(Adansonia Gregorii). 2 3 4 5 JD Pettigrew FRS1 6 7 8 9 Queensland Brain Institute1 10 11 Emeritus Prof

Home , Adansonia, Adansonia gregorii

1 Controversial Timing for the Arrival in Australia of the Boab (Adansonia gregorii). 2 3 4 5 JD Pettigrew FRS1 6 7 8 9 Queensland Brain Institute1 10 11 Emeritus Prof. JD Pettigrew 12 [email protected] 13 14 15 16 6842 words 17 18 Abstract: The Australian baobab, or Boab, (Adansonia gregorii), is mysteriously separated 19 from the remaining 8 African and Madagascan species in its genus by the Indian Ocean. 20 Information about the time of the Boab’s arrival in Australia was sought using the 21 molecular genetics of the nITS gene in 220 Boabs sampled from their complete distribution 22 across the Kimberley. nITS substitutions had limited diversity (0.36%), in keeping with the 23 “young” genetics shown by DNA microsatellites in another study. There were more 24 substitutions in NW trees compared with those at the Eastern limit of its distribution 25 around the Victoria River, which are presumed to be more recent. Coalescence time and 26 divergence time could be based on reliable data concerning the range of nITS substitutions 27 in the Boab and their divergence from the African baobab sister species, but these 28 estimations had a stumbling block:- there is no reliable estimate of the mutation rate for 29 the nITS gene of the Boab. Earlier publications made the assumption that the mutation 30 rate for the Boab was the same as that of its African sister taxon (Adansonia digitata). This 31 risky assumption gives a divergence time of 2.4 Ma that is discrepant with other studies, 32 such as microsatellites, that indicate a much younger age. This assumption also overlooks 33 the completely different ecology and pollination of the Boab compared to its African sisters, 34 as well as the known lack of any phylogenetic correlation for nITS mutation rate. In 35 contrast to the assumption of equality between African and Australian mutation rates, 36 three lines of qualitative and quantitative evidence refute this assumption and indicate that 37 the Boab is an outlier with a very high mutation rate. Time dependence of mutation rate 38 predicts an elevated mutation rate as does Yang’s relative rate test of mutation rate. A 39 quantitative. phylogenetic study of nITS in all 9 baobab species, with an appropriate 40 outgroup, shows that all Boab samples have branch lengths that are 18X longer than any 41 other baobab species in the phylogeny. Combined with the base mutation rate of 2.5 x 10-9 42 substitutions/site/year, this gives a new estimate of the Boab mutation rate of 45 x 10-9 43 substitutions/site /year. 44 The new estimate of mutation rate gives a coalescence time and a divergence time of 45 around 72 Ka, in line with the Toba mega-eruption that marked the beginning of modern 46 human migrations out of Africa, one of which may have brought a Boab progenitor to 47 Australia. 48 49 50 51

52 53 54 Fig. 2: The Boab, Adansonia gregorii. Flowers (a), Buds (b), Seed pods (c), Characteristic 55 baobab pachycauly (d,e). 56 57 58 59 Introduction: 60 The Australian baobab, or Boab, Adansonia gregorii, is a genuine botanical mystery. The puzzle 61 might well be better understood if we knew more about when it arrived in Australia. The first use 62 of molecular genetics to examine its timing, effectively dismissed the idea that the Australian 63 baobab had separated from African or Madagascan relatives as a result of continental drift. The 64 estimated Australia-Africa divergence from molecular genetics was 2.4 million years compared 65 to the more than one hundred million years expected from vicariance (Baum et al. 1998). This 66 result from molecular genetics showed the effectiveness of molecular phylogeny in settling some 67 issues of timing, but questions remained. First, only a single sequence was available from the 68 Boab, so there were not enough data available to decide whether its origin was amongst the 69 Madagascan, or the African, species of baobabs. At the time, Madagascar was a popular choice 70 of the two, because the Boab is a diploid like all six Madagascan baobab species and unlike the 71 African tetraploid (Baum and Oginuma 1994). The second reason favoring a Madagascan origin 72 was that a flotation route from Madagascar to Australia had been established by Aepiornis 73 (elephant bird) eggs that had made the journey on two recorded occasions (Long et al. 1998) . 74 Such phylogenetic uncertainty about African vs Madagascan origins makes it very difficult to 75 apply the relative rate test, as shown below. A second major uncertainty concerns the mutation 76 rate to be applied to the divergence. In the study by Baum et al. (1998) and in subsequent studies 77 of Boab timing (Bell et al 2014, Rangan et al. 2015), it was assumed that the Boab’s Australian 78 mutation rate, is the same as the African baobab, Adansonia digitata. No basis for this 79 assumption has been advanced, a possible weakness of which can be shown by a simple exercise 80 in the time-dependence of mutation rate (see below). This significantly further shortens the 81 apparent calibration time of 2.4 Ma suggested by the assumption of equality between Australian 82 and African mutation rates. Application of a correction from the time-dependence curves of Ho 83 et al. (2005) applies to all genomes although it is less well known for plants (Drake et al. 1998). 84 An estimate of the correction would be in the range of 0.5-1.5 Ma, giving a divergence time of 85 0.9-1.9 Ma instead of 2.4 Ma. The exact magnitude of this correction is not as important as the 86 question it raises about the assumption of equality of Australian mutation rates with those of the 87 putative African baobab precursors. This correction yields a younger age for the Boab, as do 88 other approaches such as DNA microsatellites, raising the possibility that the 2.4 Ma divergence 89 is an overestimate based on the assumption of a low rate. 90 91 This study attempts to go beyond the question of the Boab mutation rate to provide a 92 more precise value. At the same time, more evidence is presented for nITS substitutions in a 93 large number of Boabs. Two qualitative techniques imply an elevated mutation rate for the Boab, 94 and a third quantitative technique shows a 18X elevation in mutation rate that gives an arrival 95 time of around 72 ka, consistent with circumstantial evidence of human transport. 96 97 98 99 Methods and Materials: 100 Choosing the Mutation Rate: 101 102 The compilation of nITS data on substitutions in a large sample of individual trees is an 103 important prerequisite to the estimation of their coalescence or divergence time. Even more 104 important, however, is the mutation rate so that the number of substitutions in the phylogenetic 105 reconstruction can be converted to time. There is a widely-used mutation rate for the African 106 baobab, Adansonia digitata, which is an average of two rates, for cotton, genus Gossypium 107 (Wendel et al 1955), and for the family Winteracae (Suh et al 1993). These two rates are 108 separated by a factor of ten, but were chosen because each had a well-documented phylogenetic 109 history, that stretched back to the early history of angiosperms in the case of Winteraceae (Suh et 110 al 1993). The choices were made largely on the basis of phylogeny because baobabs lack 111 fossilised wood (it is too friable) and a clear cut fossil pollen record, so the published mutation 112 rate (Baum et al 1998 ) is a compromise between the rate from ancient Winteraceae 113 (0.45/site/year) (Suh et al 1993) and the rate derived from cotton (45 /site/year) (Wendel et al 114 1955). The ten-fold difference reflects the difficulties and imprecision of mutation rate estimates 115 in the context of the present study where distinguishing between the different scenarios for the 116 arrival of the Boab would require precision in the mutation rate estimate. The range would be 117 even greater if other angiosperms with well-documented phylogeny and mutation rate are in 118 included in the estimate of rate, such as Primulaceae (8.4) and Gentianaceae (19), which would 119 increase the range of possible rates in the African baobab to 40x. This context of wide variations 120 possible in nITS mutation rates needs to be borne in mind in assessing mutation rate of the Boab, 121 ab initio. 122 123 The estimate for mutation rate of A. digitata hinged upon phylogenetic information from from 124 distant, ancestral lineages. In the case of the mutation rate for A. gregorii, information about 125 phylogeny can now be obtained from much closer to the stem arising near those of its sister taxa, 126 as uncertainties have now been resolved, such as the identity of the crown taxon (which is A. 127 digitata, not one of the Madagascan taxa) as well as the vexed question whether the Australian 128 baobab is closer to the African or to the Madagascan clade (recent evidence indicates that it is 129 the African). 130 These are crucial, but fragile, details that are essential for the following phylogenetic analysis 131 because of evidence that they are altered by details of the reconstruction, such as an 132 inappropriate choice of outgroup or variation in the treatment of indels (Pettigrew et al. 2012). 133 The phylogeny of all 9 baobabs has already been published, and some criticism has been leveled 134 at its use here. The point is that this is the first time that the baobab phylogeny has been used to 135 estimate mutation rate. The late recognition of the importance of new analysis is the result of the 136 easy and unquestioned assumption that has been made repeatedly in the literature, which has 137 assumed that Boab’s nITS mutation rate is the same as the African baoab. The author was also 138 seduced by this assumption at first:- hence my co-authorship of the papers that use this 139 assumption (Pettigrew et al 2012, Bell et al 2014). 140 The key observations are completely new interpretations on the branch lengths of each baobab 141 species, never mind the fact that the overall phylogeny has been published. These show that most 142 baobabs in the phylogeny have similar branch lengths, in partial support of the assumption that 143 different baobabs could be assumed to have the same mutation rate. However, this was not true 144 for the Boab, which as an obvious outlier, with branch lengths that were 18x longer than any of 145 the other 8 baobabs in the phylogeny. The implications of this much greater rate of change in the 146 Boab are that its mutation rate is seriously underestimated by assuming that it is the same as the 147 African species, A. digitata and that arrival time may have been 18x earlier than the 2.4 Ma 148 estimate based on that assumption. Arrival may have been as early as 1.4 x 10-6/18 = 78 Ka. 149 150 Fig. 1: 151 gregorii clearly has a greater rate in both of these diagrams, where length is proportional to divergence. 152 Calculating the exact rate increase for A. gregorii requires a judgement about the exact phylogenetic position of the 153 node (n), where A. gregorii leaves the stem. In detailed phylogenetic assessments of the phylogenetic position of A. 154 gregorii, there has been uncertainty about the degree of closeness of the relationship between A. gregorii and the 155 African baobabs, but there is now a consensus that A. gregorii is closer to the African baobabs than to the 156 Madagascan baobabs. The calculated increase in rate could therefore vary from 2X to 18X as different analyses 157 place this node nearer or closer to the African clade, with the highest value of 18X when the node is closer to the 158 African clade 159 160 Relative Rate Calculation: 161 The classical test for rate variation is attributable to Yang (2002). A graphical demonstration of 162 Yang's approach to the present problem is shown in Fig. 1. The figure makes it obvious that the 163 Boab, A. gregorii, has an elevated rate. Estimating the magnitude of that elevation would be 164 necessary for any attempt to determine timing using the pattern of substitutions in nITS. 165 Unfortunately, such precision is limited by an aspect of the phylogenetic information: viz:- 166 its uncertainty. 167 The relative rate test requires knowledge about the phylogeny, particularly the outgroup 168 against which most measurements are made. 169 170 Phylogenetic reconstructions of of baoabs are fragile because only a small number of 171 informative substitutions are available. As an example of this fragility, there are two published 172 versions of the phylogeny that could not be further apart from each other. In one phylogeny, the 173 only tetraploid baobab is found at the base of the phylogenetic tree, with the other seven species 174 therefore having had to undergo multiple, independent reversions to the diploid state (Baum et al. 175 1998). The alternative phylogeny, which is generated when a different outgroup is chosen, or the 176 numbers of replicate samples from different baobabs are balanced, has the tetraploid at the crown, 177 along with the Australian and African species (Pettigrew et al. 2012). This stark difference can 178 be explained by the forcing effect of the outgroup, but for the present analysis the important 179 point is that relative rate is not an absolute measure, but is affected by the phylogenetic 180 relationships of the taxa used for the relative rate test. This is shown by the comparison in Fig. 1, 181 where the relative rate of A. gregorii is much greater in comparison to the African species (A) 182 when its node is close to them, than it is when the node is close to the Madagascan clade (B). 183 184 It would be possible to make an arbitrary choice between these possibilities and use that to 185 calculate a relative rate. Such a dichotomous choice would inevitably lose information, so we 186 chose an alternative that reflected the posterior probability of the phylogeny (using Mr. Bayes) 187 and compared that to the raw rates obtained using PAUP. Although this phylogeny has already 188 been published (Pettigrew et al 2012) this is the first time that there has been a detailed 189 examination of the branch lengths of each of the many baobabs on the phylogeny. This is shown 190 in Fig. 2 which allows a quantitative comparison between rate increases and the background. The 191 average relative length of A.gregorii branches in PAUP was 18x the baseline values obtained 192 using Mr. Bayes. Since the base line calculation assumed a rate of 2.5 x 10-9, by this 193 analysis, the new estimate for the mutation rate of A. gregorii is 4.5 x 10-8 194 (changes/nucleotide/year). 195 196 Time Dependence: 197 The revised Australian mutation rate fixes a coalescence time in Australia of 72 ka. This short 198 time is well inside the period of exponentially increasing mutation rate that has been defined in 199 the curves of Ho and collaborators (2005) of time dependence of mammalian mtDNA mutation 200 rate. Time dependence is a phenomenon tat affects all genomes, even viral genomes that have 201 revealed details of the underlying mechanism, where there is a delay between ”purifying 202 selection” and the preceeding initial mutations which are therefore more numerous at short time 203 intervals. Although these curves from mammalian mtDNA do not have calibrated scales, 204 quantitation is possible using data from plant taxa that have both high mutation rate and very 205 short calibration times, such as Gentiana var. Ciminalis, which has the highest published nITS 206 rate, although somewhat less than the rate we estimated for A. gregorii (Kay et al. 2006). 207 The exercise has two results:- 208 1. Although our estimated rate for A. gregorii is high, based on phylogenetic reconstruction, it 209 corresponds to the values given by the quantitative time dependence curves from mammalian 210 mtDNA (Ho et al.1988). No work on plants has provided details of time dependence of 211 comparable precision, but the phenomenon, originally discovered by Crow, is found in all 212 genomes, from prokaryotes to eucaryotes, and in nuclear genomes as well as mitochondrial 213 genomes, so it can be expected that this large increase in mutation rate is valid, even if the 214 quantitative details in Boabs are not known with precision (Drake et al. 1998). 215 2. This result establishes the plausibility of such high rates, near the upper end of the known 216 range of plant rates (3-50 x 10-9/site/year) (Wolfe et al. 1987). 217 Phylogenetic reconstruction: 218 Since the relative rate calculation was dependent on the underlying phylogeny, a number of 219 different reconstructions were used try to minimise the interaction between relative rate 220 measurements and the particular phylogenetic reconstruction. Previous work had shown that 221 phylogenetic reconstructions of baobabs are fragile, based upon a small number of informative 222 substitutions (Pettigrew et al. 2012). For this reason, the topology of the phylogeny could be 223 radically changed by varying the outgroup or failing to balance the numbers of taxa. For example, 224 Madagascan baobabs appear at the crown of the phylogeny rather than its base if one uses more 225 than two replicates of the Madagascan sequences. Such an “inversion” of the phylogeny, where 226 the tetraploid baobab appears at the base, where many unlikely reversions to the diploid state 227 would be required, also occurs with some inappropriate outgroups and is a feature of some 228 published phylogenies (e.g. Baum et al. 1998) . This raised a question as to the appropriate 229 reconstruction on which to base relative rate calculations, since some alternative phylogenies, 230 such as the “inverted” topology, reduce the magnitude of any rate increase. 231 232 233 DNA Collection and Extraction: Emergent leaves were sampled from 220 trees over the 234 complete present distribution of A. gregorii in the Kimberley, which has notable gaps, such as 235 the central plateau (where Boabs are eliminated by occasional frost), and the western coast of 236 Admiralty Gulf (where uninterrupted stone slabs preclude Boab growth) (Fig. 2b). Accessible 237 trees near roads and tracks were sometimes sampled from the roof-rack of a 4WD using a 4 m 238 fruit picker, but most samples were taken in flight from a hovering R22 (Robinson) helicopter. 239 The cut leaves were placed in a zip-lock plastic bag with 15 g silica gel. DNA extraction was 240 based upon the Qiagen DNeasy Plant protocol with a few modifications: viz:- 1. Leaves were 241 ground (without need for liquid N2 because of “glassy desiccation” that affects baobab leaves in 242 silica gel), with an equal mass of PVP (polyvinylprrrolidine); 2. After the precipitation step, 243 tubes were spun at 20,000xg for 30 min at 4 0 C to give a clearer separation of the supernatant. 3. 244 DNA was eluted from the spin columns three times, each with 100 µl of buffer AE. Primers 245 ITS.LEU (gtccactgaaccttatcatttag) and ITS4 (tcctccgcttattgatatgc) were used to amplify and 246 sequence the nuclear ribosomal internal transcribed spacer region (nrITS). Primers for 247 chloroplast DNA PCR were directed towards tmlF (cp5). (cp5F – ggttcaagtccctctatccc, cp5R 248 (GenBank Accession numbers AGK1943-AGK2163, JN400291-JN400323). Electronic 249 supplementary material: 3: Sequence. [2]). 250 The 220 DNA samples used in this study were collected and extracted by JDP and CEV in 2008. 251 They were also the basis of two published studies which assumed that the Boab mutation rate 252 was the same as the African rate, an assumption leading to a discrepancy that was explained by 253 proposing a “Pleistocene refugium” (Bell et al 2014, Rangan et al 2015 ). The present study was 254 stimulated by the delayed realisation that African and Australian mutation rates might not be the 255 same. 256 257 PCR and Sequencing: Primers ITS.LEU (gtccactgaaccttatcatttag) and ITS4 (tcctccgcttattgatatgc) 258 were used to amplify and sequence the nuclear ribosomal internal transcribed spacer region 259 (nrITS) (GenBank Accession numbers AGK1943-AGK2163, Electronic supplementary material: 260 3: Sequence. Typical concentrations were 3-10 ng/µl. The PCR product was used as template for 261 sequencing in a 10 µl reaction volume using 1.75 µl Big Dye Buffer, 0.5 µl Big Dye v3.1, 1.5 µl 262 purified PCR product, and 0.32 µm primer. The labelled product was purified as described above 263 and sequenced at the Australian Genome Research Facility (AGRF; Brisbane, Australia). 264 Resulting sequences were aligned using ClustalW 265 (http://www.ch.embnet.org/software/ClustalW.html). 266 Phylogenetic Analysis. --- Multiple sequence alignments were carried out using MUSCLE, 267 through the Geneious interface, with eight iterations. Regions where the alignment was 268 ambiguous were removed, indels of more than one nucleotide were re-coded as a single 269 character, and then analyses were run with gaps treated as a new character state, and with gaps 270 treated as unknown. Parsimony analyses were carried out in PAUP* 4.0 ß 10 (Swofford, 2002). 271 For each DNA sequence region, a heuristic search with 1000 replicates, random addition of taxa, 272 and tree bisection reconnection (TBR) branch swapping was used. Bootstrap analyses were 273 carried out with 1000 bootstrap replicates, each with 100 heuristic search replicates, with random 274 addition of taxa and TBR branch swapping. Uncertainty about the topology of the basal 275 Australian, African and Malagasy lineages was reduced by treating gaps as a new character state 276 (as described above), reducing the number of sequences in the large Malagasy clade, and 277 checking different outgroups (Cavanillesia was most effective in reducing the number of trees), 278 with the result that the number of equally most parsimomious trees was reduced from 30 to 12 279 for analysis using ITS sequence, all of which favour a linkage between the Australian and 280 African clades, with the Madagascan clade at the basal node. 281

282 Bayesian analysis was carried out using the MRBAYES (Huelsenbeck & Ronquist, 2001; Ronquist 283 & Huelsenbeck, 2003) plugin version 2.0.3 for Genious (Biomatters Ltd.). The optimal models 284 of sequence evolution for each gene region were determined with the Akaike Information 285 Criterion (AIC) using Modeltest, through the Geneious interface. Using the selected model, two 286 simultaneous searches were performed, each with four MCMC chains (one cold and three hot), 287 with a sample frequency of 1000. Every 1,000,000 generations, the standard deviation of split 288 frequencies between the two simultaneous analyses was calculated and when this decreased to 289 less than 0.01 the search was stopped. This process was repeated with two further simultaneous 290 runs of the MCMC, and the results were compared to confirm that apparent convergence of the 291 first two runs wasn’t due to both reaching the same local optimum. Plots of the likelihoods of 292 sampled trees were examined to determine when the MCMC chains had reached stationarity, and 293 the sampled trees prior to this were discarded as burn-in. A majority rule consensus tree was 294 obtained from the remaining trees. 295 296 Rationale for Comparison of Parsimony and Bayesian Analyses: 297 We compared the results of phylogenetic reconstruction using PAUP and Mr. BAYES using the 298 same starting matrix, one that had been shown previously to give a relatively stable topology in 299 which the tetraploid is in the crown and the Boab is closer to the African baobabs than it is to the 300 Maldagascan baobabs. The parsimony method provided direct access to a phylogeny in which 301 branch lengths were proportional to mutation rate, without the complications of rate adjustment 302 that are implicit in Bayesian reconstructions and without the need to provide a specific 303 quantitative hypothesis about the change in rate that underlies the a posteriori Bayesian approach. 304 The role of the Bayesian method was to provide a phylogenetically appropriate context for the 305 relative rates of individual taxa in PAUP that could be used to estimate the absolute magnitude of 306 each. There were no clues from the natural history or phylogeny that might help one to guess if 307 the Boab had an altered mutation rate or what the altered rate might be. This made it difficult to 308 frame a hypothesis for a posterior Bayesian testing. On the other hand, the flexibility of this 309 method makes it appropriate to provide the phylogenetic context for each rate. Of particular 310 importance here would be the estimated relative distance of A. gregorii from the African and 311 Madagascan clades, a divergence which strongly affects the calculated rate of the A. gregorii 312 clade (as shown in Fig. 1). and which is more finely estimated by Mr. Bayes than by PAUP. 313 Estimation of Boab nrITS Mutation Rate: 314 At the outset of the study, we presumed that the published, calibrated mutation rates for nrITS of 315 the African Baobab, A. digitata, would also be applicable to its close Australian relative, A. 316 gregorii. Using the African mutation rate gave very large estimates of Boab age, much larger 317 than expected, suggesting that a more appropriate age would be obtained if we could use a more 318 appropriate, larger, Australian mutation rate. The dangers inherent in our early assumption that 319 A. gregorii would have the same mutation rate as A. digitata are apparent in the warning 320 published by Kay et al (2006) in their description of the 50-fold variation seen in independently 321 calibrated nrITS rates from 28 plant taxa. 322 " No significant phylogenetic signal to the rates was detected (p =0.393), suggesting that 323 phylogenetic relatedness is not an appropriate justification when choosing rates from the 324 literature."(Kay et al. 2006). Following this admonition, it would be reasonable to question 325 whether the mutation rate of any of the other 8 baobabs is similar to the African rates. In fact, 326 only A. gregorii has an obviously elevated rate in the relative rate tests, the time-dependent 327 calculations, and the phylogenetic reconstructions, in keeping with its mysterious transport, its 328 disjunct status, and its completely different, vacant, new niche in Australia’s Kimberley, 329 compared to the other baobabs. 330 Supporting a divergent Australian mutation rate, we found large discrepancies between the age 331 estimates given by nrITS substitutions using the African mutation rate, and other estimates such 332 as those derived from microsatellites, or from the time to reach the current distribution from 333 cumulative dispersal of Boab seed (Electronic supplementary material: 1 : Macropod dispersal 334 and Microsatellites). Although these other estimates were less precise, they were yet more than 335 an order of magnitude lower than the estimate provided by the nrITS substitutions combined 336 with the African mutation rate (Table 1).

337 338 339 Fig. 3: 340 Eighteen-fold increase in branch lengths for all eight samples of nITS from A. gregorii in parsimony reconstruction 341 by PAUP (on right).Rate calculations are dependent upon the phylogenetic topology, which is explicit in 342 this PAUP reconstruction that is known to be congruent with other detailed work supporting the sister 343 relationship between A. gregorii and the African baobabs. The parsimony reconstruction has transparency 344 of the effects of rate that require more complex intervention in the less transparent a posteriori 345 methodology of Bayesian analysis which provides a contextual baseline of rates across the genus (left side). 346 Except for A. digitata, no revision of mutation rate has been attempted for any other of the remaining 8 347 baobabs, all of which could conceivably have a different mutation rate. These data show that A. gregorii 348 has a rate that is different enough to be obvious, at 18X, compared to all other baobabs. 349 350 As a result, we thought that we may have underestimated the rate, a conjecture that was 351 supported quantitatively by comparing reconstructions of the phylogeny of all 9 baobab species 352 using "fixed clock" (PAUP conditions versus "relaxed clock" (MrBayes 3.2, [10]). This 353 comparison is shown in Fig. 1, adapted from Pettigrew et al [2]; [ Fig. S7C, PAUP vs Fig. S7F, 354 MrBayes]. The Boab, A. gregorii, was the only baobab species of the 9 in the genus whose rate 355 departed significantly in every sample from all other baobab taxa. Branch lengths of the Boab 356 were on average 18.3x longer. There were 8 separate samples of DNA from different trees of A. 357 gregorii, that each gave 720 bp of nrITS sequence. Lengths for these 8 A. gregorii branches on 358 the Bayesian reconstruction of the phylogeny of all Adansonia species (Fig. S7F, [2]) were 0.07, 359 0.08, 0.068, 0.066, 0.066, 0.1, 0.067, 0.069 substitutions, while the same 8 samples in the PAUP 360 reconstruction gave branch lengths of 70.6, 8.2, 18.9, 12.7, 10.9, 3.8, 11.9 and 9.8 substitutions 361 respectively (Fig.1), giving a mean ratio between the two methods of 18.3x +/- 20.2 S.D. Since 362 both the PAUP and Bayesian trees had assumed a mutation rate of 2.48 x 10-9 363 substitutions/site/year, the appropriate rate may therefore be 18.3X greater, at around 4.5x10-8 364 substitutions/site/year. This is the “Australian” rate that has been used in this paper to calculate 365 Boab age from nrITS substitutions (Table 1). This is a large mutation rate, but must be seen in 366 the context of the very small number of taxa with very short calibration times, all of which also 367 have very high mutation rates. The total range (50X) of published nITS rates (Kay et al. 2006). 368 Using the published time-dependence curves, one can estimate the change in the mutation rates 369 of well-known taxa if their calibration time were extended slightly. (e.g. Gossypium would have 370 the even greater mutation rate of 5.5.X 10-8 substitutions/site/year if it were measured at 70 Ka 371 instead of the established 8.5 Ma). 372 Mathematical Test of the Mutation Rate Increase Using Time-Dependence:: 373 Explicit determinations of time dependence of mutation rate, like the curves delineated for time 374 and mt DNA of humans, are not available for plants. Nevertheless, a cross check is possible for 375 plant nITS from the survey of Kay et al (2006), which shows a close fit. For example, the plant 376 taxon with the most recent calibration time of the 29 that were sampled (0.1 Mya), Gentiana var 377 Ciminalis, also has the highest mutation rate. At 19 x 10-9 this is 50x the rate of the lower taxa 378 and 7x the rate of the mean. This species is therefore located on the steepest part of the time 379 dependence curve that would be expected to give a rate around 20 if the calibration time were 380 shortened even further, from 0.1 Mya to 0.07 Mya (as indicated by nITS substitutions and the 381 mutation rate calculated from the phylogeny of Adansonia) (MRPA). 382 To test our estimate of the magnitude of the increased mutation rate, we used the mathematical, 383 time-dependence curves for mutation rate (Ho et al. 2005)]. These curves give relative values, 384 but not the specific values for calibration time, or rate, of individual taxa, so we used Gentiana 385 var. Ciminalis as a model because it has the shortest calibration time (100 Ka) and the highest 386 mutation rate (19 x 10-9 substitutions/site/year) for any published nITS gene, in line with our 387 heterodox proposal for an increased mutation rate in A. gregorii. We asked “from the curves”, 388 what would be the consequences for this model taxon, if the calibration time were shortened 389 even further, for example, to ~70 Ka instead of 1 Ma? The curves show that this would lead to an 390 increase of mutation rate by a factor of 2.4X, to 4.6 X 10-8, , which is very close to the estimate of 391 4.5 X 10-8 for A. gregorii that we derived independently from phylogenetic analyses of the 392 sequence data themselves. The close similarity between the rate derived from time-dependence 393 and the rate derived from phylogenetic analysis suggests that time dependence alone may 394 account completely for the raised mutation rate of a very recent species, such as A. gregorii. Note 395 that this test is guided by the hypothesis that very short calibration times and high mutation rates 396 might be involved, but that these surprisingly consistent results from the mathematics are 397 independent of those arising from the comparison between different phylogenetic reconstructions 398 and patterns of substitution (Fig. 1). The difference between the two analyses is that in the first 399 case we have used phylogeny of the nITS substitutions with different clock constraints to 400 estimate a mutation rate which could then be used to arrive at a date. In the second case, we 401 began with hypothetical dates and then derived mutation rate using the time dependence curves. 402 403 In addition to analysis based on all the substitutions in the 220x720 nITS matrix, an alternative 404 analysis was based on biogeographical information which enabled a comparison of "Old" trees 405 from the NW with "New" (EK) trees from the Eastern Victoria R. that had been defined by 406 microsatellites [[6], Electronic supplementary material 1: Macropod dispersal and 407 microsatellites]. Although nITS substitutions had not permitted the prior identification of the 408 sub-regions identified by microsatellites, the different pattern of nITS substitutions in the East 409 and West sub-regions enabled a separate calculation of age;- 71 Ka (Table 1) 410

Results and Discussion: Relative Rate Test: The Classical method for assessing mutation rate variations is the relative rate test, which is shown in Fig. 1 for the Boab. This test is incorporated into some phylogenetic reconstructions such as Mr. Bayes, but this figure shows why we did not use this approach. The problem of dependence of rate upon the topology of the phylogeny means that derivation of rate may not be so obvious when hidden inside an algorithm like Mr. Bayes. The exercise showed that the Boab has an elevated rate compared with other baobabs and that the elevation is greatest when the node giving rise to the Boab is close to the African baobabs. When the node of Boab branch is close to the Madagascan baobabs the rate increase is 2X, but when the node is close to the African clade, the calculated increase in rate may be as much as 18X.

Time-Dependence of Mutation Rate: The curves for time dependence are all very similar, but there is no scale for mutation rate on the ordinate, so we tested a variety of recent times to check them against mutation rate. This gave a remarkable correspondence between the mutation rate that we estimated from phylogenetic reconstruction and the mutation rate given by the time-dependence curve at 70 ka. The correspondence is remarkable because there is a large number of possible combinations of mutation rate, nITS substitutions and coalescence time, from which the curves seem to have chosen the appropriate one. nITS Substitutions: There were 566 steps in the consensus of trees generated by PAUP from the matrix of 220 ITS sequences (Electronic supplementary material: 3 : Sequence; GenBank Accession numbers AGK1943-AGK2163, JN400291-JN400323 ). All phylogenetic trees generated from the population of 220 individuals of A. gregorii were monophyletic. The substitutions were evenly distributed throughout the matrix and so were consistent with clock-like behaviour. Using the estimated Australian mutation rate for A. gregorii of 4.5 X 10-8, we arrive at timing for this baobab in Australia of ~70 Ka. Using the African mutation rate instead, timing is estimated at 1200 Ka (Table 1). Biogeographical information from microsatellites studied in these same DNA samples allowed the detection of a contrasting set of substitutions in western vs, eastern populations. There was a difference of 20 substitutions between 7 trees in sub-group NC (“Old”) on the Northwest Coast and 2 EK trees (“New”) in the East Kimberley. The divergence of 0.38% gives a coalescence timing of 1234 Ka (African rate) or 88 Ka (Australian estimate) (Table 1). The information from chloroplast haplotypes was not useful in the present studies (see Pettigrew et al. 2012) except for a finding of the same, unusual, cp5 haplotype in two widely-separated trees on the NW and E sides of the Kimberley plateau. As well as being widely separated, by 180 km of Kimberley coastline, they were not connected to any trees with the same haplotype on the plateau itself, so must have been the result of dispersal on the floodplain, around the NW to NE coastal margins of the plateau. These “floodplain species” were part of the same population of N and NC trees that were already shown to be “young” by both DNA microsatellites (Bell et al. 2014) and nITS substitutions (ibid).

“Australian” mutation Rate: Phylogenetic analysis of all 9 baobab species with a fixed clock (PAUP) revealed that the Boab is an outlier with much longer branch lengths on every tree sampled. These increases amount to a 18x increase in the rate of evolution when compared to the other species, or to the same samples of Boabs in a similar reconstruction using a “relaxed clock” (Fig. 3). Since the base mutation rates used for these reconstructions were the published values of the rate for Adansonia digitata of 2.48 - 2.9 x 10-9 substitutions/site/year, the estimated final mutation rate for the Boab is 4.5 – 5.2 x 10-8 substitutions/site/year, which gives a timing in Australia of 69 – 78 Ka

(Table 2).

ASSUMED MEASURED Mutation Rate 2.5 X 10-9 45 x 10-9 Basis for Rate African Rate Analysis (9 baobabs) Divergence (A. digitata-A. gregorii) 0.6 % 0.6 % Divergence Time 2.4 Mya 72 Kya Steps in nITS Boab Tree 566 566 Coalescence Time 1.3 Kya 72 Ka

Coalescence Time vs. Divergence Time:: There are now many more African/Australian alignments available from nITS sequence compared with the single Australian sequence that provided the divergence time to the stem node by Baum et al (1998). The new sequences of the present study give a divergence to the African diploid, A. kilima, of 0.6%, or 2.4 Ma if one makes the assumption of equality of rate between African and Australian baobabs (2.5 X 10-9 substitutions/site/year). By convention, the stem node is midway, at 1.2 Ma, but note that this also assumes a low mutation rate for the A. gregorii limb of the divergence that would have to be revised upward by the measures here. If one uses the revised, high rate (45 X 10-8 substitutions/site/year), derived from two independent calculations, the time for the limb on the A. gregorii side of the stem node becomes 68 Ka. In other words, if one uses the new estimate of mutation rate for A. gregorii, coalescence time (67 Ka) and divergence time (68 Ka) are very close. This hypothetical date for the divergence time can be further adjusted, because of its unknowns, compared to coalescence time. For example, transport to Australia may not have occurred precisely at the time when the precursor split from the stem. The resulting “waiting time” is another unknown with respect to mutation rate and timing. There are many resulting scenarios. Note that these do not show any superiority of divergence time over coalescence time. Rather, the two measures generally support each other at~70 Ka, with small adjustments of the “waiting time” and heterogeneous mutation rates across the node allowing a perfect match between coalescence and divergence times. The close similarity between coalescence time and divergence time in calculations using the revised Australian rate does not leave any spare time for the postulated Pleistocene refugium and bottleneck in the Kimberley. The similarity of these two timing measures also underlines the validity of coalescence time, as well as divergence time, as a measure of the Boab’s arrival in Australia. Two previous studies raised the possibility that the Boab might have been a more recent arrival than generally believed.

1. Limited NE Distribution: Bowman (1997) was very familiar with the Boab distribution and was puzzled that the active dispersal front on the NE flank of the Boab distribution had not yet taken Boabs into the Gulf region. There was no obvious restriction of the NE expansion of the distribution, such as fire, that had been studied and eliminated. An obvious explanation for the puzzling observation of this limit to the distribution is that the Boabs were much more recent than expected.

2. Young vs Old Controversy: A recent study of Boab genetics using microsatellites showed that Boabs appeared to have a recent origin. The young microsatellite dates and the low genetic diversity were in conflict with the older 2.4 Ma estimate (1.4. Ma in this study: Table 1) using the African mutation rate. Rather than testing a possible alternate rate, the solution adopted to deal with this discrepancy was the invention of a "Pleistocene refugium" from which modern, young Boabs had sprung without revealing any evidence of their older, precursor stock. There is no experimental support for this invention, by definition, which owes its existence solely to the conflict between the "young genetics" of the microsatellite data and the "old inference" from the African mutation rate. If the Boab is actually recent, as indicated by a higher Australian rate, and the assumption of the African rate is incorrect, there is no discrepancy and the need for the "Pleistocene refugium" disappears. The recently-extended proposal, of a Pleistocene refugium on the Timor floodplain before the inundation of the Holocene (Rangan et al. 2015), also has the problem that there are no obvious genetic remnants of it. There is good evidence that there were Boabs on the floodplain in the form of cp5 haplotypes on either side of the Kimberley peninsula that were not connected to any trees with the same haplotype on the plateau and must therefore have been dispersed on the floodplain before inundation (ibid). While this is evidence for the presence of Boabs on the floodplain before inundation, it is not evidence for a refugium, as none of these floodplain trees has the predicted Pleistocene age, belonging instead to the recent N and NW microsatellite subgroups (Bell et al. 2014). A floodplain refugium may also be a dubious concept because of the numerous breaks in the Kimberley escarpment that would have allowed floodplain Boabs to reach the plateau via one of their favourite riverine dispersal routes, provided by the outlets of the Fitzroy, Ord, Victoria and Fitzmaurice Rivers, whose present day Boabs all have relatively the young ages found in the microsatellite DNA study (Bell et al. 2014).

? Sufficient Time for a New Species. The estimated Australian mutation rate gives a short coalescence time for A. gregorii in Australia that raises a question in the minds of some observers about whether 70 Ka is sufficient time for the evolution of a new species. A number of points address this issue:- 1. At a rate 18X that of some other trees, the species-specific changes will accumulate faster than judged by absolute time scales. 2. A. gregorii is a "good" species of baobab with distinctive floral evolution that includes an upright bundle of anthers, compared with the pendant anthers of its African sister taxa, and the more loosely oriented anthers of the Madagascan baobabs (Pettigrew et al 2012, Baum et al 1998). This major change in the orientation of the Boab anthers could have been accomplished despite the small absolute time interval, given the intense selective pressure of the main pollinator, Pteropus alecto, which consumes the anthers completely from above while it is perched beside the flower ("G. Rethus and J. Pettigrew" in prep). This large flying fox is 10x the size of the small megabats (Rousettus, Epomophorus) which pollinate the pendant African baobab flowers while hanging from them, an option not available to P. alecto that may help explain the evolution of the solid attachment and upright anthers of the Boab flower. 3. There are numerous examples of rapid plant speciation such as:-. a. hexaploid wheat and teosinte maize that have appeared as part of the beginnings of human agriculture around 10 Ka ago (Ranere and Piperno 2009); b. new neotropical forest species that have appeared in 50 Ka (Rull 2008), as well as new species of daisies (Ungerer et al. 1998); c. the numerous new species of Corus that have evolved recently as part of their pollination syndromes with hummingbirds (Kay et al 2005).

?Extreme nITS Mutation Rate: While all five measures indicate an increase in mutation rate, the value given by phylogenetic analysis of nITS substitutions is 4.5 x 10-8 substitutions /site/year. This is something of a record, with the nearest published rate for this gene being in Gentiana var. Ciminalis at 19x10-9 substitutions/site/year, a plant taxon which is also distinguished for its very short calibration time (0.1 Ma). To put this into context, there is a 50x variation in the published mutation rate for this gene (Kay et al. 2006). Moroever, the published distribution of nITS rates is biased toward longer calibration times, so one might expect more extreme rates like those of Boab and Gentiana var. Ciminalis if more taxa with short calibration times are studied. A. gregorii has a very short calibration time with which the high mutation rate is quantitatively consistent, based on time- dependence curves. A. gregorii may have a record rate at present, but this is well contained within the range of plant nuclear rates (3-50 x 10-9/site/year) (Wolfe et al. 1987). 411 412 Conclusion: Five different lines of evidence support an inequality between Australian and 413 African baobab mutation rates. Each indicates that the change in the mutation rate of A. gregorii 414 is an increase. Two measures are quantitative and agree that the increase in mutation rate is 18X. 415 1. Time Dependence: Even if one uses the African rate that is under question, the calculated 416 divergence time is nominal at 1.4-2.4 Ma depending on the study, values inside the calibration 417 times that are known to be associated with increased rates because of time dependence. These 418 nominal values of 1-4-2.4 Ma cannot therefore be taken at face value because we do not know 419 the relative contributions to it of African and Australian limbs of the phylogeny, with the likely 420 contribution of the Australian limb having many more substitutions as a result of the increased 421 rate. 422 2. The Classical Relative Rate Test of Yang shows an obvious increase in the A. gregorii rate 423 whose magnitude increases markedly in phylogenetic reconstructions where A. gregorii branches 424 closer to the African baobabs than to the Madagascan baobabs, a topology that is favoured in 425 recent studies. In addition to showing that A. gregorii has an increased rate, this test emphasises 426 the importance of the particular phylogenetic reconstruction used in the relative rate test. 427 3. Comparison of parsimony and Bayesian reconstructions allowed the increase in mutation rate 428 to be quantified accurately. The indicated rate is very high, but is still in keeping with the 50x 429 range of published rates for this gene. While it is quite close to the published record rate for this 430 gene, it is also associated with the very short calibration times that are elsewhere associated with 431 very high rates. 432 4. Time-dependence curves provide a highly quantitative relationship between rate and 433 calibration time. These curves predicted the same rate that we obtained in the phylogenetic 434 reconstructions using information about substitutions in nITS. 435 5. Finally, there is a number of observations where there is a discrepancy between the apparent 436 young age of the Boab and the much older age predicted from lower, African rate. These include 437 microsatellite DNA studies of the Boab (Bell et al. 2014), and estimated dispersal across the 438 Kimberley by the main macropod agents. Both of these estimates are very recent, less that 100 ka, 439 neither of which are easy to reconcile with the 1.4 - 2.4 Ma given by the African rate, but 440 perfectly in keeping with the younger age given by the increased mutation rate. 441 442 Conclusion: 443 This study provides no support for the commonly-made assumption that the mutation rate for the 444 nITS gene of the Boab is the same as its African sister taxon, A. digitata. In the largest survey of 445 nITS mutation rate so far, Kay et al (2006) also cautioned against this assumption, because close 446 relatives can have wildly different rates. Instead, three approaches, the classic relative rate test, 447 time dependence of mutation rate and phylogenetic analysis, all indicate a greatly increased 448 mutation rate for the Boab, with the most quantitative method giving a 18x increase. This is large, 449 but still within the 50x range of mutation rates of nITS. Combined with the nITS substitutions 450 revealed in this study, an 18x increase in rate gives an arrival time in Australia for the Boab 451 around 70 Ka, which is also the close to the time of the Toba mega-eruption (Storey et al. 2012) 452 that had a big impact on modern humans (Robock et al 2009), many of whom subsequently left 453 Africa, the source of the Boab's progenitor (Rasmussen et al. 2011). The extreme utility of 454 baobabs (Supplementary Material) would recommend them to migrants, so human transport 455 might explain the very narrow distribution of Boabs in the Kimberley, much narrower than 456 expected if seed arrived by flotation, as well as the completely overlapping distribution of rock 457 art that has numerous depictions of Boabs (Pettigrew 2012). A link between the age of Boabs in 458 Australia from molecular genetics, and the age of depicted Boabs in rock art, is presently only 459 circumstantial, but might become substantive with advances in the dating of individual samples 460 of rock art. 461

462 John Pettigrew 14/4/2013 7:17 PM 463 The best estimate from this study for the timing of the Boab’s arrival in Australia is around 70 Ka (Table 1). This 473 Deleted: Australian Genome Research 474 Facility (AGRF) at the University of 464 happens to coincide with the Toba mega-eruption (Robock et al 2009; Storey et al. 2012) which is thought to have 475 Queensland generously donated all the 476 sequencing required to complete this project. 465 triggered the first modern human migrants to leave Africa (Endicott et al. 2009). John Pettigrew 14/4/2013 7:17 PM 466 Formatted: Font:Italic, Font color: Text 1 467 Acknowledgements: John Pettigrew 14/4/2013 7:17 PM 468 Claudia Vickers played an essential role in refinement of the technique for DNA extraction from Formatted: Font:Italic, Font color: Text 1

469 Boab leaves and the subsequent preparation for DNA sequencing. Chloe Callistemon assisted with Claudia Vickers 14/7/2015 2:56 PM 470 leaf collection. Lars Nielsen made available his excellent laboratory facilities in the Australian Comment [1]: Did you want to mention Chloe for assistance in collecting leaf 471 Institute for Bioengineering and Nanotechnology. Lance Conley at Lone Eagle Aviation material? And/or anyone else? John Pettigrew 12/4/2013 11:07 PM 472 (Kununurra WA) provided essential support for helicopter-based collections in difficult locations. 477 Deleted: a 478 All the Sanger sequencing of the nITS gene in this project was generously donated by the 479 Australian Genome Research Facility (AGRF) at the University of Queensland; John Pettigrew 14/4/2013 7:17 PM 480 Formatted: Font:Italic, Font color: Text 1 481 482 483 484 485 References: 486 487 Ally D, Ritland K, Otto SP (2010) Aging in a Long-Lived Clonal Tree. PLoS Biol 8(8), 488 e1000454. doi:10.1371/journal.pbio.1000454 489 490 Balter, M (2010) Of two minds about Toba’s impact. Science 327, 1187-1188. 491 http://dx.doi.org/10.1126/science.327.5970.1187-a 492 493 Baum DA, Oginuma K. 1994. A review of chromosome numbers in Bombacaceae with new 494 counts for Adansonia. Taxon 43, 11–20 495 496 Baum, D. A., R. L. Small, and J. F. Wendel. 1998. Biogeography and floral evolution of 497 baobabs (Adansonia, Bombacaceae) as inferred from multiple data sets. Systematic Biology 47, 498 181–207. http://dx.doi.org/10.1080/106351598260879 499 500 Bell KL. Rangan,H, Fowler R, Kull CA, Pettigrew JD, Vickers CE , and Murphy DJ (2014) 501 Genetic diversity and biogeography of the Boab Adansonia gregorii (Malvaceae: Bombacoideae) 502 Australian Journal of Botany 62(2), 164-174 http://dx.doi.org/10.1071/BT13209 503 504 Bowman DMJS (1997) Observations on the demography of the Australian 505 Boab (Adansonia gibbosa) in the north-west of the Northern Territory, 506 Australia. Australian Journal of Botany 45, 893-904. doi:10.1071/BT96092 507 508 Boys, J. , Cherry, M. and Dayanandan, S. (2005) Microsatellite analysis reveals genetically 509 distinct populations of red pine (Pinus resinosa, Pinaceae) American Journal of Botany, 92 (5), 510 833-841. http://dx.doi.org/10.3732/ajb.92.5.833 511 512 Cieslarová, J. Hanáček P., Fialová, E. Hýbl, M. Smýkal P.(2011) Estimation of pea (Pisum 513 sativum L.) microsatellite mutation rate based on pedigree and single-seed descent analyses. 514 Journal of applied genetics 52(4), 391-401. DOI:10.1007/s13353-011-0058-9 515 516 Cooper A. and Stringer C.B. (2013), Did the Denisovans Cross the Wallace Line? Science 342 517 (6156), 321–3, doi:10.1126/science.1244869 518 519 Cooper A. and Stringer C.B. (2013), Did the Denisovans Cross the Wallace Line? Science 342 520 (6156): 321–3, doi:10.1126/science.1244869 521

522 Drake JW, Charlesworth B, Charlesworth D and Crow JF 1998 Rates of Spontaneous Mutation: 523 Genetics 148, 1667-1686

524 525 Eldridge, M.D.B. & R.L. Close (1992). 'Taxonomy of Rock Wallabies, Petrogale (Marsupialia: 526 Macropodidae). I. A Revision of the Eastern Petrogale with the Description of Three New 527 Species'. Australian Journal of Zoology. 40, 605-625. http://dx.doi.org/10.1071/zo9920605 528 529 Endicott, P., Ho, SYW., Metspalu, M. and Stringer, C. (2009) 530 Evaluating the mitochondrial timescale. Trends in Ecology and Evolution. 24, 516-521 531 of human evolution. http://dx.doi.org/10.1016/j.tree.2009.04.006 532 533 Grosser JW, Omar AA, Gmitter JA, Syvertsen JP (2013) Salinity Tolerance of ‘Valencia’ 534 Orange Trees on Allotetraploid Rootstocks. Proceedings Florida State Horticultural Society. 535 125, 50–55. 2012. http://dx.doi.org/10.1093/jxb/erl121 536 537 Hardouin, EA. and Tautz D. (2013) Increased mitochondrial mutation frequency after an island 538 colonization: positive selection or accumulation of slightly deleterious mutations? Biology 539 Letters 9(2), 20121123. doi: 10.1098/rsbl.2012.1123 540 541 Ho SYH, Phillips MJ, Cooper A, Drummond AJ (2005). Time Dependency of Molecular Rate 542 Estimates and Systematic Overestimation of Recent Divergence Times". Molecular Biology and 543 Evolution 22 (7), 1561–8. http://dx.doi.org/10.1093/molbev/msi145 544 545 Kay KM, Whittall JB and Hodges SA (2006) A survey of nuclear ribosomal internal transcribed 546 spacer substitution rates across angiosperms: an approximate molecular clock with life history 547 effects. BMC Evolutionary Biology, 6, 36 doi:10.1186/1471-2148-6-36 548 549 Kay KM, Reeves PA, Olmstead RG and Schemske DW (2005) Rapid speciation and the 550 evolution of hummingbird pollination in neotropical Costus subgenus Costus (Costaceae): 551 evidence from nrDNA ITS and ETS sequences.. American Journal Botany November 2005 92, 552 1899-1910; doi:10.3732/ajb.92.11.1899

553 554 Kuchma O, Vornam B, Finkeldey R (2011) Mutation rates in Scots pine (Pinus sylvestris) from 555 the Chernobyl exclusion zone evaluated with amplified fragment-length polymorphisms (AFLPs) 556 and microsatellite markers. Mutation Research 725, 29–35. 557 558 Lanfear, R., Ho, S., Jonathan, D., Moles, A., Aarssen, L., Swenson, N., Warman, L., Zanne, A., 559 Allen, A. (2013). Taller plants have lower rates of molecular evolution. Nature Communications, 560 4, 1-7. http://dx.doi.org/10.1038/ncomms2836 561 562 Lewis-Williams DJ and Challis S (2011). Deciphering Ancient Minds. London: Thames & 563 Hudson. http://dx.doi.org/10.1080/0048721x.2011.592107 564 565 Long JA, Vickers-Rich P, Hirsch K, Bray E, and Tuniz C (1998) The Cervantes egg: an early 566 Malagasy tourist to Australia. Records of the Western Australian Museum 19, 39-46 567 568 Martínkova N, Barnett R, Cucchi T, Struchen R, Pascal M, Fischer MC, Higham, Brace S, Ho 569 SYW, Quéré J-P, O'Higgins P, Excoffier L, Heckel G, Hoelzel AR, Dobney KM and Searle JB 570 (2013) Divergent evolutionary processes associated with colonization of offshore islands 571 Molecular Ecology 22, 5205–5220, doi:10.1071/ZO9920605 572 573 Merchant, J.C. (1983). Agile Wallaby in The Complete Book of Australian Mammals (ed. 574 Ronald Strahan). Angus & Robertson. p. 242. http://dx.doi.org/10.2307/1381267 575 576 Molinier J, Ries G, Zipfel C, & Barbara Hohn B. (2006). Transgeneration memory of stress in 577 plants. Nature 442, 1046-1049. http://dx.doi.org/10.1038/nature05022 578 579 Moray, C. Lanfear R. and Bromham L. (2014) Domestication and the Mitochondrial Genome: 580 Comparing Patterns and Rates of Molecular Evolution in Domesticated Mammals and Birds and 581 Their Wild Relatives. Genome Biological Evolution 6(1), 161–169 doi:10.1093/gbe/evu005 582 583 Nakamura, R. (2011) Multi-ethnic co-existence in Kilwa Island, Tanzania. Shima: International 584 Journal of Research into Island Cultures. 5: 44-68. 585 http://www.shimajournal.org/issues/v5n1/e.%20Nakamura%20Shima%20v5n1%2044-68.pdf 586 587 O'Connell LM and K. Ritland K. (2004) Somatic Mutations at Microsatellite Loci in Western 588 Red cedar (Thuja plicata: Cupressaceae) Journal of Heredity 95 (2), 172-176.doi: 589 10.1093/jhered/esh024 590 591 Pettigrew JD, Callistemon C, Weiler A, Gorbushina A, Krumbein W & Weiler R (2010) Living 592 Pigments in Australian Bradshaw Rock Art. Antiquity 84, 326. 593 http://antiquity.ac.uk/projgall/pettigrew326/ 594 595 Pettigrew JD., Bell, KL., Bhagwandin, A., Grinan, E., Jillani, N., Meyer, J., Wabuyele, E., 596 Vickers, CE. (2012) Morphology, ploidy and molecular phylogenetics reveal a new diploid 597 species from Africa in the baobab genus Adansonia (Malvaceae: Bombacoideae) Taxon 61, 598 1240-1250. http:www.uq.edu.au/nuq/jack/kilima.pdf 599 600 Pettigrew, JD. (2010) Iconography in Bradshaw rock art: Breaking the circularity. Clinical and 601 Experimental Optometry. 88, 39-45. http://dx.doi.org/10.1111/j.1444-0938.2011.00648.x 602 603 Pike AWG, Hoffmann DL, Garcia-Diez M, Pettit PB, Alcolea J, De Balbin R, Gonzalez-Sainz C, 604 de las Hera C, Lasheras JA, Montes R, Zilhao J. (2012) U-Series Dating of Paleolithic Art in 11 605 Caves in Spain. Science 336, (6087) 1409-1413 DOI: 10.1126/science.1219957 606 607 Ranere, A , & Piperno D. ( 2009) "The Cultural and chronological context of early Holocene 608 maize and squash domestication in the Central Balsas River Valley, Mexcio" and "Starch grain 609 and phytolith evidence for early ninth millennium B.P. maize from the Central Balsas River 610 Valley, Mexico" – Proceedings of the National Academy of Sciences USA. Early edition, March 611 24. http://phys.org/news157047461.html#jCp 612

613 Rangan H, Bell KL, Baum DA, Fowler R, McConvell P, et al. (2015) New Genetic and 614 Linguistic Analyses Show Ancient Human Influence on Baobab Evolution and Distribution in 615 Australia. PLoS ONE 10(4), e0119758. doi:10.1371/journal.pone.0119758

616 Raquin A-L, Depaulis F, Lambert A, Galic N, Brabant P, and Goldringer I. (2008) 617 Experimental Estimation of Mutation Rates in a Wheat Population With a Gene Genealogy 618 Approach. Genetics. 179(4): 2195–2211. http://dx.doi.org/10.1534/genetics.107.071332 619 620 Rasmussen et al 2011 An Aboriginal Australian genome reveals separate human dispersals into 621 Asia. Science. 334(6052), :94-8. doi:10.1126/science.1211177 622 623 Reich, David; Green, Richard E.; Kircher, Martin; Krause, Johannes; Patterson, Nick; Durand, 624 Eric Y.; Viola, Bence; Briggs, Adrian W. & Stenzel, Udo (2010), Genetic history of an archaic 625 hominin group from Denisova Cave in Siberia, Nature 468 (7327), 1053–1060, 626 doi:10.1038/nature09710, PMID 21179161. 627 628 Robock, A, Ammann, CM., Oman, L., Shindell, D., Levis, S. and Stenchikov, G. (2009), Did the 629 Toba volcanic eruption of ∼74 ka B.P. produce widespread glaciation?, Journal of Geophysics 630 Research. 114, D10107, doi:10.1029/2008JD011652 631 632 Ronquist F1, Huelsenbeck JP (2003) MrBayes 3: Bayesian phylogenetic inference under mixed 633 models. Bioinformatics. 12, 19(12):1572-4. http://dx.doi.org/10.1093/bioinformatics/btg180 634 635 Rull V. (2008) Speciation timing and neotropical biodiversity: the Tertiary–Quaternary debate in 636 the light of molecular phylogenetic evidence: Molecular Ecology 11, 2722–2729. 637 DOI: 10.1111/j.1365-294X.2008.03789.

638 639 Swofford, DL (2002) PAUP: (Phylogenetic Analysis under Parsimony). Sinauer Publisher, 640 Boston. http://dx.doi.org/10.1007/978-1-4020-6754-9_12413 641 642 Storey, M.,Roberts, RG and Saidin M. (2012) Astronomically calibrated 40Ar/39Ar age for the 643 Toba supereruption and global synchronization of late Quaternary records. 644 Proceedings of the National Academy of Sciences U S A. 109(46), 18684–18688. 645 http://dx.doi.org/10.1073/pnas.1208178109 646 647 Suh, Y, Thien LB, Reeve HE, and Zimmer EA (1993) Molecular evolution and phylogenetic 648 implications of internal transcribed spacer sequences of ribosomal DNA in Winteraceae. Am. J. 649 Bot. 80:1042-1055 650 651 Tsy J-MLP, Lumaret R, Flaven-Noguier E, Sauve M, Dubois M-P, Danthu, P. (2013). Nuclear 652 microsatellite variation in Malagasy baobabs (Adansonia, Bombacoideae, Malvaceae) reveals 653 past hybridization and introgression. Annals of Botany,112 (9), 1759-1773. doi: 654 10.1093/aob/mct23 655 656 Ungerer MC et al. (1998) Rapid hybrid speciation in wild sunflowers. Proceedings of the 657 National Academy of Sciences U S A. 95(20), 11757–11762. 658 659 Walsh, G. (2000). Bradshaw art of the Kimberley. Takarakka Nowan Kas. 660 http://dx.doi.org/10.2307/2694252 661 662 Wickens, G. and Lowe, P. (2008). The baobabs: Pachycauls of Africa, 663 Madagascar, and Australia. Berlin, New York: Springer. http://dx.doi.org/10.1007/978-1-4020- 664 6431-9 665 666 Woinarski, J., Ritchie, E. & Winter, J. (2008). Macropus antilopinus. In: IUCN 2008. IUCN Red 667 List of Threatened Species. Retrieved 30 December 2008. http://dx.doi.org/10.3354/esr006109 668

669 Wendel JF, Schnabel A, and Seelanan T. (1955) Bidirectional interlocus concerted evolution 670 following allopolyploid speciation in cotton (Gossypium). Proceedings of the National Academy 671 of Sciences USA 92:280-284

672

673 Wolfe KH, Li, W-H, Sharp PM (1987) Rates of nucleotide substitution vary greatly among plant, 674 mitochondrial, chloroplast, and nuclear DNAs. Proceedings of the National Academy of 675 Sciences USA 84, 9054-9058

676 Yang, Z. 2002. Molecular clock. M. Pagel (eds). Oxford Encyclopedia of Evolution. Oxford 677 University Press, Oxford. pp.747-750 678