(CCHFV): Surveillance Studies Among D

University of Veterinary Medicine Hannover

Crimean-Congo hemorrhagic fever orthonairovirus (CCHFV): Surveillance studies among different livestock in sub-Saharan Africa and the molecular characterization of Hyalomma ticks serving as main reservoir and vector

Inaugural-Dissertation to obtain the academic degree Doctor medicinae veterinariae (Dr. med. vet.)

submitted by

Ansgar Schulz Wismar

Hannover 2020

Academic supervision: Prof. Dr. Martin H. Groschup Friedrich-Loeffler-Institut Federal Research Institute for Animal Health Institute of Novel and Emerging Infectious Diseases Greifswald-Insel Riems

1. Referee: Prof. Dr. Martin H. Groschup Friedrich-Loeffler-Institut Federal Research Institute for Animal Health Institute of Novel and Emerging Infectious Diseases Greifswald - Insel Riems

2. Referee: Prof. Dr. Christina Strube Institute of Parasitology University of Veterinary Medicine Hannover Hannover

Day of the oral examination: 16th June 2020 -

Sponsorship: This work was supported by the German Federal Foreign Office in the framework of the German Partnership Program for Excellence in Biological and Health Security.

TABLE OF CONTENTS

1 INTRODUCTION ...... 01

2 LITERATURE REVIEW ...... 04 2.1 History and naming of CCHFV ...... 04 2.2 Classification ...... 04 2.3 Morphology and genome characterization ...... 05 2.3.1 S segment ……………………………………………………………………………….06 2.3.2 M segment ...... 06 2.3.3 L segment ...... 06 2.4 Virus replication ...... 07 2.5 Transmission ...... 08 2.6.1 Hylomma ticks and their special role in CCHFV transmission cycle ……………….08 2.6.2 Tick transmission routes …...... 10 2.6.3 Exposure risks in humans/ direct transmission ...... 11 2.6 Epidemiology ...... 12 2.6.1 Europe ……………………………………………………………………………….….12 2.6.2 Asia ...... 14 2.6.3 Africa ...... 14 2.7 Clinical signs in humans …...... 16 2.8 Pathology ...... 17 2.9 Diagnostic and detection of CCHFV ...... 17 2.10 Prevention and treatment ...... 19

3 MATERIAL AND METHODS ...... 21 3.1 Samples…………………………...... 21 3.2 Serology……...... 21 3.3 DNA/RNA extraction………………………… ...... 22 3.4 Morphological tick species identification…………………...... 22 3.5 Molecular tick species identification………...... 22 3.6 Virus detection and characterization……...... 23 3.7 Statistical analyzes…………………………...... 23 3.8 Literature research…………………………...... 24

4 MANUSCRIPT I: Crimean-Congo hemorrhagic fever orthonairovirus antibodies in Mauritanian livestock (cattle, goats, sheep and camels) is stratified by the animal´s age..……...... 25 4.1 Abstract ...... 25 4.2 Introduction ...... 26 4.3 Materials and methods ...... 27 4.4 Results …...... 30 4.5 Discussion ...... 31 4.6 Conclusion ...... 34 4.7 Tables ...... 34 4.6 Figures ...... 37 4.8 Acknowledgments ...... 37

5 MANUSCRIPT II: Molecular discrimination of Hyalomma tick species serving as reservoirs and vectors for Crimean-Congo hemorrhagic fever virus in sub-Saharan Africa ...... 38

6 MANUSCRIPT III: Detection of Crimean- Congo hemorrhagic fever orthonairovirus (CCHFV) in Hyalomma ticks collected from Mauritanian livestock- more than just a virus indicator?...... 40 6.1 Abstract ...... 40 6.2 Introduction ...... 41 6.3 Materials and methods ...... 42 6.4 Results ...... 44 6.5 Discussion ...... 47 6.6 Tables ...... 50 6.7 Figures ...... 53 6.8 Acknowledgments ...... 54

7 GENERAL DISCUSSION ...... 55 8 SUMMARY ...... 61 9 ZUSAMMENFASSUNG ...... 63 10 BIBLIOGRAPHY ...... 66 11 AUTHORS´ CONTRIBUTION ...... 80

12 ACKNOWLEDGMENTS ...... 82

Manuscripts extracted from the doctorate project:

1.) A. Schulz, Y. Barry, F. Stoek, A. Ba, M.A. Sas, J. Schulz, P. Kirkland, M. Eiden, M.H. Groschup Crimean-Congo hemorrhagic fever orthonairovirus antibody prevalence in Mauritanian livestock (cattle, goats, sheep and camels) are stratified by the animals age; to be submitted

2.) A. Schulz, A. Karger, B. Bettin, A. Eisenbarth, M. A. Sas, C. Silaghi, M. H. Groschup; Molecular discrimination of Hyalomma tick species serving as reservoirs and vectors for Crimean-Congo hemorrhagic fever virus in sub-Saharan Africa, Ticks and Tick-borne Diseases (2020) 101382 (https://doi.org/10.1016/j.ttbdis.2020.101382)

3.) A. Schulz, Y. Barry, F. Stoek, M. J. Pickin, A. Eisenbarth, M. Eiden, M. H. Groschup; Detection of Crimean- Congo hemorrhagic fever orthonairovirus (CCHFV) in Hyalomma ticks collected from Mauritanian livestock- more than just a virus indicator?; to be submitted

Manuscripts excluded from the doctorate project:

K. K. Kasi, F. v. Arnim, A. Schulz, A. Rehman, A. Chudhary, M. Oneeb, M. A. Sas, T. Jamil, P. Maksimov, C. Sauter‐Louis, F. J. Conraths, M. H. Groschup Crimean‐Congo haemorrhagic fever virus in ticks collected from livestock in Balochistan, Pakistan; Transboundary and Emerging Diseases (2020), (https://doi.org/10.1111/tbed.13488)

K. K. Kasi, M. A. Sas, C. Sauter‐Louis, F. v. Arnim, J. M. Gethmann, A. Schulz, K. Wernike, M. H. Groschup, F. J. Conraths Epidemiological investigations of Crimean-Congo haemorrhagic fever virus infection in sheep and goats in Balochistan, Pakistan; Ticks and Tick-borne Diseases (2020) (https://doi.org/10.1016/j.ttbdis.2019.101324)

R. Poueme, F. Stoek, N. Nloga, J. Awah-Ndukum, M. Rissmann, A. Schulz, A. Wade, J. Kouamo, M. Moctar, A. Eisenbarth, L. God-yang, S. Dickmu Seroprevalence and Associated Risk Factors of Rift Valley Fever in Domestic Small Ruminants in the North Region of Cameroon; Veterinary Medicine International (2019), (https://doi.org/10.1155/2019/8149897)

Parts of the results have been presented at conferences:

Junior Scientist Zoonoses Meeting in Hamburg, Germany, 2018: “Crimean-Congo hemorrhagic fever virus – Virus Detection in Ticks in sub-Saharan Africa” (Poster presentation)

National Symposium on Zoonoses Research in Berlin, Germany, 2018: “Molecular discrimination of Hyalomma tick species serving as reservoirs and vectors for Crimean-Congo hemorrhagic fever virus in sub-Saharan Africa” (Poster presentation)

National Medical Biodefence Conference in Munich, Germany, 2018: “Epizootiological investigation of Rift Valley fever virus and Crimean-Congo hemorrhagic fever virus in Mauritania, including regional capacity building” (Poster presentation)

International Symposium on Ticks and Tick-borne Diseases in Weimar, Germany, 2019: “Molecular species discrimination of Hyalomma and other ticks potentially transmitting Crimean-Congo hemorrhagic fever virus in sub-Saharan Africa” (oral presentation)

LIST OF ABBREVATIONS

16s 16s ribosomal RNA 28s 28s ribosomal RNA μg microgram μl microliter A. Amblyomma AGDP agar gel diffusion precipitation arbovirus arthropod-borne virus bp base pair BSA bovine serum albumine BSL biosafety level CCHF Crimean-Congo hemorrhagic fever CCHFV Crimean-Congo hemorrhagic fever orthonairovirus CCS cell culture supernatant CFR case fatality rate CI confidence interval CMR Republic of Cameroon CO1 cytochrome c oxidase 1 cRNA complementary RNA CRO Republic of Croatia DR Congo Democratic Republic of the Congo EBOV Ebola virus ELISA enzyme linked immunosorbent assay ER endoplasmatic reticulum GA genetic algorithm Gc C-terminal glycoprotein GLMN generalized linear mixed-effect model Gn N-terminal glycoprotein GPC glycoprotein precursor G-protein glycoprotein H. Hyalomma

H3 Histone H3 HCCA α-cyano-4-hydroxycinnamic acid HAZV Hazara virus HRP horseradish peroxidase IFA immunofluorescence assay IFN interferon IgG immunoglobulin G IgM immunoglobulin M I. Ixodes IL interleukin ITS II internal transcribed spacer 2 kGy kilo grey km kilometers km2 square kilometers KO knock out KNN k-nearest neighbor L-protein large protein L-segment large segment LC laboratory colony m meter MALDI-TOF MS matrix-assisted laser desorption/ionization time-of-flight mass spectrometer min minute ml milliliter mRNA messenger RNA MRT Islamic Republic of Mauritania MSP main spectra projections M-segment medium segment nm nanometer NSM non-structural M-protein NSS non-structural S-protein N-protein nucleocapsid protein OD optic density OTU ovarian tumour proteases

PBS phosphate buffered saline PCR polymerase chain reaction pmol picomole PreGc Gc precursor protein PreGn Gn precursor protein QC quick classifier R. Rhipicephalus RdRp RNA dependent RNA polymerase RFLP restriction fragment length polymorphism RNA ribonucleic acid qRT-PCR quantitative reverse transcription polymerase chain reaction SD standard deviation SNN supervised neural network ss(-)RNA single stranded RNA of negative polarity S-segment small segment STAT signal transducer and activator of transcription SVM support vector machine TCS tissue culture supernatant TNF tumor necrosis factor vRNA viral RNA V Volt

LIST OF TABLES

Table 2.1: Overview of available commercial diagnostic test ...………………………19

Table 4.1: Immunization results of the alpaca ...…………………………………………34

Table 4.2: Results of seroepidemiogical studies in cattle, goats, sheep and camels in Mauritania ..…………………………………………………………………………………35

Table 4.3: Age-related prevalence of IgG-specific CCHFV antibodies in cattle, goats, sheep and camels ..………………………………………………………………………..36

Table 4.4: Results of the generalized linear mixed-effects model (GLMM) for age (a) and species (b) ……………………………………………………………………………..36

Table 6.1: Overview showing results across all four sampled herds, including the number of specimens of different species and CCHFV-positive ticks ………………..68

Table 6.2: Sex distribution of sampled ticks at the different collection sites and correlation between sex and CCHFV ...…………………………………………………..69

Table 6.3: All sampled animals on which CCHF-positive ticks were found (6 out of 91), including weak-positive tested ticks on those individuals and the species of the most positive sample ………………………………………………………………………….....70

Table 6.4: Genetic distances (%) between the CCHFV lineages found in the respective positive ticks on cattle and camels by comparing the qRT-PCR amplicons ………...70

LIST OF FIGURES

Figure 2.1: Classification and phylogeny of CCHFV ……………………………………..5

Figure 2.2: Intracellular replication of CCHFV ..…………………………………………..8

Figure 2.3: Two male Hyalomma specimens: H. marginatum (A) collected in Croatia and H. rufipes (B) collected in Cameroon ...……………………………………………….9

Figure 2.4: Life cycle of Hyalomma ssp. ticks and vertical and horizontal transmission ..……………………………………………………………………………....11

Figure 4.1: Effects of age (a) and species (b) regarding CCHFV IgG antibody status in different livestock species in Mauritania ..……………………………………………..37

Figure 6.1: Phylogenetic tree showing the genetic relationships of the small (S) segment of the protypic strains and selected CCHFV-positive samples from Mauritania (1384 bp) ……………………………………………………………………………………71

1 INTRODUCTION

Crimean-Congo hemorrhagic fever orthonairovirus (CCFHV) is one of the most widespread arthropod-borne zoonotic viruses and is distributed throughout most of the African continent, South / Southeast Europe and Asia (Bente et al., 2013). It belongs to the family of Nairoviridae and the genus of Orthonairoviruses. Ticks of the genus Hyalomma are considered to be the main vector and reservoir for the virus (Gargili et al., 2017). Besides the bite of ticks, CCHFV can also be transmitted directly through contact with infectious tissues or body fluids of humans or animals. Infected humans can develop an Ebola-like disease characterized by severe hemorrhagic fever, massive bleedings and shock syndrome. However, human outbreaks occur mainly as sporadic individual cases and epidemics are only rarely seen (Bente et al., 2013; Ergonul, 2008). In addition, a great number of domesticated and wild mammal species are known to be susceptible to the virus, but in contrast, they develop only a short-term viremia without clinical symptoms following infection (Spengler et al., 2016a; Spengler et al., 2016b). The virus therefore occurs predominantly in rural areas and people working in close contact with livestock represent a high-risk group, but the absence of clinical manifestations in animals makes it difficult to assess potential risk areas. A first indication of CCHFV presence in certain areas can be derived from the detection of specific antibodies in different host animals (Spengler et al., 2016a). With few exceptions, especially the African countries are under-studied in terms of CCHFV epidemiology. Therefore, the main goal of this work presented here was to gain insights into the virus ecology as well as the interaction between susceptible livestock and vectors in a selected African country. Moreover, the information and data obtained should help to shed light on the obscure epidemiological situation. Although the first human case in Mauritania (West Africa) already occurred in 1983 (Saluzzo et al., 1985a) and further outbreaks have been confirmed over the years (Gonzalez et al., 1990; Kleib et al., 2016; Nabeth et al., 2004a), only a small number of studies on CCHFV in this country have been carried out to date. Interestingly, previous seroepidemiological surveys in livestock revealed a large difference between the prevalence in cattle (67 %) and sheep (18 %) in Mauritania (Gonzalez et al., 1990; Sas et al., 2017a). For this reason, the objective of the first manuscript was to investigate potential reasons for the big difference in IgG seroprevalence between large and small ruminants based on new serological data. Hence, sera from the most

important Mauritanian livestock (cattle, camels, sheep and goats) were examined for CCHFV-specific IgG antibodies to assess if a certain species bear a particular risk for spreading the virus. The study should also provide an updated overview on the antibody prevalence in Mauritania. However, whether the virus actually circulates in a certain region can only be confirmed by the direct detection of viral RNA. As susceptible host species only develop a short-lasting viremia, the screening of the main reservoir (Hyalomma ticks) represents the most promising approach for the evidence of CCHFV. Within the past, more emphasis was laid on the detection of viral RNA in the ticks rather than correct species identification. This led to the current situation of several doubtful uploaded gene sequences of ticks in GenBank and partly controversial reports claiming the detection of CCHFV among different tick species (Estrada-Pena et al., 2013; Gargili et al., 2017; Zhang and Zhang, 2014). The correct vector species identification became an essential task to avoid false conclusions regarding positive ticks and their species (Gargili et al., 2017). Therefore, the second manuscript was concerned with different molecular methods for the determination of Hyalomma species, to ensure a reliable and precise discrimination of collected ticks. For this purpose, different approaches including `restriction fragment length polymorphism´(RFLP), `cytochrome oxidase 1-analysis´ (CO1 sequencing) and mass spectrometry (MALDI-TOF MS) for molecular tick identification were established. During the last decades, it became apparent that MALDI-TOF MS provides a reliable discrimination tool for various arthropod species (Hoppenheit et al., 2013; Karger et al., 2012; Kaufmann et al., 2012; Schaffner et al., 2014). A MALDI-TOF MS database of spectra from six different Hyalomma species was generated for a molecular phenotyping of these ticks. To obtain a broader range of the data set, other tick genera were added serving as outgroups. In addition, primers for the CO1 gene segment of Hyalomma ticks were selected to allow a differentiation by DNA barcoding. However, sequencing facilities or costly MALDI-TOF equipment may not always be available, especially when ticks have to be identified directly on-site following field collections e.g. in developing countries. Therefore, two different restriction enzymes were used to digest the CO1 amplicon and distinguish the most common Hyalomma species (RFLP) which were expected within our field samplings in Mauritania by their characteristic gel pattern. These newly established methodologies should form the basis for the third manuscript, which comprises the detection of CCHFV in Hyalomma ticks collected from Mauritanian livestock. Apart from investigating the virus prevalence, one of the

main objectives was to examine a large number of Hyalomma ticks while ensuring the most accurate species identification possible in order to obtain more information to explain potential differences in CCHFV prevalence that may occur between the Hyalomma species. Until today it is not clarified whether all Hyalomma species currently known share the same CCHFV vector competence. This may be one of the contributing factors explaining the variation in CCHFV prevalence and number of human cases among different endemic areas.

2 LITERATURE REVIEW

2.1 History and naming of CCHFV

CCHFV was not scientifically described until the mid-20th century, most likely because severe courses of the disease in humans are only sporadic and many infected patients developed merely mild and non-specific symptoms (Bente et al., 2013). In the 12th century there were already reports of a severe hemorrhagic disease in Central Asia which were apparently connected to tick bites (Hoogstraal, 1979). The first documented outbreak in modern times was in 1944, when Soviet troops re-conquered the Crimean Peninsula territory, which was previously occupied by the German army. After the end of the fighting 200 Russian soldiers and farmers tried to restore abandoned agricultural land and suffered from hemorrhagic shock syndrome with a 10 % fatality rate after being bitten by a large number of ticks (Chumakov, 1965; Grashchenkov, 1945; Hoogstraal, 1979). In 1967, Chumakov succeeded in isolating the virus from newborn mice that previously died after they were infected with the virus originating from CCHF patients and he named the virus “Crimean hemorrhagic fever” virus (CHF). 1969 was a turning point in the history of the virus, when Casals (1969) proved that CHF was not distinguishable from the “Congo virus”, which was isolated from a boy in the Belgian Congo (present Democratic republic of Congo, DRC) in 1956. It demonstrated that the virus occurred not only in Europe and Asia, but also in Africa. Thereupon it was suggested to rename the virus “CHF- Congo virus” (Casals et al., 1970) which later turned into CCHFV, the name commonly used today.

2.2 Classification

CCHFV in the order of Bunyavirales belongs to the family of Nairoviridae and the genus of Orthonairovirus (ICTV, 2020). Therefore, the correct name is actually “Crimean- Congo hemorrhagic fever orthonairovirus”, which is rarely used in common scientific practice and is thus often simplified as “Crimean-Congo hemorrhagic fever virus” (Figure 2.1). Orthonairoviruses are tick-borne viruses, which are divided into different serogroups and characterized by a large L segment (Bente et al., 2013). The unusually large size of the L-segment distinguishes them from other bunyaviruses. Together with the Hazaravirus, which is non-pathogenic for humans and has been isolated from

rodents in Pakistan (Begum et al., 1970; Dowall et al., 2012), it makes up the CCHF serogroup.

Figure 2.1 Classification and phylogeny of CCHFV

2.3 Morphology and genome characterization

The CCHFV virion is spherical (diameter: 80-100 nm) and its lipid envelope is coated with Gn and Gc glycoproteins, which play an important role for the virion-host cell interactions (Bente et al., 2013). The ss (-) RNA genome of each virus particle is divided into three segments. The open reading frames (ORF) of each three segments are flanked with the same complementary non-coding endings (5’-UCUCAAAGA and 3’-AGAGUUUCU), which form a panhandle structure through base pairing. This structure is conserved within all other viruses of the genus (Clerex-Van Haaster et al., 1982; Elliott et al., 1991; Raju and Kolakofsky, 1989).

2.3.1 S segment

The S segment is the smallest of the three segments and encodes the nucleoprotein (NP). The NP plays an important role in RNA encapsulation and interacts with the large protein (L protein) to form ribonucleoprotein complexes. Therefore, it is essential for viral replication (Levingston Macleod et al., 2015). In addition, it has been described that the S segment also encodes the non-structural protein (NSs) in opposite orientation, which might have an apoptotic function (Barnwal et al., 2016). Comparing the S segments of different CCHFV isolates at the nucleotide level revealed a diversity of up to 20% (Deyde et al., 2006).

2.3.2 M segment

The medium segment contains the genetic information for a polyprotein, which is cotranslationally cleaved into the two type 1 transmembrane glycoproteins and post- translationally proceeded into Gn and Gc. This process starts at the endoplasmic reticulum (ER) and is concluded in the Golgi body (Altamura et al., 2007; Bertolotti- Ciarlet et al., 2005). The glycoproteins play an important role for the attachment to the host cell and are mainly responsible for stimulating the production of neutralizing antibodies in the host organism (Whitehouse, 2004). Thus, the correct glycoprotein synthesis regulates the expression of infectious particles (Bergeron et al., 2007). The M segment exhibits the highest genetic variability among all three segments with up to 31 % difference. Selection pressure induced by the necessity to adapt to a broad range of ticks and host species in different environmental zones and the host's immune system is most likely responsible for this genetic diversity (Deyde et al., 2006; Gargili et al., 2017).

2.3.3 L segment

The L segment of CCHFV and other orthonairoviruses is characterized by its large size. The ORF measures over 12,000 nucleotides in length and encodes a 4,000- amino acid polyprotein, including domains for the RNA-dependent RNA polymerase (RdRp) and an ovarian tumor protease (Honig et al., 2004; Kinsella et al., 2004). While RdRp catalyzes the replication of RNA from an RNA template and is therefore essential

for viral replication, there is only limited knowledge about the function of the OTU (Honig et al., 2004). Moreover, it was demonstrated that OTU has no significant influence on virus replication in the host cell at all (Bergeron et al., 2010). A strain-wise genetic diversity of up to 22% can also be found among the L-segment (Deyde et al., 2006).

2.4 Virus replication

Although the replication cycle of CCHFV has not yet been entirely resolved in all its details, critical points in terms of host-cell interactions have been uncovered over the last few years (Bente et al., 2013). Figure 2.2 from Bente et al. (2013) shows a scheme of virus replication in a cell. The study of Xiao et al. (2011) leads to the assumption that in particular Gc has a key function in binding to host cells, while the specific cellular receptor is still unknown. However, the entry into the cell apparently occurs through a clathrin-dependent endocytosis (Simon et al., 2009). Further major factors influencing cell entry are the host molecule nucleolin (Xiao et al., 2011), cholesterol and a low pH value (Garrison et al., 2013; Simon et al., 2009). After entering the host cell, the ss (-) RNA genome from CCHFV is transcribed into a positive-strand intermediate by the viral RdRp (Bente et al., 2013). The synthesis of glycoproteins is a very complex process. First, the precursor proteins PreGn and PreGc are synthesized in the ER (Altamura et al., 2007) and subsequently transported as heterodimers to the Golgi body

(Shi et al., 2010). Here in the organelle, PreGn and PreGc are further cleaved, folded, O-glycosylated and assembled into the new virion (Shi et al., 2010). After the budding of the virus particle at the Golgi apparatus, the virion exits the host cell through exocytosis.

Figure 2.2 Intracellular replication cycle of CCHFV

Virions bind to cell surface receptors (A), and are internalised through clathrin-dependent,

receptor-mediated endocytosis (B). Reduced pH

in the endosome leads to a conformational change in the viral glycoproteins resulting in fusion between the envelope and endosomal membranes, allowing the nucleocapsids to be released into the cytosol (C). After dissociation of the nucleocapsids (D), messenger RNA (mRNA) and complementary RNA (cRNA) are generated

by the RNA-dependent RNA-polymerase

(RdRp). The mRNA is translated into viral

proteins, while the cRNA is used as a template for genomic vRNA production (E). The vRNA, RdRp and capsid proteins associate to form new nucleocapsids. Glycoprotein translation occurs in the endoplasmic reticulum (F), where the precursor protein is cleaved into GN and GC precursor forms. The glycoproteins are

transported to the Golgi complex (G), where

further processing takes places (H). New virions

are formed (I) once final glycoprotein maturation has taken place, and are transported to the plasma membrane and released (J). (Bente et al., 2013)

2.5 Transmission

2.5.1 Hylomma ticks and their special role in the CCHFV transmission cycle

Hard ticks (Ixodidae) are considered to be the main vector of CCHFV. However, it has been postulated that ticks of the genus Hyalomma are most vector competent, since the CCHFV distribution overlaps exactly with the occurrence of these ticks (Gargili et al., 2017). Currently, 27 different Hyalomma species have been described (Sands et al., 2017), although it is not clear whether all of them are independent species or rather a morphological variation. It is also unknown whether all Hyalomma species represent

a reservoir and vector or if there are interspecific differences in vector competence. While Palearctic ticks such as H. marginatum (Fig. 2.3 A) are considered to be the principle vector in Europe, Afrotropical H. rufipes ticks (Fig. 2.3 B) are most responsible for virus transmission in Africa (Bente et al., 2013). Hyalomma species prefer low humidity and their distribution area covers almost the entire African continent, South / Southeast Europe and Asia as far as India and China (Estrada-Pena and de la Fuente, 2014; Gargili et al., 2017). They are predominantly 2- or 3-host ticks, but there are also exceptions such as H. scupense, which are known to have a 1-host cycle (Apanaskevich et al., 2010). In general, members of the genus Hyalomma are considered to be large-sized ticks and most species are characterized by a more or less distinctive pale ring pattern on their legs. Hyalomma ticks have large, albeit simply organized paired eyes (Bergermann et al., 1997) which enable them to perceive simple visual stimuli such as light/dark, size or shape (Kopp and Gothe, 1995). These abilities also support their unusual "hunting behavior", making them markedly different from ticks of other genera. Instead of waiting for passing victims, they can chase potential hosts actively over a distance of several hundred meters (Hoogstraal, 1979). Adult stages often feed on a wide range of domesticated and wild ungulates including camelids, while larvae and nymphs prefer small mammals, birds or reptiles (Estrada- Pena and de la Fuente, 2014; Spengler and Estrada-Pena, 2018).

A B

Figure 2.3 Two male Hyalomma specimens- H. marginatum (A) collected in Croatia and H. rufipes (B) collected in Cameroon

2.5.2 Tick transmission routes

The transmission cycle of CCHFV is shown in Figure 2.4. The virus is transmitted vertically between the individual stages of vector competent ticks, which are defined by their ability to receive, maintain and transmit the virus to their eggs, larvae, nymphs or adult stages (Bente et al., 2013). However, there is only limited knowledge of how frequently the virus is transmitted vertically into the next generation respectively the percentage of positive eggs laid by infected females (Gargili et al., 2017). On the other hand, ticks can become horizontally infected while feeding on viremic hosts or through the co-feeding effect (Jones et al., 1997; Logan et al., 1990). Ticks are so-called “pool feeders”. In other words, they form a blood-filled lacuna in the dermis of the host by means of their mouthparts and the effect of cytolytic enzymes. If infected and non- infected ticks are simultaneously infested, the infected ticks can infect the non-infected ticks via common or closely neighboring pools. This effect can even occur in non- susceptible host animals. Many livestock (such as cattle, sheep, goats or equids) as well as wild life, especially small mammals (such as hares or hedgehogs), are considered to be susceptible and develop a short-term viremia lasting approximately one week (Spengler et al., 2016a; Spengler et al., 2016b). After the vector competent tick has ingested a CCHFV-positive blood meal, the virus enters the organs and tissues via the midgut barrier, whereby the highest titers are usually found in salivary glands (Dickson and Turell, 1992). Although developing viremia, infected animals do not show clinical signs, which makes it difficult to identify CCHFV risk areas. Besides ostriches (Swanepoel et al., 1998), birds do not develop viremia. However, migratory birds play an important role, as they are capable of carrying attached larvae or nymphs over very long distances and thus contribute to the spread of ticks or the virus (Gargili et al., 2017).

Figure 2.4 Life cycle of Hyalomma spp. ticks and vertical and horizontal transmission of CCHFV. The course of the tick life cycle is indicated with blue arrows. Upon hatching, larvae find a small animal host for their first blood meal (hematophagy). Depending on the tick species, the larvae either remain attached to their host following engorgement and molt in place (two-host ticks) or fall off and molt (three-host ticks); this transition

is marked by an asterisk. The nymphs then either continue to feed on the animal on which they molted (two-host ticks) or attach to a new small animal (three-host ticks). Upon engorgement, nymphs of all species drop off their host andmolt into adults. Adult ticks then find a large animal for hematophagy, and mate while attached to the host. After taking a blood meal, the engorged females drop off and find a suitable location for ovipositing. During the tick life cycle, there are a number of opportunities for virus transmission between ticks and mammals (solid

red arrows) and directly between ticks, through co-feeding (dashed arrows). For each form of virus transfer, the thickness of the red arrow indicates the efficiency of transmission. Infection of humans can occur through the bite of an infected tick or through exposure to the body fluids of a viremic animal or CCHF patient. (Bente et al., 2013)

2.5.3 Exposure risks for humans/ direct transmission

In fact, humans are considered to be accidental or dead-end hosts for CCHFV. The most frequent way for humans to be infected is through the bite of a CCHFV-positive tick. People who work in close contact with animals (such as farmers, abattoir workers, rangers or veterinarians) represent a high-risk group. Furthermore, the stay in rural areas in times of increased tick activity can also be a predisposing factor (Gunes et al., 2011). The virus can also be transmitted to humans through direct contact with infected tissue, blood or other body fluids. CCHFV outbreaks are often reported after abattoir

workers have been infected during the slaughter of viremic animals (Fazlalipour et al., 2016; Thomas et al., 2019). Besides direct transmission from animal to human, nosocomial infections also play an important role in endemic countries. Hospital staff members, such as nurses or doctors who have unprotected contact (e.g. not using gloves) with CCHF patients are particularly exposed (Ergonul et al., 2007).

2.6 Epidemiology

CCHFV is one of the most widespread arthropod-borne zoonosis worldwide. Although knowledge of its overall distribution has been limited for many years since it was first recognized in 1944, it has now been confirmed that the virus is endemic in large parts of Africa, Europe and Asia. In the past, the WHO defined a region or state as endemic for CCHFV when reports of positive serological or PCR findings (in humans, ticks, animals) were available in these countries (Spengler et al., 2019). As mentioned before, the distribution of the virus is very closely associated with the occurrence of Hyalomma ticks, which are considered the main vector and reservoir. So far, there has been no autochthonous human CCHFV case in a region where Hyalomma ticks are not endemic (Hoogstraal, 1979; Spengler et al., 2016a). The most northern boundary of CCHFV respectively Hyalomma ticks is currently at the 50th parallel north (WHO, 2017), but there is a tendency to expand further northwards (WHO, 2013: 46th parallel north). Recent reports of increased occurrence of Hyalomma ticks in regions previously considered free of this important CCHFV vector have received widespread public attention, such as in Germany (Chitimia-Dobler et al., 2016; Chitimia-Dobler et al., 2019b), Malta (Hornok et al., 2020), France (Grech-Angelini et al., 2016; Vial et al., 2016), Hungary (Hornok and Horvath, 2012) or Sweden (Grandi et al., 2020). However, the spread of Hyalomma ticks and thus an increasing risk of CCHFV introduction into northern Europe may have been driven by warmer winters and drier summers recorded over the last decades (Estrada-Pena et al., 2012a). Further potential risk factors promoting the spread of CCHFV are introduction through infected humans, ticks and animal movements (Spengler et al., 2019).

2.6.1 Europe

In Europe, CCHFV is predominantly endemic in the former territory of the Soviet Union and the Balkans or Southeastern Europe. Since the collapse of the Soviet Union, the 12

number of CCHFV cases in Russia has increased significantly (Bente et al., 2013). Between 2002 and 2008, there were over 1000 reported human cases with a mortality rate of 3.2% (Leblebicioglu, 2010). Furthermore, the Balkans and Southeast Europe are also considered to be endemic areas. In Bulgaria more than 1500 cases were counted between 1953 and 2008 (Papa et al., 2004), which is also coincident with seropositive livestock and 2 % CCHFV positive ticks (Gergova et al., 2012). CCHFV- specific antibodies in farm animals (10-20 %) as well as sporadic CCHFV infections in humans were also found in Kosovo, Macedonia and Albania (Duh et al., 2008; Mertens et al., 2015; Papa et al., 2002a; Papa et al., 2002b; Papa et al., 2017). Greece plays a special role in South-Eastern Europe. Although surrounded by endemic countries with large numbers of human cases, no CCHFV infections have been detected for a long time. This might be associated with the AP92 virus strain, which was isolated from Rhipicephalus bursa ticks collected from goats in Greece in 1975 (Papadopoulos, 1980). AP92 is genetically very different compared to other CCHFV isolates and seems to cause only mild or no clinical symptoms in humans (Midilli et al., 2009). The first human case in Greece was reported in 2008 and the isolated strain was more closely related to the Balkan isolates rather than to AP92 (Papa et al., 2010). The latest case was reported in 2018, when a Greek construction worker became ill with CCHFV after his return from Bulgaria (Papa et al., 2018). Besides the Balkans, there is only limited evidence of CCHFV in the rest of Europe. Filipe et al. (1985) found in humans CCHFV antibodies in Portugal and Estrada-Pena et al. (2012b) isolated CCHFV RNA in H. lusitanicum collected from Spanish wild deer. Therefore, the first autochthonous human case of CCHFV 2016 in Spain with fatal outcome (Negredo et al., 2017) was an important milestone in terms of raising awareness of emerging diseases like CCHFV in (Western) Europe. Bente et al. (2013) described the epidemiological situation in Turkey (which acts as a link between Europe and Asia) as extraordinary. While the first CCHFV case was only described in 2002 (Karti et al., 2004), more than 5000 cases were confirmed within 7 years until 2009 with a fatality rate of 5 % (Bente et al., 2013; Ozkaya et al., 2010). Furthermore, the high antibody prevalence of up to 12.8 % in high-risk groups (Gunes et al., 2009) and virus detection in up to 20 % of ticks underline the high-endemic status of the country (Gunes et al., 2011). A well- developed health care system combined with increased awareness among doctors and the public is probably one reason for the extremely high number of cases with a comparatively low lethality rate. Interestingly, an AP92-like strain was isolated from a

patient who showed only mild clinical symptoms during a CCHFV infection (Midilli et al., 2009), whereas normally strains of the viral clades Europe 1 and Europe 2 were found in Turkey.

2.6.2 Asia

The first CCHFV isolation in Asia was made in Pakistan in the 1960s (Begum et al., 1970), although the first human case was reported in 1965 in China (Yen et al., 1985). Over time, Pakistan has turned into a high-risk area with a large number of annual human cases (Atif et al., 2017) including high prevalences found in livestock and ticks (Kasi et al., 2020a; Kasi et al., 2020b). In contrast, CCHFV was described in India comparatively late in 2011 during a nosocomial outbreak (Mishra et al., 2011). Further seroprevalence studies and RNA detection in ticks supported the presence of CCHF in India (Mourya et al., 2012). In the Middle East, CCFHV was first reported in Iran in the 1970s by specific antibodies in humans, cattle and sheep (Saidi et al., 1975). After a long period of sporadic studies, a national CCHFV surveillance program was established in 1999. Between 2000 and 2009, there were 635 confirmed human cases, of which 89 had a fatal outcome (Chinikar et al., 2010). In neighboring Afghanistan, the National Surveillance System reported 1,284 human CCHF cases from 2007 to 2018. Due to the Gulf wars and political unrest, the data available in Iraq is rather sketchy (Bente et al., 2013). Nevertheless, several human cases could be confirmed in recent times (Majeed et al., 2012). The first CCHFV case on the Arabian Peninsula was reported in a hospital in Dubai (1979), when a CCHF patient infected several hospital staff members (Suleiman et al., 1980). In the mid-1990s, further human cases were confirmed in the United Arab Emirates including the detection of CCHFV antibodies in slaughterhouse workers and livestock (Khan et al., 1997; Schwarz et al., 1997). Around the same time, human cases were also reported in Oman and the circulation of the virus was demonstrated by surveillance studies in farm animals and ticks (Scrimgeour, 1996; Williams et al., 2000).

2.6.3 Africa

Although CCHFV was first isolated in Africa in 1956 in Belgian Congo as "Congo virus", there is still limited knowledge about the individual African countries. Until today, only few further studies have been carried out on CCHFV in the present territories of the 14

Democratic Republic of Congo and the Republic of Congo. They revealed low seroprevalence in livestock (Sas et al., 2017b) and the isolation of a strain almost identical to the first strain discovered in 1956 in the Congo (Grard et al., 2011). By far the most studies about CCHFV in Africa were conducted in South Africa. The first case in the country was reported in 1981 when a boy bitten by a Hyalomma tick died of severe hemorrhagic fever (Gear et al., 1982). Until 1989, Swanepoel et al. (1989) succeeded in tracking and confirming up to 50 further human CCHF cases in South African hospitals (Bente et al., 2013). Large-scale seroprevalence studies in numerous wildlife species (Shepherd et al., 1987) as well as livestock (Swanepoel et al., 1985) also demonstrated widespread virus circulation across the country. Another remarkable aspect is the finding that ostriches are the only bird species that can develop CCHFV viremia, which was proven by animal infections trials (Swanepoel et al., 1998). The study was conducted after staff members of an ostrich abattoir in South Africa became ill with CCHF after slaughtering the birds (Swanepoel et al., 1998; van Eeden et al., 1985). On the other hand, many data from other African countries have become outdated and only within the last two decades more studies have been conducted to survey the epidemiological CCHFV situation in Africa. However, it can be assumed that the virus occurs almost across the entire continent. There are no human case reports of CCHFV known among the North African countries Morocco, Algeria, Libya, Tunisia and Egypt. The isolation of an AP92-like CCHFV strain from a H. aegyptium in Algeria may indicate that predominantly less human pathogenic isolates circulate in this region (Kautman et al., 2016). In contrast, human CCHFV cases have been frequently reported in Mauritania (Gonzalez et al., 1990; Nabeth et al., 2004a; Saluzzo et al., 1985a) and Senegal (Nabeth et al., 2004b; Tall et al., 2009). The virus circulation was also confirmed by studies that showed a high antibody prevalence in different livestock (Gonzalez et al., 1990; Nabeth et al., 2004a; Nabeth et al., 2004b; Sas et al., 2017a; Wilson et al., 1990). The first human outbreak of CCHFV in Mali recently occurred in February 2020 (not published yet). Previously, there was only data available in Mali on the detection of antibodies in cattle (Maiga et al., 2017) and viral RNA isolation from ticks (Zivcec et al., 2014). Only little is known about the current situation in Niger (Mariner et al., 1995) and Chad (Gonzalez et al., 1989). In Sudan, several human CCHF outbreaks have been confirmed so far (Bower et al., 2019). Furthermore, antibodies were detected in different livestock (Ibrahim et al., 2015; Suliman et al., 2017) and viral RNA was isolated from Hyalomma ticks

(Chitimia-Dobler et al., 2019a). The first description of CCHFV in Nigeria was made in 1964 and within the following years the present-day reference strain Ibar10200 was isolated from H. excavatum ticks (Causey et al., 1970). There have recently been several humans outbreaks of CCHFV in Uganda, East Africa (Balinandi et al., 2018; Kizito et al., 2018) and the first human case in Kenya was reported in 2002 (Dunster et al., 2002), followed by virus detection in Hyalomma ticks in 2011 (Sang et al., 2011). Although the data from Ethiopia and Tanzania is very outdated, they prove the presence of CCHFV (Hoogstraal, 1979; Wood et al., 1978). In summary, knowledge on CCHFV in Africa is still very patchy and there is plenty research potential in the countries listed above, as well as those not mentioned.

2.7 Clinical signs in humans

In contrast to susceptible animals, humans can develop severe hemorrhagic symptoms with a partially high mortality rate during a CCHFV infection. The clinical course of the disease includes four phases: incubation, pre-hemorrhagic, hemorrhagic and convalescent (Hoogstraal, 1979). Thereby, the incubation time appears to depend on how the patient has been infected (Hoogstraal, 1979). While the first symptoms occur already 1-5 days after a tick bite, it can take 5-7 days following first contact with infected tissue/blood (Ergonul, 2006; Ergonul et al., 2006b). The second phase (prehemorrhagic) with its very unspecific symptoms (e.g.: fever, muscle pain, nausea) is barely distinguishable from a general infectious disease. This often leads to CCHF not being diagnosed or mistaken with other diseases. The hemorrhagic phase (day 3- 5 of the disease) is characterized by initial petechiae on the skin and mucous membranes, which can turn into extensive, severe skin bleedings. Furthermore, bleedings can also occur in the gastrointestinal and urinary tract, as well as hepato- and splenomegaly (Swanepoel et al., 1989). Death usually occurs between days 5 and 14 due to shock, bleeding and multiple organ failure (Bente et al., 2013). In the worst case, the time of convalescence of recovered patients can last up to one year until they are completely free of symptoms (Ergonul, 2006). During the past, information on the case fatality rates (CFR) varied widely from 5% in Turkey (Ergonul, 2006) to 80% in China (Yen et al., 1985). Small, sporadic outbreaks and the fact that a majority of endemic countries only have a deficient health care system complicates a correct assessment of the CFR. Different circulating virus strains, the lack of awareness and

effective protection measures may also influence the CFR. Moreover, there is probably a high rate of unrecognized cases in patients who have only mild clinical symptoms and thus are not diagnosed (Bente et al., 2013).

2.8 Pathology

Until now, there is only one evidence that CCHFV can directly infect the endothelium, based on viral antigen found in the endothelium during an autopsy (Burt et al., 1997). Nevertheless, detection of the virus at this stage does not imply that the virus was able to infect the endothelium directly and caused an increased vascular permeability. In any case, it starts soon after the disease onset (Bente et al., 2013). In contrast, more is known about the pro-inflammatory cytokine response during a CCHFV infection. The study of Connolly-Andersen et al. (2009) demonstrated that the virus replicates in human monocyte dendritic cells, which can cause an increased release of proinflammatory cytokines. This also correlates with findings of elevated serum levels of IL-6, IL-10, TNF-α and IFN-γ in CCHF patients (Ergonul et al., 2006a; Papa et al., 2006; Saksida et al., 2010). The fact that STAT1-KO mice also develop elevated levels of IL- 6, IL-10, TNF-α and IFN-γ after CCHFV infection, as well as the susceptibility of IFN- KO mice, supports the clinical observations (Bereczky et al., 2010). Based on these findings, CCHFV appears to be causing similar pathological effects in humans as the Ebola virus (EBOV), which also induces proinflammatory cytokines and intrinsic coagulation/ platelet aggregation leading to vascular dysfunctions (Mahanty and Bray, 2004; Schnittler and Feldmann, 2003). Simon et al. (2006) showed also that the mediator nitric oxide (NO) suppresses the viral replication of CCHFV. Furthermore, higher concentrations of natural killer (NK) and cytotoxic T cells were observed in severe cases compared to mild disease courses (Akinci et al., 2009; Yilmaz et al., 2008). The absence of IgM and IgG antibodies in patients with fatal disease progressions might indicate a loss of lymphocytes due to apoptosis, but this has not yet been proven (Bente et al., 2013).

2.9 Diagnostic and detection of CCHFV

Within the first years after its discovery, CCHFV was usually detected by virus isolation, inoculation in newborn mice, hemagglutinin inhibition, AGDP or complement fixations test. Especially the former gold standard of virus isolation and inoculation in newborn 17

mice involved handling a non-inactivated BSL-4 pathogen and was therefore a delicate procedure (Bente et al., 2013). Today, the gold standard in humans and animals are RT-PCR and the detection of IgG /IgM antibodies, which represent much more sensitive, safer and quicker diagnostic tools. IgM antibodies against CCHFV can be detected in sera of patients about one week after infection and IgG shortly after (Shepherd et al., 1989). While IgM remains in serum only for a few months, IgG antibodies can be detected for years (Yadav et al., 2019). For antibody detection, either enzyme-linked immunosorbent assays (ELISA) or immunofluorescence assays (IFA) are used. Since CCHF patients with severe symptoms may not develop any antibody response, the RT- PCR is considered to be more reliable. The main issue for a PCR is the high genetic diversity of CCHFV (Deyde et al., 2006), which makes it more difficult for a single test to cover all strains. Especially the highly divergent strain AP92 was challenging for the development of a CCFHV Pan-strain PCR (Duh et al., 2006; Garrison et al., 2007; Wolfel et al., 2007). The PCR assay of Atkinson et al. (2012) was the first to be capable of detecting all seven described virus clades using a highly conserved 5´ non-coding region of the S segment as the target region. In contrast, approach of Sas et al. (2018) was the first one-step multiplex RT-qPCR, which was able to detect all known CCHFV strains by using clade-specific primer sets. An overview of all currently available commercial tests is given in Table 2.1.

Table 2.1 Overview of available commercial diagnostic test

Assay Target species Company

VectorBest (Russia), BDSL (Scotland), Gentaur* (Belgium), NovaTec Immundiagnostica* Human (Germany), Alpha Diagnostic* IgM ELISA (USA, TX), Creative Diagnostics* (USA, NY)

Mouse Alpha Diagnostic* (USA, TX)

VectorBest (Russia), Gentaur* (Belgium), NovaTec Human Immundiagnostica* (Germany), Alpha Diagnostic* (USA, TX), Creative Diagnostics* (USA, NY) IgG ELISA

Bovine, rabbit, mouse Alpha Diagnostic* (USA, TX)

Multi-species IDvet (France)

IgM IFA Human Euroimmun (Germany)

IgG IFA Human Euroimmun (Germany)

Antigen capture ELISA Virus VectorBest (Russia)

Altona Diagnostics (Germany), RT-qPCR Virus Liferiver Bio-Tech (USA, CA), Gentaur* (Belgium)

(Adapted by Sas et al, https://nbn-resolving.org/urn:nbn:de:gbv:95-110132) *non-validated assay and for research purposes only

2.10 Prevention and treatment

In general, preventive measures against CCHFV have a high priority in controlling and managing human outbreaks. Avoiding tick bites during out-door activities in endemic regions by using repellents and wearing long-sleeved clothes reduces the risk of infection immensely. Epidemiological studies in risk areas can also raise public awareness and thus sensitize the local public. Whenever there is a risk of exposure, at least gloves, protective eyewear and scrubs should be worn, e.g. while handling tissue or body fluids from potential infected humans or animals. However, working with non-inactivated viruses in the laboratory should only be performed under BSL-4 conditions (Mertens et al., 2013). Furthermore, it must to be mentioned that the majority of CCHFV infections does not require intensive medication due to mild or nonspecific

disease courses (Bente et al., 2013). In severe cases the therapy is limited to the treatment of the symptoms, such as volume replacement and the application of platelets, plasma and blood transfusion (Ergonul, 2008). The usage of ribavirin is often documented within human case reports and is claimed to improve the clinical symptoms of patients, at least when applied during the early stage of disease (Ergonul et al., 2004; Mardani et al., 2003). Unfortunately, all these studies usually lack significant evidence about its effectiveness; therefore, the therapeutic benefit must be interpreted carefully (Soares-Weiser et al., 2010). Although antibody therapy based on the plasma of CCHFV survivors has been used in Russia and Bulgaria (Akinci et al., 2009; Leshchinskaia, 1970; Papa et al., 2004; Vassilev et al., 1991), there are no studies confirming its efficiency.

3 MATERIAL AND METHODS

The following section provides an overview of the materials and methods used for this thesis. A more detailed description of methodology and the experimental setups can be found in the respective manuscripts.

3.1 Samples

The sample collection was carried out by the Mauritanian State Veterinary Laboratory “Office National de Recherches et de Développement de l'Elevage“ (ONARDEL)ONARDEL following all relevant national as well as international regulations and according to fundamental ethical principles for diagnostic purposes in the framework of a governmental program for the animal health surveillance. The sample collection was focused on the four most important livestock species within the country (cattle, sheep, goats and camels) and an attempt was made to collect an equal number of serum samples from each region. However, due to the deficient infrastructure in the remote regions of the country and political instability near the border with Mali, this aim could not always be ensured. The ticks of Manuscript II originated from field collections in Cameroon (by Samuel Abah, LANAVET), Mauritania (by Yahya Barry, ONARDEL), Croatia (by Dr. Relja Beck, Croatian Veterinary Institute) as well as from laboratory colonies (kindly provided by MSD Animal Health Innovation GmbH, Schwabenheim, Germany and Insect Services, Berlin, Germany). All samples were stored in 70 % ethanol at -20 °C. Furthermore, more than 1500 Hyalomma ticks (Manuscript III) were sampled in 2018 from four different herds (cattle and camels) in Mauritania. The Australian camel serum samples were also collected in the framework of an animal health surveillance program according to fundamental ethical principles. Performance of an alpaca immunization experiment was carried out in accordance with national and European legislation (Directive 2010/63/EU on the protection of animals used for scientific purposes). It was approved by the competent authority of the Federal State of Mecklenburg-Western Pomerania, Germany (Landesamt für Landwirtschaft, Lebensmittelsicherheit und Fischerei Mecklenburg-Vorpommern, Rostock).

3.2 Serology

In order to enable handling of the samples under BSL-2 conditions, all serum samples were tested for potential animal pathogens and zoonotic diseases including foot-and- mouth disease virus (FMDV), bluetongue virus (BTV), Rift Valley fever virus (RVFV) and Crimean-Congo hemorrhagic fever virus (CCHFV) via qRT-PCR. All sera that tested positive for one of these pathogens were excluded from further studies and transferred to higher biosafety level laboratories at FLI. All serum samples were also tested for CCHFV IgG antibodies against the N protein of the virus using different in- house (Mertens et al., 2015; Schuster et al., 2016) and adapted commercial ELISAs (VectorBest, Nowosibirst, Russia) based on the diagnostic workflow published before (Mertens et al. 2009). Moreover, an adapted commercial immunoflourescence assay (Euroimmun, Lübeck, Germany) was used as a decision support for questionable sera. Detailed information on all serological methods used as well as on the establishment of a novel camel-specific in-house ELISA are presented in Manuscript I.

3.3 DNA/RNA extraction

The ticks (Manuscript II / III) were shredded in AVL buffer using a steel bead and a tissuelyzer (TissueLyser II, Qiagen, Hilden, Germany). Subsequently, for smaller sample quantities the DNA/RNA was extracted using the Viral RNA mini Kit (Qiagen, Hilden, Germany) as suggested by the manufacturer. For a larger number of samples, nucleic acid extraction was performed using an automated extraction instrument (KingFisher Scientific, Waltham, USA) with the NucleoMag® VET kit (Macherey-Nagel, Düren, Germany).

3.4 Morphological tick species identification

All Hyalomma ticks originating from the field collection were morphologically identified prior to the homogenization. The identification was performed under a stereomicroscope (Nikon SMZ 745T, Minato, Japan) using the keys of Apanaskevich et al. (Apanaskevich and Horak, 2008a; 2008b; Apanaskevich et al., 2008; Apanaskevich et al., 2010). Since all non-Hyalomma species originated exclusively

from defined laboratory colonies, no further morphological determination was performed for these ticks.

3.5 Molecular tick species identification

The development and implementation of molecular species identification methods is described in Manuscript II. For this purpose, a primer set targeting the cytochrome oxidase 1 (CO1) gene segment of ticks was applied. The PCR product was applied on an agarose gel and sequenced by means of Sanger sequencing (Eurofins, Luxembourg, Luxembourg) which allowed a genetic determination of the tick species (DNA barcoding). Additionally, the amplicons were cleaved using two different restriction enzymes and subsequently applied on a polyacrylamide gel. As a result, the tick species could be distinguished from each other based on species-specific gel patterns. Apart from the distinction on a genetic level, the ticks were also differentiated by molecular phenotyping. A MALDI-TOF MS database consisting of spectra of different Hyalamma and non-Hyalomma species was established to allow a comparison of the ticks based on their proteins.

3.6 Virus detection and characterization

All ticks of Manuscript III were individually extracted and examined for CCHFV by using a modified one-step multiplex assay (qRT-PCR; Sas et al. (2018)) as described previously by Kasi et al. (2020b) using a CFX96 Real-Time System (Biorad, Hercules, USA). Positive samples were re-tested by a conventional PCR using a Biorad C1000 Thermal Cycler (Biorad, Hercules, USA). The obtained PCR products were applied on an agarose gel and subsequently characterized by Sanger sequencing. The phylogenetic tree for the different CCHFV genotypes found in the ticks samples was generated using Neighbor-Joining algorithm and Jukes-Cantor distance model in Geneious version 2019.2 (Biomatters, available from https://www.geneious.com) and FigTree v1.4.4 (available from https://github.com/rambaut/figtree/releases).

3.7 Statistical analyzes

All analysis including confidence intervals (CI), Fisher's exact test, chi-square, generalized linear mixed-effects model (GLMM), cut-off calculation for the ELISA were performed in R (version 3.6.0 (2019-04-26) - "Planting of a Tree" (R Core Team, 2019)) using the package lsmeans (Lenth, 2016). Results of the MALDI Biotyper query were exported and transferred to the statistical programming language R (version 3.5.1., (R Development Core Team, 2011)). Score values were arranged as a distance matrix for the construction of a Sammon map by two-dimensional scaling (Sammon, 1969). Statistical models were calculated for pairs of tick species with ClinProTools software (version 2.2, Bruker)

3.8 Literature research

For the literature research of this thesis, PubMed® database (National Center for Biotechnology Information, Bethesda (Maryland), USA) was used.

4 MANUSCRIPT I:

Crimean-Congo hemorrhagic fever orthonairovirus antibody prevalence in Mauritanian livestock (cattle, goats, sheep and camels) is stratified by the animal’s age

A. Schulz1, Y. Barry2, F. Stoek1, A. Ba2, M.A. Sas1, J. Schulz1, P. Kirkland3, M. Eiden1, M.H. Groschup1

1 Friedrich-Loeffler-Institut, Institute of Novel and Emerging Infectious Diseases, Südufer 10, 17493 Greifswald-Insel Riems, Germany

2 A l'Office National de Recherche et de Développement de l'Elevage (ONARDEL), Nouakchott, Mauritania

3 Elizabeth Macarthur Agriculture Institute, Woodbridge Rd, Menangle NSW 2568, Australia

4.1 Abstract

Background: Crimean-Congo hemorrhagic fever orthonairovirus (CCHFV) is one of the most widespread zoonotic arthropod-borne viruses in many parts of Africa, Europe and Asia. It belongs to the family of Nairoviridae in the genus of Orthonairovirus. The reservoir and vector are ticks of the genus Hyalomma. Livestock animals (such as cattle, small ruminants and camels) develop a viremia lasting up to two weeks followed by seroconversion. This study was carried out to assess risk factors that affect seroprevalence rates in different species.

Methods: In total, 928 samples from livestock animals (cattle= 201; sheep= 247; goats= 233; camels= 247) from 13 of 15 regions in Mauritania were assayed for CCHFV-specific immunoglobulin G (IgG) antibodies using enzyme-linked immunosorbent assays (ELISA) (including a novel indirect camel-IgG-specific CCHF ELISA). Inconclusive results were resolved by an immunofluorescence assays (IFA). A generalized linear mixed-effects model (GLMM) was used to draw conclusions about the impact of certain factors (age, species, sex and region) which might have influenced the CCHFV antibody status of surveyed animals.

Results: In goats and sheep, 15 % and 16 % of the animals were seropositive, whereas in cattle (69 %) and camels (81 %) the prevalence rate was significantly higher. On average, cattle and camels were up to four times older than small ruminants. Interestingly in all species, the seroprevalence was directly linked to age of the animals, i.e. older animals had significantly higher seroprevalence rates than younger animals.

Conclusions: The highest seroprevalence CCHFV in Mauritania was found in camels and cattle, followed by small ruminants. The large proportion of positive animals in cattle and camels might be explained by the high age of the animals. Future CCHFV prevalence studies should at least consider the age of surveyed animals in order to avoid misinterpretations.

4.2 Introduction

Crimean-Congo hemorrhagic fever orthonairovirus (CCHFV) is one of the most widespread zoonotic arthropod-borne viruses distributed in many parts of Africa, Europe and Asia (Bente et al., 2013; Hoogstraal, 1979). It belongs to the family of Nairoviridae in the genus of Orthonairovirus. Many livestock species such as cattle, goats, sheep or camels can become infected with this virus and even develop viremia, but still do not develop clinical symptoms (Spengler et al., 2016b). Humans can be infected by infectious blood, tissue or other body fluids from viremic animals or patients. Most virus infections are caused by bites of infected Hyalomma ticks, which are the main reservoir and transmission vector of CCHFV (Whitehouse, 2004). In contrast, infected people can suffer from severe symptoms, including hemorrhagic fever with case fatality rates ranging from 5 % in Turkey (Leblebicioglu et al., 2016) up to 80 % in China (Yen et al., 1985). Livestock farming plays an important role for the income of the local population in Mauritania and represents an integral part of the Mauritanian economy (Mint Mohamed Lemine et al., 2017). The close contact between farmers and their animals, as well as insufficient medical or veterinary care in rural areas, bears a serious health risk for humans and animals. The first human case of CCHFV in Mauritania was described in 1983 (Saluzzo et al., 1985a) and triggered an initial serological study for CCHFV antibodies in humans, cattle and rodents (Saluzzo et al., 1985b). Gonzalez et al. (1990) conducted the first larger serological study in sheep

and they obtained a prevalence of 18 %. Another albeit much smaller survey on sheep and goats in 2003 revealed a similar prevalence (Nabeth et al., 2004a). In 2013, cattle were tested for CCHFV IgG antibodies for the first time and a surprisingly high seropravalence of 67 % was observed (Sas et al., 2017a). Investigations of cattle in Sudan for CCHFV antibodies (Ibrahim et al., 2015) showed that collection site, age, husbandry system and tick infestation are the biggest risk factors on seroprevalence. An age-related increase in CCHFV IgG antibody prevalence was already observed in sheep (Wilson et al., 1990) and cattle (Ibrahim et al., 2015; Lotfollahzadeh et al., 2011; Mohamed et al., 2008). Therefore, this current study in Mauritania was focused on potential host-related risk factors (like age, species, sex and region) to reveal their impact on CCHFV seroprevalence rates in different livestock species. This study provides a comprehensive overview of the current CCHFV-IgG antibody circulation in Mauritania. We have used already established tests for cattle, sheep and goats (in-house / adapted commercial) as well as a newly developed camel-IgG specific ELISA. Emphasis was particularly laid on previously understudied species in Mauritania (CCHFV infections in camels and goats).

4.3 Materials and methods

4.3.1 Serum samples

Mauritania, located in West Africa south of the Western Sahara, has a size of 1,030,000 km2 and is one of the most sparsely populated countries in Africa due to the prevalent Saharan landscape. It is divided into 13 different regions, which are subdivided in 44 departments. In 2015, serum samples were taken from cattle (n= 201), sheep (n= 247), goats (n= 233) and camels (n= 247) from 13 out of 15 regions (Table 4.2). Samples from the capital region Nouakchott originated from a large abattoir that is connected with one of the most important livestock markets in this region. For 873 of 928 samples the age and sex of the sampled animals available. The sample collection was carried out by the Mauritanian State Veterinary Laboratory ONARDEL following all relevant national as well as international regulations and according to fundamental ethical principles for diagnostic purposes in the framework of a governmental program for animal health surveillance.

4.3.2 Establishment of a camel-specific in-house IgG CCHFV ELISA

A camel-specific CCHFV IgG ELISA was developed using His-tagged recombinant N- Protein of CCHFV-strain Kosovo Hoti (Accession no. DQ133507) as antigen. Half of the 96-Well F-Bottom microplates (Greiner Bio-One, Austria) were coated with 100 µl coating buffer (1xPBS; BSA 1%; pH 9) including 0.2 µg of antigen, whereas for the second half the antigen was omitted. The plates were incubated over night at 4°C in the fridge and afterwards blocked for 1 h at 37°C with 200 µl blocking buffer (IDvet, Grabels, France). Serum samples were diluted 1:80 in serum dilution buffer (IDvet DB no.11) and 50µl applied twice each to the wells with antigen and the wells without antigen. The plates were then incubated for 1h at 37°C and washed 3 x with 250 µl/well washing buffer (PBS-Tween 0.1%). The unlabeled goat- anti-lama IgG conjugate (Southern Biotech) was diluted 1:1500 in dilution buffer (IDvet DB no.3; 100µl/well) and incubated for 1 h at 37°C. Afterwards plates were washed 3 x with 250 µl/well washing buffer (PBS-Tween 0.1%). To obtain a detectable signal a rabbit anti-goat-HRP (Southern Biotech) conjugate in ratio 1:3000 (100 µl/well) was used and incubated for 1h at 37°C. Finally, the plate was washed one last time and 100 µl/well TMB solution (Bio-Rad) was added. After the 10 min of incubation time the reaction was stopped with 100 µl 1M H2SO4 and measured with a Tecan plate reader Infinite® 200 PRO at 450 nm against the reference wavelength of 620 nm. In order to exclude possible strong background reactions of the sera, which could falsify the result, a corrected OD

(optical density) value was used (OD (av.) antigen – OD (av.) no antigen). The corrected OD value of the sample (R-sample) divided by the corrected OD value of the positive control (R-positive) gave the final result (fR) and was expressed as a percentage (fR =[R-sample/R-positive] * 100). The camel-specific in-house CCHFV IgG-ELISA was validated using 42 camel sera from Australia as negative controls. These samples were also collected in the framework of an animal health surveillance program. According to the WHO (27 October 2019), Australia is officially free of CCHFV. There were no field samples from Mauritanian camels available that could be considered as confirmed positive. Thus, to calculate a cut-off for the new camel-specific in-house IgG ELISA, the mean 푋 and standard deviation 푆퐷 of the corrected OD values of the negative controls were calculated and cut-off values were determined using

퐶푢푡푂푓푓 = 푎 ∙ 푋 + 푓 ∙ 푆퐷,

with 푎 and 푓 arbitrarily defined multipliers (Lardeux et al., 2016). The repeatability of the test was evaluated using the Bland-Altman statistics (Bland and Altman, 1999; Giavarina, 2015). To verify whether the ELISA is able to detect specific reactions in camelid sera against CCHFV IgG antibodies, an alpaca was immunized under laboratory conditions with the same recombinant N-Protein of CCHFV-strain Kosovo Hoti used for ELISA. Blood samples, including day 0, were collected after immunization and tested in the ELISA. The Kosovo-Hoti N-protein was expressed in an E.coli vector. In order to exclude an unspecific immune reaction of the alpaca against possible E. coli contamination, the samples were tested twice. In the first approach the N-protein was normally coated, in the second approach the plates were covered with an E. coli lysate (Tab. 4.1). Additionally, 12 serum samples from German zoo animals (Bactrian camel and dromedary) were tested as negative controls to validate the newly developed ELISA. Performance of the experiment was carried out in accordance with national and European legislation (Directive 2010/63/EU on the protection of animals used for scientific purposes). It was approved by the competent authority of the Federal State of Mecklenburg-Western Pomerania, Germany (Landesamt für Landwirtschaft, Lebensmittelsicherheit und Fischerei Mecklenburg-Vorpommern, Rostock).

4.3.3 Serological investigation of cattle, sheep, goats and camels by in-house CCHFV- IgG- ELISA

All samples were tested according to a flow chart (Mertens et al., 2009) combining different ELISA and IFA test systems. The sera from cattle, sheep and goats were assayed (twice in case of a positive result) with the respective species–specific in- house CCHFV IgG ELISA system (Mertens et al., 2015; Schuster et al., 2016). Positive findings were tested during a second test run with adapted commercial ELISAs (Vector Best, Novosibirsk, Russia) to confirm these results. In case of a divergent outcome, an adapted commercial IFA (Euroimmun, Lübeck, Germany) was used to obtain a final result. The diagnostic approach for the camel sera is described above.

4.3.4 Statistical analysis

The effects of age, species and sex on the CCHFV status was estimated using a generalized linear mixed-effects model (GLMM). The variables 푎푔푒, 푠푝푒푐푖푒푠 and 푠푒푥 were considered as fixed effects. Including 푟푒푔푖표푛 as random regional effect with 2 variance 휎푟푒푔푖표푛 led to the mixed model:

휋 푙표푔 ( ) = 훽 + 훽 ∙ 푎푔푒 + 훽 ∙ 푠푝푒푐푖푒푠 + 훽 ∙ 푠푒푥 + 푏 ∙ 푟푒푔푖표푛 (1) 1 − 휋 0 1 2 3

where 휋 indicated the probability of an animal to be CCHFV positive. 훽푖 and 푏 were the regression coefficients. Model reduction was performed, as the variable 푠푒푥 did not show a significant effect. This led to the final model:

휋 푙표푔 ( ) = 훽 + 훽 ∙ 푎푔푒 + 훽 ∙ 푠푝푒푐푖푒푠 + 푏 ∙ 푟푒푔푖표푛 (2) 1 − 휋 0 1 2

Least-squares means were used for summarizing the effects of factors 푎푔푒 and 푠푝푒푐푖푒푠. All analysis were performed in R (version 3.6.0 (2019-04-26) - "Planting of a Tree" (R Core Team, 2019) using the package lsmeans (Lenth, 2016).

4.4 Results

4.4.1 Validation of the new camel-specific inhouse IgG-CCHFV- ELISA

Forty-two Australian negative camel sera were used for the calculation and validation of the cut-off. Two cut-off values were calculated to define a range of inconclusive results. The upper cut-off value (푎 = 1, 푓 = 2) was set to 19.96 % and samples above this value were considered to be CCHFV positive. The lower cut-off value (푎 = 1, 푓 = 2) was 10.45 % and samples below this value were considered as negative. Samples showing OD values between these two cut-off values were considered to be inconclusive. Bland-Altman analysis (Bland and Altman, 1999) indicated good repeatability of the assay (data not shown). However, two of the Australian sera showed a clear positive reaction in the ELISA. In the second test run, both were positive again, but deviated strongly from the first run. The rest of the samples showed

no significant deviation in their values upon repetition. Since no positive reference field sera existed, a serum of an immunized alpaca was used as reference. On days 0, 4 and 7 after immunization, no specific reaction was detected by the ELISA. All sera collected after the 14th day were highly positive indicating that the ELISA is able to detect a specific seroconversion in camelids (Tab. 4.1) without any or only minimal reactivity to E. coli antigens itself. In addition, 12 camel sera originating from German zoos tested negative.

4.4.2 Serological and statistical findings in cattle, goats, and sheep and camels

This study revealed a considerable prevalence difference between animal species (Tab. 4.2 and Fig. 4.1 B). Cattle samples showed a seroprevalence of 68.66 % with regional differences ranging from 50 to 95%. 16 % of sheep (ranging from 0 to 50 %) and 15 % of goats (ranging from 0 to 37 %) were positive. The prevalence of camels (81 %), however, was even higher than in cattle. Moreover, we observed that older animals were more likely to be positive than younger animals (Tab. 4.3 and Fig. 4.1 A). A more detailed statistical analysis revealed a significant effect of age and species on the CCHFV status of the investigated animals, whereas sex had no influence. The region was another reason of random variability. Table 4.4 shows the comparison of the different age and species categories regarding their influence on the CCHFV antibody status. All age categories were clearly different from group A (0-2 years). In addition, the second youngest age group B (3-4 years) differed almost from all others with one exception. There was no difference between B and the three next older cohorts C (5-6 years), D (7-10 years) and E (>10 years). When considering the species, there were no significant seroprevalence differences between goats and sheep nor between cattle and camels.

4.5 Discussion

The aim of the study was to reveal factors, which have a decisive impact on the CCHFV seroprevalences in different livestock species. For this purpose, several established diagnostic assays for serological IgG detection in cattle, sheep and goats were used. Since there was no diagnostic assay readily available for camels, a new camel-specific in-house ELISA was developed. With two exceptions, all negative reference sera were clearly negative. Two serological reactors from camels from Australia may either be

non-specific immune responses or represent cross-reactions to other orthonairoviruses circulating in Australia. An importation history for these camels from Africa/Arabia to Australia could be excluded. Furthermore, the detection of a distinct immune response in the serum of the immunized alpaca from the 14th day onwards supports the validity of the ELISA in terms of specific reactions (Tab. 4.1). This study provides an updated overview of the CCHFV-IgG antibody circulation in the four major livestock species in Mauritania. Using the same assay as Sas et al. (2017a), almost identical prevalence (69 % compared to 67 %) was found in cattle. Seroprevalence found in sheep (16 %) deviated only slightly from older data (18.3 %) of Gonzalez et al. (1990). So far, only 27 goat samples have been investigated in Mauritania within a human case report study of Nabeth et al. (2004a) finding three positive animals (11.1 %). We detected a prevalence of 15 % among 233 tested goats and thus could confirm these findings. Camels were never screened for CCHFV-specific antibodies in Mauritania before. Only a limited number of CCHFV seroprevalence studies in camels have been carried out so far (Spengler et al., 2016a), with recent findings indicating prevalences of 5.3 % in Iran (Champour et al., 2014), 10.5-14.4 % in Niger (Mariner et al., 1995), 21.3 % in Sudan (Suliman et al., 2017) and 67 % in the United Arab Emirates (Camp et al., 2020) respectively. Using the newly established camel-specific ELISA, this study revealed a surprisingly high proportion of positive animals (81 %). More detailed surveillance data on camels are therefore needed which should take the most important risk factors (age, collection site, tick infestation and husbandry system) into account to clarify the role of camelids in CCHFV transmission and maintenance cycles. Age and species dependent CCHFV antibody prevalences were observed for cattle and camels, as well as for sheep, and goats (Fig. 4.1 and Tab. 4.3). Significantly, higher CCHFV antibody prevalences were found in cattle and camels (37 % / 25 %) in young age groups (0-2 years) as compared to sheep and goats (8 % / 8 %). Moreover, antibody prevalences rise in the older age groups (3-4 years and older) in all species, however, cattle and camels reach more than 80 % CCHFV antibody prevalences while sheep and goats of the corresponding ages remain at about 20% respectively. Our findings correlate well with previous observations of age-depended seroprevalences found in sheep (Wilson et al., 1990) and cattle (Ibrahim et al., 2015; Lotfollahzadeh et al., 2011; Mohamed et al., 2008). Furthermore, it could be shown that the age also had a significant influence on CCHFV seroprevalences in goats and camels (Tab. 4.3 and

Fig. 4.1 A). It is clear that the steady rise of antibody prevalence with increasing age in all species can be due to an additive effect. However, hardly any experimental data are available on the CCHFV antibody persistence in livestock and wildlife, which would determine the extent of this effect. Obviously, a higher age coincides with a higher chance for CCHFV infection promoting tick infestations in endemic regions. Since infection induced antibody levels persist for longer periods, more seropositive animals will be found on population level. CCHFV infection studies in cattle, sheep and equids revealed that all examined species developed a short-term viremia (Spengler et al., 2016b). Wilson et al. (1991) and Gonzalez et al. (1998) demonstrated IgG antibody titers in sheep lasting at least up to 30 respectively 40 days post infection (dpi). On the other hand, antibody persistence of up to 256 dpi (African hedgehog) and 512 dpi (Cape ground squirrel) was observed in wild mammals (Shepherd et al., 1989). In humans, IgG antibodies were detected up to 5 years after recovery from a CCHFV infection (Yadav et al., 2019). Unfortunately, there are no experimental data for camelids to date. More long-term CCHFV infection studies with livestock are necessary to improve our understanding of the humoral and cellular immunological memory in host species. Sheep and goats constitute as an important source of meat in Mauritania and therefore are slaughtered early. Cattle and camels are often used as dual-purpose breeds. These species are both kept for dairy farming and sent to the slaughterhouse when milk yields decrease. For meat production, primarily young animals are slaughtered. Due to the fact that female camels produce the largest amount of milk around between the 6th and 8th parity (i.e. 10-12 years of age) (Musaad et al., 2013), they reach a high average age and are often slaughtered late at the age of 18-20 when milk yields start to decrease gradually. This might be explain why most of the camels in this study were older than 10 years. However, age effects alone cannot explain prevalence differences between large and small ruminants in young, as well as in old age groups. Therefore, differences in husbandry systems may also play a role in terms of CCHFV seroprevalence. It was shown for cattle (Ibrahim et al., 2015) and small ruminants (Kasi et al., 2020b) that nomadic grazing would significantly increase seroprevalences due to higher tick exposition risks compared to stationary trough feeding systems. Vegetation, lack of tick treatment and the absence of poultry (which pick ticks) are also considered as potential risk factors (Kasi et al., 2020b). These parameters may also

account for higher prevalences in cattle and camels compared to sheep and goats of same age groups.

4.6 Conclusion

This study provides a comprehensive up-to-date overview of CCHFV IgG seroprevalences in the four most important Mauritanian livestock breeds, highlighting the role of two host-related risk factors (age and species). Older camels and cattle were significantly more often tested positive for CCHFV antibodies than younger small ruminants. In order to obtain more meaningful results, future CCHFV prevalence studies should at least consider the age of surveyed animals, to avoid misinterpretations. In addition, we have developed a camel-specific IgG ELISA that can be used in future CCHFV seroprevalence studies.

4.7 Tables

Table 4.1 Immunization results (OD value and final result in % (fR =[R-sample/R-positive] * 100)) of the alpaca in the novel camel-specific IgG ELISA using two different coating proteins (N-Protein of Kosovo-Hoti and E. coli lysate)

Alpaca Protein coated PC NC 0 dpi 4 dpi 7 dpi 14 dpi 21 dpi 28 dpi

N-protein 1,568 -0,009 -0,006 0,044 -0,025 2,647 3,038 2,936 - -1% 0% 3% -2% 169% 194% 187% 0,047 0,101 0,106 0,136 0,082 0,095 0,090 0,033 E.coli lysate - 6% 7% 9% 5% 6% 6% 2%

PC= positive control (camel field sample from Mauritania) dpi= days post immunization NC= negative control (German zoo camel)

Table 4.2 Results of seroepidemiogical studies in cattle, goats, sheep and camels in Mauritania

Cattle Goats Sheep Camels Region inc. p/n prev. (%) p/n prev. (%) p/n prev. (%) p/i/n prev. (%) (%)

5/0/5 100 0% Adrar ------(49-100) (0-52) 29 21 Assaba - - 8/28 7/32 - - - (13-49) (9-40)

50 25 50 Brakna 14/28 2/8 5/10 - - - (31-69) (3-65) (19-81)

5 6 Guidimaka - - 2/39 2/32 - - - (1-17) (1-21)

Hodh 95 37 15 39/41 15/41 6/40 - - - El Chargui (83-99) (22-53) (6-30)

Hodh 66 21 35/53 - - 17/81 - - - EL Gharbi (52-78) (13-31)

66 89 3 Nouakchott 43/65 - - - - 83/3/93 (53-77) (81-91) (1-9)

16 7 29 24 Inchiri - - 8/51 2/29 6/5/21 (7-29) (1-23) (11-52) (8-47)

50 0 0 Tagant 7/14 0/55 0/5 - - - (23-77) (0-6) (0-52)

Tiris 88 13 ------7/1/8 Zemmour (47-100) (0-53)

0 0 82 11 Trarza - - 0/11 0/18 98/13/120 (0-28) (0-19) (74-88) (6-18)

Total 138/201 69 (62-75) 35/233 15 (11-20) 39/247 16 (11-21) 199/22/247 81 (75-85) 9 (9-13)

p= positive n= number of tested individuals inc. = inconclusive result (ELISA) *= Nouakchott, officially subdivided into three separated regions, has been treated as one region 95 % confidence interval (CI %) in brackets

Table 4.3 Age-related prevalence of IgG-specific CCHFV antibodies in cattle, goats, sheep and camels

Age group Cattle (Øage: 10.17) Goats (Øage: 2.88) Sheep (Øage: 2.91) Camels (Øage: 11.55) (years) prev. (%) p/n prev. (%) p/n prev. (%) p/n prev. (%) p/n 37 8 8 25 A 0-2 22/60 8/95 9/116 2/8 (25-50) (4-16) (4-14) (3-65) 63 20 22 88 B 3-4 10/16 17/87 18/82 7/8 (35-85) (12-29) (14-32) (47-100) 92 20 28 100 C 5-6 23/25 4/20 12/43 5/5 (74-99) (6-44) (15-44) (48-100) 94 75 0 90 D 7-10 64/68 6/8 0/1 9/10 (86-98) (35-97) (0-98) (55-100) 85 92 E >10 17/20 - - - - 167/182 (62-97) (87-95)

prev. = prevalence p= positive n= number of tested individuals 95 % confidence interval (CI %) in brackets

Table 4.4 Results of the generalized linear mixed-effects model (GLMM) for age (a) and species (b) after p-value adjustment using multivariate t- distribution. The significance level was set to 0.05. Significant results were marked in bold.

Differences between age groups p-value Differences between species p-value a b A: 0-2 – B: 3-4 < 0.0001 Camel – Cattle 0.9609

A: 0-2 – C: 5-6 < 0.0001 Camel - Goat < 0.0001

A: 0-2 – D: 7-10 < 0.0001 Camel - Sheep < 0.0001

A: 0-2 – E: > 10 < 0.0001 Cattle - Goat < 0.0001

B: 3-4 – C: 5-6 0.5970 Cattle - Sheep < 0.0001

B: 3-4 – D: 7-10 0.0003 Goat - Sheep 0.9915

B: 3-4 – E: >10 0.0458

C: 5-6 – D: 7-10 0.0112

C: 5-6 – E: >10 0.3709

D: 7-10 – E: >10 0.7875

4.8 Figures

Figure 4.1 Effects of age (a) and species (b) regarding CCHFV IgG antibody status in different livestock species in Mauritania. Overall, for 850 of 928 samples age, species, region and an unambiguous CCHFV-antibody status were available. All inconclusive results were excluded. Fig. 4.1 B summarizes the age dependency for all four animal species.

4.9 Acknowledgments

We thank Martina Abs, René Schöttner and Bärbel Hammerschmidt for technical support and all Mauritanian partners for their help when collecting the serum samples. In addition, we would like to thank and all animal caretakers for their technical support. This study was co-funded by the German Office for Foreign Affairs (German Partnership Program for Biosecurity), by the Deutsche Forschungsgemeinschaft (grant number: GR 980/4-1) as well as by the European Union (LEAP-AGRI LEARN project (ID 222).

5 MANUSCRIPT II:

Molecular discrimination of Hyalomma tick species serving as reservoirs and vectors for Crimean-Congo hemorrhagic fever orthonairovirus in sub-Saharan Africa

A. Schulz1, A. Karger2, B. Bettin2, A. Eisenbarth1, M.A. Sas1, C. Silaghi3, M.H. Groschup1

1 Friedrich-Loeffler-Institut, Institute of Novel and Emerging Infectious Diseases, Südufer 10, 17493 Greifswald-Insel Riems, Germany

2 Friedrich-Loeffler-Institut, Institute of Molecular Virology and Cell Biology, Südufer 10, 17493 Greifswald-Insel Riems, Germany

3 Friedrich-Loeffler-Institut, Institute of Infectology, Südufer 10, 17493 Greifswald-Insel Riems, Germany

5.1 Abstract

The species identification of tick vectors of Crimean-Congo hemorrhagic fever orthonairovirus (CCHFV), especially Hyalomma (H.) species, is a prerequisite to understand the eco-epidemiology of this disease and to reveal vector and virus reservoir species. However, the morphologic species discrimination can be difficult for damaged or blood-fed ticks and in case of species intercrosses. Therefore, we used matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI- TOF MS) and restriction fragment length polymorphism (RFLP) analysis to distinguish the most common Hyalomma species from sub-Saharan Africa (H. truncatum, H. rufipes and H. dromedarii). Within the last years, MALDI-TOF MS analysis based on tick leg proteins has been shown to be a reliable method to distinguish several tick species. For this purpose, a reference spectral library of several European, American and African tick species was established. In this study, six different Hyalomma species were tested, all of which were all clearly distinguishable by mass spectrometric analyses. Moreover, MALDI TOF- MS was able to confirm morphologic findings where sequencing provided ambiguous results. In addition, a polymerase chain reaction (PCR) based on the CO1 gene amplification of ticks has been developed for the unequivocal species identification by amplicon sequencing and specific restriction endonuclease cleavage pattern analysis. RFLP proved to be a feasible auxiliary

discrimination tool for selected Hyalomma species when access to sequencing methods is not available, as for instance during field studies.

Ticks and Tick-borne Diseases (2020) 101382 (https://doi.org/10.1016/j.ttbdis.2020.101382)

6 MANUSCRIPT III:

Detection of Crimean- Congo hemorrhagic fever orthonairovirus (CCHFV) in Hyalomma ticks collected from Mauritanian livestock- more than just a virus indicator?

A. Schulz1, Y. Barry2, F. Stoek1, M.J. Pickin1, A. Eisenbarth1, M. Eiden1, M.H. Groschup1

1Friedrich-Loeffler-Institut, Institute of Novel and Emerging Infectious Diseases, Südufer 10, 17493 Greifswald-Insel Riems, Germany

2Office National de Recherche et de Développement de l'Elevage (ONARDEL), Nouakchott, Mauritania

6.1 Abstract

Crimean- Congo hemorrhagic fever orthonairovirus (CCHFV) belongs to the Nairovididae family in the Orthonairovirus genus and is an emerging tick-borne virus. CCHFV is present in most parts of Africa, Asia as well as southern Europe. It can cause severe hemorrhagic symptoms in humans with a high fatality rate (5- 30 %). Hyalomma ticks were collected from four different livestock herds (cattle and camel) in Mauritania in 2018. The tick species was determined morphologically and confirmed on a molecular level using cytochrome oxidase 1 gene marker (CO1). For the detection of CCHFV ticks were tested individually with a one-step multiplex real-time RT-qPCR. Subsequently all positive samples were sequenced (S segment) to determine the CCHFV genotype. Overall, 39 of 1523 ticks, collected from 63 cattle and 28 camels, tested positive for CCHFV (2.56%). All ticks belonged to three different Hyalomma species. The highest prevalence was found in H. rufipes (5.67 %; 16/282), followed by H. dromedarii (1.89 %; 23/1214) and H. impeltatum (0 %; 0/21). Positive ticks were found on only 6 out of the 91 source animals which is indicative for horizontal infections. Sequencing of positive samples revealed two different lineages (Africa I and Africa III). This study confirms the CCHFV prevalence (2.56 %) in Hyalomma ticks collected from camels and cattle in Mauritania. The true prevalence of unfed ticks is probably much lower since a considerable number of ticks are likely to have been passively infected during the blood meal by co-feeding or viremia of the host. Tick control measures should be implemented, especially in the examined areas.

6.2 Introduction

Crimean- Congo hemorrhagic fever virus (CCHFV) belongs to the Nairovididae family in the Orthonairovirus genus and is an emerging zoonotic arthropod-borne virus causing Crimean-Congo hemorrhangic fever (CCHF). CCHFV is present in most parts of Africa, southern Asia as well as southern Europe (Bente et al., 2013; Hoogstraal, 1979). The virus is characterized by high genetic diversity (Deyde et al., 2006). Ticks of the genus Hyalomma are considered to be the main vector and reservoir of the virus (Whitehouse, 2004). Most, if not all, diverse Hyalomma feeding hosts (ranging from wildlife species to domesticated animals) can be infected, but seem only to develop a short-term viremia without clinical symptoms (Spengler et al., 2016a). In contrast, CCHFV infections in humans can lead to severe hemorrhagic symptoms with a high lethality rate of up to 30 % (Whitehouse, 2004). Seroepidemiological studies of different susceptible livestock and wildlife can provide a first indication appreciation whether CCHFV is circulating in certain regions and thus have become an important cornerstone for defining potential endemic risk-areas (Spengler et al., 2016a; Spengler et al., 2016b). However, serological surveys cannot provide information on the true virus prevalence, CCHFV strain genetics and host-vector dynamics. These data can only be obtained by complex experimental studies of tick-host transmission, which are conducted according to stringent guidelines as described by Gargili et al. (2017). As a compromise to these complex experiments, ticks from less complicated field studies are often screened for the presence of virus, although these findings must be interpreted cautiously. The detection of CCHFV in engorged ticks is only evidence for virus presence but it does not imply the vector competence of a tick, since passive contamination from blood of the host cannot be excluded (Gargili et al., 2017). According to WHO data, Mauritania in West Africa is considered a highly endemic country with a large annual number of human CCHF cases. Traditional husbandry is common meaning close contact between livestock and farmers. The first evidence of a human CCHFV case in Mauritania was reported in 1983 (Saluzzo et al., 1985a). Several serological studies on livestock revealed a high seroprevalence of 15 % in small ruminants (Gonzalez et al., 1990; Nabeth et al., 2004a) and up to 67 % in cattle (Sas et al., 2017a), underlining the high endemic status of the country. Despite this high seroprevalence, CCHFV prevalence in ticks has not been systematically studied in Mauritania. The first comprehensive survey was conducted in 1985 and included

2539 ticks collected from cattle, sheep, goats, camels and horses (Saluzzo et al., 1985b). The samples were pooled and analyzed using complement-fixation test, resulting in 12/172 (6-9 %) CCHFV positive tick pools. Of four analyzed tick species (H.rufipes, H. marginatum, H. impeltatum and H. dromedarii), only H. rufipes pools were positive. In a second study, 378 engorged and non-engorged ticks of two different genera (Hyalomma and Rhipicephalus) were tested for CCHFV. Only in four Rh. evertsi evertsi collected from sheep were CCHFV detected whereas all Hyalomma ticks showed negative results (Nabeth et al., 2004a). The aim of the presented study was to obtain recent data on the circulation of CCHFV in livestock and Hyalomma ticks in Mauritania. Special emphasis was laid on an accurate species identification of the ticks (Estrada-Pena et al., 2013; Gargili et al., 2017) and recording sample histories to improve our understanding of the host-vector dynamics in the sampled herds. Moreover, CCHFV genotypes were determined. Results contribute to the CCHFV exposure risk analysis for local farmers, butchers and others working/living in close contact with livestock.

6.3 Materials and methods

6.3.1 Collection sites

Mauritania is a large West African country with mostly Sahara-covered landscape and low population density. Samples were collected in the surrounding region to the capital Nouakchott and the town of Rosso. Camels were sampled at a livestock market with an associated slaughterhouse (Tenweich) on the outskirts of Nouakchott. In addition, one cattle herd was sampled at a dairy farm 60 km east of Nouakchott near the small village Idini (Trarza). Two other sampling sites for cattle and camels respectively were located in the surrounding area of Rosso (Trarza) in southwestern Mauritania. The distance between Nouakchott and Rosso is about 200 km.

6.3.2 Collection of samples

Up to 30 Hyalomma ticks were collected from 28 camels and 63 bovines from the four aforementioned herds. Moreover, blood samples were taken from most of these animals (Idini, cattle: n= 49; Nouakchott slaughterhouse, camels: n= 13; Rosso,

camels: n=15). No blood samples were available from the cattle herd in Rosso. Since Hyalomma ticks are considered as the main vector and reservoir for CCHFV, ticks from other genera were excluded from this field study. Collected ticks were stored at - 80 °C without any medium at the Office National de Recherche et de Développement de l'Elevage (ONARDEL) in Nouakchott. Ethanol (90%) was added to the samples immediately prior to their shipment to the Friedrich- Loeffler- Institute (FLI). The sample collection was carried out by the Mauritanian State Veterinary Laboratory ONARDEL following all relevant national as well as international regulations and according to fundamental ethical principles for diagnostic purposes in the framework of a governmental program for animal health surveillance.

6.3.3 Morphological and molecular species identification

All ticks were morphologically identified using the identification keys of Apanaskevich et al. (Apanaskevich and Horak, 2008a, b, 2009; Apanaskevich et al., 2008). Individual ticks were homogenized in AVL buffer (Qiagen) using a Tissuelyser II (Qiagen) machine. The homogenates were cleared by centrifugation and supernatants used for nucleic acid extraction. DNA/RNA was extracted using a a KingFisher Flex instrument (ThermoFisher) with the NucleoMag® VET kit (Macherey-Nagel, Germany) according to the manufacturer`s protocol. A selected number of hard to determine as well as CCHFV-positive ticks were species identified using cytochrome oxidase 1 gene sequencing and restriction fragment length polymorphism (Schulz et al., 2020).

6.3.4 CCHFV genome detection

RNA extracted from individual ticks and serum samples was used to screen for CCHFV. The screening was performed using a modified one-step multiplex assay (qRT-PCR; Sas et al. (2018)) as described previously (Kasi et al., 2020b). Samples were considered “positive” in case of Ct-values below 35 and “weak-positive” if between 35 and 40.

6.3.5 Molecular and phylogenetic analyzes of CCHFV genotypes

In order to get a first insight into the detected CCHFV genotypes, amplicons (127 bp) of the qRT-PCR products of all positive-tested samples were sequenced by Sanger 43

sequencing (Eurofins) and compared by using the BLAST tool (NCBI). For this purpose, the PCR protocol was performed using only one primer pair ("CCHF-III"). Due to the small length of the PCR product, it was necessary to amplify a larger segment from the S segment, which allows a more meaningful phylogenetic analysis. Therefore, primers complimentary close the terminal regions were chosen based on the most related sequence in the BLAST results. The primers to amplify African linage 1 were: “for 5’- AACACGTGCCGCTTACGC” and “rev 5’ – TATCGTTGCCGCACAGCC”; and for African linage 3, “for 5’ – ATGGAAAACAAAATCGAGGTGAATAACAAAGAT” and “rev 5’ – TTAGATAATGTTAGCACTGGTGGCATT”. Both the reverse transcription using SuperScript IV Reverse Transcriptase (Thermofisher) with the reverse primer as well as the PCR using the KAPA HiFi HotStart ReadyMix PCR Kit (Kapa Biosystems) were performed according to the manufacturer's instructions. The amplified fragment was sequenced by Sanger sequencing (Eurofins) and used to create a phylogenetic tree (Fig. 5.1).

6.3.6 Statistical analysis

Statistical analyses included 95 % confidence intervals (CI), Fisher's exact test and chi-square test. Therefore, R software and R-Studio (an integrated development environment for R) were used for the calculation (R Core Team, 2019). Those ticks that could not be species identified were excluded for Fisher's exact test and chi- square test (Table 6.1).

6.4 Results

6.4.1 Tick species and their distribution on hosts

Overall, 1523 blood-fed ticks were collected from 63 cattle and 28 camels. Morphological identification revealed that three different tick species (H. dromedarii, H. rufipes and H. impeltatum) were present in the surveyed areas. Due to the large morphological diversity of Hyalomma ticks and the similarity of H. dromedarii and H. impeltatum, 219 specimens were identified genetically by the restriction fragment length polymorphism (RFLP) approach. Furthermore, the CO1 gene amplicon used for restriction digest was sequenced from 47 ticks to unambiguously identify their species.

However, for six Hyalomma ticks the exact species could not be determined. Results of species determination and distribution among the different collection sites and hosts are summarized in Table 6.1. H. dromedarii represented the by far largest population (79.58 %), followed by H. rufipes (18.52 %) and H. impeltatum (1.51 %). Despite the predominance of H. dromedarii, a great variation was observed regarding the distribution of tick species across the different sampled regions and hosts. In both camel herds, the percentage of H. dromedarii was almost 100 % while ticks of other species were found only sporadically. In contrast, the distribution of tick species among the two cattle herds was considerably more heterogeneous. A large number of H. dromedarii individuals (88.43 %) were identified on the dairy farm in Idini, although H. rufipes (6.94 %) and H. impeltatum (3.64 %) were also recorded. On the other hand, 85.34% of the collected ticks from the cattle herd in Rosso were identified as H. rufipes and only 14.66 % as H. dromedarii. The distribution of sexes (Table 6.2) showed nearly a 70:30 ratio of males to females across all four collection sites. In the cattle herd from Rosso the proportion of male ticks was slightly higher as compared to the other sampling sites.

6.4.2 CCHFV prevalence in ticks and sera

Of the 1523 individual Hyalomma ticks analyzed, 39 tested positive for CCHFV by qRT- PCR and 23 were considered “weak-positive”. A comprehensive summary is given in Table 6.1. The CCHFV prevalence between species and sampling sites showed some significant differences. Overall, 23 out of 1214 H. dromedarii (1.89 %) and 16 out of 282 H. rufipes (5.67 %) were found to be positive for CCHFV. All 21 examined H. impeltatum ticks were negative. Only three H. dromedarii collected from camels at the Tenweich slaughterhouse tested positive (0.85 %). In contrast, all ticks from the camel herd in Rosso region were negative, whereas 7 out of 266 ticks (all H. rufipes) originating from cattle in the same region were positive (2.63 %). The highest prevalence (4.79 %) was found in the cattle herd from Idini region where 29 positive ticks were identified in a total of 605. Overall, 20 of 537 H. dromedarii (3.72%) and 9 of 42 H. rufipes (21.43%) were CCHFV-positive, while all H. impeltatum ticks were negative. In total, 2.28 % of female and 2.67 % male sampled ticks were CCHFV- positive. No significant sex differences were observed in terms of CCHFV prevalence

(Table 6.2). All 77 collected serum samples of camels and cattle were tested negative for CCHFV.

6.4.3 Distribution of positive-tested ticks on the sampled livestock

The distribution of all CCHFV-positive ticks on cattle and camels is summarized in Table 6.2. Positive ticks were found on 6 of 91 (6.59%) sampled animals. In four cattle, either more than one of the collected ticks were positive or were associated with an increased number of “weak-positive” ticks. In one case, “Cattle no. 1”, all 22 collected ticks were CCHF-positive. In each of the four cattle, one of the collected ticks was highly positive with much higher levels of S-segment RNA (lower ct- value) compared to the other ticks collected from the same bovine. In three cases, these highly positive ticks were identified as H. rufipes and in one case determined to be H. dromedarii. In "Cattle no. 5“, a one single CCHFV-positive tick (H. rufipes) was found, while the remaining seven ticks were negative. All of the three CCHFV-positive ticks collected from "Camel no. 1" were identified as H. dromedarii. The viral S-segment RNA levels were almost identical in all three samples. No “weak-positive” ticks were found on the camels.

6.4.4 Phylogeny of CCHFV genotypes

To determine the CCHFV genotypes the 127bp qRT-PCR amplicons were sequenced. Sequences were obtained for 28 of the 39 positive ticks and compared by using the BLAST tool (NCBI). Essentially, two different CCHFV genotypes, Africa I and Africa III, were found (Table 6.3 / 6.4). Ticks originating from the same animal carried the same CCHFV genotype. However, two different lineages (Africa I and III) circulated simultaneously within ticks sampled from cattle in Idini. (Table 6.3). Lineages also differed between collection sites and/or host species (Table 6.4). The Africa I lineage detected in ticks from cattle (Idini) and camel (Tenweich slaughterhouse) shared nucleotide differences of 3.15 %. Africa III genotypes found in ticks feeding on cattle from Idini and from Rosso varied by 2.17 %. The overall difference between the Africa I and Africa III lineages ranged from 10.04 % between the cattle herd from Idini (I) and Rosso (III) up to a maximum of 13.19 % between camels from Tenweich slaughterhouse (I) and cattle from Rossi/Idini (III). To confirm that the short amplicon

was representative for the whole segment, the complete coding region of the S segment from two CCHFV-positive ticks was RT-PCR amplified and sequenced. Alignments with GenBank database sequences revealed a 97.5 % and 99.4 % nucleotide similarity for the protoypic Africa I and Africa III strains respectively. Construction of a phylogenetic tree (Figure 6.1) shows both sequences cluster well with the reference strains of Africa I (Senegal) and III (Mauritania/Mali).

6.5 Discussion

Previous serological studies have shown a high CCHFV antibody seroprevalence in Mauritanian livestock and several severe CCHFV cases have been reported in humans. Hence, Mauritania is considered to be a high-endemic country for CCHFV (Gonzalez et al., 1990; Kleib et al., 2016; Nabeth et al., 2004a; Saluzzo et al., 1985a; Sas et al., 2017a). CCHF cases were also confirmed in Senegal which boarders Mauritania to the south (Nabeth et al., 2004b; Tall et al., 2009). In Mali, east of Mauritania, no human cases of CCHF have been reported. However, serological data (Maiga et al., 2017) and virus detection in ticks (Zivcec et al., 2014) have proven a CCHFV circulation also in Mali. CCHFV monitoring in ticks (especially of genus Hyalomma) has not yet been conducted systematically in this West African region. Existing data sets are either small-scaled, outdated or were generated by the analysis of tick pools with focus on virus detection and thus allow only limited conclusions on the species of positive ticks (Nabeth et al., 2004a; Saluzzo et al., 1985b; Zeller et al., 1997; Zivcec et al., 2014). Therefore, this study was carried out to provide a better understanding of host-vector dynamics and the current epidemiological situation in Mauritanian livestock herds. The presence of the three tick species H. rufipes, H. dromedarii and H. impeltatum in Mauritania is consistent with previous reports from the region (Apanaskevich and Horak, 2008a, 2009; Apanaskevich et al., 2008). The primary host of H. dromedarii are camels (Apanaskevich et al., 2008), which explains the high number of specimen (97.01 – 98.58 %) found on camels in the Rosso and Tenweich regions (Table 6.1). Due to the important role that camels play as agricultural livestock for milk and meat production in Mauritania, there is a high camel density in the country (Mint Mohamed Lemine et al., 2017). Moreover, cattle and other ungulates can also be infested by adult stages of H. dromedarii (Apanaskevich et al., 2008), especially if camels and cattle are

held in close contact. Thus, the 88.71 % H. dromedarii ticks found on cattle from Idini were not an exceptional finding. The higher rate of male ticks across all four sampling sites (Table 6.2) is probably caused by the absence of female ticks during oviposition, which is taking place in the environment and not on the host itself (Estrada-Pena and de la Fuente, 2014). In total, 39 /1523 (2.56 %) of the blood-fed ticks collected from cattle and camels were CCHFV- positive (Table 6.1). The highest prevalence was found in both cattle herds from Idini (4.79 %) and Rosso (2.63 %), followed by the camels from the Tenweich slaughterhouse (0.85 %). No positive ticks were found on camels from Rosso region. The reasons for different CCHFV prevalences across collection sites and host species are various and require careful interpretation. One explanation could be a difference in susceptibility of cattle and camels for the virus and/or a better capability of cattle to support a long lasting viremia. So far, only a small number of CCHFV infection experiments have been conducted with different livestock (cattle, sheep and horses), which showed that all species developed a short-term viremia of similar duration (Spengler et al., 2016b). However, no experimental data of CCHFV infections with camelids are available to date to prove this assumption. There remains a need for further infection experiments comparing the susceptibility for CCHVF of different host species. The tick species themselves may have an impact on the CCHFV prevalence. Ticks of the genus Hyalomma are considered as main vector and reservoir of CCHFV (Gargili et al., 2017), but it is still unknown whether all of the currently recognized 27 Hyalomma species (Horak et al., 2002; Sands et al., 2017) can function as efficiently as virus reservoir and/or vector. Despite the considerably higher number (79.71 %) of H. dromedarii ticks (Table 6.1), more H. rufipes (5.67 %) than H. dromedarii (1.89 %) ticks were CCHFV-positive. This difference was most obvious among the cattle herd from Idini, where 21.43 % H. rufipes and only 3.72 % H. dromedarii were CCHF-positive. Nevertheless, since our data were derived from blood-fed ticks, speculations about vector competence have to be interpreted cautiously. Co-feeding and/or viremic hosts (Gonzalez et al., 1992; Gordon et al., 1993; Jones et al., 1997; Logan et al., 1990) may have also contributed to the concentrated occurrence of some of the 39 positive ticks collected from 6 (of 91) animals (Table 6.3). Interestingly, one of several positive ticks collected from four bovines in Idini and Rosso (no. 1- 4) each had much higher levels of S-segment RNA than the co-infesting ticks. This observation may indeed indicate

co-feeding infections or viremic host animals. It is also noteworthy that three of four highly positive ticks in Idini (88.76% H. dromedarii vs. 6.94% H. rufipes) were identified as H. rufipes (Table 6.3) which is suggestive for a better vector competence of H. rufipes for CCHFV. Genomic data proving the very exact genome sequence for all ticks from a given bovine support this assumption (Table 6.3 / 6.4). Apparently, as a great number of ticks have been passively infected via blood meal, the true CCHFV prevalence in unfed ticks and thus the absolute risk of exposure to local farmers may be considerably lower than the measured 2.56 %. Nevertheless, it is recommended to enforce tick control strategies and encourage public awareness of tick bite prevention in examined areas. At least two different CCHFV genotypes (Africa I and III) were found in ticks in Mauritania, either alone or even circulating side by side simultaneously as observed in one cattle herd from Idini (Table 6.3 / 6.4).

6.6 Tables

Table 6.1 Overview showing results across all four sampled herds, including the number of specimens of different species, CCHF-positive ticks and analysis for correlation between the three identified species and CCHFV status by chi-square test (p < 0.05).

Traza-Quaduaga-Idini Cattle (n=43) Tenweich slaughterhouse/ market Camel (n=14) Tick species/ positve ticks Tick species/ positve ticks Species n % p Prev./total prev/species n % p Prev./total Prev./species 0 % 0 % 0 % 0 % 0 % 0 Hyalomma sp. 6 0.99 % 0 0 (0-0.06) (0-16.84) (0-1.05) (-) 3.31 % 3.72 % 0.85 % 0.87 % 537 88.76 % 20 346 98.58 % 3 H. dromedarii (2.03-5.06) (2.29-5.69) (0.78-2.48) (0.18-2.51) 0 % 0 % 0 % 0 % 0 H. impeltatum 20 3.31 % 0 0 0 % (0-0.06) (0-16.84) (0-1.05) (-) 1.49 % 21.43 % 0 % 0 % H. rufipes 42 6.94 % 9 5 1.42 % 0

(0.06-2,8) (10.3-36.81) (0-1.05) (0-52.18)

4.79 % p-value: 0.85% p-value: In total 605 29 351 3

(3.23-6.81) 0.001 (0.78-2.48) N.A.*

Rosso region Cattle (n=20) Rosso region Camel (n=14) Tick species/ positve ticks Tick species/ positve ticks Species n % p Prev./total Prev./species n % p Prev./total Prev./species 0 % 0 % 0 % 0 % 0 Hyalomma sp. 0 0 % 0 0 0 % (0-1.38) (-) (0-1.21) (-) 0 % 0 % 0 % 0 % 292 97.01 % 0 H. dromedarii 39 14.66% 0 (0-1.38) (0-9.03) (0-1.21) (0-1.26) 0 % 0 % 0 % 0 % 0 H. impeltatum 0 0 % 0 1 0.33 % (0-1.38) (-) (0-1.21) (0-95.7) 2.63 % 3.08 % 0 % 0 % H. rufipes 227 85.34% 7 8 2.66% 0

(1.06-5.35) (1.25-6.25) (0-1.21) (0-36.94)

2.63 % p-value: 0 % p-value: In total 266 0 301 0

(1.06-5.35) N.A.* (0-1.21) 0.531

Total (n=91) Tick species / positve ticks Species n % p prev/total prev/species 0 % 0 % Hyalomma sp. 6 0.39 % 0 (0-0.24) (0-45.93) 1.51 % 1.89 % H. dromedarii 1214 79.71 % 23 (1.2-2.83) (0.96-2.26) 0 % 0 % H. impeltatum 21 1.38 % 0 (0-0.24) (0-16.11) 1.05 % 5.67 % H. rufipes 282 18.52 % 16 (0.6-1.7) (3.28-9.05) 2.56 % p-value: In total 1523 39 (1.83-3.48) <0.001

n= number of ticks p= number of CCHF-positive ticks prev. = prevalence Hyalomma sp. = not identified species 95 % confidence interval (CI %) in brackets *= no p-value available, because of the absence of H. impeltatum at this sampling site

Table 6.2 Sex distribution of sampled ticks at the different collection sites and correlation between sex and CCHFV status by Fisher's exact test (p < 0.05).

Traza-Quaduaga-Idini Cattle (n=43) Sex n % p Prev./total Prev./sex p-value f 190 31.40 % 8 1.32 % (0.57-2.59) 4.21 % (1.84-8.13) 0.8378 m 415 68.60 % 21 3.47 % (2.16-5.26) 5.06 % (3.16-7.63)

605 29

Tenweich Slaughterhouse Market Camel (n=14) Sex n % p Prev./total Prev./sex p-value f 106 30.20 % 2 0.57 % (0.07-2.04) 1.89 % (0.23-6.65) 0.2178 m 245 69.80 % 1 0.28 % (0-1.58) 0.41 % (0.01-2.25)

351 3

Rosso region Camel (n=14) Sex n % p Prev./total Prev./sex p-value f 83 27.57 % 0 0 % (0-1.22) 0 % (0-4.35) 1 m 218 72.43 % 0 0 % (0-1.22) 0 % (0-1.68)

301 0

Rosso region Cattle (n=20) Sex n % p Prev./total Prev./sex p-value f 59 22.18 % 0 0 % (0-1.38) 0 % (0-6.06) 0.354 m 207 77.82 % 7 2.63% (1.37-6.84) 3.38 % (1.37-6.84)

266 7

Total (n=91) Sex n % p Prev./total Prev./sex p-value f 438 28.76 % 10 0.66 % (0.32-1.2) 2.28 % (1.1-4.16) 0.724 m 1085 71.24 % 29 1.90 % (1.28-2.73) 2.67 % (1.8-3.82)

1523 39 n= number of ticks prev. = prevalence f= female m= male p= number of CCHF-positive ticks 95 % confidence interval (CI %) in brackets

Table 6.3 All sampled animals on which CCHF-positive ticks were found (6 out of 91), including weak-positive tested ticks on those individuals and the species of the most positive sample. The CCHFV genotype was determined by comparing the qRT-PCR product (127 bp) using the BLAST Tool.

Tick sample with the highest ct- value CCHFV genotype Host Region n p (+) Lowest Species (lowest ct- Second-lowest species ct- value value) ct- value Idini Cattle no. 1 22 22 0 18.26 H. rufipes 28.62 Africa I Idini Cattle no. 2 30 1 8 19.44 H. dromedarii 35.22 Africa I Idini Cattle no. 3 22 5 9 19.68 H. rufipes 34.44 Africa I Rosso Cattle no. 4 21 7 3 28.8 H. rufipes 31.52 Africa III Idini Cattle no. 5 8 1 0 26.66 H. rufipes - Africa III Tenweich Camel no. 1 24 3 0 28.67 H. dromedarii (3x) (29.89; 29.56) Africa I In total 127 39 20

n= number of ticks p= positive ticks (+) = weak-positive ticks

Table 6.4 Genetic distances (%) between the CCHFV lineages found in the respective positive ticks on cattle and camels by comparing the qRT-PCR amplicons (127 bp). In all positive ticks originated from the same host animal, both the genotype and the detected gene sequence were identical.

Cattle No.1 Cattle No.2 Cattle No.3 Cattle No.4 Cattle No.5 Camel No.1 Host animal / region/ strain Idini region Idini region Idini region Rosso region Idini region Tenweich region Africa I Africa I Africa I Africa III Africa III Africa I Cattle No.1 Idini region Africa I - 100% 100% 89.96 % 89.76 % 96.85 % Cattle No.2 Idini region Africa I 100% - 100% 89.96 % 89.76 % 96.85 % Cattle No.3 Idini region Africa I 100% 100% - 89.96 % 89.76 % 96.85 % Cattle No.4 Rosso region Africa III 89.96 % 89.96 % 89.96 % - 97.83 % 86.81 % Cattle No.5 Idini region Africa III 89.76 % 89.76 % 89.76 % 97.83 % - 86.81 % Camel No.1 Tenweich region Africa I 96.85 % 96.85 % 96.85 % 86.81 % 86.81 % -

6.7 Figures

DQ211638_Greece 100 Europe-2 (VI) Tick MR_194_Idini DQ211640 Senegal KY484027 Senegal Africa-3 (I) DQ211639 Senegal DQ211650 Kongo KX013485 Uganda Africa-2 (II) DQ076413 Uganda NC_005302 Nigeria CHU88410_Nigeria GQ862372 Sudan KJ682819_South_Africa DQ076415 Uganda 100 Africa-1 (III) KJ682820 Namibia Tick MR 225 Idini KF793333_Mali DQ211641 Mauritania KJ027521_Iran DQ206447 Russia 81 GU477489_Bulgaria GQ337053_Turkey Europe-1 (V) KM201260_Bulgaria JN173797_Russia DQ133507_Yugoslawia DQ211645_Oman JX908640 Afghanistan 64 AF527810_Iran KJ196326_Iran CHU88414_Pakistan Asia-1 (IV) AJ538198_Pakistan HM452305 Afghanistan DQ446214_Iran KY213714_India 65 KC867274_Iran AF481799_Uzbekistan.

AY029157_China CHU88413_China AF358784_China DQ217602_China FJ562093_China KJ676542_Iran_ AY223475_Uzbekistan Asia-2 (IV) AY049083_Tajikistan AY297691_Tajikistan JN572089_India JF922679_India JX051650_India JN572088_India 0.03 KT384399_India

Figure 6.1 Phylogenetic tree showing the genetic relationships of the small (S) segment of the protypic strains and selected CCHFV-positive samples from Mauritania (1384 bp). The tree was generated using Neighbor-Joining algorithm and Jukes-Cantor distance model in Geneious version 2019.2 (Biomatters, available from https://www.geneious.com). The tree was midpoint rooted using FigTree v1.4.4 (available from https://github.com/rambaut/figtree/r

eleases). Values at branches represent support in 1,000 bootstrap replicates. Bootstrap values are only shown at major branches.

6.8 Acknowledgments

We thank Kristin Vorpahl for technical support and Jana Schulz for creating the phylogenetic tree. Moreover, we especially thank Aliou Ba and all Mauritanien collaboration partners for their help collecting the tick samples in Mauritania. This study was co-funded by the German Office for Foreign Affairs (German Partnership Program for Biosecurity), by the Deutsche Forschungsgemeinschaft (grant number: GR 980/4- 1) as well as by the European Union (LEAP-AGRI LEARN project (ID 222).

7 GENERAL DISCUSSION

Crimean-Congo hemorrhagic orthonairovirus virus is found throughout South / South- East Europe and wide parts of Asia and Africa. Its main reservoir and vector are ticks of the genus Hyalomma. Humans can develop severe hemorrhagic fever symptoms following a CCHFV infection, while other susceptible host species do not show any clinical signs (Hoogstraal, 1979; Whitehouse, 2004). Therefore, CCHF is considered to be one of the most-wide spread arthropod-borne zoonosis. The absence of clinical manifestations in livestock or wildlife makes it even more difficult to render potential risk areas (Spengler et al., 2016a; Spengler et al., 2016b). Turkey is supposed to be a CCHFV hot spot due to a high number of annual human outbreaks, but despite the numerous confirmed cases the CFR is comparatively low (Ergonul, 2006; Ergonul et al., 2006b). At the same time, it is also one of the best investigated countries regarding virus epidemiology and treatment of CCHF patients including a high level of awareness among the public health system as well as the population towards the exposure risk (Akinci et al., 2009; Leblebicioglu, 2010). Although Hyalomma ticks are found across the entire African continent, current knowledge about CCHFV in Africa is more like a patchwork of isolated confirmed human cases and prevalence studies (Estrada-Pena and de la Fuente, 2014; Gargili et al., 2017). It can be assumed that especially in sub- Saharan Africa a high number of CCHFV infections are unreported, due to inadequate health systems or lack of infrastructure. Therefore, it is essential to conduct comprehensive field studies on CCHFV in both susceptible hosts and ticks to fill these gaps in knowledge. Furthermore, it was recognized that the detection of pathogens in ticks constitutes only one part of this challenge. At least the same emphasis should be laid on the correct identification of the tick species in order to avoid false conclusions about the CCHFV status of the tick respectively further vector competence assumptions (Estrada-Pena et al., 2013; Gargili et al., 2017). Mauritania in West Africa is a sparsely populated country, providing ideal habitats for Hyalomma ticks with its arid Saharan landscape and a high livestock density (Messina et al., 2015). Until now, only few studies on CCHFV have been conducted in Mauritania and therefore it was selected for this work. Keeping of livestock represents an important means of securing the livelihood for a large proportion of the Mauritanian population and constitutes an integral aspect of the society because of the nomadic culture. Due to the widespread traditional husbandry, farmers are often in close contact

with their animals, which, in combination with low animal health standards, increases the risk of contracting zoonotic diseases such as CCHF dramatically. Serological detection of CCHFV-specific antibodies in livestock can provide a first evidence whether the virus is circulating in a particular region. Instead of comparative studies between different livestock breeds, previous serological investigations in Mauritania were usually limited to one species at a time. Interestingly, earlier data showed a noticeable difference in IgG prevalence between sheep (Gonzalez et al. (1990); Nabeth et al. (2004a): 18 %) and cattle (Sas et al. (2017a): 67 %). Therefore, a survey (manuscript I) was conducted testing the four most important livestock species in Mauritania (cattle, n= 201; sheep, n= 247; goats, n= 233; camels, n= 247) for CCHFV- specific IgG antibodies. In addition, potential risk factors that may influence the seroprevalence were searched for. To date, only a small number of goats (n= 27) have been examined in Mauretania for CCHFV (Nabeth et al., 2004a) while camels have not been tested at all. For the screening of the small and large ruminants, several already established in-house and adapted commercial assays were available, which were applied according to the diagnostic approach of Mertens et al. (2009). The in- house ELISAs for cattle, sheep and goats are based on the N-protein of the European strain Kosovo Hoti (genotype V), whereas the adapted commercial VectorBest ELISA uses the Asian strain UZ10145 (genotype IV). The third method used was a commercial, species-adapted IFA from Euroimmun, which is based on the Nigerian reference strain for genotype III (IbAr10200). The IFA was only applied as decision support to judge questionable samples of the previous ELISA test runs. The high genetic diversity still constitutes one of the major challenges for CCHFV diagnostics. The usage of assays based on N-proteins of three different lineages improves the diagnostic range for detecting antibodies against different CCHFV strains. On the other hand, it may also be responsible that the three tests do not always coincide completely. Since no in-house ELISA for camelids was available, it was necessary to establish a new assay based on the protocol of Mertens et al. (2015). For the validation, 42 sera of dromedary camels were used as negative reference samples from Australia, which is considered free of CCHFV according to the WHO. With the exception of two samples, showing widely differing OD values in each test run, all of them were clearly negative. Unspecific immune reactions or cross reactivity with other unknown orthonairoviruses may be responsible for the two outliers. Furthermore, the detection of a distinct immune response in the serum of the immunized alpaca from the 14th day

onwards supports the validity of the ELISA in terms of specific reactions. This study reports the highest CCHFV seroprevalence in cattle (69 %) and camels (81 %), while sheep (16 %) and goats (15 %) were significantly less positive for IgG antibodies, thus confirming the previous findings (Gonzalez et al., 1990; Nabeth et al., 2004a; Sas et al., 2017a). So far, there are no data on CCHFV seroprevalence in camels in Mauritania available, but recent studies from Sudan (Suliman et al., 2017) and the United Arab Emirates (Camp et al., 2020) revealed prevalences of 21 % up to 67 % in camelids. Overall, cattle and camels had significant higher IgG seroprevalence than sheep and goats. The reasons for this discrepancy can be various, but the age of the tested animals seems to have an important impact on the CCHFV seroprevalence, which was already shown among sheep (Wilson et al., 1990) and cattle (Akinci et al., 2009; Ibrahim et al., 2015; Lotfollahzadeh et al., 2011; Mohamed et al., 2008). This effect was also observed within our study. Animals of all four examined species in the older age groups (3-4 years and older) had a significantly higher antibody prevalence than younger individuals. However, significant higher CCHFV antibody prevalence was found in cattle and camels (37 % / 25 %) of younger age groups (0-2 years) compared to sheep and goats of the same age group (8 % / 8 %). Cattle and camels also had higher average ages (Øage: 10.17/ 11.55) over small ruminants (Øage: 2.91/ 2.88), which is most likely one reason for the large difference in seroprevalence. A higher age coincides with a greater chance that an infected tick bit the individual animal. Unfortunately, only few long-term studies on CCHFV susceptibility and antibody persistence have been carried out so far. Nevertheless, antibodies up to 512 dpi (Cape ground squirrel) were detected in wildlife (Shepherd et al., 1989) and in humans even up to 5 years after a recovered CCHF infection (Yadav et al., 2019). Apart from age and host susceptibility, the husbandry conditions of the livestock also play an important role affecting the seroprevalence. It was reported for cattle and small ruminants that the grazing system, type of vegetation, tick treatment and the presence of poultry picking ticks can significantly influence the prevalence status (Ibrahim et al., 2015; Kasi et al., 2020a). These parameters might also explain the higher prevalence found in cattle and camel compared to the small ruminants of the same age groups. To sum up, the first study demonstrates that cattle and camels have a significantly higher seroprevalence than small ruminants, which is partly related to the higher age of the tested animals, but husbandry conditions may also be an influencing factor. Comparative studies on CCHFV susceptibility between different livestock are urgently

required to determine which species pose a particular risk of infection. However, whether the virus actually circulates in specific regions can only be proven by direct virus detection. Since susceptible host animals only develop a short-term viremia (Spengler et al., 2016b), the screening of Hyalomma ticks (the main reservoir and vector of CCHFV) represents a well-suited method for the detection of viral RNA. In this context, Gargili et al. (2017) postulated that correct vector species identification is as important as the pathogen detection itself. Therefore, the second manuscript addressed the establishment of different molecular species differentiation methodologies such as MALDI-TOF MS and RFLP. Although morphological species identification is the fastest and most cost-effective approach, it requires well-trained tick experts to avoid incorrect species identification. Hybridization (Rees et al., 2003) and different genetic clades (Cangi et al., 2013) may also not be detected by morphological determination. MALDI-TOF MS based on leg proteins performed well for tick species identification. The per-sample costs for reagents are low and all six examined Hyalomma species (H. rufipes, H. truncatum, H. marginatum, H. dromedarii, H. scupense, H. nitidum), as well as the ticks of other genera which were used as outgroups, could be clearly distinguished. Moreover, it was even possible to differentiate between the genetically questionable species H. truncatum and H. nitidum. However, it turned out that ticks from laboratory colonies were much easier to distinguish compared to those originating from field samplings, as they are less likely to be contaminated with environmental dust and dirt or foreign proteins from the host animal, which influence the mass-spectrometric analyses. Since the availability of expensive mass spectrometers can limit its application, an alternative approach such as RFLP was considered that would allow ticks to be identified directly on- site during field collections e.g. in developing countries. For this purpose, a primer pair for the CO1 gene segment of different Hyalomma species was selected and two different restriction enzymes (AluI, HinfI) were used to digest the CO1 amplicon (495 bp). The ticks were differentiated by their species-specific gel pattern. Using this approach, all species could be distinguished except H. truncatum and H. nitidum. A sequence comparison using the Blast Tool (NCBI) also yielded no conclusive results, while the MALDI-TOF MS analysis showed a noticeable difference between species. The distinction between these two ticks presents a general problem, as to date it is not clear whether H. nitidum is a distinct species or just a morphological variety of H. truncatum (Apanaskevich and Horak, 2008b; Sands et al., 2017; Tomassone et al., 2005). Further

genetic investigations are required for a more meaningful statement regarding the relationship between these two species. RFLP has proven to be an alternative molecular approach for species identification due to its feasibility, high sample throughput and reliable test results. In conclusion, these molecular discrimination tools provided an important cornerstone for the third manuscript on the viral detection in 1523 Hyalomma ticks collected from livestock in Mauritania. Special emphasis was laid on a correct species identification, which could be ensured by RFLP and CO1 sequencing. Based on the significantly higher seroprevalences reported by the first manuscript, cattle and camels were selected for this study to increase the chance to detecting positive ticks. Previous tick collection data sets are either outdated (Saluzzo et al., 1985b) or were only conducted on a very small scale (Nabeth et al., 2004a). Therefore, this study was carried out to obtain a better understanding of host vector dynamics and the current epidemiological situation in selected Mauritanian livestock. Of the 1523 ticks collected, H. dromedarii (n= 1214) made up by far the largest proportion followed by H. rufipes (n= 282) and H. impeltatum (n= 21). Overall, 219 ticks were identified by RFLP including 47 specimens, which were additionally sequenced using the CO1 amplicon to unambiguously identify the species. While H. dromedarii (97.01- 98.58 %) clearly dominated in the two sampled camel herds, more H. rufipes were found among the cattle (6.94- 85.34 %). Since the primary host of adult H. dromedarii are camels (Apanaskevich et al., 2008), which play an important role in Mauritania for milk and meat production, the high number of specimens found on camels and cattle was not an exceptional finding. In total, 39 of 1523 (2.56 %) of the blood-fed ticks collected from cattle and camels were CCHF- positive. The highest prevalence was found in both cattle herds from Idini (4.79 %) and Rosso (2.63 %), whereas less positive ticks where detected in the two camels herds (0.85 % / 0%). These findings seems to contradict with the serological observations from the first manuscript, which reported highest seroprevalence in camels. However, it must be mentioned that no significant difference in IgG prevalence between cattle and camels was observed either. Differences in susceptibility of cattle and camels for the virus and/or a better capability of cattle to support a long-lasting viremia could be a one explanation, but as there are no comparative studies on the susceptibility, this assumption remains speculation (Spengler et al., 2016b). Interestingly, despite the high proportion of H. dromedarii, significantly more H. rufipes (5.67 %) compared to H. dromedarii (1.89 %) or H. impeltatum (0 %) were positive for CCHFV. This may

indicate that the tick species itself also has an influence on the prevalence. However, since the data derived from blood-fed ticks, conclusions about vector competence must be interpreted cautiously (Gargili et al., 2017). In total, the positive ticks were concentrated in only 6 of 91 animals examined, which was most likely caused by viremic hosts or the described effect of co-feeding (Akinci et al., 2009; Gonzalez et al., 1992; Gordon et al., 1993; Jones et al., 1997; Logan et al., 1990). This would also imply that the true prevalence of unfed ticks is probably lower since a considerable number of ticks will have been passively infected during the blood meal. Further investigations of non-engorged Hyalomma specimen would be advisable to determine the absolute infection rate of unfed ticks. The sequencing of the positive ticks revealed that two different CCHFV genotypes (Africa I and III) were circulating in the examined livestock herds, which is consistent with previous isolated strains from Mauritania. By analyzing the positive ticks from the cattle in Idini, we were also able to demonstrate that both genotypes can occur simultaneously in one herd. In summary, this study is a complementary follow-up to the first manuscript, providing valuable information on host-vector relationships and the actual virus prevalence in Mauritania. The great proportion of CCHFV-positive Hyalomma ticks supports the previously observed high IgG seroprevalence in Mauritanian livestock. Moreover, molecular identification methods of the second manuscript have been proven as a very useful instrument to distinguish morphologically questionable species even in larger numbers of samples.

8 SUMMARY

Ansgar Schulz

CCHFV is distributed over wide parts of Asia, South/ Southeast Europe and the African continent. Although the virus was found in several tick species of different genera, Hyalomma ticks are considered to be the main vector and reservoir of the virus. While susceptible livestock and wildlife do not show clinical signs of illness, humans can develop severe Ebola-like hemorrhagic symptoms. Apart from bites of infected ticks, main transmission routes for humans are direct contact with infectious blood or body fluids from animals or humans. Sound knowledge about the distribution and ecology of CCHFV exists only in a few countries such as Turkey or South Africa. In contrast, only insufficient information on the virus epidemiology is available for many other endemic regions. Although there have been recurrent human outbreaks of CCHFV in sub- Saharan Africa in the past, African countries have been neglected in terms of comprehensive CCHFV studies for the last decades. Mauritania in West Africa is considered to be a high-endemic country for CCHFV because of several confirmed human case reports. Due to dry desert landscape with only little vegetation and a high density of livestock, it provides an ideal habitat for the Hyalomma ticks, which prefer a warm and arid climate. Furthermore, traditional animal husbandry systems and low animal hygiene standards increase the risk of contracting zoonotic diseases such as CCHFV. Therefore, one of the main objectives of this thesis was to conduct detailed prevalence studies in both susceptible livestock and Hyalomma ticks, in order to obtain a better understanding of the current epidemiological situation and host-vector relationships in Mauritania. The detection of IgG antibodies in livestock can provide an initial indication whether the virus circulated in a certain region. The first manuscript revealed a high CCHFV-IgG seroprevalence ranging from 15 to 81 % among the four most important Mauritanian livestock breeds and emphasized two risk factors (age and species) responsible for high prevalence. Older camels and cattle examined were significantly more positive for CCHFV than the four times younger small ruminants.

Future CCHFV prevalence studies should at least take into account the age of the surveyed animals to minimize misinterpretations. In addition, the newly developed camel specific IgG ELISA is a useful diagnostic tool that allows further CCHFV seroprevalence studies in camels. Based on this data Hyalomma ticks were collected from cattle and camel and screened for viral RNA to render the actual CCHFV prevalence in Mauritania. Thereby, correct identification of the vector species constituted a major aspect of this work and was ensured by different, novel established molecular discrimination approaches described in the second manuscript. For this purpose, six different Afrotropical and Palearctic Hyalomma species were differentiated genetically (CO1 sequencing, RFLP) and by molecular phenotyping (MALDI-TOF MS). By using MALDI-TOF MS, we were able to distinguish all six Hyalomma species, even the phylogenetically questionable species H. truncatum and H. nitidum. Although RFLP and CO1 sequencing could not distinguish between these two species, they provided reliable results and allowed a high sample throughput. Out of 1523 Hyalomma ticks collected from cattle and camels in Mauritania, 219 specimens were molecularly identified by RFLP and CO1 sequencing. Moreover, the PCR results of the third manuscript revealed a high CCHFV prevalence (2.56 %) in blood-fed Hyalomma ticks, whereas H. rufipes showed significantly higher CCHF infection rates compared to H. dromedarii and H. impeltatum. The actual prevalence of unfed ticks is probably lower than this high number of infected ticks would suggest since a considerable number of ticks will have been passively infected while feeding on the viremic blood or through the effect of co-feeding. Moreover, the sequencing of positive ticks demonstrated that two different genotypes (Africa I and III) were circulating in the examined herds, which is consistent with previous isolated strains. In summary, this thesis provides a comprehensive up-to-date overview of the current CCHFV distribution in susceptible host and vector species in Mauritania. The acquired data should contribute for a better understanding of the complex and obscure epidemiological situation of the virus in Sub-Saharan Africa. Future studies should particularly focus on differences in CCHFV vector competence, which may occur between the different Hyalomma species. However, due to the high prevalence of CCHFV in ticks and livestock, tick prevention and control measures should be implemented to minimize the risk of CCHFV infection of local farmers.

9 ZUSAMMENFASSUNG

Prävalenzstudien zum Krim-Kongo Hämorrhagischen Fieber Virus (CCHFV) bei verschiedenen Nutztieren in Sahara-Afrika und die molekulare Charakterisierung von Hyalomma-Zecken, dem Hauptreservoir und Vektor des Virus

Ansgar Schulz

Das Krim-Kongo Hämorrhagische Fieber Virus (CCHFV) ist über weite Teile Asiens, Süd-/Südosteuropas und dem afrikanischen Kontinent verbreitet. Hyalomma-Zecken werden als Hauptvektor und Reservoir des Virus angesehen, obwohl es bereits in anderen Zeckenarten verschiedener Gattungen nachgewiesen wurde. Während für das Virus empfängliche Nutz- und Wildtiere keine klinischen Krankheitssymptome zeigen, können Menschen eine schwere Ebola-ähnliche hämorrhagische Fiebererkrankung entwickeln. Abgesehen von den Stichen infizierter Zecken besteht der Hauptübertragungsweg für den Menschen im direkten Kontakt zu infektiösem Blut oder Körperflüssigkeiten von infizierten Menschen und Tieren. Fundierte Kenntnisse über die Verbreitung und Ökologie von CCHFV sind nur für einige wenige Länder, wie z.B. die Türkei oder Südafrika, vorhanden. Für viele andere endemische Regionen dagegen, liegen nur unzureichende Informationen über die gegenwärtige Virusepidemiologie vor. Obwohl in der Vergangenheit immer wieder über klinisch- manifestierte Infektionen beim Menschen in Subsahara-Afrika berichtet wurde, sind nur wenige umfangreiche Studien zu CCHFV in afrikanischen Ländern durchgeführt worden. Im westafrikanische Land Mauretanien gilt CCHFV aufgrund mehrerer bestätigter humaner Fallberichte als stark endemisch. Wegen seiner trockenen Wüstenlandschaft mit nur spärlicher Vegetation und einer hohen Viehdichte bietet Mauretanien ein ideales Habitat für Hyalomma-Zecken, welche ein warmes und trockenes Klima bevorzugen. Darüber hinaus wird das Risiko an zoonotischen Krankheiten wie CCHF zu erkranken durch die weitverbreitete traditionelle Tierhaltung und die niedrigen Tierhygienestandards stark erhöht. Eines der Hauptziele dieser Arbeit war es daher, detaillierte Prävalenzstudien sowohl bei empfänglichen Nutztieren als auch bei Hyalomma-Zecken durchzuführen, um ein besseres Verständnis über die aktuelle epidemiologische Situation und die Wirt-Vektor-Beziehungen in Mauretanien

zu erhalten. Der Nachweis von IgG-Antikörpern bei Nutztieren kann ein erstes Indiz dafür liefern, ob das Virus in einer bestimmten Region bereits aufgetreten ist oder zirkuliert. Die erste Studie offenbarte eine hohe CCHFV-IgG-Seroprävalenz (15- 81 %) bei den vier wichtigsten mauretanischen Nutztierrassen und hob in diesem Zusammenhang zwei Risikofaktoren (Alter und Art) hervor, die wahrscheinlich mit der hohen Prävalenz zusammenhängen. Insbesondere bei den älteren Kamelen und Rindern, die untersucht wurden, waren signifikant mehr Tiere positiv für CCHFV als bei den deutlich jüngeren beprobten kleinen Wiederkäuern. Zukünftige CCHFV- Prävalenzstudien sollten daher stets das Alter der untersuchten Tiere berücksichtigen, um Fehlinterpretationen bezüglich der Aussagen zur Seroprävalenz bestimmter Tiere zu vermeiden. Darüber hinaus eröffnet der neu entwickelte kamelspezifische IgG- ELISA Möglichkeiten zur Durchführung weiterer CCHFV-Seroprävalenzstudien bei Kamelen. Auf der Grundlage dieser Daten der ersten Studie wurden Hyalomma- Zecken von Rindern und Kamelen gesammelt und auf Virus-RNA untersucht, um die tatsächliche CCHFV-Prävalenz in Mauretanien zu ermitteln. Die korrekte Identifizierung der Vektorarten stellte dabei einen wichtigen Aspekt dieser Studie dar, was durch verschiedene, neu etablierte molekulare Speziesbestimmungsmethoden, beschrieben in dem zweiten Manuskript, gewährleistet werden konnte. Für die Etablierung wurden sechs verschiedene afrotropische und paläarktische Hyalomma- Arten sowohl genetisch (CO1-Sequenzierung, RFLP) als auch durch molekulare Phänotypisierung (MALDI-TOF MS) differenziert. Mit Hilfe von MALDI-TOF MS konnten alle sechs Hyalomma-Arten, einschließlich der phylogenetisch umstrittenen Arten H. truncatum und H. nitidum, unterschieden werden. Obwohl die Verwendung von RFLP- und CO1-Sequenzierung keine eindeutige Unterscheidung zwischen diesen beiden Spezies erlaubte, lieferten sie doch zuverlässige Ergebnisse bei einem hohen Probendurchsatz. Von 1523 Hyalomma-Zecken, die von Rindern und Kamelen in Mauretanien gesammelt wurden, konnten 219 Proben mit Hilfe von RFLP- und CO1- Sequenzierung nachträglich molekular identifiziert werden. Die PCR-Untersuchungen dieser dritten Studie, zeigten eine hohe CCHFV-Prävalenz (2,56 %) bei blutgefüllten Hyalomma-Zecken, wobei H. rufipes im Vergleich zu H. dromedarii und H. impeltatum signifikant höhere CCHF-Infektionsraten aufwiesen. Die tatsächliche Virusprävalenz in ungesogenen Zecken ist jedoch wahrscheinlich deutlich geringer als es der hohe Anteil positiver Zecken vermuten lässt, da anzunehmen ist, dass eine beträchtliche Anzahl von Zecken passiv durch die Aufnahme von virämischem Blut oder dem „Co-Feeding“-

Effekt horizontal infiziert wurde. Die Sequenzierung der positiven Zecken zeigte darüber hinaus, dass in den untersuchten Herden zwei unterschiedliche Virusstämme (Afrika I und III) zirkulierten. Diese Ergebnisse stimmen auch mit den früheren isolierten Genotypen aus Mauretanien überein. Zusammenfassend betrachtet bietet die Arbeit einen Überblick über die aktuelle Verbreitung von CCHFV in empfänglichen Wirts- und Vektorarten in Mauretanien. Die gewonnenen Daten und Erkenntnisse tragen zu einem besseren Verständnis der komplexen und unübersichtlichen epidemiologischen Situation des Virus in Subsahara-Afrika bei. Zukünftige Studien sind nötig und sollten sich vor allem auf mögliche Unterschiede im CCHFV- Vektorkompetenzverhalten bei den verschiedenen Hyalomma-Arten konzentrieren. Aufgrund der hohen Prävalenz von CCHFV in Zecken und Tieren ist es wichtig, Maßnahmen zur Zeckenprävention und -bekämpfung durchzuführen, um das Risiko einer CCHFV-Infektion der lokalen Bevölkerung in Mauretanien zu minimieren.

10 BIBLIOGRAPHY

Akinci, E., Yilmaz, M., Bodur, H., Onguru, P., Bayazit, F.N., Erbay, A., Ozet, G., 2009. Analysis of lymphocyte subgroups in Crimean-Congo hemorrhagic fever. International journal of infectious diseases : IJID : official publication of the International Society for Infectious Diseases 13, 560-563. Altamura, L.A., Bertolotti-Ciarlet, A., Teigler, J., Paragas, J., Schmaljohn, C.S., Doms, R.W., 2007. Identification of a novel C-terminal cleavage of Crimean-Congo hemorrhagic fever virus PreGN that leads to generation of an NSM protein. J Virol 81, 6632-6642. Apanaskevich, D.A., 2002. Identification of species of Hyalomma asiaticum group (Ixodidae) in areas of their sympatry based on immature stages. Parazitologiia. 36, 271-279. Apanaskevich, D.A., Filippova, N.A., Horak, I.G., 2010. The genus Hyalomma Koch, 1844. x. redescription of all parasitic stages of H. (Euhyalomma) scupense Schulze, 1919 (= H. detritum Schulze) (Acari: Ixodidae) and notes on its biology. Folia parasitologica 57, 69-78. Apanaskevich, D.A., Horak, I.G., 2008a. The genus Hyalomma Koch, 1844: V. re- evaluation of the taxonomic rank of taxa comprising the H. (Euhyalomma) marginatum Koch complex of species (Acari : Ixodidae) with redescription of all parasitic stages and notes on biology. Int J Acarol 34, 13-42. Apanaskevich, D.A., Horak, I.G., 2008b. The genus Hyalomma. VI. Systematics of H. (Euhyalomma) truncatum and the closely related species, H. (E.) albiparmatum and H. (E.) nitidum (Acari: Ixodidae). Experimental & applied acarology 44, 115- 136. Apanaskevich, D.A., Horak, I.G., 2009. The genus Hyalomma Koch, 1844. IX. Redescription of all parasitic stages of H. (Euhyalomma) impeltatum Schulze & Schlottke, 1930 and H. (E.) somalicum Tonelli Rondelli, 1935 (Acari: Ixodidae). Systematic parasitology 73, 199-218. Apanaskevich, D.A., Schuster, A.L., Horak, I.G., 2008. The genus Hyalomma: VII. Redescription of all parasitic stages of H. (Euhyalomma) dromedarii and H. (E.) schulzei (Acari: Ixodidae). Journal of medical entomology 45, 817-831. Atif, M., Saqib, A., Ikram, R., Sarwar, M.R., Scahill, S., 2017. The reasons why Pakistan might be at high risk of Crimean Congo haemorrhagic fever epidemic; a scoping review of the literature. Virol J 14, 63. Atkinson, B., Chamberlain, J., Logue, C.H., Cook, N., Bruce, C., Dowall, S.D., Hewson, R., 2012. Development of a real-time RT-PCR assay for the detection of Crimean-Congo hemorrhagic fever virus. Vector borne and zoonotic diseases 12, 786-793. Balinandi, S., Patel, K., Ojwang, J., Kyondo, J., Mulei, S., Tumusiime, A., Lubwama, B., Nyakarahuka, L., Klena, J.D., Lutwama, J., Strher, U., Nichol, S.T., Shoemaker, T.R., 2018. Investigation of an isolated case of human Crimean- Congo hemorrhagic fever in Central Uganda, 2015. International journal of infectious diseases : IJID : official publication of the International Society for Infectious Diseases 68, 88-93. Barnwal, B., Karlberg, H., Mirazimi, A., Tan, Y.J., 2016. The Non-structural Protein of Crimean-Congo Hemorrhagic Fever Virus Disrupts the Mitochondrial Membrane Potential and Induces Apoptosis. J Biol Chem 291, 582-592. Begum, F., Wisseman, C.L., Jr., Casals, J., 1970. Tick-borne viruses of West Pakistan. IV. Viruses similar to or identical with, Crimean hemorrhagic fever (Congo-

Semunya), Wad Medani and Pak Argas 461 isolated from ticks of the Changa Manga Forest, Lahore District, and of Hunza, Gilgit Agency, W. Pakistan. Am J Epidemiol 92, 197-202. Bente, D.A., Forrester, N.L., Watts, D.M., McAuley, A.J., Whitehouse, C.A., Bray, M., 2013. Crimean-Congo hemorrhagic fever: history, epidemiology, pathogenesis, clinical syndrome and genetic diversity. Antiviral research 100, 159-189. Bereczky, S., Lindegren, G., Karlberg, H., Akerstrom, S., Klingstrom, J., Mirazimi, A., 2010. Crimean-Congo hemorrhagic fever virus infection is lethal for adult type I interferon receptor-knockout mice. J Gen Virol 91, 1473-1477. Bergermann, S., Schol, H., Gobel, E., Gothe, R., 1997. Morphology of the eyes in adult Hyalomma truncatum ticks (Acari: Ixodidae). Experimental & applied acarology 21, 21-39. Bergeron, E., Albarino, C.G., Khristova, M.L., Nichol, S.T., 2010. Crimean-Congo hemorrhagic fever virus-encoded ovarian tumor protease activity is dispensable for virus RNA polymerase function. J Virol 84, 216-226. Bergeron, E., Vincent, M.J., Nichol, S.T., 2007. Crimean-Congo hemorrhagic fever virus glycoprotein processing by the endoprotease SKI-1/S1P is critical for virus infectivity. J Virol 81, 13271-13276. Bertolotti-Ciarlet, A., Smith, J., Strecker, K., Paragas, J., Altamura, L.A., McFalls, J.M., Frias-Staheli, N., Garcia-Sastre, A., Schmaljohn, C.S., Doms, R.W., 2005. Cellular localization and antigenic characterization of crimean-congo hemorrhagic fever virus glycoproteins. J Virol 79, 6152-6161. Bland, J.M., Altman, D.G., 1999. Measuring agreement in method comparison studies. Stat Methods Med Res 8, 135-160. Boucheikhchoukh, M., Laroche, M., Aouadi, A., Dib, L., Benakhla, A., Raoult, D., Parola, P., 2018. MALDI-TOF MS identification of ticks of domestic and wild animals in Algeria and molecular detection of associated microorganisms. Comp. Immunol. Microbiol. Infect. Dis. Bower, H., El Karsany, M., Alzain, M., Gannon, B., Mohamed, R., Mahmoud, I., Eldegail, M., Taha, R., Osman, A., Mohamednour, S., Semper, A., Atkinson, B., Carter, D., Dowall, S., Furneaux, J., Graham, V., Mellors, J., Osborne, J., Pullan, S.T., Slack, G.S., Brooks, T., Hewson, R., Beeching, N.J., Whitworth, J., Bausch, D.G., Fletcher, T.E., 2019. Detection of Crimean-Congo Haemorrhagic Fever cases in a severe undifferentiated febrile illness outbreak in the Federal Republic of Sudan: A retrospective epidemiological and diagnostic cohort study. PLoS neglected tropical diseases 13, e0007571. Burt, F.J., Swanepoel, R., Shieh, W.J., Smith, J.F., Leman, P.A., Greer, P.W., Coffield, L.M., Rollin, P.E., Ksiazek, T.G., Peters, C.J., Zaki, S.R., 1997. Immunohistochemical and in situ localization of Crimean-Congo hemorrhagic fever (CCHF) virus in human tissues and implications for CCHF pathogenesis. Arch Pathol Lab Med 121, 839-846. Camp, J.V., Ahmed, D., Osman, B.M., Shah, M.S., Howarth, B., Khafaga, T., Weidinger, P., Karuvantevida, N., Kolodziejek, J., Mazrooei, H., Wolf, N., Loney, T., Nowotny, N., 2020. Crimean-Congo Hemorrhagic Fever Virus Endemicity in United Arab Emirates, 2019. Emerg Infect Dis 26. Cangi, N., Horak, I.G., Apanaskevich, D.A., Matthee, S., das Neves, L.C., Estrada- Pena, A., Matthee, C.A., 2013. The influence of interspecific competition and host preference on the phylogeography of two African ixodid tick species. PloS one 8, e76930. Casals, J., 1969. Antigenic similarity between the virus causing Crimean hemorrhagic fever and Congo virus. Proc Soc Exp Biol Med 131, 233-236.

Casals, J., Henderson, B.E., Hoogstraal, H., Johnson, K.M., Shelokov, A., 1970. A review of Soviet viral hemorrhagic fevers, 1969. J Infect Dis 122, 437-453. Causey, O.R., Kemp, G.E., Madbouly, M.H., David-West, T.S., 1970. Congo virus from domestic livestock, African hedgehog, and arthropods in Nigeria. Am J Trop Med Hyg 19, 846-850. Champour, M., Mohammadi, G., Chinikar, S., Razmi, G., Shah-Hosseini, N., Khakifirouz, S., Mostafavi, E., Jalali, T., 2014. Seroepidemiology of Crimean- Congo hemorrhagic fever virus in one-humped camels (Camelus dromedarius) population in northeast of Iran. J Vector Borne Dis 51, 62-65. Chinikar, S., Ghiasi, S.M., Moradi, M., Goya, M.M., Shirzadi, M.R., Zeinali, M., Meshkat, M., Bouloy, M., 2010. Geographical distribution and surveillance of Crimean-Congo hemorrhagic fever in Iran. Vector borne and zoonotic diseases 10, 705-708. Chitimia-Dobler, L., Issa, M.H., Ezalden, M.E., Yagoub, I.A., Abdalla, M.A., Bakhiet, A.O., Schaper, S., Riess, R., Vollmar, P., Grumbach, A., Bestehorn, M., Antwerpen, M., Dobler, G., Shuaib, Y.A., 2019a. Crimean-Congo haemorrhagic fever virus in Hyalomma impeltatum ticks from North Kordofan, the Sudan. International journal of infectious diseases : IJID : official publication of the International Society for Infectious Diseases 89, 81-83. Chitimia-Dobler, L., Nava, S., Bestehorn, M., Dobler, G., Wolfel, S., 2016. First detection of Hyalomma rufipes in Germany. Ticks and tick-borne diseases 7, 1135-1138. Chitimia-Dobler, L., Schaper, S., Riess, R., Bitterwolf, K., Frangoulidis, D., Bestehorn, M., Springer, A., Oehme, R., Drehmann, M., Lindau, A., Mackenstedt, U., Strube, C., Dobler, G., 2019b. Imported Hyalomma ticks in Germany in 2018. Parasites & vectors 12, 134. Chumakov, M.P., 1965. A short review of the investigation of the virus of Crimean hemorrhagic fever [Russian; NAMRU-3 translation T189]. Endemic Viral Infections vol. 7. Clerex-Van Haaster, C.M., Clerex, J.P., Ushijima, H., Akashi, H., Fuller, F., Bishop, D.H., 1982. The 3' terminal RNA sequences of bunyaviruses and nairoviruses (Bunyaviridae): evidence of end sequence generic differences within the virus family. J Gen Virol 61 (Pt 2), 289-292. Connolly-Andersen, A.M., Douagi, I., Kraus, A.A., Mirazimi, A., 2009. Crimean Congo hemorrhagic fever virus infects human monocyte-derived dendritic cells. Virology 390, 157-162. Deyde, V.M., Khristova, M.L., Rollin, P.E., Ksiazek, T.G., Nichol, S.T., 2006. Crimean- Congo hemorrhagic fever virus genomics and global diversity. J Virol 80, 8834- 8842. Diarra, A.Z., Almeras, L., Laroche, M., Berenger, J.M., Kone, A.K., Bocoum, Z., Dabo, A., Doumbo, O., Raoult, D., Parola, P., 2017. Molecular and MALDI-TOF identification of ticks and tick-associated bacteria in Mali. PLoS Negl Trop Dis. 11, e0005762. 10.1371/journal.pntd.0005762. Dickson, D.L., Turell, M.J., 1992. Replication and tissue tropisms of Crimean-Congo hemorrhagic fever virus in experimentally infected adult Hyalomma truncatum (Acari: Ixodidae). Journal of medical entomology 29, 767-773. Dowall, S.D., Findlay-Wilson, S., Rayner, E., Pearson, G., Pickersgill, J., Rule, A., Merredew, N., Smith, H., Chamberlain, J., Hewson, R., 2012. Hazara virus infection is lethal for adult type I interferon receptor-knockout mice and may act as a surrogate for infection with the human-pathogenic Crimean-Congo hemorrhagic fever virus. J Gen Virol 93, 560-564.

Duh, D., Nichol, S.T., Khristova, M.L., Saksida, A., Hafner-Bratkovic, I., Petrovec, M., Dedushaj, I., Ahmeti, S., Avsic-Zupanc, T., 2008. The complete genome sequence of a Crimean-Congo hemorrhagic fever virus isolated from an endemic region in Kosovo. Virol J 5, 7. Duh, D., Saksida, A., Petrovec, M., Dedushaj, I., Avsic-Zupanc, T., 2006. Novel one- step real-time RT-PCR assay for rapid and specific diagnosis of Crimean-Congo hemorrhagic fever encountered in the Balkans. J Virol Methods 133, 175-179. Dunster, L., Dunster, M., Ofula, V., Beti, D., Kazooba-Voskamp, F., Burt, F., Swanepoel, R., DeCock, K.M., 2002. First documentation of human Crimean- Congo hemorrhagic fever, Kenya. Emerg Infect Dis 8, 1005-1006. Dvorak, V., Halada, P., Hlavackova, K., Dokianakis, E., Antoniou, M., Volf, P., 2014., Identification of phlebotomine sand flies (Diptera: Psychodidae) by matrix- assisted laser desorption/ionization time of flight mass spectrometry. Parasit Vectors. 7, 21. 10.1186/1756-3305-7-21. Elliott, R.M., Schmaljohn, C.S., Collett, M.S., 1991. Bunyaviridae genome structure and gene expression. Curr Top Microbiol Immunol 169, 91-141. Ergonul, O., 2006. Crimean-Congo haemorrhagic fever. Lancet Infect Dis 6, 203-214. Ergonul, O., 2008. Treatment of Crimean-Congo hemorrhagic fever. Antiviral research 78, 125-131. Ergonul, O., Celikbas, A., Dokuzoguz, B., Eren, S., Baykam, N., Esener, H., 2004. Characteristics of patients with Crimean-Congo hemorrhagic fever in a recent outbreak in Turkey and impact of oral ribavirin therapy. Clin Infect Dis 39, 284- 287. Ergonul, O., Tuncbilek, S., Baykam, N., Celikbas, A., Dokuzoguz, B., 2006a. Evaluation of serum levels of interleukin (IL)-6, IL-10, and tumor necrosis factor- alpha in patients with Crimean-Congo hemorrhagic fever. J Infect Dis 193, 941- 944. Ergonul, O., Zeller, H., Celikbas, A., Dokuzoguz, B., 2007. The lack of Crimean-Congo hemorrhagic fever virus antibodies in healthcare workers in an endemic region. International journal of infectious diseases : IJID : official publication of the International Society for Infectious Diseases 11, 48-51. Ergonul, O., Zeller, H., Kilic, S., Kutlu, S., Kutlu, M., Cavusoglu, S., Esen, B., Dokuzoguz, B., 2006b. Zoonotic infections among veterinarians in Turkey: Crimean-Congo hemorrhagic fever and beyond. International journal of infectious diseases : IJID : official publication of the International Society for Infectious Diseases 10, 465-469. Estrada-Pena, A., Ayllon, N., de la Fuente, J., 2012a. Impact of climate trends on tick- borne pathogen transmission. Front Physiol 3, 64. Estrada-Pena, A., de la Fuente, J., 2014. The ecology of ticks and epidemiology of tick-borne viral diseases. Antiviral research 108, 104-128. Estrada-Pena, A., Gray, J.S., Kahl, O., Lane, R.S., Nijhof, A.M., 2013. Research on the ecology of ticks and tick-borne pathogens--methodological principles and caveats. Frontiers in cellular and infection microbiology 3, 29. Estrada-Pena, A., Palomar, A.M., Santibanez, P., Sanchez, N., Habela, M.A., Portillo, A., Romero, L., Oteo, J.A., 2012b. Crimean-Congo hemorrhagic fever virus in ticks, Southwestern Europe, 2010. Emerg Infect Dis 18, 179-180. Fazlalipour, M., Baniasadi, V., Mirghiasi, S.M., Jalali, T., Khakifirouz, S., Azad-Manjiri, S., Mahmoodi, V., Naderi, H.R., Zarandi, R., Salehi-Vaziri, M., 2016. Crimean- Congo Hemorrhagic Fever Due to Consumption of Raw Meat: Case Reports From East-North of Iran. Japanese journal of infectious diseases 69, 270-271.

Feltens, R., Gorner, R., Kalkhof, S., Groger-Arndt, H., von Bergen, M., 2010. Discrimination of different species from the genus Drosophila by intact protein profiling using matrix-assisted laser desorption ionization mass spectrometry. BMC Evol. Biol. 10, 95. 10.1186/1471-2148-10-95. Filipe, A.R., Calisher, C.H., Lazuick, J., 1985. Antibodies to Congo-Crimean haemorrhagic fever, Dhori, Thogoto and Bhanja viruses in southern Portugal. Acta Virol 29, 324-328. Gargili, A., Estrada-Pena, A., Spengler, J.R., Lukashev, A., Nuttall, P.A., Bente, D.A., 2017. The role of ticks in the maintenance and transmission of Crimean-Congo hemorrhagic fever virus: A review of published field and laboratory studies. Antiviral research 144, 93-119. Gargili, A., Thangamani, S., Bente, D., 2013. Influence of laboratory animal hosts on the life cycle of Hyalomma marginatum and implications for an in vivo transmission model for Crimean-Congo hemorrhagic fever virus. Front Cell Infect Microbiol. 3, 39. 10.3389/fcimb.2013.00039. Garrison, A.R., Alakbarova, S., Kulesh, D.A., Shezmukhamedova, D., Khodjaev, S., Endy, T.P., Paragas, J., 2007. Development of a TaqMan minor groove binding protein assay for the detection and quantification of Crimean-Congo hemorrhagic fever virus. Am J Trop Med Hyg 77, 514-520. Garrison, A.R., Radoshitzky, S.R., Kota, K.P., Pegoraro, G., Ruthel, G., Kuhn, J.H., Altamura, L.A., Kwilas, S.A., Bavari, S., Haucke, V., Schmaljohn, C.S., 2013. Crimean-Congo hemorrhagic fever virus utilizes a clathrin- and early endosome-dependent entry pathway. Virology 444, 45-54. Gear, J.H., Thomson, P.D., Hopp, M., Andronikou, S., Cohn, R.J., Ledger, J., Berkowitz, F.E., 1982. Congo-Crimean haemorrhagic fever in South Africa. Report of a fatal case in the Transvaal. S Afr Med J 62, 576-580. Gergova, I., Kunchev, M., Kamarinchev, B., 2012. Crimean-Congo hemorrhagic fever virus-tick survey in endemic areas in Bulgaria. J Med Virol 84, 608-614. Giavarina, D., 2015. Understanding Bland Altman analysis. Biochem Med (Zagreb) 25, 141-151. Gonzalez, J.P., Camicas, J.L., Cornet, J.P., Faye, O., Wilson, M.L., 1992. Sexual and transovarian transmission of Crimean-Congo haemorrhagic fever virus in Hyalomma truncatum ticks. Res Virol 143, 23-28. Gonzalez, J.P., Camicas, J.L., Cornet, J.P., Wilson, M.L., 1998. Biological and clinical responses of west African sheep to Crimean-Congo haemorrhagic fever virus experimental infection. Res Virol 149, 445-455. Gonzalez, J.P., Josse, R., Johnson, E.D., Merlin, M., Georges, A.J., Abandja, J., Danyod, M., Delaporte, E., Dupont, A., Ghogomu, A., et al., 1989. Antibody prevalence against haemorrhagic fever viruses in randomized representative Central African populations. Res Virol 140, 319-331. Gonzalez, J.P., LeGuenno, B., Guillaud, M., Wilson, M.L., 1990. A fatal case of Crimean-Congo haemorrhagic fever in Mauritania: virological and serological evidence suggesting epidemic transmission. Trans R Soc Trop Med Hyg 84, 573-576. Gordon, S.W., Linthicum, K.J., Moulton, J.R., 1993. Transmission of Crimean-Congo hemorrhagic fever virus in two species of Hyalomma ticks from infected adults to cofeeding immature forms. Am J Trop Med Hyg 48, 576-580. Grandi, G., Chitimia-Dobler, L., Choklikitumnuey, P., Strube, C., Springer, A., Albihn, A., Jaenson, T.G.T., Omazic, A., 2020. First records of adult Hyalomma marginatum and H. rufipes ticks (Acari: Ixodidae) in Sweden. Ticks and tick- borne diseases, 101403.

Grard, G., Drexler, J.F., Fair, J., Muyembe, J.J., Wolfe, N.D., Drosten, C., Leroy, E.M., 2011. Re-emergence of Crimean-Congo hemorrhagic fever virus in Central Africa. PLoS neglected tropical diseases 5, e1350. Grashchenkov, N.I., 1945. Investigation of Etiology, Pathogenesis, and Clinical Symptomatology of Crimean Hemorrhagic Fever. Reports on the 1944 Scientific Investigation of the Institute of Neurology. Akad. Med. Nauk SSR, Moscow, pp. 100–107. Grech-Angelini, S., Stachurski, F., Lancelot, R., Boissier, J., Allienne, J.F., Gharbi, M., Uilenberg, G., 2016. First report of the tick Hyalomma scupense (natural vector of bovine tropical theileriosis) on the French Mediterranean island of Corsica. Veterinary parasitology 216, 33-37. Gunes, T., Engin, A., Poyraz, O., Elaldi, N., Kaya, S., Dokmetas, I., Bakir, M., Cinar, Z., 2009. Crimean-Congo hemorrhagic fever virus in high-risk population, Turkey. Emerg Infect Dis 15, 461-464. Gunes, T., Poyraz, O., Vatansever, Z., 2011. Crimean-Congo hemorrhagic fever virus in ticks collected from humans, livestock, and picnic sites in the hyperendemic region of Turkey. Vector borne and zoonotic diseases 11, 1411-1416. Hebert, P.D.N., Cywinska, A., Ball, S.L., DeWaard, J.R., 2003. Biological identifications through DNA barcodes. Proc R Soc Lond B Biol Sci. 270, 313-321. 10.1098/rspb.2002.2218. Honig, J.E., Osborne, J.C., Nichol, S.T., 2004. Crimean-Congo hemorrhagic fever virus genome L RNA segment and encoded protein. Virology 321, 29-35. Hoogstraal, H., 1979. The epidemiology of tick-borne Crimean-Congo hemorrhagic fever in Asia, Europe, and Africa. Journal of medical entomology 15, 307-417. Hoppenheit, A., Murugaiyan, J., Bauer, B., Steuber, S., Clausen, P.H., Roesler, U., 2013. Identification of Tsetse (Glossina spp.) using matrix-assisted laser desorption/ionisation time of flight mass spectrometry. PLoS neglected tropical diseases 7, e2305. Horak, I.G., Camicas, J.L., Keirans, J.E., 2002. The Argasidae, Ixodidae and Nuttalliellidae (Acari: Ixodida): a world list of valid tick names. Experimental & applied acarology 28, 27-54. Hornok, S., Grima, A., Takacs, N., Szekeres, S., Kontschan, J., 2020. First records and molecular-phylogenetic analyses of three tick species (Ixodes kaiseri, Hyalomma lusitanicum and Ornithodoros coniceps) from Malta. Ticks and tick- borne diseases, 101379. Hornok, S., Horvath, G., 2012. First report of adult Hyalomma marginatum rufipes (vector of Crimean-Congo haemorrhagic fever virus) on cattle under a continental climate in Hungary. Parasites & vectors 5, 170. Ibrahim, A.M., Adam, I.A., Osman, B.T., Aradaib, I.E., 2015. Epidemiological survey of Crimean Congo hemorrhagic fever virus in cattle in East Darfur State, Sudan. Ticks and tick-borne diseases 6, 439-444. Jones, L.D., Gaunt, M., Hails, R.S., Laurenson, K., Hudson, P.J., Reid, H., Henbest, P., Gould, E.A., 1997. Transmission of louping ill virus between infected and uninfected ticks co-feeding on mountain hares. Medical and veterinary entomology 11, 172-176. Jonsson, N.N., Mayer, D.G., Matschoss, A.L., Green, P.E., Ansell, J., 1998. Production effects of cattle tick (Boophilus microplus) infestation of high yielding dairy cows. Vet. parasitol. 78, 65-77.

Karger, A., 2016a. Current developments to use linear MALDI-TOF spectra for the identification and typing of bacteria and the characterization of other cells/organisms related to infectious diseases. Proteomics Clin Appl. 10, 982- 993. 10.1002/prca.201600038. Karger, A., 2016b. Discrimination of Burkholderia Species, Brucella Biovars, Francisella tularensis and Other Taxa at the Subspecies Level by MALDI-TOF Mass Spectrometry, MALDI-TOF and Tandem MS for Clinical Microbiology, pp. 249-267. Karger, A., Bettin, B., Gethmann, J.M., Klaus, C., 2019. Whole animal matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) mass spectrometry of ticks - Are spectra of Ixodes ricinus nymphs influenced by environmental, spatial, and temporal factors? PloS one. 14, e0210590. 10.1371/journal.pone.0210590. Karger, A., Kampen, H., Bettin, B., Dautel, H., Ziller, M., Hoffmann, B., Suss, J., Klaus, C., 2012. Species determination and characterization of developmental stages of ticks by whole-animal matrix-assisted laser desorption/ionization mass spectrometry. Ticks and tick-borne diseases 3, 78-89. Karti, S.S., Odabasi, Z., Korten, V., Yilmaz, M., Sonmez, M., Caylan, R., Akdogan, E., Eren, N., Koksal, I., Ovali, E., Erickson, B.R., Vincent, M.J., Nichol, S.T., Comer, J.A., Rollin, P.E., Ksiazek, T.G., 2004. Crimean-Congo hemorrhagic fever in Turkey. Emerg Infect Dis 10, 1379-1384. Kasi, K.K., Sas, M.A., Sauter-Louis, C., von Arnim, F., Gethmann, J.M., Schulz, A., Wernike, K., Groschup, M.H., Conraths, F.J., 2020a. Epidemiological investigations of Crimean-Congo haemorrhagic fever virus infection in sheep and goats in Balochistan, Pakistan. Ticks and tick-borne diseases 11, 101324. Kasi, K.K., von Arnim, F., Schulz, A., Rehman, A., Chudhary, A., Oneeb, M., Sas, M.A., Jamil, T., Maksimov, P., Sauter-Louis, C., Conraths, F.J., Groschup, M.H., 2020b. Crimean-Congo haemorrhagic fever virus in ticks collected from livestock in Balochistan, Pakistan. Transbound Emerg Dis. Kaufmann, C., Schaffner, F., Ziegler, D., Pfluger, V., Mathis, A., 2012. Identification of field-caught Culicoides biting midges using matrix-assisted laser desorption/ionization time of flight mass spectrometry. Parasitology 139, 248- 258. Kautman, M., Tiar, G., Papa, A., Siroky, P., 2016. AP92-like Crimean-Congo Hemorrhagic Fever Virus in Hyalomma aegyptium Ticks, Algeria. Emerg Infect Dis 22, 354-356. Khan, A.S., Maupin, G.O., Rollin, P.E., Noor, A.M., Shurie, H.H., Shalabi, A.G., Wasef, S., Haddad, Y.M., Sadek, R., Ijaz, K., Peters, C.J., Ksiazek, T.G., 1997. An outbreak of Crimean-Congo hemorrhagic fever in the United Arab Emirates, 1994-1995. Am J Trop Med Hyg 57, 519-525. Kinsella, E., Martin, S.G., Grolla, A., Czub, M., Feldmann, H., Flick, R., 2004. Sequence determination of the Crimean-Congo hemorrhagic fever virus L segment. Virology 321, 23-28. Kizito, S., Okello, P.E., Kwesiga, B., Nyakarahuka, L., Balinandi, S., Mulei, S., Kyondo, J., Tumusiime, A., Lutwama, J., Ario, A.R., Ojwang, J., Zhu, B.P., 2018. Notes from the Field: Crimean-Congo Hemorrhagic Fever Outbreak - Central Uganda, August-September 2017. MMWR. Morbidity and mortality weekly report 67, 646-647. Kleib, A.S., Salihy, S.M., Ghaber, S.M., Sidiel, B.W., Sidiya, K.C., Bettar, E.S., 2016. Crimean-Congo Hemorrhagic Fever with Acute Subdural Hematoma, Mauritania, 2012. Emerg Infect Dis 22, 1305-1306.

Kopp, K., Gothe, R., 1995. Hyalomma truncatum (Acari; Ixodidae): investigations into the scototaxis of unfed adult ticks. Experimental & applied acarology 19, 53-64. Lardeux, F., Torrico, G., Aliaga, C., 2016. Calculation of the ELISA's cut-off based on the change-point analysis method for detection of Trypanosoma cruzi infection in Bolivian dogs in the absence of controls. Mem Inst Oswaldo Cruz 111, 501- 504. Kumsa, B., Laroche, M., Almeras, L., Mediannikov, O., Raoult, D., Parola, P., 2016. Morphological, molecular and MALDI-TOF mass spectrometry identification of ixodid tick species collected in Oromia, Ethiopia. Parasitol. Res. 115, 4199- 4210. 10.1007/s00436-016-5197-9. Leblebicioglu, H., 2010. Crimean-Congo haemorrhagic fever in Eurasia. Int J Antimicrob Agents 36 Suppl 1, S43-46. Leblebicioglu, H., Ozaras, R., Irmak, H., Sencan, I., 2016. Crimean-Congo hemorrhagic fever in Turkey: Current status and future challenges. Antiviral research 126, 21-34. Lenth, R.V., 2016. Least-Squares Means: The R Package lsmeans. J Stat Softw 69, 1-33. Leshchinskaia, E.V., 1970. [Hemorrhagic fever in the USSR territory]. Meditsinskaia sestra 29, 29-33. Levingston Macleod, J.M., Marmor, H., Garcia-Sastre, A., Frias-Staheli, N., 2015. Mapping of the interaction domains of the Crimean-Congo hemorrhagic fever virus nucleocapsid protein. J Gen Virol 96, 524-537. Logan, T.M., Linthicum, K.J., Bailey, C.L., Watts, D.M., Dohm, D.J., Moulton, J.R., 1990. Replication of Crimean-Congo hemorrhagic fever virus in four species of ixodid ticks (Acari) infected experimentally. Journal of medical entomology 27, 537-542. Lotfollahzadeh, S., Nikbakht Boroujeni, G.R., Mokhber Dezfouli, M.R., Bokaei, S., 2011. A serosurvey of Crimean-Congo haemorrhagic fever virus in dairy cattle in Iran. Zoonoses Public Health 58, 54-59. Mahanty, S., Bray, M., 2004. Pathogenesis of filoviral haemorrhagic fevers. Lancet Infect Dis 4, 487-498. Maiga, O., Sas, M.A., Rosenke, K., Kamissoko, B., Mertens, M., Sogoba, N., Traore, A., Sangare, M., Niang, M., Schwan, T.G., Maiga, H.M., Traore, S.F., Feldmann, H., Safronetz, D., Groschup, M.H., 2017. Serosurvey of Crimean-Congo Hemorrhagic Fever Virus in Cattle, Mali, West Africa. Am J Trop Med Hyg 96, 1341-1345. Majeed, B., Dicker, R., Nawar, A., Badri, S., Noah, A., Muslem, H., 2012. Morbidity and mortality of Crimean-Congo hemorrhagic fever in Iraq: cases reported to the National Surveillance System, 1990-2010. Trans R Soc Trop Med Hyg 106, 480-483. Mardani, M., Jahromi, M.K., Naieni, K.H., Zeinali, M., 2003. The efficacy of oral ribavirin in the treatment of crimean-congo hemorrhagic fever in Iran. Clin Infect Dis 36, 1613-1618. Mariner, J.C., Morrill, J., Ksiazek, T.G., 1995. Antibodies to hemorrhagic fever viruses in domestic livestock in Niger: Rift Valley fever and Crimean-Congo hemorrhagic fever. Am J Trop Med Hyg 53, 217-221. Mertens, M., Schmidt, K., Ozkul, A., Groschup, M.H., 2013. The impact of Crimean- Congo hemorrhagic fever virus on public health. Antiviral research 98, 248-260. Mertens, M., Vatansever, Z., Mrenoshki, S., Krstevski, K., Stefanovska, J., Djadjovski, I., Cvetkovikj, I., Farkas, R., Schuster, I., Donnet, F., Comtet, L., Tordo, N., Ben Mechlia, M., Balkema-Buschmann, A., Mitrov, D., Groschup, M.H., 2015.

Circulation of Crimean-Congo Hemorrhagic Fever Virus in the former Yugoslav Republic of Macedonia revealed by screening of cattle sera using a novel enzyme-linked immunosorbent assay. PLoS neglected tropical diseases 9, e0003519. Mertens, M., Wolfel, R., Ullrich, K., Yoshimatsu, K., Blumhardt, J., Romer, I., Esser, J., Schmidt-Chanasit, J., Groschup, M.H., Dobler, G., Essbauer, S.S., Ulrich, R.G., 2009. Seroepidemiological study in a Puumala virus outbreak area in South- East Germany. Med Microbiol Immunol 198, 83-91. Messina, J.P., Pigott, D.M., Golding, N., Duda, K.A., Brownstein, J.S., Weiss, D.J., Gibson, H., Robinson, T.P., Gilbert, M., William Wint, G.R., Nuttall, P.A., Gething, P.W., Myers, M.F., George, D.B., Hay, S.I., 2015. The global distribution of Crimean-Congo hemorrhagic fever. Trans R Soc Trop Med Hyg 109, 503-513. Midilli, K., Gargili, A., Ergonul, O., Elevli, M., Ergin, S., Turan, N., Sengoz, G., Ozturk, R., Bakar, M., 2009. The first clinical case due to AP92 like strain of Crimean- Congo Hemorrhagic Fever virus and a field survey. BMC infectious diseases 9, 90. Mint Mohamed Lemine, A., Ould Lemrabott, M.A., Hasni Ebou, M., Mint Lekweiry, K., Ould Ahmedou Salem, M.S., Ould Brahim, K., Ouldabdallahi Moukah, M., Ould Bouraya, I.N., Brengues, C., Trape, J.F., Basco, L., Bogreau, H., Simard, F., Faye, O., Ould Mohamed Salem Boukhary, A., 2017. Mosquitoes (Diptera: Culicidae) in Mauritania: a review of their biodiversity, distribution and medical importance. Parasites & vectors 10, 35. Mishra, A.C., Mehta, M., Mourya, D.T., Gandhi, S., 2011. Crimean-Congo haemorrhagic fever in India. Lancet 378, 372-372. Mohamed, M., Said, A.R., Murad, A., Graham, R., 2008. A serological survey of Crimean-Congo haemorrhagic fever in animals in the Sharkia Governorate of Egypt. Vet Ital 44, 513-517. Mourya, D.T., Yadav, P.D., Shete, A.M., Gurav, Y.K., Raut, C.G., Jadi, R.S., Pawar, S.D., Nichol, S.T., Mishra, A.C., 2012. Detection, Isolation and Confirmation of Crimean-Congo Hemorrhagic Fever Virus in Human, Ticks and Animals in Ahmadabad, India, 2010-2011. PLoS neglected tropical diseases 6. Musaad, A., Faye, B., Nikhela, A.A., 2013. Lactation curves of dairy camels in an intensive system. Trop Anim Health Prod 45, 1039-1046. Nabeth, P., Cheikh, D.O., Lo, B., Faye, O., Vall, I.O., Niang, M., Wague, B., Diop, D., Diallo, M., Diallo, B., Diop, O.M., Simon, F., 2004a. Crimean-Congo hemorrhagic fever, Mauritania. Emerg Infect Dis 10, 2143-2149. Nabeth, P., Thior, M., Faye, O., Simon, F., 2004b. Human Crimean-Congo hemorrhagic fever, Senegal. Emerg Infect Dis 10, 1881-1882. Nebbak, A., El Hamzaoui, B., Berenger, J.M., Bitam, I., Raoult, D., Almeras, L., Parola, P., 2017. Comparative analysis of storage conditions and homogenization methods for tick and flea species for identification by MALDI-TOF MS. Med. Vet. Entomol. 31, 438-448. 10.1111/mve.12250. Negredo, A., de la Calle-Prieto, F., Palencia-Herrejon, E., Mora-Rillo, M., Astray- Mochales, J., Sanchez-Seco, M.P., Bermejo Lopez, E., Menarguez, J., Fernandez-Cruz, A., Sanchez-Artola, B., Keough-Delgado, E., Ramirez de Arellano, E., Lasala, F., Milla, J., Fraile, J.L., Ordobas Gavin, M., Martinez de la Gandara, A., Lopez Perez, L., Diaz-Diaz, D., Lopez-Garcia, M.A., Delgado- Jimenez, P., Martin-Quiros, A., Trigo, E., Figueira, J.C., Manzanares, J., Rodriguez-Baena, E., Garcia-Comas, L., Rodriguez-Fraga, O., Garcia- Arenzana, N., Fernandez-Diaz, M.V., Cornejo, V.M., Emmerich, P., Schmidt-

Chanasit, J., Arribas, J.R., Crimean Congo Hemorrhagic Fever@Madrid Working, G., 2017. Autochthonous Crimean-Congo Hemorrhagic Fever in Spain. The New England journal of medicine 377, 154-161. Ozkaya, E., Dincer, E., Carhan, A., Uyar, Y., Ertek, M., Whitehouse, C.A., Ozkul, A., 2010. Molecular epidemiology of Crimean-Congo hemorrhagic fever virus in Turkey: occurrence of local topotype. Virus Res 149, 64-70. Papa, A., Bino, S., Llagami, A., Brahimaj, B., Papadimitriou, E., Pavlidou, V., Velo, E., Cahani, G., Hajdini, M., Pilaca, A., Harxhi, A., Antoniadis, A., 2002a. Crimean- Congo hemorrhagic fever in Albania, 2001. Eur J Clin Microbiol Infect Dis 21, 603-606. Papa, A., Bino, S., Velo, E., Harxhi, A., Kota, M., Antoniadis, A., 2006. Cytokine levels in Crimean-Congo hemorrhagic fever. J Clin Virol 36, 272-276. Papa, A., Bozovi, B., Pavlidou, V., Papadimitriou, E., Pelemis, M., Antoniadis, A., 2002b. Genetic detection and isolation of crimean-congo hemorrhagic fever virus, Kosovo, Yugoslavia. Emerg Infect Dis 8, 852-854. Papa, A., Christova, I., Papadimitriou, E., Antoniadis, A., 2004. Crimean-Congo hemorrhagic fever in Bulgaria. Emerg Infect Dis 10, 1465-1467. Papa, A., Dalla, V., Papadimitriou, E., Kartalis, G.N., Antoniadis, A., 2010. Emergence of Crimean-Congo haemorrhagic fever in Greece. Clinical microbiology and infection : the official publication of the European Society of Clinical Microbiology and Infectious Diseases 16, 843-847. Papa, A., Markatou, F., Maltezou, H.C., Papadopoulou, E., Terzi, E., Ventouri, S., Pervanidou, D., Tsiodras, S., Maltezos, E., 2018. Crimean-Congo haemorrhagic fever in a Greek worker returning from Bulgaria, June 2018. Euro surveillance : bulletin Europeen sur les maladies transmissibles = European communicable disease bulletin 23. Papa, A., Velo, E., Kadiaj, P., Tsioka, K., Kontana, A., Kota, M., Bino, S., 2017. Crimean-Congo hemorrhagic fever virus in ticks collected from livestock in Albania. Infect Genet Evol 54, 496-500. Papadopoulos, 1980. Crimean-Congo hemorrhagic fever (CCHF) in Greece: isolation of the virus from Rhipicephalus bursa ticks and a preliminary serological survey. Zentbl Bakteriol Hyg. R Core Team, 2019. R: A language and environment for statistical computing. R Foundation for Statistical Computing, Vienna, Austria. Raju, R., Kolakofsky, D., 1989. The ends of La Crosse virus genome and antigenome RNAs within nucleocapsids are base paired. J Virol 63, 122-128. Rees, D.J., Dioli, M., Kirkendall, L.R., 2003. Molecules and morphology: evidence for cryptic hybridization in African Hyalomma (Acari: Ixodidae). Mol Phylogenet Evol 27, 131-142. Rothen, J., Githaka, N., Kanduma, E.G., Olds, C., Pfluger, V., Mwaura, S., Bishop, R.P., Daubenberger, C., 2016. Matrix-assisted laser desorption/ionization time of flight mass spectrometry for comprehensive indexing of East African ixodid tick species. Parasit Vectors. 9, 151. 10.1186/s13071-016-1424-6. Saidi, S., Casals, J., Faghih, M.A., 1975. Crimean hemorrhagic fever-Congo (CHF-C) virus antibodies in man, and in domestic and small mammals, in Iran. Am J Trop Med Hyg 24, 353-357. Saksida, A., Duh, D., Wraber, B., Dedushaj, I., Ahmeti, S., Avsic-Zupanc, T., 2010. Interacting roles of immune mechanisms and viral load in the pathogenesis of crimean-congo hemorrhagic fever. Clin Vaccine Immunol 17, 1086-1093.

Saluzzo, J.F., Aubry, P., McCormick, J., Digoutte, J.P., 1985a. Haemorrhagic fever caused by Crimean Congo haemorrhagic fever virus in Mauritania. Trans R Soc Trop Med Hyg 79, 268. Saluzzo, J.F., Digoutte, J.P., Camicas, J.L., Chauvancy, G., 1985b. Crimean-Congo haemorrhagic fever and Rift Valley fever in south-eastern Mauritania. Lancet 1, 116. Sammon, J., 1969. A non-linear mapping for data structure analysis. IEEE Trans Comp C. 18, 401-409. Sands, A.F., Apanaskevich, D.A., Matthee, S., Horak, I.G., Harrison, A., Karim, S., Mohammad, M.K., Mumcuoglu, K.Y., Rajakaruna, R.S., Santos-Silva, M.M., Matthee, C.A., 2017. Effects of tectonics and large scale climatic changes on the evolutionary history of Hyalomma ticks. Mol Phylogenet Evol 114, 153-165. Sang, R., Lutomiah, J., Koka, H., Makio, A., Chepkorir, E., Ochieng, C., Yalwala, S., Mutisya, J., Musila, L., Richardson, J.H., Miller, B.R., Schnabel, D., 2011. Crimean-Congo hemorrhagic fever virus in Hyalommid ticks, northeastern Kenya. Emerg Infect Dis 17, 1502-1505. Sas, M.A., Mertens, M., Isselmou, E., Reimer, N., El Mamy, B.O., Doumbia, B., Groschup, M.H., 2017a. Crimean-Congo Hemorrhagic Fever Virus-Specific Antibody Detection in Cattle in Mauritania. Vector borne and zoonotic diseases 17, 582-587. Sas, M.A., Mertens, M., Kadiat, J.G., Schuster, I., Pongombo, C.P.S., Maloba, A.G.K., Groschup, M.H., 2017b. Serosurvey for Crimean-Congo hemorrhagic fever virus infections in ruminants in Katanga province, Democratic Republic of the Congo. Ticks and tick-borne diseases 8, 858-861. Sas, M.A., Vina-Rodriguez, A., Mertens, M., Eiden, M., Emmerich, P., Chaintoutis, S.C., Mirazimi, A., Groschup, M.H., 2018. A one-step multiplex real-time RT- PCR for the universal detection of all currently known CCHFV genotypes. J Virol Methods 255, 38-43. Schaffner, F., Kaufmann, C., Pfluger, V., Mathis, A., 2014. Rapid protein profiling facilitates surveillance of invasive mosquito species. Parasites & vectors 7, 142. Schnittler, H.J., Feldmann, H., 2003. Viral hemorrhagic fever--a vascular disease? Thromb Haemost 89, 967-972. Schulz, A., Karger, A., Bettin, B., Eisenbarth, A., Sas, M.A., Silaghi, C., Groschup, M.H., 2020. Molecular discrimination of Hyalomma tick species serving as reservoirs and vectors for Crimean-Congo hemorrhagic fever virus in sub- Saharan Africa. Ticks and tick-borne diseases, 101382. Schuster, I., Mertens, M., Mrenoshki, S., Staubach, C., Mertens, C., Bruning, F., Wernike, K., Hechinger, S., Berxholi, K., Mitrov, D., Groschup, M.H., 2016. Sheep and goats as indicator animals for the circulation of CCHFV in the environment. Experimental & applied acarology 68, 337-346. Schwarz, T.F., Nsanze, H., Ameen, A.M., 1997. Clinical features of Crimean-Congo haemorrhagic fever in the United Arab Emirates. Infection 25, 364-367. Scrimgeour, E.M., 1996. Crimean-Congo haemorrhagic fever in Oman. Lancet 347, 692. Shepherd, A.J., Leman, P.A., Swanepoel, R., 1989. Viremia and antibody response of small African and laboratory animals to Crimean-Congo hemorrhagic fever virus infection. Am J Trop Med Hyg 40, 541-547. Shepherd, A.J., Swanepoel, R., Shepherd, S.P., McGillivray, G.M., Searle, L.A., 1987. Antibody to Crimean-Congo hemorrhagic fever virus in wild mammals from southern Africa. Am J Trop Med Hyg 36, 133-142.

Shi, X., van Mierlo, J.T., French, A., Elliott, R.M., 2010. Visualizing the replication cycle of bunyamwera orthobunyavirus expressing fluorescent protein-tagged Gc glycoprotein. J Virol 84, 8460-8469. Simon, M., Falk, K.I., Lundkvist, A., Mirazimi, A., 2006. Exogenous nitric oxide inhibits Crimean Congo hemorrhagic fever virus. Virus Res 120, 184-190. Simon, M., Johansson, C., Mirazimi, A., 2009. Crimean-Congo hemorrhagic fever virus entry and replication is clathrin-, pH- and cholesterol-dependent. J Gen Virol 90, 210-215. Soares-Weiser, K., Thomas, S., Thomson, G., Garner, P., 2010. Ribavirin for Crimean- Congo hemorrhagic fever: systematic review and meta-analysis. BMC infectious diseases 10, 207. Spengler, J.R., Bergeron, E., Rollin, P.E., 2016a. Seroepidemiological Studies of Crimean-Congo Hemorrhagic Fever Virus in Domestic and Wild Animals. PLoS neglected tropical diseases 10, e0004210. Spengler, J.R., Bergeron, E., Spiropoulou, C.F., 2019. Crimean-Congo hemorrhagic fever and expansion from endemic regions. Curr Opin Virol 34, 70-78. Spengler, J.R., Estrada-Pena, A., 2018. Host preferences support the prominent role of Hyalomma ticks in the ecology of Crimean-Congo hemorrhagic fever. PLoS neglected tropical diseases 12, e0006248. Spengler, J.R., Estrada-Pena, A., Garrison, A.R., Schmaljohn, C., Spiropoulou, C.F., Bergeron, E., Bente, D.A., 2016b. A chronological review of experimental infection studies of the role of wild animals and livestock in the maintenance and transmission of Crimean-Congo hemorrhagic fever virus. Antiviral research 135, 31-47. Suleiman, M.N., Muscat-Baron, J.M., Harries, J.R., Satti, A.G., Platt, G.S., Bowen, E.T., Simpson, D.I., 1980. Congo/Crimean haemorrhagic fever in Dubai. An outbreak at the Rashid Hospital. Lancet 2, 939-941. Suliman, H.M., Adam, I.A., Saeed, S.I., Abdelaziz, S.A., Haroun, E.M., Aradaib, I.E., 2017. Crimean Congo hemorrhagic fever among the one-humped camel (Camelus dromedaries) in Central Sudan. Virol J 14, 147. Swanepoel, R., Gill, D.E., Shepherd, A.J., Leman, P.A., Mynhardt, J.H., Harvey, S., 1989. The clinical pathology of Crimean-Congo hemorrhagic fever. Rev Infect Dis 11 Suppl 4, S794-800. Swanepoel, R., Leman, P.A., Burt, F.J., Jardine, J., Verwoerd, D.J., Capua, I., Bruckner, G.K., Burger, W.P., 1998. Experimental infection of ostriches with Crimean-Congo haemorrhagic fever virus. Epidemiol Infect 121, 427-432. Swanepoel, R., Shepherd, A.J., Leman, P.A., Shepherd, S.P., Miller, G.B., 1985. A common-source outbreak of Crimean-Congo haemorrhagic fever on a dairy farm. S Afr Med J 68, 635-637. Tall, A., Sall, A.A., Faye, O., Diatta, B., Sylla, R., Faye, J., Faye, P.C., Faye, O., Ly, A.B., Sarr, F.D., Diab, H., Diallo, M., 2009. [Two cases of Crimean-Congo haemorrhagic fever (CCHF) in two tourists in Senegal in 2004]. Bull Soc Pathol Exot 102, 159-161. Thangamani, S., Bente, D., 2014. Establishing protocols for tick containment at Biosafety Level 4. Pathog Dis. 71, 282-285. 10.1111/2049-632X.12187. Thomas, R., Mathew, F., Louis, E.M., Valsan, C., Priyanka, R., Thomas, J., Raphael, L., 2019. Contact Tracing for an Imported Case of Crimean-Congo Hemorrhagic Fever - Experience from a Tertiary Care Center in Kerala, South India. Indian journal of community medicine : official publication of Indian Association of Preventive & Social Medicine 44, 285-287.

Tomassone, L., Camicas, J.L., De Meneghi, D., Di Giulio, A., Uilenberg, G., 2005. A note on Hyalomma nitidum, its distribution and its hosts. Experimental & applied acarology 35, 341-355. van Eeden, P.J., Joubert, J.R., van de Wal, B.W., King, J.B., de Kock, A., Groenewald, J.H., 1985. A nosocomial outbreak of Crimean-Congo haemorrhagic fever at Tygerberg Hospital. Part I. Clinical features. S Afr Med J 68, 711-717. Vassilev, T., Valchev, V., Kazarov, G., Razsukanova, L., Vitanov, T., 1991. A reference preparation for human immunoglobulin against Crimean/Congo hemorrhagic fever. Biologicals : journal of the International Association of Biological Standardization 19, 57. Vial, L., Stachurski, F., Leblond, A., Huber, K., Vourc'h, G., Rene-Martellet, M., Desjardins, I., Balanca, G., Grosbois, V., Pradier, S., Gely, M., Appelgren, A., Estrada-Pena, A., 2016. Strong evidence for the presence of the tick Hyalomma marginatum Koch, 1844 in southern continental France. Ticks and tick-borne diseases 7, 1162-1167. Whitehouse, C.A., 2004. Crimean-Congo hemorrhagic fever. Antiviral research 64, 145-160. Williams, R.J., Al-Busaidy, S., Mehta, F.R., Maupin, G.O., Wagoner, K.D., Al-Awaidy, S., Suleiman, A.J., Khan, A.S., Peters, C.J., Ksiazek, T.G., 2000. Crimean- congo haemorrhagic fever: a seroepidemiological and tick survey in the Sultanate of Oman. Trop Med Int Health 5, 99-106. Wilson, M.L., Gonzalez, J.P., Cornet, J.P., Camicas, J.L., 1991. Transmission of Crimean-Congo haemorrhagic fever virus from experimentally infected sheep to Hyalomma truncatum ticks. Res Virol 142, 395-404. Wilson, M.L., LeGuenno, B., Guillaud, M., Desoutter, D., Gonzalez, J.P., Camicas, J.L., 1990. Distribution of Crimean-Congo hemorrhagic fever viral antibody in Senegal: environmental and vectorial correlates. Am J Trop Med Hyg 43, 557- 566. Wolfel, R., Paweska, J.T., Petersen, N., Grobbelaar, A.A., Leman, P.A., Hewson, R., Georges-Courbot, M.C., Papa, A., Gunther, S., Drosten, C., 2007. Virus detection and monitoring of viral load in Crimean-Congo hemorrhagic fever virus patients. Emerg Infect Dis 13, 1097-1100. Wood, O.L., Lee, V.H., Ash, J.S., Casals, J., 1978. Crimean-congo hemorrhagic fever, Thogoto, dugbe, and Jos viruses isolated from ixodid ticks in Ethiopia. Am J Trop Med Hyg 27, 600-604. Xiao, X., Feng, Y., Zhu, Z., Dimitrov, D.S., 2011. Identification of a putative Crimean- Congo hemorrhagic fever virus entry factor. Biochem Biophys Res Commun 411, 253-258. Yadav, P.D., Pardeshi, P.G., Patil, D.Y., Shete, A.M., Mourya, D.T., 2019. Persistence of IgG antibodies in survivors of Crimean Congo hemorrhagic fever virus infection, India. J Infect Public Health 12, 598-599. Yen, Y.C., Kong, L.X., Lee, L., Zhang, Y.Q., Li, F., Cai, B.J., Gao, S.Y., 1985. Characteristics of Crimean-Congo hemorrhagic fever virus (Xinjiang strain) in China. Am J Trop Med Hyg 34, 1179-1182. Yilmaz, M., Aydin, K., Akdogan, E., Sucu, N., Sonmez, M., Omay, S.B., Koksal, I., 2008. Peripheral blood natural killer cells in Crimean-Congo hemorrhagic fever. J Clin Virol 42, 415-417.

Yssouf, A., Almeras, L., Berenger, J.M., Laroche, M., Raoult, D., Parola, P., 2015. Identification of tick species and disseminate pathogen using hemolymph by MALDI-TOF MS. Ticks Tick Borne Dis. 6, 579-586. 10.1016/j.ttbdis.2015.04.013. Yssouf, A., Flaudrops, C., Drali, R., Kernif, T., Socolovschi, C., Berenger, J.M., Raoult, D., Parola, P., 2013a. Matrix-assisted laser desorption ionization-time of flight mass spectrometry for rapid identification of tick vectors. J. Clin. Microbiol. 51, 522-528. 10.1128/JCM.02665-12. Yssouf, A., Socolovschi, C., Flaudrops, C., Ndiath, M.O., Sougoufara, S., Dehecq, J.S., Lacour, G., Berenger, J.M., Sokhna, C.S., Raoult, D., Parola, P., 2013b. Matrix- assisted laser desorption ionization--time of flight mass spectrometry: an emerging tool for the rapid identification of mosquito vectors. PloS one. 8, e72380. 10.1371/journal.pone.0072380. Zeller, H.G., Cornet, J.P., Diop, A., Camicas, J.L., 1997. Crimean-Congo hemorrhagic fever in ticks (Acari: Ixodidae) and ruminants: field observations of an epizootic in Bandia, Senegal (1989-1992). Journal of medical entomology 34, 511-516. Zhang, R.L., Zhang, B., 2014. Prospects of using DNA barcoding for species identification and evaluation of the accuracy of sequence databases for ticks (Acari: Ixodida). Ticks and tick-borne diseases 5, 352-358. Zivcec, M., Maiga, O., Kelly, A., Feldmann, F., Sogoba, N., Schwan, T.G., Feldmann, H., Safronetz, D., 2014. Unique strain of Crimean-Congo hemorrhagic fever virus, Mali. Emerg Infect Dis 20, 911-913.

11 AUTHORS´ CONTRIBUTION

Manuscript I

A. Schulz: Conceptualization, Methodology, Investigation, Visualization, Data curation, Validation, Writing - original draft F. Stoek: Investigation, Visualization, Data curation, Validation, Writing - review & editing Y. Barry: Conceptualization, Resources, Investigation, Data curation M.A. Sas: Conceptualization, Methodology, Investigation, Writing - review & editing J. Schulz: Methodology, Visualization, Data curation, Validation, Formal analysis, Software, Writing - review & editing P. Kirkland: Resources, Conceptualization, Investigation M. Eiden: Conceptualization, Methodology, Investigation M.H. Groschup: Conceptualization, Resources, Funding acquisition, Project administration, Supervision, Writing - review & editing.

Manuscript II

A. Schulz: Conceptualization, Methodology, Investigation, Visualization, Data curation, Validation, Writing - original draft A. Karger: Visualization, Methodology, Investigation, Software, Validation, Formal analysis, Writing - review & editing B. Bettin: Visualization, Methodology, Investigation, Software, Validation A. Eisenbarth: Writing - review & editing, Conceptualization M.A. Sas: Writing - review & editing, Supervision C. Silaghi: Writing - review & editing, Resources, Supervision M.H. Groschup: Conceptualization, Resources, Funding acquisition, Project administration, Supervision, Writing - review & editing.

Manuscript III

A. Schulz: Conceptualization, Methodology, Investigation, Visualization, Data curation, Validation, Writing - original draft Y. Barry: Conceptualization, Resources, Investigation, Data curation F. Stoek: Conceptualization, Investigation, Data curation, Validation M.J. Pickin: Conceptualization, Methodology, Investigation, Validation, Writing - review & editing, A. Eisenbarth: Conceptualization, Supervision M. Eiden: Conceptualization, Supervision, Writing - review & editing M.H. Groschup: Conceptualization, Resources, Funding acquisition, Project administration, Supervision, Writing - review & editing.

12 ACKNOWLEDGMENTS

First of all, I would like to thank Prof. Dr. M. H. Groschup for his supervision, the support during my time as doctoral student and giving me the opportunity to do my PhD at the Institute of Novel and Emerging Infectious Diseases (FLI). I also thank for the trust in my work within the last three years. Working at the institute was a great professional and personal experience for me. Special thanks go also to Miriam Andrada Sas. Without her support and instruction, my first year would have been much more difficult. Furthermore, I would like to thank all former and current laboratory staff members (Martina Abs, Matthew Pickin, René Schöttner, Kristin Vorpahl, Albert Eisenbarth and Maria Justiniano Suarez), who have supported me and without them this work would not have been possible. I would also like to thank Franziska Stoek, who was employed on the same project. Without her help, organizational talent and language skills, the business trips to Cameroon and Mauritania would have been much more challenging. However, she was also a great support in Germany. I also want to thank Axel Karger and Barbara Bettin for their expertise and kind support in the MALDI-TOF MS analysis of ticks. It was a great pleasure for me to work with our cooperation partners from Cameroon and Mauritania. I thank Lidia Chitimia-Dobler for teaching me the basics of the morphological identification of Hyalomma ticks and Jana Schulz for assistance in statistical evaluation. I thank Abel Wade, Samuel Abah, Rodrigue Poueme, Yayha Barry and Aliou Ba for their warm hospitality. I also want to thank Ibrahim for his excellent tea and Yacub for driving us safely the long way to Rosso and back. I also thank Melanie Rissmann, Martin Eiden and Markus Keller for their scientific advice and assistance and I acknowledge Michael Brindle for proofreading my thesis. I also enjoyed the pleasant culinary evenings with Arian Köhler, Florian Binder and Franziska Stoek, as well as the professional talks about reptiles and other exotic pets with Benjamin Gutjahr. Last but not least, I would like to thank my family and friends for all their encouragement, whereby I am very grateful to my parents for their great support.