DOCSLIB.ORG

Therapeutic Options for Retinoblastoma Pia R

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Therapeutic Options for Retinoblastoma Pia R Various forms of chemotherapy and targeted therapies have helped improve rates of survival and ocular salvage in retinoblastoma. Photo courtesy of Lynn E. Harman, MD. Themes at the Shard. Therapeutic Options for Retinoblastoma Pia R. Mendoza, MD, and Hans E. Grossniklaus, MD Background: Retinoblastoma is the most common primary intraocular malignancy in children. The manage- ment of retinoblastoma is complex and depends on several factors. Methods: This review provides an update on current and emerging therapeutic options for retinoblastoma. The medical literature was searched for articles relevant to the management of retinoblastoma. The results of prospective and retrospective studies on chemotherapy and focal therapy for retinoblastoma are summarized. Animal models for novel therapeutic agents are also discussed. Results: Treatment strategies for retinoblastoma involve intravenous chemoreduction, local administration routes of chemotherapy (eg, intra-arterial, intravitreal), focal therapy for tumor consolidation (eg, photocoagulation, thermotherapy, cryotherapy, plaque brachytherapy), external beam radiotherapy, and surgical enucleation. Emerging therapies include alternative chemotherapeutic agents, molecularly targeted therapies, and novel drug-delivery systems. Conclusion: In the past 10 years, the management strategy for retinoblastoma has significantly changed, shifting toward local chemotherapy and away from systemic chemotherapy. Innovations in the field of molecular biology and the development of targeted therapies have led to improvements in survival rates and ocular salvage for this disease. However, the need still exists to further assess the long-term effects of such directional changes in therapy. Introduction sor gene RB1. Major advances, such as our understand- Retinoblastoma is the most common primary intraoc- ing of the molecular biology of the tumor and the de- ular malignancy in children; its incidence rate is 1 in velopment of targeted therapy, have improved survival 14,000 to 20,000 livebirths.1 However, compared with rates in developed countries.3 In the United States, the other pediatric malignancies, retinoblastoma is rare, 5-year overall survival rate is 97%.4 Much of this suc- comprising 3% to 4% of all pediatric cancers.2 It is a cess is due to the benefits of effective treatments, in- tumor of the developing retina that arises from primi- cluding chemotherapy, focal or consolidation therapy, tive retinal stem cells or cone precursor cells associated external beam radiotherapy, and surgical enucleation with inactivation of both alleles of the tumor suppres- (Table 1).5 With early diagnosis and aggressive, multi- modal treatment strategies, near-complete cure rates are possible, and many patients retain functional vi- From the Department of Ophthalmology, Emory University School of Medicine, Atlanta, Georgia. sion in at least 1 eye. However, in developing nations, Address correspondence to Hans E. Grossniklaus, MD, 1365 where access to health care is limited, retinoblastoma Clifton Road, Northeast, BT428, Atlanta, GA 30322. E-mail: can cause blindness and death.6 [email protected] Among the mainstay treatments for retinoblastoma Submitted October 14, 2015; accepted January 5, 2016. are intravenous chemotherapy (involving agents asso- No significant relationships exist between the authors and the companies/organizations whose products or services may be ref- ciated with significant toxicities), surgical enucleation, erenced in this article. external beam radiotherapy, or all 3 options, poten- April 2016, Vol. 23, No. 2 Cancer Control 99 tially result in disfigurement and sec- Concepts and Principles of ondary malignancies. However, in re- Table 1. — Therapeutic Options Treatment in Retinoblastoma cent years, an ongoing evolution has The goal of treatment in retinoblas- taken place, where treatment is being Chemotherapy toma is the elimination of the tumor geared toward more targeted therapy Intravenous while concurrently minimizing col- and local medication delivery. Local Chemoreduction lateral injury to other tissues. The delivery increases exposure to intra- Adjuvant therapy priorities in management are (1) pre- ocular target areas, reduces overall venting metastasis, (2) reducing the Metastatic retinoblastoma systemic exposure and harmful late risk of long-term secondary tumors Intra-arterial effects, and improves effectiveness (eg, osteosarcoma, soft-tissue sarco- and rates of tolerability. The intro- Intravitreal ma), (3) saving the eye, and (4) pre- duction of intra-arterial and intravit- Periocular serving vision.11 Caring for a patient real chemotherapy has resulted in a Focal Therapy with retinoblastoma must be a mul- change in treatment algorithms and Thermotherapy tidisciplinary effort involving pedi- improved outcomes, with their pos- Photocoagulation atric oncologists, ocular oncologists, sibility of ocular salvage and mainte- radiation oncologists, ocular pathol- Cryotherapy nance of vision.7 ogists, and geneticists to optimize Preclinical models that simulate Plaque brachytherapy treatment outcomes. human disease are needed for rare External Beam Radiotherapy Treatment depends on tumor childhood cancers such as retinoblas- Enucleation stage, laterality and number of tu- toma because not enough patients mor foci (unifocal, unilateral, mul- with the disease exist for large-scale, tifocal, or bilateral), the localization multicenter clinical trials. Despite the lack of clinical and size of tumors within the eye, presence of vit- trials, rates of survival and ocular preservation have reous seeding, age and health of the child, and the improved.7 In vitro studies and animal models remain family’s wishes.12 The type of management depends instrumental in understanding biological mechanisms on the tumor classification, which is based on 2 sys- and assessing safety and effectiveness of the treatment tems: the International Classification of Retinoblas- options for this disease.8-10 Examples of emerging ther- toma13 used to predict success of chemoreduction14 apies under investigation for retinoblastoma are alter- and the tumor, node, and metastasis classification native chemotherapeutic agents, molecularly targeted of the American Joint Committee on Cancer15 for tu- therapies, and novel drug-delivery systems. mor staging (Table 2). Location of the tumor in rela- Table 2. — International Classification and General Therapeutic Options for Retinoblastoma Eye Group General Feature Specific Feature (Presence of ≥ 1) Therapy A Small tumor away from Tumor ≤ 3 mm Laser photocoagulation fovea and optic disc Thermotherapy Cryotherapy Plaque brachytherapy B Larger tumor Tumor > 3 mm Laser photocoagulation Macular Tumor located < 3 mm from fovea Thermotherapy Juxtapapillary Tumor located ≤ 1.5 mm from optic disc Cryotherapy Subretinal fluid Presence of subretinal fluid ≤ 3 mm from tumor margin Plaque brachytherapy Intravenous/intra-arterial chemoreduction C Focal seeds Presence of subretinal, vitreous seeds, or both located ≤ 3 mm Intra-arterial chemotherapy from main tumor Intravitreal chemotherapy D Diffuse seeds Presence of subretinal, vitreous seeds, or both located > 3 mm Intra-arterial chemotherapy from main tumor Intravitreal chemotherapy Enucleation E Extensive tumor Tumor occupying > 50% of the globe Intra-arterial chemotherapy Neovascular glaucoma Enucleation Opaque media from hemorrhage in anterior chamber, vitreous, Adjuvant intravenous chemotherapy or subretinal space if high-risk histopathological features Invasion of postlaminar optic nerve, choroid (> 2 mm), sclera, present orbit, anterior chamber 100 Cancer Control April 2016, Vol. 23, No. 2 tion to the optic disc and macula is important in the that systemic chemotherapy delivered prior to external clinical evaluation because it largely affects the vi- beam radiotherapy contributed to tumor control and sual prognosis. Involvement of certain tissues in and ocular salvage.19 A subsequent study on eyes treated around the eye, including the optic nerve, choroid, with chemoreduction combined with focal treatments iris, sclera, and orbit, increase the likelihood of tumor (cryotherapy, thermotherapy, or plaque radiotherapy) metastasis.16 demonstrated tumor regression and decreased need In children, unilateral retinoblastoma is differ- for additional external beam radiotherapy and enucle- ently managed than bilateral tumors. In general, ation.20 This was a major advancement in management unilateral cases are the result of sporadic mutations, because it was evident that satisfactory tumor control whereas bilateral cases are typically multifocal, he- could be attained with systemic chemotherapy while reditary, and occur in patients carrying a germline saving the eye and avoiding the adverse events of exter- RB1 mutation, thus placing them at risk for other ma- nal beam radiotherapy.20 Using the International Classi- lignancies (eg, intracranial neuroblastic tumors [pine- fication of Retinoblastoma, treatment success was found aloblastoma in trilateral retinoblastoma]). In general, in 100% of group A eyes, 93% of group B eyes, 90% of unilateral tumors can be managed with focal therapy group C eyes, and 48% group D eyes.14 This launched alone; chemoreduction, intra-arterial chemotherapy the so-called “systemic chemotherapy era” (1990s to with focal therapy, or both; or enucleation. If genetic 2006); however, with the advent of local routes of ad- testing is not performed, then patients with unilateral ministration (intra-arterial and intravitreal),
Load more

Recommended publications
  • Susceptibility of Heterozygous and Nullizygous P53 Knockout Mice to Chemical Carcinogens: Tissue Dependence and Role of P53 Gene Mutations
    J Toxicol Pathol 2005; 18: 121–134 Review Susceptibility of Heterozygous and Nullizygous p53 Knockout Mice to Chemical Carcinogens: Tissue Dependence and Role of p53 Gene Mutations Tetsuya Tsukamoto1, Akihiro Hirata1, and Masae Tatematsu1 1Division of Oncological Pathology, Aichi Cancer Center Research Institute, 1–1 Kanokoden, Chikusa-ku, Nagoya 464–8681, Japan Abstract: Mutations of the p53 tumor suppressor gene constitute one of the most frequent molecular changes in a wide variety of human cancers and mice deficient in p53 have recently attracted attention for their potential to identify chemical genotoxins. In this article, we review the data on the susceptibility of p53 nullizygote (–/–), heterozygote (+/ –), and wild type (+/+) mice to various carcinogens. Induction of esophageal and tongue squamous cell carcinomas (SCCs) by methyl-n-amylnitrosamine was shown to be increased in p53 (+/–) mice, in addition to the high sensitivity shown by p53 (–/–) littermates. N,N-dibutylnitrosamine (DBN) treatment also caused more tumor development in p53 (+/–) than wild-type mice, as with N-butyl-N-(4-hydroxybutyl)nitrosamine (BBN) in the urinary bladder. In addition, p53 (+/–) heterozygotes proved more sensitive than wild type littermates to the induction of stromal cell tumors like hemangiomas/hemangiosarcomas by N-bis(2-hydroxypropyl)nitrosamine (BHP) or lymphomas and fibrosarcomas with other carcinogens. Analysis of exons 5–8 of the p53 gene demonstrated mutations in approximately one half of the lesions. With N-methyl-N-nitrosourea, preneoplastic lesions of the stomach, pepsinogen altered pyloric glands (PAPG), and a gastric adenocarcinoma, were found after only 15 weeks in p53 (–/–) mice, although there was no significant difference in the incidence of gastric tumors between p53 (+/+) and (+/–) mice in the longer-term.
    [Show full text]
  • Transcriptional Control of Tissue-Resident Memory T Cell Generation
    Transcriptional control of tissue-resident memory T cell generation Filip Cvetkovski Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Graduate School of Arts and Sciences COLUMBIA UNIVERSITY 2019 © 2019 Filip Cvetkovski All rights reserved ABSTRACT Transcriptional control of tissue-resident memory T cell generation Filip Cvetkovski Tissue-resident memory T cells (TRM) are a non-circulating subset of memory that are maintained at sites of pathogen entry and mediate optimal protection against reinfection. Lung TRM can be generated in response to respiratory infection or vaccination, however, the molecular pathways involved in CD4+TRM establishment have not been defined. Here, we performed transcriptional profiling of influenza-specific lung CD4+TRM following influenza infection to identify pathways implicated in CD4+TRM generation and homeostasis. Lung CD4+TRM displayed a unique transcriptional profile distinct from spleen memory, including up-regulation of a gene network induced by the transcription factor IRF4, a known regulator of effector T cell differentiation. In addition, the gene expression profile of lung CD4+TRM was enriched in gene sets previously described in tissue-resident regulatory T cells. Up-regulation of immunomodulatory molecules such as CTLA-4, PD-1, and ICOS, suggested a potential regulatory role for CD4+TRM in tissues. Using loss-of-function genetic experiments in mice, we demonstrate that IRF4 is required for the generation of lung-localized pathogen-specific effector CD4+T cells during acute influenza infection. Influenza-specific IRF4−/− T cells failed to fully express CD44, and maintained high levels of CD62L compared to wild type, suggesting a defect in complete differentiation into lung-tropic effector T cells.
    [Show full text]
  • Gene Expression Patterns Define Novel Roles for E47 in Cell Cycle Progression, Cytokine-Mediated Signaling, and T Lineage Development
    Gene expression patterns define novel roles for E47 in cell cycle progression, cytokine-mediated signaling, and T lineage development Ruth Schwartz*†, Isaac Engel*†‡, Mohammad Fallahi-Sichani§, Howard T. Petrie§, and Cornelis Murre*¶ *Division of Biological Sciences, University of California at San Diego, La Jolla, CA 92093-0377; and §Scripps͞Florida Research Institute, 5353 Parkside Drive, RF-1, Jupiter, FL 33458 Communicated by Michael S. Levine, University of California, Berkeley, CA, May 5, 2006 (received for review April 7, 2006) In maturing T lineage cells, the helix–loop–helix protein E47 has analyze the global patterns of gene expression in E2A-deficient been shown to enforce a critical proliferation and developmental lymphomas in the absence and presence of E47. Cluster analysis checkpoint commonly referred to as ␤ selection. To examine how identified groups of genes that were regulated by E47 and shared E47 regulates cellular expansion and developmental progression, biochemical or physiological properties. These included genes we have used an E2A-deficient lymphoma cell line and DNA involved in cell survival, cell cycle progression, stress response, lipid microarray analysis to identify immediate E47 target genes. Hier- metabolism, ␣␤, and natural killer T (NKT) cell function. Based on archical cluster analysis of gene expression patterns revealed that these observations, we suggest that E47 functions in molecular E47 coordinately regulates the expression of genes involved in cell pathways to coordinate cell survival, cell growth, and developmen- survival, cell cycle progression, lipid metabolism, stress response, tal maturation. We identified cyclin-dependent kinase 6 (Cdk6) as and lymphoid maturation. These include Plc␥2, Cdk6, CD25, Tox, an E47 target gene, providing a potential mechanism underlying a Gadd45a, Gadd45b, Gfi1, Gfi1b, Socs1, Socs3, Id2, Eto2, and Xbp1.
    [Show full text]
  • Supplementary Material Contents
    Supplementary Material Contents Immune modulating proteins identified from exosomal samples.....................................................................2 Figure S1: Overlap between exosomal and soluble proteomes.................................................................................... 4 Bacterial strains:..............................................................................................................................................4 Figure S2: Variability between subjects of effects of exosomes on BL21-lux growth.................................................... 5 Figure S3: Early effects of exosomes on growth of BL21 E. coli .................................................................................... 5 Figure S4: Exosomal Lysis............................................................................................................................................ 6 Figure S5: Effect of pH on exosomal action.................................................................................................................. 7 Figure S6: Effect of exosomes on growth of UPEC (pH = 6.5) suspended in exosome-depleted urine supernatant ....... 8 Effective exosomal concentration....................................................................................................................8 Figure S7: Sample constitution for luminometry experiments..................................................................................... 8 Figure S8: Determining effective concentration .........................................................................................................
    [Show full text]
  • Delayed Treatment with 4-Methylpyrazole Protects Against Acetaminophen Hepatotoxicity in Mice by Inhibition of C-Jun N-Terminal Kinase Jephte Y
    TOXICOLOGICAL SCIENCES, 170(1), 2019, 57–68 doi: 10.1093/toxsci/kfz077 Advance Access Publication Date: March 23, 2019 Research Article Delayed Treatment With 4-Methylpyrazole Protects Against Acetaminophen Hepatotoxicity in Mice by Inhibition of c-Jun n-Terminal Kinase Jephte Y. Akakpo,* Anup Ramachandran,* Luqi Duan,* Matthew A. Schaich,† Matthew W. Jaeschke,* Bret D. Freudenthal,† Wen-Xing Ding,* Barry H. Rumack,‡ and Hartmut Jaeschke*,1 *Department of Pharmacology Toxicology & Therapeutics and †Department of Biochemistry and Molecular Biology, University of Kansas Medical Center, Kansas City, Kansas 66160; and ‡Department of Emergency Medicine and Pediatrics, University of Colorado School of Medicine, Aurora, Colorado 80045 1To whom correspondence should be addressed at Department of Pharmacology, Toxicology & Therapeutics, University of Kansas Medical Center, 3901 Rainbow Blvd, MS 1018, Kansas City, KS 66160. Fax 913 588 7501; E-mail: [email protected]. ABSTRACT Acetaminophen (APAP) overdose is the most common cause of hepatotoxicity and acute liver failure in the United States and many western countries. However, the only clinically approved antidote, N-acetylcysteine, has a limited therapeutic window. 4-Methylpyrazole (4MP) is an antidote for methanol and ethylene glycol poisoning, and we have recently shown that cotreatment of 4MP with APAP effectively prevents toxicity by inhibiting Cyp2E1. To evaluate if 4MP can be used therapeutically, C57BL/6J mice were treated with 300 mg/kg APAP followed by 50 mg/kg 4MP 90 min later (after the metabolism phase). In these experiments, 4MP significantly attenuated liver injury at 3, 6, and 24 h after APAP as shown by 80%–90% reduction in plasma alanine aminotransferase activities and reduced areas of necrosis.
    [Show full text]
  • Immune Suppressive Landscape in the Human Esophageal Squamous Cell
    ARTICLE https://doi.org/10.1038/s41467-020-20019-0 OPEN Immune suppressive landscape in the human esophageal squamous cell carcinoma microenvironment ✉ Yingxia Zheng 1,2,10 , Zheyi Chen1,10, Yichao Han 3,10, Li Han1,10, Xin Zou4, Bingqian Zhou1, Rui Hu5, Jie Hao4, Shihao Bai4, Haibo Xiao5, Wei Vivian Li6, Alex Bueker7, Yanhui Ma1, Guohua Xie1, Junyao Yang1, ✉ ✉ ✉ Shiyu Chen1, Hecheng Li 3 , Jian Cao 7,8 & Lisong Shen 1,9 1234567890():,; Cancer immunotherapy has revolutionized cancer treatment, and it relies heavily on the comprehensive understanding of the immune landscape of the tumor microenvironment (TME). Here, we obtain a detailed immune cell atlas of esophageal squamous cell carcinoma (ESCC) at single-cell resolution. Exhausted T and NK cells, regulatory T cells (Tregs), alternatively activated macrophages and tolerogenic dendritic cells are dominant in the TME. Transcriptional profiling coupled with T cell receptor (TCR) sequencing reveal lineage con- nections in T cell populations. CD8 T cells show continuous progression from pre-exhausted to exhausted T cells. While exhausted CD4, CD8 T and NK cells are major proliferative cell components in the TME, the crosstalk between macrophages and Tregs contributes to potential immunosuppression in the TME. Our results indicate several immunosuppressive mechanisms that may be simultaneously responsible for the failure of immuno-surveillance. Specific targeting of these immunosuppressive pathways may reactivate anti-tumor immune responses in ESCC. 1 Department of Laboratory Medicine, Xin Hua Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai, China. 2 Institute of Biliary Tract Diseases Research, Shanghai Jiao Tong University School of Medicine, Shanghai, China. 3 Department of Thoracic Surgery, Ruijin Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai, China.
    [Show full text]
  • Pharmacology Review(S) Memorandum
    CENTER FOR DRUG EVALUATION AND RESEARCH APPLICATION NUMBER: 207103Orig1s000 PHARMACOLOGY REVIEW(S) MEMORANDUM Ibrance (palbociclib) Date: January 23, 2015 To: File for NDA 207103 From: John K. Leighton, PhD, DABT Acting Director, Division of Hematology Oncology Toxicology Office of Hematology and Oncology Products I have examined pharmacology/toxicology supporting and labeling reviews for Ibrance conducted by Dr. Chen, and secondary memorandum and labeling provided by Dr. Palmby. I concur with Dr. Palmby’s conclusion that Ibrance may be approved and that no additional nonclinical studies are needed for the proposed indication. Reference ID: 3691405 --------------------------------------------------------------------------------------------------------- This is a representation of an electronic record that was signed electronically and this page is the manifestation of the electronic signature. --------------------------------------------------------------------------------------------------------- /s/ ---------------------------------------------------- JOHN K LEIGHTON 01/23/2015 Reference ID: 3691405 MEMORANDUM Date: January 22, 2015 From: Todd R. Palmby, PhD Pharmacology/Toxicology Supervisor Division of Hematology Oncology Toxicology (DHOT) Office of Hematology and Oncology Products (OHOP) To: File for NDA 207103 Ibrance (palbociclib) Re: Approvability for Pharmacology and Toxicology Indication: in combination with letrozole for the treatment of postmenopausal women with estrogen receptor (ER)-positive, human epidermal growth factor
    [Show full text]
  • Review Recognition of Specific DNA Sequences
    Molecular Cell, Vol. 8, 937–946, November, 2001, Copyright 2001 by Cell Press Recognition of Specific DNA Sequences Review Colin W. Garvie and Cynthia Wolberger1 teins that mediate recombination, DNA cleavage, meth- Department of Biophysics and Biophysical Chemistry ylation, and other processes. The broad principles of and the Howard Hughes Medical Institute DNA binding outlined here pertain to these proteins as Johns Hopkins University School of Medicine well, although the structural details differ. Baltimore, Maryland 21205 Basic Requirements for DNA Binding Double-stranded DNA is a polymer of relatively uniform Proteins that recognize specific DNA sequences play structure, with a highly negatively charged sugar-phos- a central role in the regulation of transcription. The phate backbone and a core of stacked base pairs whose tremendous increase in structural information on pro- edges are exposed in the major and minor grooves. tein-DNA complexes has uncovered a remarkable Since each base pair has a characteristic set of func- structural diversity in DNA binding folds, while at the tional groups, each DNA sequence has a chemical “sig- same time revealing common themes in binding to nature” characterized by the pattern of these groups target sites in the genome. exposed in the DNA grooves. It is this chemical surface, along with sequence-dependent variations in DNA Introduction structure and flexibility, that is recognized by proteins. Proteins recognize a particular sequence by having a The ability of a protein to bind selectively to a particular surface that is chemically complementary to that of the DNA site in the genome is the foundation upon which DNA, forming a series of favorable electrostatic and van transcriptional regulatory pathways are built.
    [Show full text]
  • Early Life Exposure to Ethinylestradiol Enhances Subsequent Responses To
    www.nature.com/scientificreports OPEN Early life exposure to ethinylestradiol enhances subsequent responses to Received: 18 August 2017 Accepted: 4 January 2018 environmental estrogens measured Published: xx xx xxxx in a novel transgenic zebrafsh Jon M. Green1, Anke Lange 1, Aaron Scott1, Maciej Trznadel1, Htoo Aung Wai 1, Aya Takesono1, A. Ross Brown 1, Stewart F. Owen2, Tetsuhiro Kudoh1 & Charles R. Tyler1 Estrogen plays fundamental roles in a range of developmental processes and exposure to estrogen mimicking chemicals has been associated with various adverse health efects in both wildlife and human populations. Estrogenic chemicals are found commonly as mixtures in the environment and can have additive efects, however risk analysis is typically conducted for single-chemicals with little, or no, consideration given for an animal’s exposure history. Here we developed a transgenic zebrafsh with a photoconvertable fuorophore (Kaede, green to red on UV light exposure) in a skin pigment-free mutant element (ERE)-Kaede-Casper model and applied it to quantify tissue-specifc fuorescence biosensor responses for combinations of estrogen exposures during early life using fuorescence microscopy and image analysis. We identify windows of tissue-specifc sensitivity to ethinylestradiol (EE2) for exposure during early-life (0–5 dpf) and illustrate that exposure to estrogen (EE2) during 0–48 hpf enhances responsiveness (sensitivity) to diferent environmental estrogens (EE2, genistein and bisphenol A) for subsequent exposures during development. Our fndings illustrate the importance of an organism’s stage of development and estrogen exposure history for assessments on, and possible health risks associated with, estrogen exposure. Exposure to endocrine disrupting chemicals (EDCs) is linked with a range of adverse health disorders and further understanding of EDCs efects is crucial for safe-guarding long-term human and environmental health1,2.
    [Show full text]
  • Gene Name Forward Primer Reverse Primer ACTB
    Gene Name Forward Primer Reverse Primer ACTB CTGGAACGGTGAAGGTGACA AAGGGACTTCCTGTAACAATGCA ACVRL1 ACATGAAGAAGGTGGTGTGTGTGG CGGGCAGAGGGGTTTGGGTA ADAMDEC1 GGGGCCAGACTACACTGAAACATT ACCCGTCACAAGTACTGATGCTG AHI1 GTCCAAAACTACCCCATCAAGGCT GCAGCACAGGAACGTATCACCT ANGPT2 TGGCAGCGTTGATTTTCAGAGG GCGAAACAAACTCATTTCCCAGCC ANPEP TGAAGAAGCAGGTCACACCCCT AACTCCGTTGGAGCAGGCGG APOA1 GCCGTGCTCTTCCTGACGG TGGGACACATAGTCTCTGCCGC ATXN7 CACCGCCCACTCTGGAAAAGAA GGGTGCAGGGCTTCTTGGTG B2M TGCTGTCTCCATGTTTGATGTATCT TCTCTGCTCCCCACCTCTAAGT BAG4 AGGTTCCAGGATATCCGCCTT TCGGTCCTGATTGTGGAACACT BCL2 ACAACATCGCCCTGTGGATGA CCGTACAGTTCCACAAAGGCAT BCL2L14 GCTCAGGGTCAAAGGACGTTGG TCAGCTACTCGGTTGGCAATGG BCL7A GAACCATGTCGGGCAGGTCG CCCATTTGTAGATTCGTAGGGATGTGT BIN1 TGCTGTCGTGGTGGAGACCTTC GCCGTGTAGTCGTGCTGGG BIRC3 TGCTATCCACATCAGACAGCCC TCTGAATGGTCTTCTCCAGGTTCA BIRC5 TTCTCAAGGACCACCGCATCT AGTGGATGAAGCCAGCCTCG BLK TCGGGGTCTTCACCATCAAAGC GCGCTCCAGGTTGCGGATGA BTRC CCAAATGTGTCATTACCAACATGGGC GCAGCACATAGTGATTTGGCATCC BUB3 CGGAACATGGGTTACGTGCAGC CCAAATACTCAACTGCCACTCGGC CAGE1 TCCAAAATGCACAGTCTTCTGGCT GGAGGCTCTTCAGTTTTTGCAGC CASP1 CCTGTTCCTGTGATGTGGAGGAAA GCTCTACCATCTGGCTGCTCAA CASP3 AGCGAATCAATGGACTCTGGAATATCC GTTTGCTGCATCGACATCTGTACCA CCL5 TCATTGCTACTGCCCTCTGCG ACTGCTGGGTTGGAGCACTTG CCL18 CCCTCCTTGTCCTCGTCTGCA GCACTGGGGGCTGGTTTCAG CCL26 TTCCAATACAGCCACAAGCCCC GGATGGGTACAGACTTTCTTGCCTC CCND2 TCAAGTGCGTGCAGAAGGACAT CTTCGCACTTCTGTTCCTCACA CCND3 TGGCTGCTGTGATTGCACATGA GATGGCGGGTACATGGCAAAGG CCR3 ACGCTGCTCTGCTTCCTGG TCCTCAGTTCCCCACCATCGC CCR4 AGCATCGTGCTTCCTGAGCAA GGTGTCTGCTATATCCGTGGGGT CCR7 AGACAGGGGTAGTGCGAGGC
    [Show full text]
  • Eomes Transcription Factor Is Required for the Development and Differentiation of Invariant NKT Cells
    ARTICLE https://doi.org/10.1038/s42003-019-0389-3 OPEN Eomes transcription factor is required for the development and differentiation of invariant NKT cells Kanako Shimizu1,3, Yusuke Sato1,3, Masami Kawamura1, Hiroshi Nakazato1, Takashi Watanabe2, 1234567890():,; Osamu Ohara2 & Shin-ichiro Fujii1,2 Eomes regulates the differentiation of CD8+ T cells into effector and memory phases. However, its role in invariant (i)NKT cells remains unknown. Here, we show the impact of Eomes on iNKT cells in the thymus and peripheral tissue using conditional knockout (Eomes- cKO) mice. In the thymus, CD1d-tetramer+CD24+CD44−NK1.1−CD69+stage 0 iNKT cells express higher levels of Eomes than the other iNKT stages. We also found that Eomes regulates NKT1 cell differentiation predominantly. Interestingly, the expression of Eomes in the steady state is low, but can be upregulated after TCR stimulation. We also showed epigenetic changes in the Eomes locus after activation. In addition, vaccination of C57BL/6, but not Eomes-cKO mice with iNKT ligand-loaded dendritic cells generated KLRG1 +iNKT cells in lung, characterized as effector memory phenotype by transcriptome profiling. Thus, Eomes regulates not only the differentiation of NKT1 cells in the thymus, but also their differentiation into memory-like KLRG1+iNKT cells in the periphery. 1 Laboratory for Immunotherapy, RIKEN Center for Integrative Medical Sciences (IMS), Yokohama, Kanagawa 230-0045, Japan. 2 Laboratory for Integrative Genomics, RIKEN Center for Integrative Medical Sciences (IMS), Yokohama, Kanagawa 230-0045, Japan. 3These authors contributed equally: Kanako Shimizu, Yusuke Sato. Correspondence and requests for materials should be addressed to K.S.
    [Show full text]
  • Counteracting CAR T Cell Dysfunction
    Oncogene (2021) 40:421–435 https://doi.org/10.1038/s41388-020-01501-x REVIEW ARTICLE Counteracting CAR T cell dysfunction 1,2 1 1 1 2 Mansour Poorebrahim ● Jeroen Melief ● Yago Pico de Coaña ● Stina L. Wickström ● Angel Cid-Arregui ● Rolf Kiessling 1 Received: 6 May 2020 / Revised: 22 September 2020 / Accepted: 30 September 2020 © The Author(s) 2020. This article is published with open access Abstract In spite of high rates of complete remission following chimeric antigen receptor (CAR) T cell therapy, the efficacy of this approach is limited by generation of dysfunctional CAR T cells in vivo, conceivably induced by immunosuppressive tumor microenvironment (TME) and excessive antigen exposure. Exhaustion and senescence are two critical dysfunctional states that impose a pivotal hurdle for successful CAR T cell therapies. Recently, modified CAR T cells with an “exhaustion- resistant” phenotype have shown superior antitumor functions and prolonged lifespan. In addition, several studies have indicated the feasibility of senescence delay in CAR T cells. Here, we review the latest reports regarding blockade of CAR T cell exhaustion and senescence with a particular focus on the exhaustion-inducing pathways. Subsequently, we describe what potential these latest insights offer for boosting the potency of adoptive cell transfer (ACT) therapies involving CAR T cells. 1234567890();,: 1234567890();,: Furthermore, we discuss how induction of costimulation, cytokine exposure, and TME modulation can impact on CAR T cell efficacy and persistence, while potential safety issues associated with reinvigorated CAR T cells will also be addressed. Introduction persistence in the hostile tumor microenvironment (TME) represent additional key impediments to efficacious CAR T In a recent decade, genetically modified immune cells, parti- cell responses and durable clinical remission following CAR T cularly chimeric antigen receptor (CAR) T cells, have raised cell therapy [4].
    [Show full text]