DOCSLIB.ORG

Expression of Exogenous Wt-P53 Does Not Affect Normal Hematopoiesis: Implications for Bone Marrow Purging

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Expression of Exogenous Wt-P53 Does Not Affect Normal Hematopoiesis: Implications for Bone Marrow Purging Gene Therapy (1997) 4, 1371–1378 1997 Stockton Press All rights reserved 0969-7128/97 $12.00 Expression of exogenous wt-p53 does not affect normal hematopoiesis: implications for bone marrow purging R Scardigli1,2, G Bossi1, G Blandino1,3, M Crescenzi1, S Soddu1 and A Sacchi1 1Molecular Oncogenesis Laboratory, Regina Elena Cancer Institute, CRS, Via delle Messi d’Oro 156, 00158 Rome, Italy Some gene therapy approaches for cancer treatment undertook a series of experiments to assess whether trans- attempt to transduce onco-suppressor genes into tumor duction of wt-p53 into normal hematopoietic cells is harm- cells. A central problem of this strategy is the targeting of ful. Two different wt-p53-recombinant retroviruses were tumor cells to avoid damage to normal ones. It has been used to infect primary, murine BM cells. Expression of noticed that transduction of wt-p53 into a large number of exogenous wt-p53 in these cells did not affect in vitro col- cancer cells induces tumor suppression. In contrast, some ony formation, and did not induce any observable effects observations suggest that introduction of exogenous wt- on morphology and differentiation. In contrast, the same p53 into nontransformed cells does not impair proliferation. viruses suppressed the tumor phenotype of v-src-transfor- If normal bone marrow (BM) cells are not affected by med 32D cells. These results might open the way to gene wt-p53 transduction, BM purging from p53-responding therapy approaches to leukemias with the p53 gene with- leukemic cells might be achieved in vitro by delivering out the need to target specifically and uniquely the tumor the wild-type onco-suppressor to all marrow cells. We cells, sparing the normal ones. Keywords: onco-suppressor; retroviral vector; leukemia; gene therapy; tumor targeting Introduction mutations.7–9 Various effects ranging from growth arrest7,10 to apoptosis11,12 or differentiation13–15 have been One of the critical steps in tumor gene therapy with described, making the wt-p53 gene a promising tool for tumor-suppressing agents (eg toxins, prodrugs, onco- tumor gene therapy. Interestingly, it was originally suppressor genes) is the transduction of the appropriate observed that introduction of exogenous wt-p53 into non- target cells. Tissue-specific methods for gene transfer or transformed, wt-p53 expressing cells, such as normal rat expression are being developed. Viral vectors are embryo fibroblasts,16,17 and VACO 235 adenoma cells7 directed to target specific cell types through chimeric coat causes no observable phenotype, suggesting that the vari- proteins containing the viral env and eukaryotic ligands, ous effects induced by wt-p53 expression might occur 1 such as EPO, or by bi-specific molecular adaptors that only in tumor cells. 2 recognize both env protein and cellular receptors. It was observed that low-level UV irradiation can acti- Another strategy is based on inserting tissue-specific pro- vate sequence-specific transcription by wt-p53 without an moters into retroviral long terminal repeats (LTRs). These increase in p53 protein levels. This activation can also be modifications drive exogenous gene transcription only in induced by antibodies specific to the C-terminal negative 3 particular tissues. An alternative approach to these stra- regulatory domain of p53 or by small peptides derived tegies might be offered by transduction of genes whose from this domain. It has thus been suggested that post- expression is detrimental only for tumor cells while not translational modifications of this negative regulatory harmful for normal ones. Some observations suggest that domain in vivo are rate-limiting steps for wt-p53 acti- the p53 onco-suppressor might belong to this type of vation.18,19 Recently, we found that expression of tem- gene. perature-sensitive p53 in its wild-type configuration Genetic modifications of the p53 onco-suppressor gene affects neither morphology nor proliferation of nontrans- are the most frequent alterations found in human can- formed, murine 32D myeloid progenitors maintained in 4–6 cers. In the past few years, a large number of experi- their normal culture conditions. In contrast, an acceler- ments have been performed to study the suppressor ated apoptotic cell death was observed after IL-3 with- activities of exogenous wt-p53 expression in tumor cells drawal,20 suggesting that this event might trigger the that have lost their normal alleles or bear p53 post-translational modifications that activate wt-p53, which would otherwise remain inactive in nonstressing conditions, in these nontransformed cells. However, Correspondence: S Soddu or A Sacchi when we transformed 32D cells with different oncogenes, Present addresses: 2Institut de Genetique et de Biologie Moleculaire et Cellulaire, Universite´ Louis Pasteur, Strasbourg, France; and 3Depart- wt-p53 expression was then able to induce tumor-sup- ment of Molecular Cell Biology, The Weizmann Institute, Rehovot, Israel pressing effects without the need for stressing stimuli.21 Received 4 February 1997; accepted 11 July 1997 These results suggest either that transformed cells might Exogenous wt-p53 does not affect normal hemopoiesis R Scardigli et al 1372 directly activate wt-p53 in the absence of stressing con- ditions, or that they are no longer able to maintain wt- p53 in an inactive form. We sought to take advantage of these findings for a new strategy of leukemia gene ther- apy. We proposed to purge the BM from leukemia by the functional targeting of tumor cells, while avoiding dam- age to normal ones, by delivering in vitro wt-p53 to all of the marrow cells. To begin to evaluate the feasibility of this strategy, we set up a series of experiments to verify whether the exogenous wt-p53 gene can be transduced into normal cells without untoward effects. Primary, murine BM cells were infected with two different recom- binant retroviruses carrying the human wt-p53 cDNA and the puromycin (pBabe-p53) or the neomycin (pLp53SN) selectable markers. No differences in prolifer- ation, differentiation, and colony formation in the pres- ence of different cytokines were found between the infected and the control cells, indicating that normal murine BM cells can tolerate transduction of an exogen- ous wt-p53 gene. In contrast, the same wt-p53 expressing retroviruses were able to infect and induce a suppressing effect on 32Dv-src-transformed cells, suggesting the possibility of using a single agent to transduce both nor- mal and tumor cells and obtain detrimental effects only in the latter. Results Expression of exogenous wt-p53 is not harmful to 32D myeloid progenitors The murine 32D cell line is constituted by nontumori- genic, myeloid progenitors,22,23 which are dependent on IL-3 for survival and proliferation, and differentiate into granulocytes upon granulocyte colony-stimulating factor (G-CSF) stimulation.24 Because of these characteristics and the low predisposition to develop IL-3-independent Figure 1 32D parental and tsp53-transfectants maintained in the pres- subclones,25 these cells are considered an adequate model ence of IL-3 or induced to differentiate by G-CSF, at the indicated tempera- tures, were cytocentrifuged and stained with May–Grunwald Giemsa to for in vitro hemopoiesis. We found that expression of the evaluate morphological features. Each cell population cultured with IL-3 temperature-sensitive p53Val135 (ts-p53) mutant, that is constituted by undifferentiated blasts, whereas those incubated with G- behaves like wt-p53 at 32°C but not at 37°C, affects CSF are mostly constituted (80% of the alive cells) of differentiated poly- neither morphology nor proliferation of 32D cells main- morphonuclear cells. tained at a permissive temperature in their normal cul- ture conditions.20 To verify whether exogenous wt-p53 murine leukemia virus and carry the selectable markers expression is also compatible with differentiation, we for puromycin or neomycin resistance, respectively. The incubated the ts-p53-expressing 32D-tsp53#6 and 32D- murine VE and GP+E packaging cells were transfected tsp53#10 cells21 at the permissive temperature in the pres- with the different constructs to produce ecotropic retro- ence of G-CSF, to assess their granulocyte maturation, viruses, as described in Materials and methods. compared with parental 32D cells. Granulocytic differen- To confirm that the human p53 protein produced by tiation was morphologically evaluated on cytocentrifuge our packaging cells has wild-type configuration, we preparations fixed and stained with May–Grunwald immunoprecipitated the exogenous p53 with mAbs Giemsa. No difference in differentiation was observed PAb1801 and PAb1620. The first mAb recognizes human between tsp53-expressing and control cells after 12 days p53 in both wild-type and mutant configurations while of incubation at 32°C in the presence of G-CSF (Figure the second recognizes only wild-type configuration. As 1). Thus, exogenous wt-p53 expression interferes neither shown in Figure 2, both packaging cell lines – VE/Babe- with morphology and proliferation, nor with differen- p53 and GP+E/Lp53 – express an exogenous p53 protein tiation of 32D cells. with wild-type immunoreactivity. Mouse primary BM cells were infected by 24 h coculti- Infection by retroviral vectors carrying wt-p53 does not vation with mitomycin-treated packaging cells in the affect the colony forming efficiency of primary BM cells presence of IL-3. The colony forming efficiency of these The results obtained with ts-p53 protein in 32D cells infected BM cells was tested by cultivation in methyl- prompted us to evaluate the effects of exogenous wt-p53 cellulose, in the presence of IL-3, GM-CSF or EPO, and transduction in primary BM cells. We inserted the human puromycin or G418 (see Materials and methods for wt-p53 cDNA into two different retroviral vectors – details). As shown in Table 1, cells infected with the wt- pBabe-puro and pLXSN – which derive from Moloney p53 recombinant retroviruses form colonies with the Exogenous wt-p53 does not affect normal hemopoiesis R Scardigli et al 1373 Figure 2 Biochemical analysis of exogenous p53 proteins in packaging cells.
Load more

Recommended publications
  • Susceptibility of Heterozygous and Nullizygous P53 Knockout Mice to Chemical Carcinogens: Tissue Dependence and Role of P53 Gene Mutations
    J Toxicol Pathol 2005; 18: 121–134 Review Susceptibility of Heterozygous and Nullizygous p53 Knockout Mice to Chemical Carcinogens: Tissue Dependence and Role of p53 Gene Mutations Tetsuya Tsukamoto1, Akihiro Hirata1, and Masae Tatematsu1 1Division of Oncological Pathology, Aichi Cancer Center Research Institute, 1–1 Kanokoden, Chikusa-ku, Nagoya 464–8681, Japan Abstract: Mutations of the p53 tumor suppressor gene constitute one of the most frequent molecular changes in a wide variety of human cancers and mice deficient in p53 have recently attracted attention for their potential to identify chemical genotoxins. In this article, we review the data on the susceptibility of p53 nullizygote (–/–), heterozygote (+/ –), and wild type (+/+) mice to various carcinogens. Induction of esophageal and tongue squamous cell carcinomas (SCCs) by methyl-n-amylnitrosamine was shown to be increased in p53 (+/–) mice, in addition to the high sensitivity shown by p53 (–/–) littermates. N,N-dibutylnitrosamine (DBN) treatment also caused more tumor development in p53 (+/–) than wild-type mice, as with N-butyl-N-(4-hydroxybutyl)nitrosamine (BBN) in the urinary bladder. In addition, p53 (+/–) heterozygotes proved more sensitive than wild type littermates to the induction of stromal cell tumors like hemangiomas/hemangiosarcomas by N-bis(2-hydroxypropyl)nitrosamine (BHP) or lymphomas and fibrosarcomas with other carcinogens. Analysis of exons 5–8 of the p53 gene demonstrated mutations in approximately one half of the lesions. With N-methyl-N-nitrosourea, preneoplastic lesions of the stomach, pepsinogen altered pyloric glands (PAPG), and a gastric adenocarcinoma, were found after only 15 weeks in p53 (–/–) mice, although there was no significant difference in the incidence of gastric tumors between p53 (+/+) and (+/–) mice in the longer-term.
    [Show full text]
  • Transcriptional Control of Tissue-Resident Memory T Cell Generation
    Transcriptional control of tissue-resident memory T cell generation Filip Cvetkovski Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Graduate School of Arts and Sciences COLUMBIA UNIVERSITY 2019 © 2019 Filip Cvetkovski All rights reserved ABSTRACT Transcriptional control of tissue-resident memory T cell generation Filip Cvetkovski Tissue-resident memory T cells (TRM) are a non-circulating subset of memory that are maintained at sites of pathogen entry and mediate optimal protection against reinfection. Lung TRM can be generated in response to respiratory infection or vaccination, however, the molecular pathways involved in CD4+TRM establishment have not been defined. Here, we performed transcriptional profiling of influenza-specific lung CD4+TRM following influenza infection to identify pathways implicated in CD4+TRM generation and homeostasis. Lung CD4+TRM displayed a unique transcriptional profile distinct from spleen memory, including up-regulation of a gene network induced by the transcription factor IRF4, a known regulator of effector T cell differentiation. In addition, the gene expression profile of lung CD4+TRM was enriched in gene sets previously described in tissue-resident regulatory T cells. Up-regulation of immunomodulatory molecules such as CTLA-4, PD-1, and ICOS, suggested a potential regulatory role for CD4+TRM in tissues. Using loss-of-function genetic experiments in mice, we demonstrate that IRF4 is required for the generation of lung-localized pathogen-specific effector CD4+T cells during acute influenza infection. Influenza-specific IRF4−/− T cells failed to fully express CD44, and maintained high levels of CD62L compared to wild type, suggesting a defect in complete differentiation into lung-tropic effector T cells.
    [Show full text]
  • Gene Expression Patterns Define Novel Roles for E47 in Cell Cycle Progression, Cytokine-Mediated Signaling, and T Lineage Development
    Gene expression patterns define novel roles for E47 in cell cycle progression, cytokine-mediated signaling, and T lineage development Ruth Schwartz*†, Isaac Engel*†‡, Mohammad Fallahi-Sichani§, Howard T. Petrie§, and Cornelis Murre*¶ *Division of Biological Sciences, University of California at San Diego, La Jolla, CA 92093-0377; and §Scripps͞Florida Research Institute, 5353 Parkside Drive, RF-1, Jupiter, FL 33458 Communicated by Michael S. Levine, University of California, Berkeley, CA, May 5, 2006 (received for review April 7, 2006) In maturing T lineage cells, the helix–loop–helix protein E47 has analyze the global patterns of gene expression in E2A-deficient been shown to enforce a critical proliferation and developmental lymphomas in the absence and presence of E47. Cluster analysis checkpoint commonly referred to as ␤ selection. To examine how identified groups of genes that were regulated by E47 and shared E47 regulates cellular expansion and developmental progression, biochemical or physiological properties. These included genes we have used an E2A-deficient lymphoma cell line and DNA involved in cell survival, cell cycle progression, stress response, lipid microarray analysis to identify immediate E47 target genes. Hier- metabolism, ␣␤, and natural killer T (NKT) cell function. Based on archical cluster analysis of gene expression patterns revealed that these observations, we suggest that E47 functions in molecular E47 coordinately regulates the expression of genes involved in cell pathways to coordinate cell survival, cell growth, and developmen- survival, cell cycle progression, lipid metabolism, stress response, tal maturation. We identified cyclin-dependent kinase 6 (Cdk6) as and lymphoid maturation. These include Plc␥2, Cdk6, CD25, Tox, an E47 target gene, providing a potential mechanism underlying a Gadd45a, Gadd45b, Gfi1, Gfi1b, Socs1, Socs3, Id2, Eto2, and Xbp1.
    [Show full text]
  • Supplementary Material Contents
    Supplementary Material Contents Immune modulating proteins identified from exosomal samples.....................................................................2 Figure S1: Overlap between exosomal and soluble proteomes.................................................................................... 4 Bacterial strains:..............................................................................................................................................4 Figure S2: Variability between subjects of effects of exosomes on BL21-lux growth.................................................... 5 Figure S3: Early effects of exosomes on growth of BL21 E. coli .................................................................................... 5 Figure S4: Exosomal Lysis............................................................................................................................................ 6 Figure S5: Effect of pH on exosomal action.................................................................................................................. 7 Figure S6: Effect of exosomes on growth of UPEC (pH = 6.5) suspended in exosome-depleted urine supernatant ....... 8 Effective exosomal concentration....................................................................................................................8 Figure S7: Sample constitution for luminometry experiments..................................................................................... 8 Figure S8: Determining effective concentration .........................................................................................................
    [Show full text]
  • Delayed Treatment with 4-Methylpyrazole Protects Against Acetaminophen Hepatotoxicity in Mice by Inhibition of C-Jun N-Terminal Kinase Jephte Y
    TOXICOLOGICAL SCIENCES, 170(1), 2019, 57–68 doi: 10.1093/toxsci/kfz077 Advance Access Publication Date: March 23, 2019 Research Article Delayed Treatment With 4-Methylpyrazole Protects Against Acetaminophen Hepatotoxicity in Mice by Inhibition of c-Jun n-Terminal Kinase Jephte Y. Akakpo,* Anup Ramachandran,* Luqi Duan,* Matthew A. Schaich,† Matthew W. Jaeschke,* Bret D. Freudenthal,† Wen-Xing Ding,* Barry H. Rumack,‡ and Hartmut Jaeschke*,1 *Department of Pharmacology Toxicology & Therapeutics and †Department of Biochemistry and Molecular Biology, University of Kansas Medical Center, Kansas City, Kansas 66160; and ‡Department of Emergency Medicine and Pediatrics, University of Colorado School of Medicine, Aurora, Colorado 80045 1To whom correspondence should be addressed at Department of Pharmacology, Toxicology & Therapeutics, University of Kansas Medical Center, 3901 Rainbow Blvd, MS 1018, Kansas City, KS 66160. Fax 913 588 7501; E-mail: [email protected]. ABSTRACT Acetaminophen (APAP) overdose is the most common cause of hepatotoxicity and acute liver failure in the United States and many western countries. However, the only clinically approved antidote, N-acetylcysteine, has a limited therapeutic window. 4-Methylpyrazole (4MP) is an antidote for methanol and ethylene glycol poisoning, and we have recently shown that cotreatment of 4MP with APAP effectively prevents toxicity by inhibiting Cyp2E1. To evaluate if 4MP can be used therapeutically, C57BL/6J mice were treated with 300 mg/kg APAP followed by 50 mg/kg 4MP 90 min later (after the metabolism phase). In these experiments, 4MP significantly attenuated liver injury at 3, 6, and 24 h after APAP as shown by 80%–90% reduction in plasma alanine aminotransferase activities and reduced areas of necrosis.
    [Show full text]
  • Immune Suppressive Landscape in the Human Esophageal Squamous Cell
    ARTICLE https://doi.org/10.1038/s41467-020-20019-0 OPEN Immune suppressive landscape in the human esophageal squamous cell carcinoma microenvironment ✉ Yingxia Zheng 1,2,10 , Zheyi Chen1,10, Yichao Han 3,10, Li Han1,10, Xin Zou4, Bingqian Zhou1, Rui Hu5, Jie Hao4, Shihao Bai4, Haibo Xiao5, Wei Vivian Li6, Alex Bueker7, Yanhui Ma1, Guohua Xie1, Junyao Yang1, ✉ ✉ ✉ Shiyu Chen1, Hecheng Li 3 , Jian Cao 7,8 & Lisong Shen 1,9 1234567890():,; Cancer immunotherapy has revolutionized cancer treatment, and it relies heavily on the comprehensive understanding of the immune landscape of the tumor microenvironment (TME). Here, we obtain a detailed immune cell atlas of esophageal squamous cell carcinoma (ESCC) at single-cell resolution. Exhausted T and NK cells, regulatory T cells (Tregs), alternatively activated macrophages and tolerogenic dendritic cells are dominant in the TME. Transcriptional profiling coupled with T cell receptor (TCR) sequencing reveal lineage con- nections in T cell populations. CD8 T cells show continuous progression from pre-exhausted to exhausted T cells. While exhausted CD4, CD8 T and NK cells are major proliferative cell components in the TME, the crosstalk between macrophages and Tregs contributes to potential immunosuppression in the TME. Our results indicate several immunosuppressive mechanisms that may be simultaneously responsible for the failure of immuno-surveillance. Specific targeting of these immunosuppressive pathways may reactivate anti-tumor immune responses in ESCC. 1 Department of Laboratory Medicine, Xin Hua Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai, China. 2 Institute of Biliary Tract Diseases Research, Shanghai Jiao Tong University School of Medicine, Shanghai, China. 3 Department of Thoracic Surgery, Ruijin Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai, China.
    [Show full text]
  • Pharmacology Review(S) Memorandum
    CENTER FOR DRUG EVALUATION AND RESEARCH APPLICATION NUMBER: 207103Orig1s000 PHARMACOLOGY REVIEW(S) MEMORANDUM Ibrance (palbociclib) Date: January 23, 2015 To: File for NDA 207103 From: John K. Leighton, PhD, DABT Acting Director, Division of Hematology Oncology Toxicology Office of Hematology and Oncology Products I have examined pharmacology/toxicology supporting and labeling reviews for Ibrance conducted by Dr. Chen, and secondary memorandum and labeling provided by Dr. Palmby. I concur with Dr. Palmby’s conclusion that Ibrance may be approved and that no additional nonclinical studies are needed for the proposed indication. Reference ID: 3691405 --------------------------------------------------------------------------------------------------------- This is a representation of an electronic record that was signed electronically and this page is the manifestation of the electronic signature. --------------------------------------------------------------------------------------------------------- /s/ ---------------------------------------------------- JOHN K LEIGHTON 01/23/2015 Reference ID: 3691405 MEMORANDUM Date: January 22, 2015 From: Todd R. Palmby, PhD Pharmacology/Toxicology Supervisor Division of Hematology Oncology Toxicology (DHOT) Office of Hematology and Oncology Products (OHOP) To: File for NDA 207103 Ibrance (palbociclib) Re: Approvability for Pharmacology and Toxicology Indication: in combination with letrozole for the treatment of postmenopausal women with estrogen receptor (ER)-positive, human epidermal growth factor
    [Show full text]
  • Review Recognition of Specific DNA Sequences
    Molecular Cell, Vol. 8, 937–946, November, 2001, Copyright 2001 by Cell Press Recognition of Specific DNA Sequences Review Colin W. Garvie and Cynthia Wolberger1 teins that mediate recombination, DNA cleavage, meth- Department of Biophysics and Biophysical Chemistry ylation, and other processes. The broad principles of and the Howard Hughes Medical Institute DNA binding outlined here pertain to these proteins as Johns Hopkins University School of Medicine well, although the structural details differ. Baltimore, Maryland 21205 Basic Requirements for DNA Binding Double-stranded DNA is a polymer of relatively uniform Proteins that recognize specific DNA sequences play structure, with a highly negatively charged sugar-phos- a central role in the regulation of transcription. The phate backbone and a core of stacked base pairs whose tremendous increase in structural information on pro- edges are exposed in the major and minor grooves. tein-DNA complexes has uncovered a remarkable Since each base pair has a characteristic set of func- structural diversity in DNA binding folds, while at the tional groups, each DNA sequence has a chemical “sig- same time revealing common themes in binding to nature” characterized by the pattern of these groups target sites in the genome. exposed in the DNA grooves. It is this chemical surface, along with sequence-dependent variations in DNA Introduction structure and flexibility, that is recognized by proteins. Proteins recognize a particular sequence by having a The ability of a protein to bind selectively to a particular surface that is chemically complementary to that of the DNA site in the genome is the foundation upon which DNA, forming a series of favorable electrostatic and van transcriptional regulatory pathways are built.
    [Show full text]
  • Early Life Exposure to Ethinylestradiol Enhances Subsequent Responses To
    www.nature.com/scientificreports OPEN Early life exposure to ethinylestradiol enhances subsequent responses to Received: 18 August 2017 Accepted: 4 January 2018 environmental estrogens measured Published: xx xx xxxx in a novel transgenic zebrafsh Jon M. Green1, Anke Lange 1, Aaron Scott1, Maciej Trznadel1, Htoo Aung Wai 1, Aya Takesono1, A. Ross Brown 1, Stewart F. Owen2, Tetsuhiro Kudoh1 & Charles R. Tyler1 Estrogen plays fundamental roles in a range of developmental processes and exposure to estrogen mimicking chemicals has been associated with various adverse health efects in both wildlife and human populations. Estrogenic chemicals are found commonly as mixtures in the environment and can have additive efects, however risk analysis is typically conducted for single-chemicals with little, or no, consideration given for an animal’s exposure history. Here we developed a transgenic zebrafsh with a photoconvertable fuorophore (Kaede, green to red on UV light exposure) in a skin pigment-free mutant element (ERE)-Kaede-Casper model and applied it to quantify tissue-specifc fuorescence biosensor responses for combinations of estrogen exposures during early life using fuorescence microscopy and image analysis. We identify windows of tissue-specifc sensitivity to ethinylestradiol (EE2) for exposure during early-life (0–5 dpf) and illustrate that exposure to estrogen (EE2) during 0–48 hpf enhances responsiveness (sensitivity) to diferent environmental estrogens (EE2, genistein and bisphenol A) for subsequent exposures during development. Our fndings illustrate the importance of an organism’s stage of development and estrogen exposure history for assessments on, and possible health risks associated with, estrogen exposure. Exposure to endocrine disrupting chemicals (EDCs) is linked with a range of adverse health disorders and further understanding of EDCs efects is crucial for safe-guarding long-term human and environmental health1,2.
    [Show full text]
  • Gene Name Forward Primer Reverse Primer ACTB
    Gene Name Forward Primer Reverse Primer ACTB CTGGAACGGTGAAGGTGACA AAGGGACTTCCTGTAACAATGCA ACVRL1 ACATGAAGAAGGTGGTGTGTGTGG CGGGCAGAGGGGTTTGGGTA ADAMDEC1 GGGGCCAGACTACACTGAAACATT ACCCGTCACAAGTACTGATGCTG AHI1 GTCCAAAACTACCCCATCAAGGCT GCAGCACAGGAACGTATCACCT ANGPT2 TGGCAGCGTTGATTTTCAGAGG GCGAAACAAACTCATTTCCCAGCC ANPEP TGAAGAAGCAGGTCACACCCCT AACTCCGTTGGAGCAGGCGG APOA1 GCCGTGCTCTTCCTGACGG TGGGACACATAGTCTCTGCCGC ATXN7 CACCGCCCACTCTGGAAAAGAA GGGTGCAGGGCTTCTTGGTG B2M TGCTGTCTCCATGTTTGATGTATCT TCTCTGCTCCCCACCTCTAAGT BAG4 AGGTTCCAGGATATCCGCCTT TCGGTCCTGATTGTGGAACACT BCL2 ACAACATCGCCCTGTGGATGA CCGTACAGTTCCACAAAGGCAT BCL2L14 GCTCAGGGTCAAAGGACGTTGG TCAGCTACTCGGTTGGCAATGG BCL7A GAACCATGTCGGGCAGGTCG CCCATTTGTAGATTCGTAGGGATGTGT BIN1 TGCTGTCGTGGTGGAGACCTTC GCCGTGTAGTCGTGCTGGG BIRC3 TGCTATCCACATCAGACAGCCC TCTGAATGGTCTTCTCCAGGTTCA BIRC5 TTCTCAAGGACCACCGCATCT AGTGGATGAAGCCAGCCTCG BLK TCGGGGTCTTCACCATCAAAGC GCGCTCCAGGTTGCGGATGA BTRC CCAAATGTGTCATTACCAACATGGGC GCAGCACATAGTGATTTGGCATCC BUB3 CGGAACATGGGTTACGTGCAGC CCAAATACTCAACTGCCACTCGGC CAGE1 TCCAAAATGCACAGTCTTCTGGCT GGAGGCTCTTCAGTTTTTGCAGC CASP1 CCTGTTCCTGTGATGTGGAGGAAA GCTCTACCATCTGGCTGCTCAA CASP3 AGCGAATCAATGGACTCTGGAATATCC GTTTGCTGCATCGACATCTGTACCA CCL5 TCATTGCTACTGCCCTCTGCG ACTGCTGGGTTGGAGCACTTG CCL18 CCCTCCTTGTCCTCGTCTGCA GCACTGGGGGCTGGTTTCAG CCL26 TTCCAATACAGCCACAAGCCCC GGATGGGTACAGACTTTCTTGCCTC CCND2 TCAAGTGCGTGCAGAAGGACAT CTTCGCACTTCTGTTCCTCACA CCND3 TGGCTGCTGTGATTGCACATGA GATGGCGGGTACATGGCAAAGG CCR3 ACGCTGCTCTGCTTCCTGG TCCTCAGTTCCCCACCATCGC CCR4 AGCATCGTGCTTCCTGAGCAA GGTGTCTGCTATATCCGTGGGGT CCR7 AGACAGGGGTAGTGCGAGGC
    [Show full text]
  • Eomes Transcription Factor Is Required for the Development and Differentiation of Invariant NKT Cells
    ARTICLE https://doi.org/10.1038/s42003-019-0389-3 OPEN Eomes transcription factor is required for the development and differentiation of invariant NKT cells Kanako Shimizu1,3, Yusuke Sato1,3, Masami Kawamura1, Hiroshi Nakazato1, Takashi Watanabe2, 1234567890():,; Osamu Ohara2 & Shin-ichiro Fujii1,2 Eomes regulates the differentiation of CD8+ T cells into effector and memory phases. However, its role in invariant (i)NKT cells remains unknown. Here, we show the impact of Eomes on iNKT cells in the thymus and peripheral tissue using conditional knockout (Eomes- cKO) mice. In the thymus, CD1d-tetramer+CD24+CD44−NK1.1−CD69+stage 0 iNKT cells express higher levels of Eomes than the other iNKT stages. We also found that Eomes regulates NKT1 cell differentiation predominantly. Interestingly, the expression of Eomes in the steady state is low, but can be upregulated after TCR stimulation. We also showed epigenetic changes in the Eomes locus after activation. In addition, vaccination of C57BL/6, but not Eomes-cKO mice with iNKT ligand-loaded dendritic cells generated KLRG1 +iNKT cells in lung, characterized as effector memory phenotype by transcriptome profiling. Thus, Eomes regulates not only the differentiation of NKT1 cells in the thymus, but also their differentiation into memory-like KLRG1+iNKT cells in the periphery. 1 Laboratory for Immunotherapy, RIKEN Center for Integrative Medical Sciences (IMS), Yokohama, Kanagawa 230-0045, Japan. 2 Laboratory for Integrative Genomics, RIKEN Center for Integrative Medical Sciences (IMS), Yokohama, Kanagawa 230-0045, Japan. 3These authors contributed equally: Kanako Shimizu, Yusuke Sato. Correspondence and requests for materials should be addressed to K.S.
    [Show full text]
  • Counteracting CAR T Cell Dysfunction
    Oncogene (2021) 40:421–435 https://doi.org/10.1038/s41388-020-01501-x REVIEW ARTICLE Counteracting CAR T cell dysfunction 1,2 1 1 1 2 Mansour Poorebrahim ● Jeroen Melief ● Yago Pico de Coaña ● Stina L. Wickström ● Angel Cid-Arregui ● Rolf Kiessling 1 Received: 6 May 2020 / Revised: 22 September 2020 / Accepted: 30 September 2020 © The Author(s) 2020. This article is published with open access Abstract In spite of high rates of complete remission following chimeric antigen receptor (CAR) T cell therapy, the efficacy of this approach is limited by generation of dysfunctional CAR T cells in vivo, conceivably induced by immunosuppressive tumor microenvironment (TME) and excessive antigen exposure. Exhaustion and senescence are two critical dysfunctional states that impose a pivotal hurdle for successful CAR T cell therapies. Recently, modified CAR T cells with an “exhaustion- resistant” phenotype have shown superior antitumor functions and prolonged lifespan. In addition, several studies have indicated the feasibility of senescence delay in CAR T cells. Here, we review the latest reports regarding blockade of CAR T cell exhaustion and senescence with a particular focus on the exhaustion-inducing pathways. Subsequently, we describe what potential these latest insights offer for boosting the potency of adoptive cell transfer (ACT) therapies involving CAR T cells. 1234567890();,: 1234567890();,: Furthermore, we discuss how induction of costimulation, cytokine exposure, and TME modulation can impact on CAR T cell efficacy and persistence, while potential safety issues associated with reinvigorated CAR T cells will also be addressed. Introduction persistence in the hostile tumor microenvironment (TME) represent additional key impediments to efficacious CAR T In a recent decade, genetically modified immune cells, parti- cell responses and durable clinical remission following CAR T cularly chimeric antigen receptor (CAR) T cells, have raised cell therapy [4].
    [Show full text]