DOCSLIB.ORG

UTR Interactions Regulate P53 Mrna Translation and Provide a Target for Modulating P53 Induction After DNA Damage

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
UTR Interactions Regulate P53 Mrna Translation and Provide a Target for Modulating P53 Induction After DNA Damage Downloaded from genesdev.cshlp.org on October 4, 2021 - Published by Cold Spring Harbor Laboratory Press 59–39-UTR interactions regulate p53 mRNA translation and provide a target for modulating p53 induction after DNA damage Jing Chen and Michael B. Kastan1 Department of Oncology, St. Jude Children’s Research Hospital, Memphis, Tennessee 38105, USA Optimal induction of p53 protein after DNA damage requires RPL26-mediated increases in p53 mRNA translation. We report here the existence of a dsRNA region containing complementary sequences of the 59- and 39-untranslated regions (UTRs) of human p53 mRNA that is critical for its translational regulation by RPL26. Mutating as few as 3 bases in either of the two complementary UTR sequences abrogates the ability of RPL26 to bind to p53 mRNA and stimulate p53 translation, while compensatory mutations restore this binding and regulation. Short, single-strand oligonucleotides that target this 59–39-UTR base-pairing region blunt the binding of RPL26 to p53 mRNA in cells and reduce p53 induction and p53-mediated cell death after several different types of DNA damage and cellular stress. The ability to reduce stress induction of p53 with oligonucleotides or other small molecules has numerous potential therapeutic uses. [Keywords: p53; translational control; DNA damage; cytoprotection] Supplemental material is available at http://www.genesdev.org. Received July 12, 2010; revised version accepted August 12, 2010. Cellular DNA is constantly damaged by endogenous mol- physiological and pathological processes (Levine and Oren ecules, such as reactive oxygen species, and exogenous 2009). Levels of p53 protein increase in cells following sources, including natural or man-made chemicals and exposure to DNA damage and other stresses, leading to radiation. Effective responses to such damage are critical cellular responses such as cell cycle arrest or programmed to reduce disease burden, including cancer development. cell death (Kastan and Bartek 2004). An ability to modulate The high incidence of cancer seen in individuals who stress induction of p53 in tumor cells or normal cells could inherit mutations in genes involved in DNA damage prove to be useful in various clinical settings. responses—such as ATM, p53, BRCA1, and BRCA2—un- Increases in p53 protein levels after DNA damage have derscores the important role that such responses play in been largely attributed to increases in the half-life of p53 tumorigenesis (Kastan and Bartek 2004). In addition, since protein. Proteasome-mediated degradation of p53 protein most current cancer therapeutics target cellular DNA, regulated by the E3–ubiquitin ligase Mdm2 helps maintain cellular responses to DNA damage are also critical de- low levels of p53 protein in nonstressed cells (Haupt et al. terminants of both tumor responses to therapy and the side 1997; Honda et al. 1997; Kubbutat et al. 1997). Cellular effects of cancer treatments. The p53 gene product is exposure to DNA damage results in an inhibition of particularly important in this regard, since the gene is Mdm2-mediated degradation of p53 protein, contributing mutated in >50% of sporadic human tumors, and inher- to an increase in p53 protein half-life and increased cellular itance of germline p53 mutations leads to a profound sus- levels of p53 protein (Ashcroft and Vousden 1999; Wade ceptibility to cancer development (Malkin et al. 1990; et al. 2010). We reported recently that increased translation Levine 1997; Olivier et al. 2010). p53 protein transcription- of p53 mRNA is also a requisite step for optimal p53 ally regulates a complex network of genes involved in induction following DNA damage (Takagi et al. 2005). In tumor suppression, metabolism, autophagy, and various particular, we found that RPL26 protein binds to the 59-untranslated region (UTR) of p53 mRNA after DNA dam- age, enhances the association of p53 mRNA with heavy 1Corresponding author. polysomes, and increases the translation of p53 mRNA. E-MAIL [email protected]; FAX (901) 595-3966. Article published online ahead of print. Article and publication date are Furthermore, the Mdm2–p53 feedback loop, which regu- online at http://www.genesdev.org/cgi/doi/10.1101/gad.1968910. lates p53 levels after DNA damage (Levine 1997; Prives 2146 GENES & DEVELOPMENT 24:2146–2156 Ó 2010 by Cold Spring Harbor Laboratory Press ISSN 0890-9369/10; www.genesdev.org Downloaded from genesdev.cshlp.org on October 4, 2021 - Published by Cold Spring Harbor Laboratory Press Modulation of p53 translation 1998; Michael and Oren 2003), also appears to involve To determine if such a 59–39-UTR dsRNA structure Mdm2–RPL26 interactions, which affect p53 translation existed in p53 mRNA, human p53 mRNA was probed (Ofir-Rosenfeld et al. 2008). Down-regulation of RPL26 with single-strand-specific (RNases A and T1) and double- protein levels with siRNA not only reduces the increases strand-specific (RNase V1) RNase enzymes. RNase A in p53 translation seen after DNA damage, it also reduces specifically recognizes ssRNA and cuts at the 39 side of increases in total p53 protein levels and cell death after C/U bases, while RNase T1 cuts at the 39 side of G bases in DNA damage (Takagi et al. 2005). Thus, blockade of ssRNA. The vast majority of cellular p53 mRNA contains RPL26-mediated translational induction of p53 is sufficient 59-UTRs with 140–170 bases (Takagi et al. 2005), so a p53 to reduce p53 induction and p53-mediated cell death. mRNA containing 145 bases of the 59-UTR and either We report here that translation of human p53 mRNA containing or lacking a full-length 39-UTR was transcribed is regulated by base-pairing interactions between 59- and in vitro, end-labeled at the 59 end with 32P, and digested 39-UTR sequences. Mutations that disrupt the interaction with RNase A or RNase T1. RNase A treatment of an end- abolish the binding of RPL26 to human p53 mRNA and labeled p53 mRNA lacking a 39-UTR resulted in a prom- diminish RPL26-dependent p53 induction. Compensatory inent band migrating at a molecular weight consistent with mutations that restore this UTR interaction rescue the cutting next to the uridine at position À36 in the 59-UTR RPL26 binding as well as translational regulation of p53 by [U(À36)] (Fig. 1C [lane 6], D [lanes 1,3]; Supplemental Fig. RPL26. Small, single-strand oligonucleotides containing S2). In contrast, RNase A failed to cut at this 59-UTR site critical sequences from this RNA interaction region in- (Fig. 1D, lane 5) if the RNA lacking the 39-UTR was hibit the binding of RPL26 to p53 mRNA and blunt p53 mutated at U(À36) (UGG to AAA, À36 to À34) (Fig. 1B, induction after exposure of cells to a variety of DNA- 59-UTR mutation/5M), thus confirming this as the site damaging agents. These observations demonstrate a novel of RNase A cutting. Addition of a full-length 39-UTR se- mechanism of regulating cellular protein levels and quence to the p53 mRNA blocked RNase A cutting at provide a reagent (oligonucleotides) that can be used to U(À36) (Fig. 1C, lane 7), consistent with the appearance of modulate stress induction of p53 in cells—a potentially a dsRNA structure at this 59-UTR site when the 39-UTR is clinically useful intervention. These mechanistic insights included in the p53 mRNA. Interestingly, a new prominent also set the stage for identifying small molecules other than band appeared when the full-length, wild-type p53 mRNA oligonucleotides that could modulate p53 induction by was digested with the C/U-directed, single-strand-specific targeting this mechanism. RNase A (Fig. 1C, lane 7, band noted by arrowhead). This new band runs at a size consistent with cutting at the Results C/U(À52/À49) sites in the putative double-strand region, the unpaired bases in this 21-base 59-UTR region (Fig. 1B). p53 mRNA contains a dsRNA structure Mutating as few as 3 bases in the predicted interacting with base-pairing between the 59- and 39-UTRs region of the 39-UTR, which should disrupt the base- RPL26 stimulation of p53 translation requires the 59-UTR, pairing of the two UTRs at this site, was sufficient to but not the coding sequence, of p53 mRNA (Takagi et al. partially restore RNase A cutting at U(À36) (Fig. 1C, lane 2005; Ofir-Rosenfeld et al. 2008). This 59-UTR translational 8). RNase A cutting at U(À36) of a p53 mRNA lacking dependence was recapitulated by a cell-based, dual-lucifer- a39-UTR could even be abrogated by simple addition of ase reporter assay, in which RPL26 selectively enhanced a DNA oligonucleotide complementary to the predicted the expression level of a chimera firefly luciferase reporter 59-UTR-interacting region (Fig. 1D, lane 2), as would be gene containing a 59-UTR sequence of human p53 mRNA expected from the creation of a double-strand structure at relative to the expression of the internal control renilla this site. Importantly, addition of a control oligonucleo- luciferase gene (Fig. 1A). Unexpectedly, adding the 39-UTR tide that would not pair with this 59-UTR region failed sequence of human p53 mRNA further enhanced RPL26 to abrogate RNase A cutting at this site in the p53 mRNA stimulation of firefly luciferase expression (Fig. 1A). This lacking the 39-UTR (Fig. 1D, lane 4). observation raised the question of why RPL26 stimulation Digestion of the various p53 mRNA species with the would simultaneously require both UTR sequences, so other single-strand-specific RNase, the G-directed RNase mathematical modeling of the p53 mRNA structure was T1 enzyme, gave similar results, cutting both a p53 mRNA performed using an RNAfold program (http://www.tbi. lacking the 39-UTR and a full-length p53 mRNA mutated univie.ac.at/RNA) to predict the minimum free energy at the 39-UTR-interacting site at G(À34/À35) (Fig.
Load more

Recommended publications
  • Susceptibility of Heterozygous and Nullizygous P53 Knockout Mice to Chemical Carcinogens: Tissue Dependence and Role of P53 Gene Mutations
    J Toxicol Pathol 2005; 18: 121–134 Review Susceptibility of Heterozygous and Nullizygous p53 Knockout Mice to Chemical Carcinogens: Tissue Dependence and Role of p53 Gene Mutations Tetsuya Tsukamoto1, Akihiro Hirata1, and Masae Tatematsu1 1Division of Oncological Pathology, Aichi Cancer Center Research Institute, 1–1 Kanokoden, Chikusa-ku, Nagoya 464–8681, Japan Abstract: Mutations of the p53 tumor suppressor gene constitute one of the most frequent molecular changes in a wide variety of human cancers and mice deficient in p53 have recently attracted attention for their potential to identify chemical genotoxins. In this article, we review the data on the susceptibility of p53 nullizygote (–/–), heterozygote (+/ –), and wild type (+/+) mice to various carcinogens. Induction of esophageal and tongue squamous cell carcinomas (SCCs) by methyl-n-amylnitrosamine was shown to be increased in p53 (+/–) mice, in addition to the high sensitivity shown by p53 (–/–) littermates. N,N-dibutylnitrosamine (DBN) treatment also caused more tumor development in p53 (+/–) than wild-type mice, as with N-butyl-N-(4-hydroxybutyl)nitrosamine (BBN) in the urinary bladder. In addition, p53 (+/–) heterozygotes proved more sensitive than wild type littermates to the induction of stromal cell tumors like hemangiomas/hemangiosarcomas by N-bis(2-hydroxypropyl)nitrosamine (BHP) or lymphomas and fibrosarcomas with other carcinogens. Analysis of exons 5–8 of the p53 gene demonstrated mutations in approximately one half of the lesions. With N-methyl-N-nitrosourea, preneoplastic lesions of the stomach, pepsinogen altered pyloric glands (PAPG), and a gastric adenocarcinoma, were found after only 15 weeks in p53 (–/–) mice, although there was no significant difference in the incidence of gastric tumors between p53 (+/+) and (+/–) mice in the longer-term.
    [Show full text]
  • Transcriptional Control of Tissue-Resident Memory T Cell Generation
    Transcriptional control of tissue-resident memory T cell generation Filip Cvetkovski Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Graduate School of Arts and Sciences COLUMBIA UNIVERSITY 2019 © 2019 Filip Cvetkovski All rights reserved ABSTRACT Transcriptional control of tissue-resident memory T cell generation Filip Cvetkovski Tissue-resident memory T cells (TRM) are a non-circulating subset of memory that are maintained at sites of pathogen entry and mediate optimal protection against reinfection. Lung TRM can be generated in response to respiratory infection or vaccination, however, the molecular pathways involved in CD4+TRM establishment have not been defined. Here, we performed transcriptional profiling of influenza-specific lung CD4+TRM following influenza infection to identify pathways implicated in CD4+TRM generation and homeostasis. Lung CD4+TRM displayed a unique transcriptional profile distinct from spleen memory, including up-regulation of a gene network induced by the transcription factor IRF4, a known regulator of effector T cell differentiation. In addition, the gene expression profile of lung CD4+TRM was enriched in gene sets previously described in tissue-resident regulatory T cells. Up-regulation of immunomodulatory molecules such as CTLA-4, PD-1, and ICOS, suggested a potential regulatory role for CD4+TRM in tissues. Using loss-of-function genetic experiments in mice, we demonstrate that IRF4 is required for the generation of lung-localized pathogen-specific effector CD4+T cells during acute influenza infection. Influenza-specific IRF4−/− T cells failed to fully express CD44, and maintained high levels of CD62L compared to wild type, suggesting a defect in complete differentiation into lung-tropic effector T cells.
    [Show full text]
  • Gene Expression Patterns Define Novel Roles for E47 in Cell Cycle Progression, Cytokine-Mediated Signaling, and T Lineage Development
    Gene expression patterns define novel roles for E47 in cell cycle progression, cytokine-mediated signaling, and T lineage development Ruth Schwartz*†, Isaac Engel*†‡, Mohammad Fallahi-Sichani§, Howard T. Petrie§, and Cornelis Murre*¶ *Division of Biological Sciences, University of California at San Diego, La Jolla, CA 92093-0377; and §Scripps͞Florida Research Institute, 5353 Parkside Drive, RF-1, Jupiter, FL 33458 Communicated by Michael S. Levine, University of California, Berkeley, CA, May 5, 2006 (received for review April 7, 2006) In maturing T lineage cells, the helix–loop–helix protein E47 has analyze the global patterns of gene expression in E2A-deficient been shown to enforce a critical proliferation and developmental lymphomas in the absence and presence of E47. Cluster analysis checkpoint commonly referred to as ␤ selection. To examine how identified groups of genes that were regulated by E47 and shared E47 regulates cellular expansion and developmental progression, biochemical or physiological properties. These included genes we have used an E2A-deficient lymphoma cell line and DNA involved in cell survival, cell cycle progression, stress response, lipid microarray analysis to identify immediate E47 target genes. Hier- metabolism, ␣␤, and natural killer T (NKT) cell function. Based on archical cluster analysis of gene expression patterns revealed that these observations, we suggest that E47 functions in molecular E47 coordinately regulates the expression of genes involved in cell pathways to coordinate cell survival, cell growth, and developmen- survival, cell cycle progression, lipid metabolism, stress response, tal maturation. We identified cyclin-dependent kinase 6 (Cdk6) as and lymphoid maturation. These include Plc␥2, Cdk6, CD25, Tox, an E47 target gene, providing a potential mechanism underlying a Gadd45a, Gadd45b, Gfi1, Gfi1b, Socs1, Socs3, Id2, Eto2, and Xbp1.
    [Show full text]
  • Supplementary Material Contents
    Supplementary Material Contents Immune modulating proteins identified from exosomal samples.....................................................................2 Figure S1: Overlap between exosomal and soluble proteomes.................................................................................... 4 Bacterial strains:..............................................................................................................................................4 Figure S2: Variability between subjects of effects of exosomes on BL21-lux growth.................................................... 5 Figure S3: Early effects of exosomes on growth of BL21 E. coli .................................................................................... 5 Figure S4: Exosomal Lysis............................................................................................................................................ 6 Figure S5: Effect of pH on exosomal action.................................................................................................................. 7 Figure S6: Effect of exosomes on growth of UPEC (pH = 6.5) suspended in exosome-depleted urine supernatant ....... 8 Effective exosomal concentration....................................................................................................................8 Figure S7: Sample constitution for luminometry experiments..................................................................................... 8 Figure S8: Determining effective concentration .........................................................................................................
    [Show full text]
  • Delayed Treatment with 4-Methylpyrazole Protects Against Acetaminophen Hepatotoxicity in Mice by Inhibition of C-Jun N-Terminal Kinase Jephte Y
    TOXICOLOGICAL SCIENCES, 170(1), 2019, 57–68 doi: 10.1093/toxsci/kfz077 Advance Access Publication Date: March 23, 2019 Research Article Delayed Treatment With 4-Methylpyrazole Protects Against Acetaminophen Hepatotoxicity in Mice by Inhibition of c-Jun n-Terminal Kinase Jephte Y. Akakpo,* Anup Ramachandran,* Luqi Duan,* Matthew A. Schaich,† Matthew W. Jaeschke,* Bret D. Freudenthal,† Wen-Xing Ding,* Barry H. Rumack,‡ and Hartmut Jaeschke*,1 *Department of Pharmacology Toxicology & Therapeutics and †Department of Biochemistry and Molecular Biology, University of Kansas Medical Center, Kansas City, Kansas 66160; and ‡Department of Emergency Medicine and Pediatrics, University of Colorado School of Medicine, Aurora, Colorado 80045 1To whom correspondence should be addressed at Department of Pharmacology, Toxicology & Therapeutics, University of Kansas Medical Center, 3901 Rainbow Blvd, MS 1018, Kansas City, KS 66160. Fax 913 588 7501; E-mail: [email protected]. ABSTRACT Acetaminophen (APAP) overdose is the most common cause of hepatotoxicity and acute liver failure in the United States and many western countries. However, the only clinically approved antidote, N-acetylcysteine, has a limited therapeutic window. 4-Methylpyrazole (4MP) is an antidote for methanol and ethylene glycol poisoning, and we have recently shown that cotreatment of 4MP with APAP effectively prevents toxicity by inhibiting Cyp2E1. To evaluate if 4MP can be used therapeutically, C57BL/6J mice were treated with 300 mg/kg APAP followed by 50 mg/kg 4MP 90 min later (after the metabolism phase). In these experiments, 4MP significantly attenuated liver injury at 3, 6, and 24 h after APAP as shown by 80%–90% reduction in plasma alanine aminotransferase activities and reduced areas of necrosis.
    [Show full text]
  • Immune Suppressive Landscape in the Human Esophageal Squamous Cell
    ARTICLE https://doi.org/10.1038/s41467-020-20019-0 OPEN Immune suppressive landscape in the human esophageal squamous cell carcinoma microenvironment ✉ Yingxia Zheng 1,2,10 , Zheyi Chen1,10, Yichao Han 3,10, Li Han1,10, Xin Zou4, Bingqian Zhou1, Rui Hu5, Jie Hao4, Shihao Bai4, Haibo Xiao5, Wei Vivian Li6, Alex Bueker7, Yanhui Ma1, Guohua Xie1, Junyao Yang1, ✉ ✉ ✉ Shiyu Chen1, Hecheng Li 3 , Jian Cao 7,8 & Lisong Shen 1,9 1234567890():,; Cancer immunotherapy has revolutionized cancer treatment, and it relies heavily on the comprehensive understanding of the immune landscape of the tumor microenvironment (TME). Here, we obtain a detailed immune cell atlas of esophageal squamous cell carcinoma (ESCC) at single-cell resolution. Exhausted T and NK cells, regulatory T cells (Tregs), alternatively activated macrophages and tolerogenic dendritic cells are dominant in the TME. Transcriptional profiling coupled with T cell receptor (TCR) sequencing reveal lineage con- nections in T cell populations. CD8 T cells show continuous progression from pre-exhausted to exhausted T cells. While exhausted CD4, CD8 T and NK cells are major proliferative cell components in the TME, the crosstalk between macrophages and Tregs contributes to potential immunosuppression in the TME. Our results indicate several immunosuppressive mechanisms that may be simultaneously responsible for the failure of immuno-surveillance. Specific targeting of these immunosuppressive pathways may reactivate anti-tumor immune responses in ESCC. 1 Department of Laboratory Medicine, Xin Hua Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai, China. 2 Institute of Biliary Tract Diseases Research, Shanghai Jiao Tong University School of Medicine, Shanghai, China. 3 Department of Thoracic Surgery, Ruijin Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai, China.
    [Show full text]
  • Pharmacology Review(S) Memorandum
    CENTER FOR DRUG EVALUATION AND RESEARCH APPLICATION NUMBER: 207103Orig1s000 PHARMACOLOGY REVIEW(S) MEMORANDUM Ibrance (palbociclib) Date: January 23, 2015 To: File for NDA 207103 From: John K. Leighton, PhD, DABT Acting Director, Division of Hematology Oncology Toxicology Office of Hematology and Oncology Products I have examined pharmacology/toxicology supporting and labeling reviews for Ibrance conducted by Dr. Chen, and secondary memorandum and labeling provided by Dr. Palmby. I concur with Dr. Palmby’s conclusion that Ibrance may be approved and that no additional nonclinical studies are needed for the proposed indication. Reference ID: 3691405 --------------------------------------------------------------------------------------------------------- This is a representation of an electronic record that was signed electronically and this page is the manifestation of the electronic signature. --------------------------------------------------------------------------------------------------------- /s/ ---------------------------------------------------- JOHN K LEIGHTON 01/23/2015 Reference ID: 3691405 MEMORANDUM Date: January 22, 2015 From: Todd R. Palmby, PhD Pharmacology/Toxicology Supervisor Division of Hematology Oncology Toxicology (DHOT) Office of Hematology and Oncology Products (OHOP) To: File for NDA 207103 Ibrance (palbociclib) Re: Approvability for Pharmacology and Toxicology Indication: in combination with letrozole for the treatment of postmenopausal women with estrogen receptor (ER)-positive, human epidermal growth factor
    [Show full text]
  • Review Recognition of Specific DNA Sequences
    Molecular Cell, Vol. 8, 937–946, November, 2001, Copyright 2001 by Cell Press Recognition of Specific DNA Sequences Review Colin W. Garvie and Cynthia Wolberger1 teins that mediate recombination, DNA cleavage, meth- Department of Biophysics and Biophysical Chemistry ylation, and other processes. The broad principles of and the Howard Hughes Medical Institute DNA binding outlined here pertain to these proteins as Johns Hopkins University School of Medicine well, although the structural details differ. Baltimore, Maryland 21205 Basic Requirements for DNA Binding Double-stranded DNA is a polymer of relatively uniform Proteins that recognize specific DNA sequences play structure, with a highly negatively charged sugar-phos- a central role in the regulation of transcription. The phate backbone and a core of stacked base pairs whose tremendous increase in structural information on pro- edges are exposed in the major and minor grooves. tein-DNA complexes has uncovered a remarkable Since each base pair has a characteristic set of func- structural diversity in DNA binding folds, while at the tional groups, each DNA sequence has a chemical “sig- same time revealing common themes in binding to nature” characterized by the pattern of these groups target sites in the genome. exposed in the DNA grooves. It is this chemical surface, along with sequence-dependent variations in DNA Introduction structure and flexibility, that is recognized by proteins. Proteins recognize a particular sequence by having a The ability of a protein to bind selectively to a particular surface that is chemically complementary to that of the DNA site in the genome is the foundation upon which DNA, forming a series of favorable electrostatic and van transcriptional regulatory pathways are built.
    [Show full text]
  • Early Life Exposure to Ethinylestradiol Enhances Subsequent Responses To
    www.nature.com/scientificreports OPEN Early life exposure to ethinylestradiol enhances subsequent responses to Received: 18 August 2017 Accepted: 4 January 2018 environmental estrogens measured Published: xx xx xxxx in a novel transgenic zebrafsh Jon M. Green1, Anke Lange 1, Aaron Scott1, Maciej Trznadel1, Htoo Aung Wai 1, Aya Takesono1, A. Ross Brown 1, Stewart F. Owen2, Tetsuhiro Kudoh1 & Charles R. Tyler1 Estrogen plays fundamental roles in a range of developmental processes and exposure to estrogen mimicking chemicals has been associated with various adverse health efects in both wildlife and human populations. Estrogenic chemicals are found commonly as mixtures in the environment and can have additive efects, however risk analysis is typically conducted for single-chemicals with little, or no, consideration given for an animal’s exposure history. Here we developed a transgenic zebrafsh with a photoconvertable fuorophore (Kaede, green to red on UV light exposure) in a skin pigment-free mutant element (ERE)-Kaede-Casper model and applied it to quantify tissue-specifc fuorescence biosensor responses for combinations of estrogen exposures during early life using fuorescence microscopy and image analysis. We identify windows of tissue-specifc sensitivity to ethinylestradiol (EE2) for exposure during early-life (0–5 dpf) and illustrate that exposure to estrogen (EE2) during 0–48 hpf enhances responsiveness (sensitivity) to diferent environmental estrogens (EE2, genistein and bisphenol A) for subsequent exposures during development. Our fndings illustrate the importance of an organism’s stage of development and estrogen exposure history for assessments on, and possible health risks associated with, estrogen exposure. Exposure to endocrine disrupting chemicals (EDCs) is linked with a range of adverse health disorders and further understanding of EDCs efects is crucial for safe-guarding long-term human and environmental health1,2.
    [Show full text]
  • Gene Name Forward Primer Reverse Primer ACTB
    Gene Name Forward Primer Reverse Primer ACTB CTGGAACGGTGAAGGTGACA AAGGGACTTCCTGTAACAATGCA ACVRL1 ACATGAAGAAGGTGGTGTGTGTGG CGGGCAGAGGGGTTTGGGTA ADAMDEC1 GGGGCCAGACTACACTGAAACATT ACCCGTCACAAGTACTGATGCTG AHI1 GTCCAAAACTACCCCATCAAGGCT GCAGCACAGGAACGTATCACCT ANGPT2 TGGCAGCGTTGATTTTCAGAGG GCGAAACAAACTCATTTCCCAGCC ANPEP TGAAGAAGCAGGTCACACCCCT AACTCCGTTGGAGCAGGCGG APOA1 GCCGTGCTCTTCCTGACGG TGGGACACATAGTCTCTGCCGC ATXN7 CACCGCCCACTCTGGAAAAGAA GGGTGCAGGGCTTCTTGGTG B2M TGCTGTCTCCATGTTTGATGTATCT TCTCTGCTCCCCACCTCTAAGT BAG4 AGGTTCCAGGATATCCGCCTT TCGGTCCTGATTGTGGAACACT BCL2 ACAACATCGCCCTGTGGATGA CCGTACAGTTCCACAAAGGCAT BCL2L14 GCTCAGGGTCAAAGGACGTTGG TCAGCTACTCGGTTGGCAATGG BCL7A GAACCATGTCGGGCAGGTCG CCCATTTGTAGATTCGTAGGGATGTGT BIN1 TGCTGTCGTGGTGGAGACCTTC GCCGTGTAGTCGTGCTGGG BIRC3 TGCTATCCACATCAGACAGCCC TCTGAATGGTCTTCTCCAGGTTCA BIRC5 TTCTCAAGGACCACCGCATCT AGTGGATGAAGCCAGCCTCG BLK TCGGGGTCTTCACCATCAAAGC GCGCTCCAGGTTGCGGATGA BTRC CCAAATGTGTCATTACCAACATGGGC GCAGCACATAGTGATTTGGCATCC BUB3 CGGAACATGGGTTACGTGCAGC CCAAATACTCAACTGCCACTCGGC CAGE1 TCCAAAATGCACAGTCTTCTGGCT GGAGGCTCTTCAGTTTTTGCAGC CASP1 CCTGTTCCTGTGATGTGGAGGAAA GCTCTACCATCTGGCTGCTCAA CASP3 AGCGAATCAATGGACTCTGGAATATCC GTTTGCTGCATCGACATCTGTACCA CCL5 TCATTGCTACTGCCCTCTGCG ACTGCTGGGTTGGAGCACTTG CCL18 CCCTCCTTGTCCTCGTCTGCA GCACTGGGGGCTGGTTTCAG CCL26 TTCCAATACAGCCACAAGCCCC GGATGGGTACAGACTTTCTTGCCTC CCND2 TCAAGTGCGTGCAGAAGGACAT CTTCGCACTTCTGTTCCTCACA CCND3 TGGCTGCTGTGATTGCACATGA GATGGCGGGTACATGGCAAAGG CCR3 ACGCTGCTCTGCTTCCTGG TCCTCAGTTCCCCACCATCGC CCR4 AGCATCGTGCTTCCTGAGCAA GGTGTCTGCTATATCCGTGGGGT CCR7 AGACAGGGGTAGTGCGAGGC
    [Show full text]
  • Eomes Transcription Factor Is Required for the Development and Differentiation of Invariant NKT Cells
    ARTICLE https://doi.org/10.1038/s42003-019-0389-3 OPEN Eomes transcription factor is required for the development and differentiation of invariant NKT cells Kanako Shimizu1,3, Yusuke Sato1,3, Masami Kawamura1, Hiroshi Nakazato1, Takashi Watanabe2, 1234567890():,; Osamu Ohara2 & Shin-ichiro Fujii1,2 Eomes regulates the differentiation of CD8+ T cells into effector and memory phases. However, its role in invariant (i)NKT cells remains unknown. Here, we show the impact of Eomes on iNKT cells in the thymus and peripheral tissue using conditional knockout (Eomes- cKO) mice. In the thymus, CD1d-tetramer+CD24+CD44−NK1.1−CD69+stage 0 iNKT cells express higher levels of Eomes than the other iNKT stages. We also found that Eomes regulates NKT1 cell differentiation predominantly. Interestingly, the expression of Eomes in the steady state is low, but can be upregulated after TCR stimulation. We also showed epigenetic changes in the Eomes locus after activation. In addition, vaccination of C57BL/6, but not Eomes-cKO mice with iNKT ligand-loaded dendritic cells generated KLRG1 +iNKT cells in lung, characterized as effector memory phenotype by transcriptome profiling. Thus, Eomes regulates not only the differentiation of NKT1 cells in the thymus, but also their differentiation into memory-like KLRG1+iNKT cells in the periphery. 1 Laboratory for Immunotherapy, RIKEN Center for Integrative Medical Sciences (IMS), Yokohama, Kanagawa 230-0045, Japan. 2 Laboratory for Integrative Genomics, RIKEN Center for Integrative Medical Sciences (IMS), Yokohama, Kanagawa 230-0045, Japan. 3These authors contributed equally: Kanako Shimizu, Yusuke Sato. Correspondence and requests for materials should be addressed to K.S.
    [Show full text]
  • Counteracting CAR T Cell Dysfunction
    Oncogene (2021) 40:421–435 https://doi.org/10.1038/s41388-020-01501-x REVIEW ARTICLE Counteracting CAR T cell dysfunction 1,2 1 1 1 2 Mansour Poorebrahim ● Jeroen Melief ● Yago Pico de Coaña ● Stina L. Wickström ● Angel Cid-Arregui ● Rolf Kiessling 1 Received: 6 May 2020 / Revised: 22 September 2020 / Accepted: 30 September 2020 © The Author(s) 2020. This article is published with open access Abstract In spite of high rates of complete remission following chimeric antigen receptor (CAR) T cell therapy, the efficacy of this approach is limited by generation of dysfunctional CAR T cells in vivo, conceivably induced by immunosuppressive tumor microenvironment (TME) and excessive antigen exposure. Exhaustion and senescence are two critical dysfunctional states that impose a pivotal hurdle for successful CAR T cell therapies. Recently, modified CAR T cells with an “exhaustion- resistant” phenotype have shown superior antitumor functions and prolonged lifespan. In addition, several studies have indicated the feasibility of senescence delay in CAR T cells. Here, we review the latest reports regarding blockade of CAR T cell exhaustion and senescence with a particular focus on the exhaustion-inducing pathways. Subsequently, we describe what potential these latest insights offer for boosting the potency of adoptive cell transfer (ACT) therapies involving CAR T cells. 1234567890();,: 1234567890();,: Furthermore, we discuss how induction of costimulation, cytokine exposure, and TME modulation can impact on CAR T cell efficacy and persistence, while potential safety issues associated with reinvigorated CAR T cells will also be addressed. Introduction persistence in the hostile tumor microenvironment (TME) represent additional key impediments to efficacious CAR T In a recent decade, genetically modified immune cells, parti- cell responses and durable clinical remission following CAR T cularly chimeric antigen receptor (CAR) T cells, have raised cell therapy [4].
    [Show full text]