addressed in an inducible knockout model (discussed in 3.4), the second question can be addressed by reintroducing functional nSR100 to nSR100-deficient and ASD-like mice. In relation to the latter, there are two possible approaches: 1) genetically reactivating nSR100 in a knockout-first allele; and 2) ectopically expressing an nSR100 transgene in nSR100-deficient mice. This thesis explores the feasibility of the former strategy and discusses its weaknesses and strengths in this section (the second strategy will be discussed in section 3.4).

The advantages of the nSR100GT allele for further characterizations of nSR100 functions in the nervous system and in the context of ASD The advantages of the nSR100GT allele within the context of ASD and its functional characterization, as shown in this study, are fourfold. Firstly, behavioral changes seen in nSR100GT mice are significant and overlap with all three ASD core domains, as previously discussed. Secondly, this thesis shows that nSR100 protein levels can be efficiently restored to 80% and 100% of wt levels in nSR100GT/GT and nSR100+/GT mice, respectively (Figure 11B). Importantly, in tamoxifen-treated nSR100GT/GT mice, PSI values in all tested nSR100- regulated events are restored to wt or higher levels (Figure 11E). Whether such effects of tamoxifen act through FlpERT2-mediated removal of the GT construct still requires repeating the tamoxifen treatment on FlpERT2 negative animals. Nonetheless, the effect of tamoxifen on stimulating nSR100 protein levels and AS-regulating activities in nSR100GT/GT mice is arguably promising, and it is thus worth testing its effect on behavioral rescue. This is true 82

even if tamoxifen, an FDA approved medical compound, exerts its effects independent of the presence of Flpase, which would imply a potential avenue for developing an ASD therapeutic. Thirdly, the clinically relevant question of whether nSR100 is required in postnatal individuals for normal levels of social behaviors can be best addressed, in a mouse model, by conditionally and postnatally knocking out nSR100. However, the generation of such a functional model has been challenging with the allele options available from the EUCOMM (Quesnel-Vallières et al, 2015). Therefore, testing whether reactivating nSR100 in adult can revert ASD-associated phenotypes, using the nSR100GT allele, may be the next best approach to address this question. Such a system allows the restoration of nSR100 to an endogenous-like level, as opposed to ectopic and/or over-expression systems which have the caveat of generating phenotypes that do not reflect the endogenous function of the gene of interest. Finally, the nSR100GT allele may be an equally useful model as compared to the nSR100+/D7-8 allele, owing to its hypomorphic effect on animal survival rate and AS of microexons (at E18.5 stage), as well as its distinct effect on mouse behaviors in the 3- chamber assay (nSR100GT-expressing females spend significantly more time being at a low mobility state in a 3-chamber setting where a peer mouse is present, a phenotype that was not observed in nSR100+/D7-8 mice). The following reasoning will attempt to elucidate the advantage that stems from allele-differential effects on the above-mentioned three aspects among nSR100GT and nSR100D7-8 mutant mice for studying ASD.

Results presented in this thesis suggest a correlation between the allelic variations at the microexon inclusion levels with those at the viability and behavior levels. This raises the question of at which stages can variations at the microexon AS levels be translated into variations at the survival and behavioral levels. A starting point to address this question is to perform RT-PCR assays on nSR100-regulated events across multiple embryonic stages (eg. E9.5 to E18.5) to look for developmental time points in which AS is differentially regulated between these two alleles. Furthermore, because not all nSR100-regulated events may be differentially effected among the two alleles (Figure 4A and 4B), RNA-seq should also be performed on cortices harvested at various stages to globally assess allele- differential effects on nSR100-regulated exons. These results should further refine nSR100- regulated events into subgroups that are regulated in allele-differential and, potentially, developmental stage-specific manners.

The observed allele-differential survival rate, together with the multiple neurodevelopmental deficits reported in nSR100 D7-8 carrying mice (Quesnel-Vallieres et al, 2015), raises the question of whether there are allele-differential effects on neurodevelopmental processes that have potential roles for viabilities. Given that ASD has been correlated with multiple neurodevelopmental processes (de la Torre-Ubieta et al, 2016; Eber and Greenberg, 2013; Silverman et al, 2018; Li et al, 2017), it is worth examining if deficits seen in nSR100D7-8 mutant mice (eg. deficits in axon-guidance and branching, midline crossing of callosal axons, and cortical organization, as well as aberrant innervation GT of the diaphragm, Quesnel-Vallieres et al, 2015) are also present in nSR100 mutant mice.

The allele-differential effects on mouse behaviors (seen in the 3-chamber assay) indicates the possibility that these two models may vary at other behavioral levels, which can be addressed by subjecting nSR100GT and nSR100D7-8 mice, in parallel, to various tests, including 3-chamber assay, reciprocal interactions (to address if there are allele-dependent differences in nose-to-nose sniffing interactions), marble burying, ultrasonic vocalization, and other ASD-associated tests.

Integrating results from the proposed three streams of experiments, which examine AS, neurodevelopmental processes, and ASD-associated behaviors in nSR100GT and nSR100D7-8 mutant mice, can help address the following questions relevant to ASD. What are the subsets of nSR100-regulated events affected in one mutant model but not the other? Are such allele-differential effects on certain AS events specific to certain stages? At these certain stages, where AS is differentially affected by distinct alleles, are there any neurodevelopmental processes that are also differentially affected by nSR100GT versus nSR100D7-8? What are the behavioral differences between nSR100GT and nSR100D7-8 mutant mice? Answers to these questions may help infer interconnections and/or correlations between potential subsets of nSR100-regulated microexons, in a temporal context, with viability, neurodevelopmental processes, and ASD-associated behaviors.

The challenge of using the nSR100GT allele for genetic reactivation-mediated rescue

In section 2.2.4, this thesis shows that the dependence on tamoxifen administration of the nSR100GT system to reactivate nSR100 poses challenges to prenatal and neonatal rescues, inferred from the high rates of fetal resorption, embryonic malformation, post-natal malnourishment, and low viabilities from these rescue experiments (described in 2.2.4). However, these damaging effects of tamoxifen on treated pups may be indirect and act, at least partially, by disturbing the physiological (eg. maternal estrogen-dependent signaling pathways, mammary gland homeostasis, etc.) and/or behaviors (eg. fostering behavior, food intake, etc.) of the pregnant or fostering mothers (Lizen et al, 2015; Shehata et al, 2014; Weber et al, 2009; Chiang et al, 2010). Furthermore, the dosages of tamoxifen administration chosen by this study were at the high end of the spectrum of dosages adopted among studies that perform similar tamoxifen-induced genetic manipulations (Andersson et al, 2010; Patel et al, 2017), as they were intended to yield high efficiencies of recombination at the frt-sites, of GT removal, and of reactivations of nSR100. Therefore, it is likely that reduced dosages, when administered in a fashion similar to this study or with reduced frequencies, may also effectively reactivate nSR100 but have minimized aversive effects on the viabilities and/or behavior of treated animals. To address this possibility, a systematic titration of tamoxifen dosage and optimization of injection conditions (frequency and timing of the injection) could be carried out to evaluate the feasibility of performing tamoxifen-induced rescue of nSR100GT mutants (Bersell et al, 2013).

Additionally, it is worth noting that in the case of adult-specific rescues, the above- mentioned damaging and potentially maternal-dependent effects of tamoxifen may not apply, in which tamoxifen can be directly administered to adult mice either through tamoxifen-enriched diet or injections (Chiang et al, 2010). Although there have been reports of tamoxifen affecting behaviors in adult mice (Patel et al, 2017, Kim et al, 2015), using proper negative controls (i.e. inclusions of oil treatment in place of tamoxifen and examinations of FlpERT2 negative mice in parallel with FlpERT2 positive mice) can help distinguish potential changes caused by tamoxifen from those that result directly from nSR100 reactivation. In conclusion, the development of optimized tamoxifen-administration protocols for reactivation of nSR100 at various stages in nSR100GT mutant mice may imply further advantages of using this allele to assess nSR100 as a therapeutic target in ASD.

3.4 Alternative models for studying nSR100 in the context of ASD

3.4.1 CRISPR SpCas9-mediated inactivation of nSR100, Srrm3, and/or nSR100-regulated and ASD-affected microexons in adult mouse brains.

This discussion proposes, as an alternative to inactivating nSR100 in brain sub-regions that circumvents the problem with the nSR100 knock-out first allele, multiplexed genomic editing in adult mouse brains using the adeno-associated virus (AAV)-mediated CRISPR- SpCas9 (the clustered, regularly interspaced, short palindromic repeats (CRISPR)- associated endonuclease (Cas)9 from Streptococcus pyogenes) system. This system was developed by the Zhang group (Swiech et al 2015), who have used it to: 1) induce InDel mutations in Mecp2 with 68% efficiency in target regions using single guide RNAs (sgRNA), 2) reproduce contextual learning deficits in these mutant mice that were seen in mouse models with permanent knock out of Mecp2, 3) simultaneously knockout two functionally redundant genes, Dnmt1 and Dnmt3a, each by a distinct sgRNA, in 62% of targeted cells, and 4) similarly, induce InDels with sgRNAs simultaneously in three genes with 35% efficiency. Although this strategy does not ubiquitously knock out target genes, as do the two types of KO alleles mentioned in this study (nSR100GT and nSR100D7-8), it has the flexibility of targeting multiple exons and/or multiple sites of a gene of interest. It is also more likely to result in depletion of a protein of interest inside cells that are successfully transduced with the CRISPR-Cas9 system, especially in the context of nSR100 inactivation, and can avoid the occurrence of unexpected protein isoforms that are potentially the result of cryptic splicing. Therefore, this alternative strategy can be a starting point to study the role of nSR100 in cell-autonomous and neurological processes and how they are related to social behaviors.

Specifically, as shown in Figure 12, the AAV-SpCas9 vector used by the Zhang group can be modified so that the expression of spCas9 is under the control of the nSR100 promoter with an upstream lox-stop-lox cassette (LSL). The AAV-SpGuide vector can be modified so that three sgRNAs target three different exons and/or coding regions of the nSR100 loci, which would enhance the chance of protein depletion of nSR100 as a result of genome

editing. The AAV-SpCas9 and AAV-SpGuides are then mixed and injected into different sub-regions in the brain of adult mice that express Cre recombinase, which facilitates the removal of LSL and activates SpCas9 expression. Although the injection carried out by the Zhang group was restricted to the visual cortex region, successful AAV-mediated transduction of CRISPR-Cas9 systems has been carried out in other brain regions such as amygdala, hypothalamus, hippocampus, corpus callosum, and somatosensory cortex (Lau et al, 2017 et al; Murlidharan et al, 2016). In relation to the latter two, for example, a midline crossing defect has been found in nSR100+/D7-8 mice in the corpus callosum region and E/I imbalance in the somatosensory cortex, two features that have both been hypothesized to contribute to ASD-like disruptions of neuronal functional networks. Together with the evidence that nSR100 is neuron specific and is ubiquitously expressed in the nervous system (Quesnel-Vallières et al, 2016), these observations lead to the question of whether nSR100 is required in these two regions throughout all life stages by an animal to display normal behaviors, and this question can be addressed by inducing nSR100 KO in these two regions using the AAV-mediated transduction of the CRISPR-SpCas9 system at different postnatal stages of interest.

Additionally, a more refined regional control of Cas9 activity can be achieved by using mouse lines that express Cre under different promoters. For example, SpCas9 can be activated either ubiquitously in all nSR100 expressing neurons (in the case of CMV driven Cre), only in mature neurons (CamkII-Cre), or specifically in parvalbumin expressing (PV+) fast-spiking interneurons (PV-Cre; Of note, all mentioned Cre-lines maintained in the C57B1/6N background, identical to that of the studied nSR100GT and nSR100+/D7-8 mutant mice, are available from the Jackson Laboratory). In relation to the latter, PV+ neurons take up 40% of GABAergic interneurons and play central roles in excitatory/inhibitory (E/I) homeostasis (Rudy et al, 2011; Selten et al, 2018). Altered properties of PV+ neurons, elevation in neuronal activities, and shift in E/I balance are highly ASD-associated (Rapanelli et al, 2017; de la Torre-Ubieta et al, 2016; Rubenstein and Mersenich, 2003) and have all been observed in nSR100+/D7-8 mice (Quesnel-Vallieres et al., 2016). Furthermore, proper functioning of PV+ neurons has been shown to play a crucial role in sustaining robust feed-forward inhibitory mechanisms that are required for proper sensory processing and gating neurons (Hu et al, 2014; Fino et al, 2012; Inui et al, 2016; Sinclair et al, 2016),

and both of these are predicted to be disrupted in nSR100GT and nSR100D7-8 mutant mice, because of their defects in startle response and PPI assays. However, whether nSR100 plays cell-autonomous roles in PV+ neurons that are important for synaptic homeostasis, functioning of the auditory sensory system, and/or ASD-associated hypersensitivity waits to be addressed. Using the AAV-mediated CRISPR SpCas9 system can help tackle these questions and shed light onto the role of nSR100 in ASD-associated behaviors within more spatiotemporally refined contexts.

In addition to the ability to target multiple exons of nSR100, another advantage of using the AAV-mediated CRISPR SpCas9 system is to address the question of functional redundancy. Evidence from the lab, based on RNA-seq and RT-PCR experiments, suggests the presence of functional redundancies between Ser/Arg repetitive matrix 3 (SRRM3) and nSR100/SRRM4, two Ser/Arg-related protein paralogues that are highly enriched in the neurons of mouse brains, owing to their ability to regulate the AS of overlapping populations of events. The previous study in the lab shows that the PSI values of neural- specific and nSR100-regulated splicing events increase along with the progression of neuronal differentiation and remain highest in mature neurons, whereas nSR100 expression reaches its peak in immature neurons, decreases during maturation, and remains low in mature neurons (Raj et al, 2014). Although one possible explanation for this divergence between the progression of PSI values and that of nSR100 expression may be due to reduced antagonistic interactions between nSR100 and PTBP1 (a splicing regulator that represses the inclusion of subsets of nSR100-regulated exons, Raj et al, 2014) during neural differentiation and/or maturation, this does not exclude the possibility that additional factors are present in mature neurons and act to sustain high inclusion levels of neural-specific events. Indeed, preliminary data from a translating ribosome affinity purification (TRAP) assay carried out in the lab suggest that the PSI reductions in nSR100+/D7-8 are much milder, if detectable, in adult brain as compared to the dramatic PSI changes seen in embryonic brains. This suggests the possibility of additional factors that act, either additively or redundantly with respect to nSR100, to promote the inclusion of neural-specific events, and Srrm3 is one such candidate. Therefore, this discussion proposes an experiment to simultaneously knockout Srrm3 and nSR100 using the AAV-mediated CRISPR SpCas9 system with one Srrm3-targeting sgRNA and two nSR100-targeting sgRNAs (or vice versa)

in adult mouse brains and 1) assess global changes in the PSI values in the targeted brain region using RNA-seq 2) test for alterations in neurological and behavioral defects. By comparing with control mouse models that are depleted of either Srrm3 or nSR100 in a similar fashion, results can 1) examine functional redundancies between Srrm3 and nSR100 in the context of AS regulation and ASD-associated neurological processes, 2) potentially sensitize the effect of nSR100-deficiency in the adult nervous system and further reduce the PSI values of nSR100-regulated exons, and 3) shed light on the roles of microexons in the adult nervous system and in ASD-associated behaviors.

Finally, CRISPR-Cas9-based strategies have been used to reprogram AS by modifying the SA and subsequently to promote the skipping of exons of interest (Yuan et al, 2018; Gapinske et al, 2018); a new transgenic mouse line generated recently in the lab using CRISPR-Cas9 has also been established, in which neuronal specific isoforms of Eif4g1/3 are depleted and impaired cognitive functioning in these mice was seen. In a similar vein, this thesis proposes a medium through-put approach to study roles of individual or combinations of multiple nSR100-regulated exons in the adult brain and in an ASD-related context by using the mentioned AAV-mediated CRISPR SpCas9 system, in which the AAV-SpGuide vector can be designed to contain three sgRNA sequences, each used to target one 5’ ss of an nSR100 target exon of interest. Candidate 5’ ss include but not limited to those that are downstream of microexons in 1) Eif4g1/3 and Mef2c, three activity- dependent genes that are involved in the transcriptional and/or translational pathways often misregulated in ASD (Irimia et al, 2014; Quesnel-Vallieres et al, 2016), of in 2) Shank1, Ank3, Nbea, and Nrxn, synaptic genes that are genetically linked to ASD (Sato et al, 2012; Bi et al, 2012; Castermans et al, 2003; Gauthier et al, 2011). Specifically, if simultaneously knocking out multiple exons in adult mice leads to ASD-associated changes, then single knockout of each exon can be repeated in mouse brain to determine which ones are functionally important in the context of neurobiology and ASD etiology.

On the other hand, knowledge of exons that are already functionally linked to certain molecular and/or neurological processes, such as the mircroexons in Eif4g1/3 (with roles in cognitive functioning as mentioned above), Unc13b, and Slit2 (Quesnel-Vallieres et al, 2015), can also be combined with this system to investigate whether known microexon- dependent or -associated processes play any roles in the adult brain to affect ASD- 89

associated behaviors. For example, the microexon in Unc13b is required to rescue defective neurite outgrowth in primary neurons derived from nSR100+/D7-8 mice. Additionally, in these mutant mice, the skipping of an nSR100-regulated microexon in Slit2 was observed in to correlate with defective midline crossings of pioneering axons in the corpus callosum region (Quesnel-Vallieres et al, 2015), which is reminiscent of phenotypes seen in a Slit2 mutant mouse model (Unni et al, 2012). Defects in neurite outgrowth and corpus callosum organization, together with a hyper-activated mTORC1/eIF4E pathway, in which Eif4g1/3 are involved, are all phenotypes that have been linked to ASD (Doers et al, 2014, Just et al., 2007; Alexander et al, 2007; Gkogkas et al, 2013); however, it is unclear whether these features are the causal factors, bypass symptoms, or downstream consequences of ASD. Therefore, by simultaneously knocking-out, for example, these exons in the brain and comparing the resulting mutants with single knockout mutants at the molecular, neurophysiological, and behavioral levels can help 1) to uncover potential roles of microexons and microexon-dependent neurological processes that are required in adult brains and 2) to test whether synergistic or additive effects of these neurological processes exist and their relationships with the development of ASD-associated symptoms.

In conclusion, the AAV-mediated CRISPR SpCas9 system provides a versatile approach to increase the chance of reliably depleting nSR100-protein, to interrogate the genetic interactions between nSR100 and nSR100-related paralogues or neural-enriched splicing factors, and to simultaneously interrogate nSR100-regulated microexons in the nervous system. In particular, this system also allows one to examine these three aspects in the adult brain and allows such interrogation to be restricted to certain brain regions and/or neuronal subtypes of interest. Collectively, the results from the experiments proposed in this section may shed light on nSR100 and/or microexon-dependent processes that contribute to the development and/or progression of the complex symptoms seen in adult ASD.

Finally, it may be worth considering a similar approach as discussed above but with an alternative editing system, the CRISPR-Cpf1/Cas12a-mediated knockout approach (Zetsche et al, 2015; Zetsche et al, 2017; Chen et al, 2018). Although the Cpf1/Cas12a endonuclease acts similarly to Cas9 but with a reduced nuclease activity, these studies and empirical evidence from the lab suggest it holds a greater advantage for multiplex gene targeting compared to the Cas9-mediated system. Therefore, this system may be suitable for the 90

proposed aims of targeting multiple nSR100 exons, nSR100-regulated exons, and nSR100- related paralogues or interactors.

Figure 12. Schematic of multiplex gene (or exon) targeting using Streptococcus pyogenes Cas9 (SpCas9) system in adult mouse brains. Partially adapted from Swiech et al (2015), this schematic proposes an approach to knock-out nSR100 in adult brain to study the role of nSR100 in mature neurons and ASD-associated behaviors. The top two constructs can be obtained (Swiech et al, 2015) followed by subcloning to replace the Mecp2 promoter (green horizontal arrow) with the nSR100 promoter or CMV promoter (horizontal blue arrow) in the spCas9-encoding adeno-associated viral (AAV) vector. For the sgRNA-encoding AAV vector, the originally designed sgRNAs (pink bars on the right) are replaced with three sgRNA that each target one separate nSR100 exon (blue bars on the right). Alternatively, on sgRNA can be designed to target an exon of SRRM3 or mTOR loci to test for, respectively, 1) genetic interaction between Srrm3 and nSR100 or 2) epistasis interaction between the mTOR pathway and nSR100.

3.4.2 Alternative model for re-activation of nSR100 in nSR100-deficient mice.

As discussed in 3.3, the nSR100GT allele poses challenges to reactivate nSR100 in mice due to its dependence on tamoxifen administration, which may potentially affect the behaviors of mice and complicate the interpretation of rescue effects from behavioral assays (Patel et al, 2017, Kim et al, 2015). Although these challenges can be addressed with stringent controls, the nSR100GT system has limited flexibility to allow the following questions to be addressed. First, at which brain regions is nSR100 required for normal behavior? Secondly, if nSR100 is required in the adult brain, is a temporary enhancement of nSR100 activities sufficient to permanently revert pathological symptoms? These questions are relevant for the therapeutic implications of nSR100 in ASD and may be addressed by systems like those discussed below that allow transient induction of nSR100 overexpression in nSR100- deficient and/or ASD like mice.

A dox-inducible overexpression system has been proposed in the lab, which can be achieved by crossing a novel transgenic mouse line that carries an allele expressing a tagged nSR100 cDNA fusion construct under the control of a CMVmini-TRE (tetracycline response element) promoter with a line expressing rtTA (reverse tetracycline-controlled transactivator, refered to as rtTA allele) either ubiquitously or in specific subtypes of neurons. In the resulting progeny, over-expression of nSR100 cDNA can be achieved by the administration of doxycycline (Dox) to activate rtTA, a transcription factor required for the transcription of the TRE-controlled nSR100 cDNA. Finally, adult specific rescue can be carried out in mice that carry one nSR100D7-8 allele, one rtTA allele, and at least one copy of the afore-mentioned transgene construct followed by Dox administration in adults. Currently, a FLAG-tagged and a GFP-tagged nSR100 construct containing the Mus musculus nSR100 cDNA are available in the lab. One of these constructs can be injected into the male pronucleus of the oocyte from a recently fertilized donor female, and the resulting egg can then be transferred into the oviduct of a fostering mother to generate mice that are mosaic, heterozygous, or homozygous for the transgenic construct. With successive intercrosses, mice that are homozygous for the transgenic construct can be identified and maintained as a novel transgenic mouse line (Liu et al, 2017).

Because this strategy is labor intensive and requires breeding of multiple generations of mice carrying various alleles, it is best to first test the tagged nSR100 cDNA construct (referred to as the nSR100 fusion construct from here on) in a system that has a more rapid readout to provide a proxy of how well this construct may function as a dox inducible system. To address this question, this discussion proposes AAV-mediated transduction of the fusion construct into the brain of adult nSR100+/D7-8; CMV-rtTA mice followed by Dox induction and behavioral assay to assess the rescue effect of overexpressing the fusion construct. AAV-mediated delivery and transduction of the transgene is a well-developed approach, and many published protocols have been shown to successfully transduce various brain regions in both juvenile and adult mice (McLean et al, 2016; Burger et al, 2004,). Most of these protocols detect active expression of transcripts and/or protein encoded by the transduced constructs within 4 days post injection, and the presence of the induced proteins lasts for at least one month in all of these studies (Schultz et al, 2008; Lowery et al 2009, Husain et al 2009, Albert et al, 2017; Aschauer et al, 2013). Of particular relevance to nSR100, two protocols (Wang et al, 2014; Wetakabe et al, 2015), both of which employed AAV-mediated transduction to the somatosensory cortex in adult mice, can be employed to transduce nSR100+/D7-8; CMV-rtTA mice with the nSR100 fusion construct in adult somatosensory regions, followed by Dox induction (via Dox-enriched diet), in situ hybridization of the nSR100 transcript, and immunofluorescence staining of FLAG or GFP (depending on which construct is transduced) to confirm transduction efficiency. Optimization of the transduction conditions and Dox dosage should then be performed so that the number of transduced neurons is maximized, the fold increase in nSR100 cDNA expression is determined, and the extent of non-specific transduction in glial cells is minimized. Finally, with these optimized conditions, nSR100+/D7-8; CMV-rtTA mice overexpressing nSR100 cDNA should be tested for rescue of defective synaptic transmission in the somatosensory cortex as well as in altered behaviors in the 3-chamber test, social reciprocal interactions, and PPI assays. Successful rescues of some or all of these deficits, if achieved, could provide confidence for proceeding to generate the novel transgenic line that expresses integrated nSR100 fusion constructs.

In conclusion, this thesis has evaluated the feasibility of using the knockout first-allele of nSR100, nSR100GT, to characterize functional roles of nSR100 in AS and ASD-associated

behaviors in mice. It has shown that nSR100GT mutant mice display core ASD behaviors correlated with altered AS of microexons. It has shown that tamoxifen-mediated removal of the GT construct can restore nSR100 protein levels as well as normal inclusion levels of microexons. It also uncovered phenotypic discrepancies between nSR100GT and nSR100D7-8 mice and argues that further examinations and comparisons between the two allele variants can help to pin down neurodevelopmental and/or neurophysiological processes affected by a specific allele that are accountable for allele-differential and ASD-associated behaviors. It also proposes two alternative models, including one that allows CRISPR-SpCas9 mediated adult-specific KO of nSR100 in specific brain regions and/or circuit levels and one that allows AAV-mediated transient overexpression of nSR100 in nSR100-deficient and/or ASD-like mouse brains, in the hope of assessing the potential of nSR100 as a therapeutic target for ASD.

References

Abu-Elneel, K. et al. (2008). Heterogeneous dysregulation of microRNAs across the autism spectrum. Neurogenetics 9, 153-61.

Adlakha, Y. K. & Saini, N. (2014). Brain microRNAs and insights into biological functions and therapeutic potential of brain enriched miRNA-128. Mol. Cancer 13, 33.

Albert K., Voutilainen M., Domanskyi A., Airavaara M. (2017). AAV Vector-Mediated Gene Delivery to Substantia Nigra Dopamine Neurons: Implications for Gene Therapy and Disease Models Genes 8(2), 63.

Alexander, A.L., Lee, J.E., Lazar, M., Boudos, R., DuBray, M.B., Oakes, T.R., Miller, J.N., Lu, J., Jeong, E.K., McMahon, W.M., et al. (2007). Diffusion tensor imaging of the corpus callosum in Autism. Neuroimage 34, 61-73

Allada R, Kadener S, Nandakumar N, Rosbash M. (2003). A recessive mutant of Drosophila clock reveals a role in circadian rhythm amplitude. EMBO J 22, 3367–3375.

Amaral, D.G., Schumann, C.M., and Nordahl, C.W. (2008). Neuroanatomy of autism. Trends Neurosci. 31, 137–145.

Ander, B.P., Barger, N., Stamova, B., Sharp, F.R. & Schumann, C.M. (2015). Atypical miRNA expression in temporal cortex associated with dysregulation of immune, cell cycle, and other pathways in autism spectrum disorders. Mol Autism 6, 37.

Andersson KB, Winer LH, Mørk HK, Molkentin JD, Jaisser F. (2010). Tamoxifen administration routes and dosage for inducible Cre-mediated gene disruption in mouse hearts. Transgenic Res. 19(4), 715–725.

Aoto, J., Martinelli, D.C., Malenka, R.C., Tabuchi, K., and Sudhof, T.C. (2013). Presynaptic neurexin-3 alternative splicing trans-synaptically controls post- synaptic AMPA receptor trafficking. Cell 154, 75–88.

Aroian R. V., Sternberg P. W., (1991) Multiple functions of let-23, a Caenorhabditis elegans receptor tyrosine kinase gene required for vulval induction. Genetics 128: 251–267.

Aschauer DF, Kreuz S, Rumpel S. (2013). Analysis of transduction efficiency, tropism and axonal transport of AAV serotypes 1, 2, 5, 6, 8 and 9 in the mouse brain. PLoS One 8:e76310 10.1371

August, G. J., and Lockhart, L. H. (1984). Familial autism and the fragileX chromosome. J Autism Dev Disord 14, 197-204.

Bailey A., Le-Couteur A., Gottesman I., Bolton P., Simonoff E., Yuzda E., Rutter M. (1995). Autism as a strongly genetic disorder: evidence from a British twin study. Psychol Med 25, 96

63-77.

Bakken TE, Miller JA, Ding SL, Sunkin SM, Smith KA, et al. 2016. A comprehensive transcriptional map of primate brain development. Nature 535:367–75

Barash Y, Calarco JA, Gao W, Pan Q, Wang X, Shai O, Blencowe BJ, Frey BJ. (2010). Deciphering the splicing code. Nature 465:53–9.

Barbosa-Morais, N.L., Irimia, M., Pan, Q., Xiong, H.Y., Gueroussov, S., Lee, L.J., Slobodeniuc, V., Kutter, C., Watt, S., C ̧ olak, R., et al. (2012). The evolutionary landscape of alternative splicing in vertebrate species. Science 338, 1587–1593.

Bear M.F., Huber K.M., and Warren S.T. (2004). The mGluR theory of fragile X mental retardation. Trends Neurosci. 27, 370–377.

Berg JM, Geschwind DH. (2012). Autism genetics: searching for specificity and convergence. Genome Biol 13, 247.

Bergbaum A. and Ogilvie C.M. (2016). Autism and chromosome abnormalities-A review. Clin Anat 29(5), 620-627.

Bernard A, Lubbers LS, Tanis KQ, Luo R, Podtelezhnikov AA, et al. (2012). Transcriptional architecture of the primate neocortex. Neuron 73:1083–99

Bersell K, Choudhury S, Mollova M, Polizzotti BD, Ganapathy B, Walsh S, et al. (2013) Moderate and high amounts of tamoxifen in alphaMHC-MerCreMer mice induce a DNA damage response, leading to heart failure and death. Disease models & mechanisms. 6(6),1459–69.

Bi C., Wu J., Jiang T., Liu Q., Cai W., Yu P., Cai T., Zhao M., Jiang Y.H., and Sun Z.S. (2012). Mutations of ANK3 identified by exome sequencing are associated with autism susceptibility. Hum. Mutat. 33, 1635–1638.

Brielmaier J., Matteson P.G., Silverman J.L., Senerth J.M., Kelly S., Genestine M., Millonig J.H., DiCicco-Bloom E., Crawley J.N. (2012). Autism-relevant social abnormalities and cognitive deficits in engrailed-2 knockout mice. PloS One 7:e40914.

Burger C, Gorbatyuk OS, Velardo MJ, Peden CS, Williams P, Zolotukhin S, et al. (2004). Recombinant AAV viral vectors pseudotyped with viral capsids from serotypes 1, 2, and 5 display differential efficiency and cell tropism after delivery to different regions of the central nervous system. Mol Ther 10(2), 302–317.

Cadwell CR, et al. Electrophysiological, transcriptomic and morphologic profiling of single neurons using Patch-seq. (2016). Nat Biotechnol. 34, 199–203.

Calarco, J.A., Superina, S., O’Hanlon, D., Gabut, M., Raj, B., Pan, Q., Skalska, U., Clarke, L., Gelinas, D., van der Kooy, D., et al. (2009). Regulation of vertebrate nervous system 97

alternative splicing and development by an SR-related protein. Cell 138, 898–910.

Castermans, D., Wilquet, V., Parthoens, E., Huysmans, C., Steyaert, J., Swinnen, L., Fryns, J.P., Van de Ven, W., and Devriendt, K. (2003). The neuro- beachin gene is disrupted by a translocation in a patient with idiopathic autism. J. Med. Genet. 40, 352–356.

Cellot G, Cherubini E. GABAergic signaling as therapeutic target for autism spectrum disorders. Front Pediatr. 2014; 2: 70

Chao, H.-T., Chen, H., Samaco, R.C., Xue, M., Chahrour, M., Yoo, J., Neul, J.L., Gong, S., Lu, H.-C., Heintz, N., et al. (2010). Dysfunction in GABA signalling mediates autism-like stereotypies and Rett syndrome phenotypes. Nature 468, 263–269.

Chawla, G., Lin, C.H., Han, A., Shiue, L., Ares, M., Jr., and Black, D.L. (2009). Sam68 regulates a set of alternatively spliced exons during neurogenesis. Mol Cell Biol 29, 201- 213.

Chen J.S., Ma E., Harrington L.B., Da Costa M., Tian X., Palefsky J.M. (2018). CRISPR- Cas12a target binding unleashes indiscriminate single-stranded DNase activity. Science 360(6387), 436–439.

Chen R.Z., Akbarian S., Tudor M., Jaenisch R. Deficiency of methyl-CpG binding protein-2 in CNS neurons results in a Rett-like phenotype in mice. Nat. Genet. 2001;27:327–331.

Clowry G, Molna ́r Z, Rakic P. 2010. Renewed focus on the developing human neocortex. J. Anat. 217:276–88 Colantuoni C, Lipska BK, Ye T, Hyde TM, Tao R, et al. 2011. Temporal dynamics and genetic control of transcription in the human prefrontal cortex. Nature 478:519– 23

Colantuoni C, Lipska BK, Ye T, Hyde TM, Tao R, et al. (2011). Temporal dynamics and genetic control of transcription in the human prefrontal cortex. Nature 478, 519–23

Cornew, L., Roberts, T.P., Blaskey, L., and Edgar, J.C. (2012). Resting-state oscillatory activity in autism spectrum disorders. J Autism Dev Disord 42, 1884-1894.

Cowan, W. M., Fawcett, J., O’Leary, D. D. M., & Stanfield, B. B. (1984). Regressive events in neurogenesis. Science 225(468), 1258–1265.

Crick F. Central dogma of molecular biology. (1970). Nature. 227, 561-563. de la Torre-Ubieta, L., Won, H.H., Stein, J.L., Geschwind, D.H. (2016). Advancing the understanding of autism disease mechanisms through genetics. Nat Med 22, 345–361.

De Rubeis S., Buxbaum J.D. (2015). Genetics and genomics of autism spectrum disorder: embracing complexity. Hum Mol Genet 24 R1, R24-R31.

Devlin B. and Scherer S.W. (2012). Genetic architecture in autism spectrum disorder. Curr. Opin. Genet. Dev. 22, 229–237.

Doers, M.E., Musser, M.T., Nichol, R., Berndt, E.R., Baker, M., Gomez, T.M., Zhang, S.C., Abbeduto, L., and Bhattacharyya, A. (2014). iPSC-derived forebrain neurons from FXS individuals show defects in initial neurite outgrowth. Stem Cells Dev 23, 1777- 1787.

Dosenbach, N. U. F., Nardos, B., Cohen, A. L., Fair, D. A., Church, J. A., Nelson, S. M., et al. (2010). Prediction of individual brain maturity using fMRI. Science 329(5997), 1358–1361.

Ebert, D.H., and Greenberg, M.E. (2013). Activity-dependent neuronal signalling and autism spectrum disorder. Nature 493, 327-337.

Ecker, C.C., Suckling, J.J., Deoni, S.C.S., Lombardo, M.V.M., Bullmore, E.T.E., Baron- Cohen, S.S., Catani, M.M., Jezzard, P.P., Barnes, A.A., Bailey, A.J.A., et al.; MRC AIMS Consortium. (2012). Brain anatomy and its relationship to behavior in adults with autism spectrum disorder: a multicenter magnetic resonance imaging study. Arch. Gen. Psychiatry 69, 195–209.

Ehninger, D. et al. Reversal of learning deficits in a Tsc2+/– mouse model of tuberous sclerosis. Nat. Med. 14, 843–848 (2008).

Ellis, J.D., Barrios-Rodiles, M., Colak, R., Irimia, M., Kim, T., Calarco, J.A., Wang, X., Pan, Q., O'Hanlon, D., Kim, P.M., et al. (2012). Tissue-specific alternative splicing remodels protein-protein interaction networks. Mol Cell 46, 884-892.

Ennaceur A. Unconditioned tests of anxiety - Pitfalls and disappointments. (2014). Physiol. Behav 135, 55–71

Fair, D. A., Cohen, A. L., Power, J. D., Dosenbach, N. U., Church, J. A., Miezin, F. M., et al. (2009). Functional brain networks develop from a “local to distributed” organization. PLoS Comp Bio 5(5), e1000381.

Falconer, D.S. (1965). The inheritance of liability to certain diseases, estimated from the incidence among relatives. Ann Hum Genet 29, 51–76.

Fan L, Li H, Zhuo J, Zhang Y, Wang J, et al. (2016). The human Brainnetome Atlas: a new brain atlas based on connectional architecture. Cereb. Cortex 26:3508–26

Fernandez BA, Scherer SW. (2017). Syndromic autism spectrum disorders: moving from a clinically defined to a molecularly defined approach. Dialog. Clin. Neurosci 19, 353–371.

Filiano, A. J., Xu, Y., Tustison, N. J., Marsh, R. L., Baker, W., Smirnov, I., et al. (2016). Unexpected role of interferon-γ in regulating neuronal connectivity and social behaviour. Nature 535, 425–429.

Fineberg SK, Kosik KS, Davidson BL. (2009). MicroRNAs potentiate neural development. Neuron 64,303–9.

Fino E, Packer AM, Yuste R. (2013). The Logic of Inhibitory Connectivity in the Neocortex. The Neuroscientist 19(3), 228–237.

Fisher, R.A. (1918). The correlation between relatives on the supposition of Mendelian inheritance. Trans R Soc Edinb 52, 399–433.

Foiling, A. (1934). Phenylpyruvic acid as a metabolic anomaly in connection with imbecility. Hoppe Seylers Z Physiol Chem 224, 169-176.

Folstein S.E., Rosen-Sheidley B. (2001). Genetics of austim: complex aetiology for a heterogeneous disorder. Nat Rev Genet 2, 943–955.

Folstein S.E. and Rutter ML. (1998). Autism: familial aggregation and genetic implications. J Autism Dev Disord 18, 3–30.

Folstein S.E. and Rutter, M. (1997). Infantile autism: a genetic study of 21 twin pairs. J Child Psychol 18, 297–321.

Friard, O., and Gamba, M. (2016). BORIS: a free, versatile open-source event-logging software for video/audio coding and live observations. Methods Ecol Evol. DOI: 10.1111/2041- 210X.12584.

Fuzik J, Zeisel A, Mate Z, Calvigioni D, Yanagawa Y, et al. (2016). Integration of electrophysiological recordings with single-cell RNA-seq data identifies neuronal subtypes. Nat Biotechno. 34, 175–83

Galton, F. (1872). On blood relationship. Proc R Soc Lond 20, 394–402.

Gapinske M., Luu A., Winter J., Woods W.S., Kostan K.A., Shiva N., et al. (2018). CRISPR- SKIP: programmable gene splicing with single base editors Genome Biol 19(1), 107

Gaugler T, Klei L, Sanders SJ, Bodea CA, Goldberg AP, Lee AB, Mahajan M, Manaa D, Pawitan Y, Reichert J, Ripke S, Sandin S, Sklar P, Svantesson O, Reichenberg A, Hultman CM, Devlin B, Roeder K, Buxbaum J.D. (2014). Most genetic risk for autism resides with common variation. Nat Genet 46, 881-885.

Gauthier, J., Siddiqui, T.J., Huashan, P., Yokomaku, D., Hamdan, F.F., Champagne, N., Lapointe, M., Spiegelman, D., Noreau, A., Lafrenie` re, R.G., et al. (2011). Truncating mutations in NRXN2 and NRXN1 in autism spectrum disorders and schizophrenia. Hum. Genet. 130, 563–573.

Gehman LT, Stoilov P, Maguire J, Damianov A, Lin C-H, Shiue L, et al. (2011). The splicing regulator Rbfox1 (A2BP1) controls neuronal excitation in the mammalian brain. Nat Genet 43, 706–711.

Gemelli T, Berton O, Nelson ED, Perrotti LI, Jaenisch R, Monteggia LM. Postnatal loss of

100

methyl-CpG binding protein 2 in the Forebrain is sufficient to mediate behavioral aspects of Rett syndrome in mice. Biological Psychiatry. 2006;59(5):468–76.

Geschwind, D.H. (2009). Advances in autism. Annu. Rev Med 60, 367–380.

Geschwind, D.H. (2011). Genetics of autism spectrum disorders. Trends Cogn. Sci. 15, 409– 416.

Geschwind, D.H. and State, M.W. (2015). Gene hunting in autism spectrum disorder: on the path to precision medicine. Lancet Neurol 14, 1109–1120.

Gillberg, C. Chromosomal disorders and autism. (1998). J Autism Dev Disord 28, 415–425 (1998).

Gkogkas CG, Khoutorsky A, Ran I, Rampakakis E, Nevarko T, Weatherill DB, et al. Autism- related deficits via dysregulated eIF4E-dependent translational control. Nature. 2013;493(7432):371–7.

Glasser MF, Coalson TS, Robinson EC, Hacker CD, Harwell J, et al. (2016). A multi-modal parcellation of human cerebral cortex. Nature 536:171–78

Gozzi, A., and Schwarz, A. J. (2016). Large-scale functional connectiviaty networks in the rodent brain. Neuro image 127, 496–509.

Gueroussov S, Weatheritt RJ, O'Hanlon D, Lin ZY, Narula A, Gingras AC, Blencowe BJ. (2017). Regulatory expansion in mammals of multivalent hnRNP assemblies that globally control alternative splicing. Cell 170, 324–339.

Gupta I., Collier P.G., Haase B., Mahfouz A., Joglekar A., Floyrd T., et al. (2018) Single-cell isoform RNA sequencing characterizes isoforms in thousands of cerebellar cells. Nat Biotechnol [Epub ahead of print]

Haberl, M. G., Zerbi, V., Veltien, A., Ginger, M., Heerschap, A., and Frick, A. (2015). Structural-functional connectivity deficits of neocortical circuits in the Fmr1(−/y) mouse model of autism. Sci. Adv. 1:e1500775.

Han S., Tai C., Westenbroek R. E., Yu F. H., Cheah C. S., Potter G. B., et al. . (2012). Autistic-like behaviour in Scn1a+/− mice and rescue by enhanced GABA-mediated neurotransmission. Nature 489, 385–390.

Hawrylycz MJ, Lein ES, Guillozet-Bongaarts AL, Shen EH, Ng L, et al. (2012). An anatomically comprehensive atlas of the adult human brain transcriptome. Nature 489:391–99

Hawrylycz MJ, Miller JA, Menon V, Feng D, Dolbeare T, et al. (2015). Canonical genetic signatures of the adult human brain. Nat. Neurosci. 18:1832–44

Hu H, Gan J, Jonas P. (2014). Interneurons. Fast-spiking, parvalbumin(+) GABAergic

101

interneurons: from cellular design to microcircuit function. Science 345:1255263

Hubbard, K.S., Gut, I.M., Lyman, M.E., and McNutt, P.M. (2013). Longitudinal RNA sequencing of the deep transcriptome during neurogenesis of cortical glutamatergic neurons from murine ESCs. F1000Res 2, 35.

Hughes, J. R. (2008). Gamma, fast, and ultrafast waves of the brain: Their relationships with epilepsy and behavior. Epilepsy Behav 13, 25–31.

Hulbert S.W., Jiang Y.H. (2016). Monogenic mouse models of autism spectrum disorders: common mechanisms and missing links. J Neurosci 321,3–23.

Husain T., Passini M. A., Parente M. K., Fraser N. W., Wolfe J. H. (2009). Long-term AAV gene and protein expression in mouse brain from a small pan-cellular promoter is similar to neural cell promoters. Gene Ther. 16: 927–932.

Iijima, T., Wu, K., Witte, H., Hanno-Iijima, Y., Glatter, T., Richard, S., and Scheiffele, P. (2011). SAM68 regulates neuronal activity-dependent alternative splicing of neurexin-1. Cell 147, 1601–1614.

Inui K, Nakagawa K, Nishihara M, Motomura E, Kakigi R. (2016). Inhibition in the human auditory cortex.PLoS One,11:e0155972

Irimia M, Weatheritt RJ, Ellis JD, Parikshak NN, Gonatopoulos-Pournatzis T, et al. (2014). A highly conserved program of neuronal microexons is misregulated in autistic brains. Cell 159, 1511–23

Jelen, N., Ule, J., Zivin, M., and Darnell, R.B. (2007). Evolution of Nova-dependent splicing regulation in the brain. PLoS Genet 3, 1838–1847. Jenny F.H., Basler K. (2014). Powerful drosophila screens that paved the wingless pathway. Fly 8, 218–225.

Jones-Davis DM, Yang M, Rider E, et al. ( 2013). Quantitative trait loci for interhemispheric commissure development and social behaviors in the BTBR T(+) tf/J mouse model of autism. PLoS One 8:e61829.

Just, M.A., Cherkassky, V.L., Keller, T.A., Kana, R.K., and Minshew, N.J. (2007). Functional and anatomical cortical underconnectivity in autism: evidence from an FMRI study of an executive function task and corpus callosum morphometry. Cereb Cortex 17, 951-961

Kamiya N, Kobayashi T, Mochida Y, et al. Wnt inhibitors Dkk1 and Sost are downstream targets of BMP signaling through the type IA receptor (BMPRIA) in osteoblasts. (2010). J Bone Miner Res 25 (2), 200–10.

Kang HJ, Kawasawa YI, Cheng F, Zhu Y, Xu X, et al. (2011). Spatio-temporal transcriptome of the human brain. Nature 478:483–89

102

Kanner, L. (1943). Autistic disturbances of affective contact. Nervous Child 2, 217-250.

Kelemen O, Convertini P, Zhang Z, Wen Y, Shen M, Falaleeva M, Stamm S. (2013). Function of alternative splicing. Gene. 514:1–30.

Kim B, Colon E, Chawla S, Vandenberg LN, Suvorov A. (2015). Endocrine disruptors alter social behaviors and indirectly influence social hierarchies via changes in body weight. Environ Health. 14, 64.

Kim, H.-J., Cho, M.-H., Shim, W. H., Kim, J. K., Jeon, E.-Y., Kim, D.-H., et al. (2016). Deficient autophagy in microglia impairs synaptic pruning and causes social behavioral defects. Mol Psychiatry doi: 10.1038

Kohane, I.S., McMurry, A., Weber, G., MacFadden, D., Rappaport, L., Kunkel, L., Bickel, J., Wattanasin, N., Spence, S., Murphy, S., et al. (2012). The co-morbidity burden of children and young adults with autism spectrum disorders. PLoS One 7, e33224.

Kurejova M, Nattenmuller U, Hildebrandt U, Selvaraj D, Stösser S, Kuner R. (2010). An improved behavioural assay demonstrates that ultrasound vocalizations constitute a reliable indicator of chronic cancer pain and neuropathic pain. Mol Pain 6:18

Labouesse M. A., Polesel M., Clementi E., Muller F., Markkanen E., Mouttet F., et al. (2018). MicroRNA expression profiling in the prefrontal cortex: putative mechanisms for the cognitive effects of adolescent high fat feeding. Sci. Rep. 8:8344.

Lau C.H., Suh Y. (2017). In vivo genome editing in animals using AAV-CRISPR system: Applications to translational research of human disease. F1000Research 6, 2153.

Lee E., Lee J., Kim E. (2017). Excitation/inhibition imbalance in animal models of autism spectrum disorders. Biol. Psychiatry 81, 838–847.

Lee S.H., Ripke S., Neale B.M., Faraone S.V., Purcel S.M., Perlis R.H., et al. (2013). Genetic relationship between five psychiatric disorders estimated from genome-wide SNPs. Nat Genet 45, 984–994.

Lehmann ML, Geddes CE, Lee JL, Herkenham M. (2013). Urine scent marking (USM): a novel test for depressive-like behavior and a predictor of stress resiliency in mice. PLoS One 8,e69822.

Lein E., Borm LE, Linnarsson S. (2017). The promise of spatial transcriptomics for neuroscience in the era of molecular cell typing. Science, 64–69.

Lein E. S., Belgard T. G., Hawrylycz M., Molnár Z. (2017). Transcriptomic perspectives on neocortical structure, development, evolution, and disease. Annu. Rev. Neurosci. 40 629–652.

103

Lerner I., Bartok O, Wolfson V, Menet JS, Weissbein U, Afik S, Haimovich D, Gafni C, Friedman N, Rosbash M, et al. (2015). Clk post-transcriptional control denoises circadian transcription both temporally and spatially. Nat Commun. 6, 7056.

Li D., Karnath HO, Xu X. (2017). Candidate biomarkers in children with autism spectrum disorder: a review of MRI studies. Neurosci Bull. 33:219–37.

Li Q., Wang L., Li X.Y., et al. (2018). Total Salvianolic Acid Balances Brain Functional Network Topology in Rat Hippocampi Overexpressing miR-30e. Front Neurosci 5, 12-448

Li Y., Zhang P., Choi T.Y., Park S.K., Park H., Lee E.J., Lee D., Roh J.D., Mah W., Kim R., et al. (2015). Splicing-dependent trans-synaptic SALM3-LAR-RPTP interactions regulate excitatory synapse development and locomotion. Cell Rep 12, 1618–1630.

Licatalosi, D.D., Yano, M., Fak, J.J., Mele, A., Grabinski, S.E., Zhang, C., and Darnell, R.B. (2012). Ptbp2 represses adult-specific splicing to regulate the generation of neuronal precursors in the embryonic brain. Genes Dev. 26, 1626–1642.

Lindell AK and Hudry K. (2013). Atypicalities in cortical structure, handedness, and functional lateralization for language in autism spectrum disorders. Neuropsychol Rev. United States 23, 257–270.

Liska A. and Gozzi A. (2016). Can Mouse Imaging Studies Bring Order to Autism Connectivity Chaos? Front. Neurosci 10, 484.

Liska A., Gomolka R., Sabbioni M., Galbusera A., Panzeri S., Scattoni, M. L., et al. (2016). Homozygous loss of autism-risk gene CNTNAP2 results in reduced local and long-range prefrontal functional connectivity. bioRxiv 60335. doi: 10.1101/060335

Linker S.B., Marchetto M.C., Narvaiza I., Denli A.M., and Gage F.H. (2017). Examining non- LTR retrotransposons in the context of the evolving primate brain. BMC Biol 15-68.

Liu E. T., Bolcun-Filas E., Grass D. S., Lutz C., Murray S., Shultz L., et al. (2017). Of mice and CRISPR: the post-CRISPR future of the mouse as a model system for the human condition. EMBO Rep. 18, 187–193.

Lowery RL, Zhang Y, Kelly EA, Lamantia CE, Harvey BK, Majewska AK. Rapid, long-term labeling of cells in the developing and adult rodent visual cortex using double-stranded adeno- associated viral vectors. (2009). Developmental neurobiology 69, 674–688.

Lundstrom, S., Reichenberg, A., Melke, J., Rastam, M., Kerekes, N., Lichtenstein, P., Gillberg, C., and Anckarsater, H. (2015). Autism spectrum disorders and coexisting disorders in a nationwide Swedish twin study. J Child Psychol Psychiatry 56, 702-710.

Luo, L., & O’Leary, D. (2005). Axon retraction and degeneration in development and disease. Annual Review of Neuroscience, 28, 127–156. Sandberg M.L., Sutton S.E., Pletcher M.T., Wiltshire T., Tarantino L..M., Hogenesch J.B., 104

Cooke M.P. (2005). c-Myb and p300 regulate hematopoietic stem cell proliferation and differentiation Dev. Cell 8, 153-166

Marshall CR, Noor A, Vincent JB, Lionel AC, Feuk L, Skaug J, et al. (2008). Structural variation of chromosomes in autism spectrum disorder. Am J Hum Genet 82, 477-488.

Maze, I., Wenderski, W., Noh, K.M., Bagot, R.C., Tzavaras, N., Purushothaman, I., Elsasser, S.J., Guo, Y., Ionete, C., Hurd, Y.L., et al. (2015). Critical Role of Histone Turnover in Neuronal Transcription and Plasticity. Neuron 87, 77-94

McClellan, J. and King, M. (2010). Genetic Heterogeneity in Human Disease. Cell 141, 210– 217.

McConnell M.J., Moran J.V., Abyzov A, et al. (2017). Intersection of diverse neuronal genomes and neuropsychiatric disease: The Brain Somatic Mosaicism Network. Science 356- eaal1641

McLean J.R., Smith G.A., Rocha E.M., Hayes M.A., Beagan J.A., Hallett P.J., Isacson O. (2014) Widespread neuron-specific transgene expression in brain and spinal cord following synapsin promoter-driven AAV9 neonatal intracerebroventricular injection. Neurosci. Lett., 576, 73–78.

McMahon JJ, et al. (2015). Seizure-dependent mTOR activation in 5-HT neurons promotes autism-like behaviors in mice. Neurobiol Dis 73, 296–306.

Merkin, J., Russell, C., Chen, P., and Burge, C.B. (2012). Evolutionary dynamics of gene and isoform regulation in Mammalian tissues. Science 338, 1593–1599.

Micheva KD, Busse B, Weiler NC, O'Rourke N, Smith S.J. (2010). Single-synapse analysis of a diverse synapse population: proteomic imaging methods and markers. Neuron 68, 639–653.

Mohammad-Rezazadeh, I., Frohlich, J., Loo, S. K., and Jeste, S. S. (2016). Brain connectivity in autism spectrum disorder. Curr. Opin. Neurol. 29, 137–147.

Mouton PR, Price DL, Walker L.C. (1995). Empirical assessment of synapse numbers in primate neocortex. J Neurosci Meth.75, 119–126.

Murlidharan G, Sakamoto K, Rao L, Corriher T, Wang D, Gao G, Sullivan P, Asokan A. (2016). CNS-restricted transduction and CRISPR/Cas9-mediated gene deletion with an engineered AAV vector. Mol Ther Nucleic Acids 5, e338.

Naviaux JC, Schuchbauer MA, Li K, Wang L, Risbrough VB, Powell SB, et al. Reversal of autism-like behaviors and metabolism in adult mice with single-dose antipurinergic therapy. Transl Psychiatry. 2014;4:e400

Nelson, S.B., and Valakh, V. (2015). Excitatory/Inhibitory Balance and Circuit Homeostasis in

105

Autism Spectrum Disorders. Neuron 87, 684-698.

Nilsen TW, Graveley BR. Expansion of the eukaryotic proteome by alternative splicing. Nature (2010) 463:457–63.

Nowak JS, Michlewski G. (2013). miRNAs in development and pathogenesis of the nervous system. Biochem Soc Trans 41, 815-820.

O’Brien J. E., Meisler M. H. (2013). Sodium channel SCN8A (Nav1.6): properties and de novo mutations in epileptic encephalopathy and intellectual disability. Front. Genet. 4:213

O’Reilly C, Lewis J.D., Elsabbagh M. (2017). Is functional brain connectivity atypical in autism? A systematic review of EEG and MEG studies. Plos One 12:e0175870.

Ohnishi, T., Shirane, M., Hashimoto, Y., Saita, S., and Nakayama, K.I. (2014). Identification and characterization of a neuron-specific isoform of protrudin. Genes Cells 19, 97–111.

Orekhova E.V., Elsabbagh M, Jones E, Dawson G, Charman T, Johnson MH, Team B. (2014). EEG hyper- connectivity in high-risk infants is associated with later autism. J. Neurodev. Disord 6, 40.

Orekhova E.V., Stroganova T. A., Nygren G., Tsetlin M. M., Posikera I. N., Gillberg C., et al. (2007). Excess of high frequency electroencephalogram oscillations in boys with autism. Biological Psychiatry, 62, 1022–1029.

Osorio F.G., Navarro C.L., Cadiñanos J., López-Mejía I.C., Quirós P.M., Bartoli C., Rivera J., Tazi J., Guzmán G., (2011). Varela I. Splicing-directed therapy in a new mouse model of human accelerated aging. Sci. Transl Med 3,106-107.

Parikshak NN, Luo R, Zhang A, Won H, Lowe JK, et al. (2013). Integrative functional genomic analyses implicate specific molecular pathways and circuits in autism. Cell 155:1008–21

Parikshak N.N., Swarup V., Belgard T.G., Irimia M., Ramaswami G., Gandal M.J., Hartl C., Leppa V., Ubieta L.T., Huang J., et al. (2016). Genome-wide changes in lncRNA, splicing, and regional gene expression patterns in autism. Nature 540, 423-427.

Park TS, Kihm J, Woo J, Park C, Lee WY, et al. (2018). Brain and eyes of Kerygmachela reveal protocerebral ancestry of the panarthropod head. Nat Commun 9(1), 1019.

Parras A, Anta H, Santos-Galindo M, Swarup V, Elorza A, et al. (2018). Autism-like phenotype and risk gene mRNA deadenylation by CPEB4 mis-splicing. Nature 560 (7719), 441-446

Patel SH, O'Hara L, Atanassova N, Smith SE, Curley MK, Rebourcet D, Darbey AL, Gannon AL, Sharpe RM, Smith LB. (2017). Low-dose tamoxifen treatment in juvenile males has long- term adverse effects on the reproductive system: implications for inducible transgenics. Sci

106

Rep 7, 8991

Pearson-Leary J, Eacret D, Chen R, Takano H, Nicholas B, Bhatnagar S, et al. (2017). Inflammation and vascular remodeling in the ventral hippocampus contributes to vulnerability to stress. Transl Psychiatry 7, e1160.

Penagarikano O, Abrahams BS, Herman EI, Winden KD, Gdalyahu A, Dong H, Sonnenblick LI, Gruver R, Almajano J, Bragin A, et al. (2011). Absence of CNTNAP2 leads to epilepsy, neuronal migration abnormalities, and core autism-related deficits. Cell 147, 235–246.

Quesnel-Vallières M., Irimia M., Cordes S.P., and Blencowe B.J. (2015) Essential roles for the splicing regulator nSR100/Srrm4 during nervous system development. Genes Dev. 29: 746- 759.

Quesnel-Vallières M., Dargaei Z., Irimia M., Gonatopoulos-Pournatzis T., Ip J., Wu M., Sterne-Weiler T., Nakagawa S., Woodin M.A., Blencowe B.J., and Cordes S.P. (2016) Misregulation of an activity-dependent splicing network as a common mechanism underlying autism spectrum disorders. Mol Cell. 64: 1023-1034.

Quesnel-Vallières M, Weatheritt RJ, Cordes SP, Blencowe BJ. (2018). Autism spectrum disorder: insights into convergent mechanisms from transcriptomics.

Quinlan S., Kenny A., Medina M., Engel T., Jimenez-Mateos E.M. (2017). MicroRNAs in Neurodegenerative Diseases. Int Rev Cell Mol Biol 334, 309-343

Rabaneda LG, Robles-Lanuza E, Nieto-González J, Scholl FG. (2014). Neurexin Dysfunction in Adult Neurons Results in Autistic-like Behavior in Mice. Cell Rep 8, 338–346

Raj, B., and Blencowe, B.J. (2015). Alternative Splicing in the Mammalian Nervous System: Recent Insights into Mechanisms and Functional Roles. Neuron 87, 14-27.

Raj, B., Irimia, M., Braunschweig, U., Sterne-Weiler, T., O’Hanlon, D., Lin, Z.-Y., Chen, G.I., Easton, L.E., Ule, J., Gingras, A.-C., et al. (2014). A global regulatory mechanism for activating an exon network required for neurogenesis. Mol. Cell 56, 90–103.

Raj, B., O’Hanlon, D., Vessey, J.P., Pan, Q., Ray, D., Buckley, N.J., Miller, F.D., and Blencowe, B.J. (2011). Cross-regulation between an alternative splicing activator and a transcription repressor controls neurogenesis. Mol. Cell 43, 843–850.

Rapanelli M., Frick L.R., Pittenger C. (2017). The role of interneurons in autism and Tourette syndrome. Trends Neurosci 40, 397-407

Richiardi J, Altmann A, Milazzo AC, Chang C, Chakravarty MM, et al. (2015). Correlated gene expression supports synchronous activity in brain networks. Science 348:1241–44

Ronald A. and Hoekstra R.A. (2011). Autism spectrum disorders and autistic traits: a decade of new twin studies. Am J Med Genet B Neuropsychiatr Genet 156B, 255–274.

107

Rosenberg, R. N., and Pettegrew, J. D. (1980). Genetic disease of the nervous system. In J M Dietschy Clin Med Neuro 5,165-242.

Rubenstein, J.L. (2011). Annual Research Review: Development of the cerebral cortex: implications for neurodevelopmental disorders. J. Child Psychol. Psychiatry 52, 339–355.

Rubenstein, J.L.R., and Merzenich, M.M. (2003). Model of autism: increased ratio of excitation/inhibition in key neural systems. Genes Brain Behav. 2, 255–267. Rudy B, Fishell G, Lee S, Hjerling-Leffler J. (2011). Three groups of interneurons account for nearly 100% of neocortical GABAergic neurons. Dev. Neurobiol 71, 45–61

Santini, E., Huynh, T.N., MacAskill, A.F., Carter, A.G., Pierre, P., Ruggero, D., Kaphzan, H., and Klann, E. (2013). Exaggerated translation causes synaptic and behavioural aberrations associated with autism. Nature 493, 411-415.

Sato, D., Lionel, A.C., Leblond, C.S., Prasad, A., Pinto, D., Walker, S., O’Connor, I., Russell, C., Drmic, I.E., Hamdan, F.F., et al. (2012). SHANK1 de- letions in males with autism spectrum disorder. Am. J. Hum. Genet. 90, 879–887.

Schultz B.R., Chamberlain J.S. Recombinant adeno-associated virus transduction and integration. (2008). Mol Ther 16, 1189–1199.

Scotti, M. M. & Swanson, M. S. RNA mis-splicing in disease. Nat. Rev. Genet. 17, 19–32 (2016).

Selten M., van Bokhoven H., Nadif Kasri N. (2018). Inhibitory control of the excitatory/inhibitory balance in psychiatric disorders. F1000Reserch 7, 23.

Sforazzini, F., Bertero, A., Dodero, L., David, G., Galbusera, A., Scattoni, M. L., et al. (2016). Altered functional connectivity networks in acallosal and socially impaired BTBR mice. Brain Struct. Funct. 221, 941–954. doi: 10.1007/s00429- 014-0948-9

Shehata M, van Amerongen R, Zeeman AL, Giraddi RR, Stingl J. (2014). The influence of tamoxifen on normal mouse mammary gland homeostasis. Breast Cancer Res 16, 411.

Shen Y, Dies KA, Holm IA, Bridgemohan C, Sobeih MM, Caronna EB, Miller KJ, Frazier JA, Silverstein I, Picker J et al. (2010). Clinical genetic testing for patients with autism spectrum disorders. Pediatrics 125, e727-e735.

Silverman J.L., Tolu S. S., Barkan C. L., Crawley J. N. (2010). Repetitive self-grooming behavior in the BTBR mouse model of autism is blocked by the mGluR5 antagonist MPEP. Neuropsychopharmacology 35, 976–989.

Silverman J.L., Oliver C.F., Karras M.N., Gastrell P.T., Crawley J.N. (2013). AMPAKINE enhancement of social interaction in the BTBR mouse model of autism. NLM 64, 268–282. Silverman J.L., Yang M., Lord C., Crawley J.N.. (2010). Behavioural phenotyping assays for

108

mouse models of autism. Nat. Rev. Neurosci 11, 490–502.

Sinclair D., Oranje B., Razak K. A., Siegel S. J., Schmid S. (2017). Sensory processing in autism spectrum disorders and fragile X syndrome – From the clinic to animal models. Neurosci Biobehav Rev 76, 235–253.

Soriano P. (1999). Generalized lacZ expression with the ROSA26 Cre reporter strain. Nat Genet. 21-70

Spencer C, Alekseyenko O, Serysheva E, Yuva-Paylor L, Paylor R. (2005). Altered anxiety- related and social behaviors in the Fmr1 knockout mouse model of fragile X syndrome. Genes, Brain Behav. 4, 420–430.

Stamm S, Ben-Ari S, Rafalska I, Tang Y, Zhang Z, Toiber D, et al. (2005). Function of alternative splicing. Gene. 344, 1–20.

Stamova B, Ander BP, Barger N, Sharp FR, Schumann CM. (2015). Specific regional and age- related small noncoding RNA expression patterns within superior temporal gyrus of typical human brains are less distinct in autism brains. J Child Neurol 30(14), 1930–46.

Steffenburg S., Gillberg CL, Steffenburg U, Kyllerman M (1996). Autism in Angelman syndrome: a population-based study. Pediatr Neurol 14 (2), 131–6.

Steffenburg S., Gillberg C., Hellgren L., Andersson L., Gillberg I.C., Jakobsson G., Bohman M. (1989). A twin study of autism in Denmark, Finland, Iceland, Norway and Sweden. J Child Psychol Psychiatry 30, 405-416.

Sterne-Weiler T., Weatheritt R. J., Best A.J., Ha C.H. K., Blencowe B.J. (2018) Efficient and Accurate Quantitative Profiling of Alternative Splicing Patterns of Any Complexity on a Laptop

Stoppel L.J., Kazdoba T.M., et al. (2018) R-Baclofen Reverses Cognitive Deficits and Improves Social Interactions in Two Lines of 16p11.2 Deletion Mice. NLM 43(3), 513-524.

Su, X., Gopalakrishnan, V., Stearns, D., Aldape, K., Lang, F.F., Fuller, G., Snyder, E., Eberhart, C.G., and Majumder, S. (2006). Abnormal expression of REST/NRSF and Myc in neural stem/progenitor cells causes cerebellar tumors by blocking neuronal differentiation. Mol. Cell. Biol. 26, 1666–1678.

Sungur A.O., Stemmler L., Wohr M., Rust M.B. (2018). Impaired Object Recognition but Normal Social Behavior and Ultrasonic Communication in Cofilin1 Mutant Mice. Front Behav Neurosci 19,12-25

Swiech L., Heidenreich M., Banerjee A., et al. (2014). In vivo interrogation of gene function in the mammalian brain using CRISPR-Cas9. Nature Biotechnology 33(1), 102–106

Tan CL, Plotkin JL, Vene MT, von Schimmelmann M, Feinberg P, Mann S, Handler A, Kjems

109

J, Surmeier DJ, O’Carroll D, et al. (2013). MicroRNA-128 governs neuronal excitability and motor behavior in mice. Science 342, 1254–1258.

Tang G., Gudsnuk K., Kuo S.H., Cotrina M.L. Rosoklija G, Sosunov A, Sonders M.S. Loss of mTOR-dependent macroautophagy causes autistic-like synaptic pruning deficits. Neuron 83, 1131–1143 (2014).

Tantra M, et al. (2014). Mild expression differences of MECP2 influencing aggressive social behavior. EMBO Mol. Med 6, 662–684.

Thorey IS, Muth K, Russ AP, Otte J, Reffelmann A, et al. (1998). Selective disruption of genes transiently induced in differentiating mouse embryonic stem cells by using gene trap mutagenesis and site-specific recombination. Mol Cell Biol 18, 3081–3088.

Traunmuller, L., Gomez, A.M., Nguyen, T.M., and Scheiffele, P. (2016). Control of neuronal synapse specification by a highly dedicated alternative splicing program. Science 352, 982- 986.

Tsai LY. (1992). Is Rett syndrome a subtype of pervasive developmental disorders? J Autism Dev Disord 22(4), 551–561.

Veliskova J., Silverman J.L., Benson M., Lenck-Santini P.P. (2018) Autistic trains in epilepsy models: Why, when and how? Epilepsy Res 144, 62-70

Viemari, J.-C., Roux, J.C., Tryba, A.K., Saywell, V., Burnet, H., Pen ̃ a, F., Za- nella, S., Be ́vengut, M., Barthelemy-Requin, M., Herzing, L.B.K., et al. (2005). Mecp2 deficiency disrupts norepinephrine and respiratory systems in mice. J. Neurosci. 25, 11521–11530.

Vogel A. C., Power J. D., Petersen S. E., Schlaggar B. L. (2010). Development of the brain's functional network architecture. Neuropsychol. Rev. 20, 362–375.

Voineagu I, Wang X, Johnston P, Lowe JK, Tian Y, Horvath S, et al. (2011). Transcriptomic analysis of autistic brain reveals convergent molecular pathology. Nature 474(7351), 380–384.

Volkmar, F.R. and McPartland, J.C. (2014). From Kanner to DSM-5: autism as an evolving diagnostic concept. Annu Rev Clin Psychol 10, 193–212. von Bartheld C.S., Bahney J., Herculano-Houzel S. (2016). The search for true numbers of neurons and glial cells in the human brain: A review of 150 years of cell counting. J Comp Neurol 524, 3865–3895.

Vorstman JAS, Staal WG, van Daalen E, van Engeland H, Hochstenbach PFR, Franke L. (2006). Identification of novel autism candidate regions through analysis of reported cytogenetic abnormalities associated with autism. Mol Psychiatry 11(1),18-28

Vuong, C.K., Black, D.L., and Zheng, S. (2016). The neurogenetics of alternative splicing.

110

Nat. Rev. Neurosci. 17, 265–281.

Wallace, M.L., Burette, A.C., Weinberg, R.J., and Philpot, B.D. (2012). Maternal loss of Ube3a produces an excitatory/inhibitory imbalance through neuron type-specific synaptic defects. Neuron 74, 793–800.

Wamsley B., Jaglin X.H., Fayuzzi E., Quattrocolo G., Nigro M.J., Yusuf N., et al. (2018). Rbfox1 Mediates Cell-type-Specific Splicing in Cortical Interneurons S0896-6273(18)30828- 6.

Wang GZ, Belgard TG, Mao D, Chen L, Berto S, et al. (2015). Correspondence between resting-state activity and brain gene expression. Neuron 88:659–66

Wang Q., Henry A. M., Harris J. A., Oh S. W., Joines K. M., Nyhus J., et al. . (2014). Systematic comparison of adeno-associated virus and biotinylated dextran amine reveals equivalent sensitivity between tracers and novel projection targets in the mouse brain. J. Comp. Neurol. 522, 1989–2012.

Watakabe A, Ohtsuka M, Kinoshita M, Takaji M, Isa K, Mizukami H, Ozawa K, Isa T, and Yamamori T (2015). Comparative analyses of adeno-associated viral vector serotypes 1, 2, 5, 8 and 9 in marmoset, mouse, and macaque cerebral cortex. Neurosci. Res 93, 144–157.

Weatheritt R. J., Sterne-Weiler T. & Blencowe B. J. (2016). The ribosome-engaged landscape of alternative splicing. Nat. Struct. Mol. Biol. 23, 1117–1123.

Weber, T. Inducible gene manipulations in serotonergic neurons. (2009). Front. Mol. Neurosci. 2, 24.

Weiss L.A., Shen Y, Korn J.M., et al. (2008). Association between microdeletion and microduplication at 16p11.2 and autism. N Engl J Med 358, 667–75.

West DB, Engelhard eEK, Adkisson M, Nava AJ, Kirov JV et al. (2016). Transcriptome Analysis of Targeted Mouse Mutations Reveals the Topography of Local Changes in Gene Expression. PLoS Genet. 12:1–19. doi: 10.1371/journal.pgen.1005691.

Wingate, M., Kirby, R. S., Pettygrove, S., Cunni , C., Schulz, E., Ghosh, T., et al. (2014). Prevalence of autism spectrum disorder among children aged 8 years—Autism developmental disabilities monitoring network, 11 sites, United States, 2010. MMWR Surveill Summ 63(2), 1–21.

Witt-Engerstrom, I., and Gillberg, C. (1987). Rett syndrome in Sweden. J Autism Dev Disord 17, 149-150.

Wöhr M, Schwarting RKW. Affective communication in rodents: ultrasonic vocalizations as a tool for research on emotion and motivation. Cell Tissue Res. 2013;354(1):81–97.

Won H, Lee HR, Gee HY, Mah W, Kim JI, Lee J, et al. (2012). Autistic-like social behaviour

111

in Shank2-mutant mice improved by restoring NMDA receptor function. Nature 486:261–265.

Wong, M., and Crino, P.B. (2012). Tuberous sclerosis and epilepsy: role of astrocytes. Glia 60, 1244–1250.

Wu, Y.E., Parikshak, N.N., Belgard, T.G. & Geschwind, D.H. (2016). Genome-wide, integrative analysis implicates microRNA dysregulation in autism spectrum disorder. Nat Neurosci 19, 1463-1476.

Wulffaert J., Van Berckelaer-Onnes IA., Scholte EM. (2009). Autistic disorder symptoms in Rett syndrome. Autism 13,567–581.

Xie, J. (2008). Control of alternative pre-mRNA splicing by Ca(++) signals. Biochim. Biophys. Acta 1779, 438–452.

Xu C., Liu X., Song X., Gao Q., Cheng L., Wang L., et al. (2016). Aberrant resting state in microRNA-30e rat model of cognitive impairment. Neuroreport 27, 809–817.

Xu Y., et al. (2010). MicroRNAs and target site screening reveals a pre-microRNA-30e variant associated with schizophrenia. Schizophr Res 119, 219–227.

Xue, Y., Ouyang, K., Huang, J., Zhou, Y., Ouyang, H., Li, H., Wang, G., Wu, Q., Wei, C., Bi, Y., et al. (2013). Direct conversion of fibroblasts to neurons by re- programming PTB- regulated microRNA circuits. Cell 152, 82–96.

Yang M, Bozdagi O, Scattoni ML, Wöhr M, Roullet FI, Katz AM, Abrams DN, Kalikhman D, Simon H, Woldeyohannes L, Zhang JY, Harris MJ, Saxena R, Silverman JL, Buxbaum JD, Crawley JN. (2012). Reduced excitatory neurotransmission and mild autism-relevant phenotypes in adolescent Shank3 null mutant mice. J Neurosci 32:6525–6541.

Yano, M., Hayakawa-Yano, Y., Mele, A., and Darnell, R.B. (2010). Nova2 regulates neuronal migration through an RNA switch in disabled-1 signaling. Neuron 66, 848–858.

Yeo, G., and Burge, C.B. (2004). Maximum entropy modeling of short sequence motifs with applications to RNA splicing signals. J. Comput. Biol. 11, 377–394.å

Yuan J, Ma Y, Huang T, Chen Y, Peng Y, Li B, et al (2018). Genetic modulation of RNA splicing with a CRISPR-guided cytidine deaminase. Mol Cell 72(2), 380-394

Zetsche, B. et al. Multiplex gene editing by CRISPR-Cpf1 using a single crRNA array. (2017). Nat. Biotechnol 35, 31–34.

Zetsche B., Gootenberg J.S., Abudayyeh O.O., Slaymaker I.M., Makarova K.S., Essletzbichler P., Volz S.E., Joung J., van der Oost J., Regev A. (2015). Cpf1 is a single RNA-guided endonuclease of a class 2 CRISPR-Cas system. Cell 163, 759–771.

Zhan, Y., Paolicelli, R. C., Sforazzini, F., Weinhard, L., Bolasco, G., Pagani, F., et al. (2014). 112

Deficient neuron-microglia signaling results in impaired functional brain connectivity and social behavior. Nat. Neurosci. 17, 400–406.

Zhuravlev A.Y. and Wood R.A. (2018). The two phases of the Cambrian Explosion. Sci Rep. Preprint at: https://www.nature.com/articles/s41598-018-34962-y

113