Targeted Deletion of Prkar1a Reveals a Role for Protein Kinase a in Mesenchymal-To-Epithelial Transition

Research Article

Targeted Deletion of Prkar1a Reveals a Role for Protein Kinase A in Mesenchymal-to-Epithelial Transition

Kiran S. Nadella,1 Georgette N. Jones,1 Anthony Trimboli,1 Constantine A. Stratakis,3 Gustavo Leone,1 and Lawrence S. Kirschner1,2

1Human Cancer Genetics Program, Department of Molecular Virology, Immunology and Medical Genetics and 2Division of Endocrinology, Diabetes and Metabolism, Department of Internal Medicine, The Ohio State University, Columbus, Ohio and 3Section on Endocrinology and Genetics, Developmental Endocrinology Branch, National Institute of Child Health and Human Development, Bethesda, Maryland

Abstract Carney complex (CNC, OMIM 160980) is an autosomal dominant multiple endocrine neoplasia syndrome caused by loss of function Dysregulation of protein kinase A (PKA) activity, caused by PRKAR1A loss of function mutations in PRKAR1A, is known to induce mutations in in at least 50% of the CNC patients tumor formation in the inherited tumor syndrome Carney characterized to date (4–6). Tumors from these patients display increased PKA activity when compared with non-CNC tumors from complex (CNC) and is also associated with sporadic tumors PRKAR1A of the thyroid and adrenal. We have previously shown that the same tissue (4). Loss of has also been reported from +/À Prkar1a mice develop schwannomas reminiscent of those sporadic tumors of the thyroid, breast, and adrenal, indicating that seen in CNC and that similar tumors are observed in tissue- this gene has tumor suppressor function in a variety of sporadic specific knockouts (KO) of Prkar1a targeted to the neural cancers (7, 8). To investigate the tumor suppressor function of Prkar1a in vivo, we generated a KO mouse model for Prkar1a and crest. Within these tumors, we have previously described the presence of epithelial islands, although the nature of have shown that heterozygote mice develop a spectrum of tumors that overlap with the tumors seen in human CNC patients (9). these structures was unclear. In this article, we report +/À Prkar1a mice developed schwannomas, bony tumors, and that these epithelial structures are derived from KO cells Prkar1a originating in the neural crest. Analysis of the mesenchymal thyroid cancer, whereas tissue-specific ablation of from a subset of cranial neural crest cells led to the development of marker vimentin revealed that this protein was markedly Prkar1a down-regulated not only from the epithelial islands, but also schwannomas. These data confirm ’s role as a tumor from the tumor as a whole, consistent with mesenchymal- suppressor gene and indicate that complete loss of the gene is to-epithelial transition (MET). In vitro, Prkar1a null primary sufficient for tumor development. mouse embryonic fibroblasts, which display constitutive PKA Vimentin is an intermediate filament protein involved in signaling, also showed evidence for MET, with a loss of maintaining cell shape, integrity of the cytoplasm, and stabilizing vimentin and up-regulation of the epithelial marker E- cytoskeletal interactions and structural processes (10). It is the cadherin. Reduction of vimentin protein occurred at the most abundant of the intermediate filament proteins and is widely expressed in a variety of mesenchymal cell types, such as posttranslational level and was rescued by proteasomal inhibition. Finally, this down-regulation of vimentin was reca- fibroblasts and endothelial cells. It is also expressed in other cell pitulated in the adrenal nodules of CNC patients, confirming types derived from mesoderm, such as mesothelium, ovarian an unexpected and previously unrecognized role for PKA in granulosa cells, and monocyte/macrophages. In most nonmesen- MET. [Cancer Res 2008;68(8):2671–7] chymal cells, vimentin is replaced by other intermediate filament proteins during the process of differentiation (11). In this article, we describe mesenchymal-to-epithelial transition Introduction À/À (MET), which occurs in Prkar1a schwannomas, as evidenced Protein kinase A (PKA) is an evolutionarily conserved serine by the gain of cytokeratin staining (as observed previously; ref. 9) threonine kinase that regulates diverse signal transduction path- and the loss of vimentin. This biochemical alteration, which ways, including cellular development, proliferation, differentiation, occurred only in cells that had undergone cre-mediated excision of À/À apoptosis, and tumorigenesis. The PKA holoenzyme exists as a Prkar1a, was mirrored in vitro in Prkar1a mouse embryonic heterotetramer consisting of two regulatory and two catalytic fibroblasts (MEFs). Finally, these findings were corroborated in subunits. In humans and mice, there are four regulatory subunit adrenal tumors from patients with the CNC due to mutation of genes: PRKAR1A, PRKAR1B, PRKAR2A, and PRKAR2B. As shown PRKAR1A. Overall, these observations suggest that PKA dysre- elegantly in knockout (KO) mouse studies, these four genes gulation caused by loss of PRKAR1A/Prkar1a leads to MET, a function in a tissue and cell-type specific manner to regulate finding which has clear implications for the behavior of these accurately the activity of the catalytic subunits (1–3). Of the four tumors. regulatory subunits, PRKAR1A is the most highly and ubiquitously expressed. Materials and Methods Prkar1a Note: Supplementary data for this article are available at Cancer Research Online Animal studies. The generation of the conditional null line (http://cancerres.aacrjournals.org/). (9) and the TEC3 (cre) line (12) have previously been described. Requests for reprints: Lawrence S. Kirschner, 420 West 12th Avenue TMRF 544, Genetically modified mice were housed in sterile microisolator racks on Columbus, OH 43210. Phone: 614-292-1190; Fax: 614-688-4006; E-mail: Lawrence. a 12-h light/dark cycle. All animals were cared for under an IACUC- [email protected]. I2008 American Association for Cancer Research. approved animal protocol in accordance with the highest standards of doi:10.1158/0008-5472.CAN-07-6002 ethical animal care. www.aacrjournals.org 2671 Cancer Res 2008; 68: (8).April 15, 2008

Patient samples. All human samples were collected with informed essentially as described (15) using the Affymetrix Mouse 430A and B chips consent at NIH from patients participating in research protocol 96-CH-0069. to compare two independently isolated cell lines that were WTor KO for the Samples used in this study were all previously shown to carry mutations in Prkar1a gene. Full details of this microarray analysis will be published the PRKAR1A gene (13). elsewhere. À/À Cell culture and transfections. Wild-type (WT) and Prkar1a MEFs were generated and maintained in DMEM supplemented with 10% fetal Results bovine serum (FBS; Hyclone) as described (14). HeLa and 293Tcells were cultured in DMEM supplemented with 10% FBS in a humidified MET in Prkar1a null tumors. In our studies of schwannomas Prkar1a+/À Prkar1aÀ/À atmosphere containing 5% CO2. For transfections, cells plated 24 h before from and tissue-specific mice, we consis- transfection were transfected with constitutively active PKA-C expression tently noted the presence of small islands of epithelial-appearing plasmid using Superfect (Qiagen) according to manufacturer’s recommen- cells that stained for cytokeratin 14 (9) and cytokeratin 18 (Fig. 1). dations. Cells were harvested 48 h after transfection for protein preparation To verify the connection between these cells and the loss of as described (14). Prkar1a, we initially attempted to stain the tumors with an Immunoblot analysis. For vimentin immunoblotting, whole-cell lysates antibody specific for the Prkar1a protein. However, all anti-Prkar1a prepared from early (P10) and late passage MEFs (P23) were separated by antibodies tested exhibited significant nonspecific staining in 10% SDS/PAGE, transferred to nitrocellulose membrane (Pall), and probed with primary antibodies from the following sources: Santa Cruz Bio- immunohistochemical testing, so results were felt to be unreliable 55 (data not shown). To circumvent this problem, we introduced into technologies [phosphorylated vimentin (Ser ), vimentin, twist, N-cadherin lacZ (N-19), and fibronectin (H-300)], Spring Bioscience (aSMA), Abcam (Snail, the mouse line the Rosa26 reporter allele (16), which enables E-cadherin), Cell Signaling, Inc. (extracellular signal-regulated kinase), and h-galactosidase expression in the presence of cre activity. Because loxP BD Biosciences (SHP2). Binding of primary antibodies was visualized after excision of the Prkar1a allele seems to occur at high efficiency incubation with species-specific secondary antibodies using chemilumines- (data not shown), we used lacZ staining as a means to mark cells cence reagents (Perkin-Elmer). which had recombined the Prkar1a alleles. Staining of serial frozen Immunofluorescence and immunohistochemistry. For immunofluo- sections of tumors showed that the epithelial islands also stained Prkar1a rescence, frozen schwannoma sections obtained from tissue- intensely for h-galactosidase activity, confirming that they arose specific KO mice were fixed in cold acetone for 10 min and blocked for from Prkar1a KO cells (Fig. 1). Because these tumors arose from 1 h with the blocking solution obtained from mouse-on-mouse kit (Vector Labs). The sections were serially stained with vimentin and phalloidin or neural crest cells, we also stained them for vimentin, an vimentin and cytokeratin 18, and the binding of primary antibodies was intermediate filament protein characteristic of mesenchymal- visualized by incubation with the appropriate secondary antibodies derived cells. Surprisingly, analysis of vimentin showed that the conjugated with Alexa 488 or 594 dyes. For immunohistochemistry, protein was essentially absent from the tumor, not only in the paraffin-embedded adrenocortical tumor sections from CNC patients were regions of the epithelial islands (Fig. 1), but also in the tumor as a bleached in 10% hydrogen peroxide for f8 h or until pigmentation had whole (Fig. 2A and B). In regions at the edge of the tumor, lacZ faded. Slides were then subject to antigen retrieval and staining for staining correlated both with neoplastic cells and with a lack of vimentin as described (9). vimentin, both of which were clearly absent from the surrounding Microarray and quantitative real-time PCR analyses. mRNA was +/+ À/À stromal tissue (Fig. 2A). isolated from Prkar1a and Prkar1a MEFs and quantitative real-time In contrast, staining with phalloidin to detect structural PCR (qRT-PCR) was performed as described (14). Vimentin primers used were forward, ATGTGAAGTTCATTTCCAACCC and reverse, TTGACTCC filamentous actin (F-actin) showed uniform labeling of both B AGAAGGGCTTCA. mRNA fold changes were calculated by the ddCt method stroma and tumor (Fig. 2 ). Finally, to confirm the immunofluo- using Gapdh as a standard. All PCR reactions were done in triplicate, and rescence data, cell lysates were prepared from snap-frozen tumors À/À +/+ each analysis was representative of three Prkar1a and one Prkar1a and shown to exhibit markedly reduced vimentin in the presence of cell lines taken from the same litter. Microarray analysis was performed unaltered levels of actin (Fig. 2C). These data suggested that all

Figure 1. Prkar1a null schwannomas exhibit gain of cytokeratin and loss of vimentin. Examples of epithelial islands observed in two different TEC3 tumors. Note the highly eosinophilic,cellular structures seen in H&E and 4 ¶,6-diamidino-2-phenylindole (DAPI) correlate with intense h-galactosidase (b-gal) staining as a marker of cre activity. These structures exhibit loss of vimentin and gain of cytokeratin 18 (CK18) staining,indicating MET. Although all cells have lost vimentin,the most intense h-galactosidase staining occurs in the cytokeratin-positive epithelial islands.

Cancer Res 2008; 68: (8).April 15, 2008 2672 www.aacrjournals.org

Figure 2. Loss of vimentin occurs in Prkar1a null schwannomas but not in tumor stroma. A, vimentin staining is lost only in cells with h-galactosidase staining as a marker for cre activity. B, immunofluorescence of vimentin and F-actin (stained by phalloidin) on frozen sections of Prkar1a null schwannomas. Vimentin staining is absent in the tumor compartment (T),whereas it is easily detectable in the stroma (S). Phalloidin, which stains F-actin,is present equally in both compartments. C, Western blotting of the tumor lysates confirmed the down-regulation of vimentin in tumors compared with normal Schwann cell lysates. h-Actin is used as a loading control.

tumor cells had undergone MET, although only some of them KO MEFs is due to enhanced proteasomal degradation caused by had reached the state of full epithelial differentiation, including excess PKA activation. cytokeratin staining. Loss of vimentin correlates with other signs of MET in À/À Down-regulation of vimentin in Prkar1a KO MEFs. To Prkar1a MEFs. To determine if loss of vimentin was an investigate the mechanisms by which loss of Prkar1a could result isolated event or if there were other molecular alterations asso- in the loss of vimentin and thus alter tumor behavior, we sought to ciated with change in cell function, we next performed immu- À/À determine if the same phenomenon was occurring in Prkar1a noblotting for the epithelial marker E-cadherin. As shown in MEFs. We have previously shown that these cells, which are Fig. 3C, E-cadherin was markedly up-regulated in the KO MEFs. generated in vitro from Prkar1aloxP/loxP MEFs, exhibit an increase in This up-regulation was mirrored at the mRNA level, as microarray both free and total PKA activity (14). In confirmation of the in vivo hybridization studies indicated a 4.4-fold increase of the E-cadherin data, we observed a striking down-regulation of vimentin in the transcript (Cdh1) in KO cells compared with WTcells (Table1). cells, including both the total and phosphorylated forms of the Finally, to confirm the alteration in cell fate, we performed protein (Fig. 3A). This down-regulation was more pronounced in Western blotting for other markers of the mesenchymal lineage late passage MEFs, in which levels of phosphorylated vimentin are (17). Analysis of N-cadherin and a-smooth muscle actin (encoded even more strongly suppressed. These results suggested that by Acta2) showed down-regulation of both of these mesenchymal increased activity of PKA as a result of the loss of Prkar1a is able to structural proteins, whereas fibronectin was not altered. Analysis of modulate vimentin levels. the transcription factors Snai1 (Snail) and Twist did not show To explore the mechanism responsible for decreased vimentin in changes in expression level. To better understand these observa- these cells, we first examined the levels of vimentin mRNA in both tions, we also mined our preexisting microarray data4 to determine KO and WTMEFs by cDNA microarray analysis (Table1). No the expression of these and other relevant mRNAs (Table 1). Using significant differences were observed in the vimentin mRNA levels an arbitrary cutoff of a 1.5-fold change, we observed transcriptional between Prkar1a KO MEFs and WTMEFs, and this observation up-regulation of the epithelial markers E-cadherin (Cdh1) and was confirmed with qRT-PCR analysis (Supplementary Fig. 1). Tight junction protein 1 (Tjp1, also known as ZO-1), and These results indicated that the observed changes in vimentin transcriptional down-regulation of the mesenchymal markers Slug protein levels occurred at the level of posttranscriptional control. (Snai2), Twist2, Hmga2, Ets1, and a-SMA (Acta2). No alterations in To determine if the reduction in vimentin level was due to transcript levels for other mesenchymal markers, such as Lef1, enhanced degradation, cells were incubated with the proteasome Ets1, Hnrpab (CBF-A), Trim28 (KAP-1), or Fsp1 (S100A4), were inhibitor MG132. Treatment of KO MEFs restored the levels of vimentin to that of WTcontrols in 6 h of treatment (Fig. 3 B), whereas no significant changes in vimentin levels were observed in WTMEFs. Theseresults indicate that a decreased vimentin level in 4 L.S. Kirschner, unpublished data. www.aacrjournals.org 2673 Cancer Res 2008; 68: (8).April 15, 2008

Figure 3. Prkar1a KO MEFs exhibit characteristics of MET. A, Western blotting of early and late passage Prkar1a knockout and WT MEFs showing down-regulation of phosphorylated vimentin and vimentin in Prkar1a knockout MEFs. B, immunoblot analysis showing that MG-132 treatment of KO MEFs restores vimentin levels to those of WT cells. Note that MG-132 does not enhance vimentin levels in WT cells. C, Prkar1a KO MEFs exhibit marked up-regulation of E-cadherin. D, Western blotting for other markers of MET in KO and WT MEFs. Note the strong decreases in N-cadherin and aSMA,whereas levels of fibronectin are decreased slightly. The transcription factors Snail and Twist do not change in the KO cells compared with Shp2,which is shown as a loading control.

observed. Interestingly, there is no change in the transcript levels of loss of PRKAR1A/Prkar1a in both human and mouse tumors, N-cadherin, despite its reduction at the protein level. These data suggesting that down regulation of vimentin is one of the indicate that the protein changes characteristic of the MET consequences of increased PKA activity which might affect the phenotype occur by a combination of both transcriptional behavior of tumor cells. regulation (Acta2) and post transcriptional regulation (vimentin, N-cadherin). Table 1. Mining of cDNA microarray data for the Down regulation of vimentin is caused by increased PKA expression of epithelial and mesenchymal markers activity. Next, we wanted to examine if these changes were a general phenomenon associated with activation of PKA. To Transcript Fold expression No. address this, we transfected the Protein Kinase A catalytic subunit change F SD* probesets (PKAC) into HeLa and 293Tcells and measured the effects on Prkar1a levels of vimentin. Similar to the observations in KO Nuclear factors Snai1 (Snail) 1.30 1 MEFs, increasing PKAC expression led to the down regulation of Snai2 (Slug) À1.73 F 0.08 2 vimentin protein in both HeLa and 293Tcells (Fig. 4 A and B). Snai3 1.01 F 0.04 2 These findings provided confirmatory evidence indicating that Twist1 1.06 1 enhanced activation of PKA is able to suppress levels of the Twist2 À2.04 1 vimentin protein. Lef1 À1.10 F 0.03 2 À F Loss of vimentin in adrenal nodules from CNC patients. The Ets1 1.55 0.30 4 F most common endocrine manifestation in CNC patients is Hnrpab (CBF-A) 1.13 0.20 6 Trim28 (KAP-1) 1.16 F 0.03 2 primary pigmented nodular adrenocortical disease (PPNAD), in Hmga2 À2.75 F 1.10 4 which multiple hypersecretory adrenal nodules are seen in the Structural Vimentin À1.16 F 0.14 3 setting of an atrophic adrenal cortex (18). Adrenal nodules from proteins E-cadherin (Cdh1) 2.71 F 2.34 2 these patients are highly pigmented due to the accumulation of N-cadherin (Cdh2) À1.14 F 0.07 3 lipofuscin, which has been reported to be seen only in nodule cells P-cadherin (Cdh3) 1.39 F 0.21 2 exhibiting loss of heterozygosity (LOH) of PRKAR1A (19, 20). R-cadherin (Cdh4) 1.07 1 Functionally, loss of PRKAR1A is associated with excess PKA Acta2 (aSMA) À2.42 F 0.99 3 signaling in these tumors, similar to Prkar1a KO MEFs Fibronectin 1 À1.10 F 0.01 2 À (14, 21). To determine if CNC-associated adrenal tumors also Fsp1 (S100A4) 1.21 1 exhibited changes in vimentin, paraffin embedded adrenocortical Tjp1 (ZO-1) 1.54 1 sections from patients were stained for vimentin. In agreement with the data presented above, human adrenal tumors exhibited *Values of >1 indicate that the gene was more highly expressed in KO essentially complete loss of vimentin in the adrenal nodules, cells, whereas values of <À1 indicate the gene was down-regulated in whereas the internodular cortex stained intensely (Fig. 5). In KO cells. In cases where more than one probeset for the indicated contrast to human patients, adrenal nodules are not observed in gene was present, SD of the fold-changes is indicated. Bold cells +/À Prkar1a mice (9, 22), so a comparative study was not possible. indicate mRNAs altered at >1.5-fold, either up or down. These results show that vimentin is down regulated in response to

Cancer Res 2008; 68: (8).April 15, 2008 2674 www.aacrjournals.org

known to affect the recruitment and function of the vasodilator- stimulated phosphoprotein at tight junctions, and this may also play a role in modulating the epithelial phenotype (36). Vimentin itself is considered a marker for mesenchymal cells, and recent data indicate that it also has a functional role in promoting the mesenchymal phenotype and invasiveness (24). This protein is typically expressed in neoplasms originating from mesenchymal tissues; sarcomas, lymphomas, malignant melano- mas, and schwannomas are virtually always vimentin-positive (37). Additionally, mesoderm derived carcinomas, like renal cell carcinoma, adrenocortical carcinoma, and adenocarcinomas of the endometrium and ovary, usually express vimentin, as do many thyroid carcinomas (38). In contrast with the finding in typical schwannomas, we observe Figure 4. Overexpression of PKA catalytic subunit in a heterologous system À/À causes down-regulation of vimentin. Immunoblot analysis of 293T and HeLa cell a striking down-regulation of vimentin in Prkar1a schwanno- lysates transiently transfected with PKA catalytic subunit revealed that increased mas, a finding recapitulated in PPNAD specimens from CNC expression of PKA-C led to down-regulation of vimentin protein. Note that this change occurs regardless if endogenous Prkar1a levels are low (293T cells) or patients. Similarly, although vimentin is normally easily detected in high (HeLa cells). PTEN is shown as a loading control. Representative blot fibroblasts, we find that the protein is essentially absent from from among three experiments. Prkar1a KO MEFs, which exhibit multiple molecular alterations consistent with MET. In each of these different models, we Discussion observed a consistent down-regulation of vimentin, which was Epithelial to Mesenchymal transition (EMT) and MET are corroborated by the activation of PKA by direct transfection of the normal embryonic processes involving interconversion of epithelial catalytic subunit. Taken as a whole, the data suggest that direct and mesenchymal cells, which serve to generate the proper variety activation of PKA causes MET. The role of PKA activation in this of differentiated tissues during organogenesis (23). EMThas been process is complex, however, as we have shown in the MEFs that proposed to be an important step in determining the behavior of changes in protein expression can occur at either the transcrip- cancers, as acquisition of the mesenchymal phenotype has been tional or posttranscriptional level. proposed to be important for allowing cancers to invade and cause This physiologic change from a mesenchymal to an epithelial metastasis (23, 24). Although the process of EMThas been studied phenotype would be expected to play an important role in tumor carefully in the setting of cancer biology, much less is known about cell biology (39), and the fact that malignant tumors are rarely seen the role of MET. During development, MET occurs during in CNC patients may be a biological reflection of this cell fate somitogenesis, kidney development and coelomic cavity formation alteration. Also, the fact that tumors associated with activation of (25–28), and a similar process plays a significant role in the repair PKA signaling, including thyroid tumors and adrenocorticortico- of kidney damage (29). In tissue culture cells, METcan be induced tropic hormone (ACTH)–responsive adrenocortical lesions, are by overexpression of the epithelial marker E-cadherin (30) or the rarely malignant may be partly explained by the fact that activation proteoglycan versican (31). METmay also have a role in cancer of PKA signaling promotes epithelial differentiation, which must be progression different from that of EMT. In a model of bladder overcome by other means before metastatic spread can occur. For cancer metastasis, METwas shown to enhance the ability of these tumors to become invasive, molecular alterations causing injected cells to seed distant sites in a Fibroblast growth factor loss of PKA signaling must occur, such as loss of the ACTH receptor receptor 2 (FGFR2)-dependent manner, whereas the ability to in adrenocortical cancers (40). metastasize from a primary tumor required a different set of Unlike other regulatory subunits of PKA, Prkar1a is the only cellular changes (29). isoform that is essential for early embryonic development (3, 9). À/À The connection between PKA signaling and epithelial-mesen- Prkar1a embryos fail to develop a functional heart tube at chymal identity has not been elucidated in detail. PKA has been E8.5 and are resorbed before E10.5, highlighting the role of cyclic proposed as a mediator of EMTin response to transforming growth AMP/PKA regulation in early embryonic development. At the À/À factor (TGF)-h1 in a murine hepatocyte cell line (32), although a biological level, early Prkar1a embryos show a reduced number direct role for PKA could not identified. Similarly, PKA activation was proposed to promote EMTin the developing neural crest downstream of BMP4/Sox9 signaling; in this model, PKA’s role in this process was found to be complex (33). To the best of our knowledge, there have been no reports describing a role for PKA in MET, either in vitro or in vivo. It has been shown that PKA can regulate vimentin phosphorylation, and this posttranslational modification seems to affect intermediate filament formation. However, no effects on vimentin protein levels have been reported (34, 35). Phosphorylation of vimentin by PKA leads to changes in cell morphology, as observed in Prkar1a KO MEFs.5 PKA is also

Figure 5. Down-regulation of vimentin in adrenal nodules of primary pigmented nodular adrenocortical disease from CNC patients. PPNAD adrenals were stained with a human anti-vimentin antibody. Note the strong staining in the 5 K.S. Nadella and L.S. Kirschner, unpublished observation. normal cortex (C),whereas staining in nodules ( N) is essentially absent. www.aacrjournals.org 2675 Cancer Res 2008; 68: (8).April 15, 2008

Downloaded from cancerres.aacrjournals.org on September 24, 2021. © 2008 American Association for Cancer Research. Cancer Research of mesodermal cells emerging from the primitive streak and fail to structure and function (43). Therefore, it seems reasonable that develop normal mesoderm-derived structures. This developmental specific loss of the PRKAR1A subunit, such as in CNC, shifts the defect was shown to be due to excess PKA activity, as it was balance toward MET, as observed in the experiments described partially rescued by genetic disruption of PKA catalytic subunits here. Further experimental studies will be required to resolve this (3). Based on the findings presented here, we propose that the uncertainty. defect in mesodermal specification in this model may be due to In summary, we have shown that activation of PKA signaling is METof these developing cells. sufficient to cause a reduction in the mesenchymal marker Given our observations suggesting that PKA activity causes MET, vimentin as part of a process of MET. This occurs in a mouse the exact role of PKA in development remains somewhat unclear. model and in human patients with the CNC. The long-term It is possible that the balance of EMTversus METis controlled by implications of these findings, including the consideration that cell type–specific factors so that the results of any experiment will manipulation of the PKA system could be used for therapeutic depend strongly on the exact tissue/cell type chosen for study. effect, may bear further investigation. Neither liver nor bladder tumors have been associated with loss of PRKAR1A in humans or mice, so the studies indicating that PKA is required for EMTin these tissues (32, 33) may contrast with Acknowledgments findings in Schwann cells, which are well known to have a Received 10/25/2007; revised 1/28/2008; accepted 2/18/2008. prominent growth response to PKA activation (41, 42). An alternate Grant support: NIH grants HD01323, CA112268-02 (L.S. Kirschner), and CA16058 (OSU Comprehensive Cancer Center) and intramural program Z01-HD-000642 (C.A. hypothesis is that there is a specific signaling effect of the Stratakis). PRKAR1A subunit that is required for EMTfunction of PKA. The costs of publication of this article were defrayed in part by the payment of page Individual PKA regulatory subunits have specific patterns of charges. This article must therefore be hereby marked advertisement in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. interaction with various A-kinase anchoring proteins, which can We thank Dr. Matthew Ringel for sharing reagents and for helpful discussions and affect PKA localization and function, particularly as it affects cell Dr. Michael Oglesbee for his expert evaluation of tumor sections.

References 11. Katsumoto T, Mitsushima A, Kurimura T. The role epithelial-mesenchymal transitions. Nat Rev Mol Cell of the vimentin intermediate filaments in rat 3Y1 Biol 2006;7:131–42. 1. Cummings DE, Brandon EP, Planas JV, Motamed K, cells elucidated by immunoelectron microscopy and 24. Vasko V, Espinosa AV, Scouten W, et al. Gene Idzerda RL, McKnight GS. Genetically lean mice result computer-graphic reconstruction. Biol Cell 1990;68: expression and functional evidence of epithelial-to- from targeted disruption of the RII h subunit of protein 139–46. mesenchymal transition in papillary thyroid carcino- kinase A. Nature 1996;382:622–6. 12. Tonks ID, Nurcombe V, Paterson C, et al. Tyrosinase- ma invasion. Proc Natl Acad Sci U S A 2007;104: 2. Burton KA, Treash-Osio B, Muller CH, Dunphy EL, Cre mice for tissue-specific gene ablation in neural crest 2803–8. McKnight GS. Deletion of type IIa regulatory subunit and neuroepithelial-derived tissues. Genesis 2003;37: 25. Christ B, Ordahl CP. Early stages of chick somite delocalizes protein kinase A in mouse sperm without 131–8. development. Anat Embryol (Berl) 1995;191:381–96. affecting motility or fertilization. J Biol Chem 1999;274: 13. Boikos SA, Stratakis CA. Carney complex: the first 20 26. Funayama N, Sato Y, Matsumoto K, Ogura T, 24131–6. years. Curr Opin Oncol 2007;19:24–9. Takahashi Y. Coelom formation: binary decision of the 3. Amieux PS, Howe DG, Knickerbocker H, et al. 14. Nadella KS, Kirschner LS. Disruption of protein lateral plate mesoderm is controlled by the ectoderm. Increased basal cAMP-dependent protein kinase activity kinase a regulation causes immortalization and Development 1999;126:4129–38. inhibits the formation of mesoderm-derived structures dysregulation of D-type cyclins. Cancer Res 2005;65: 27. Locascio A, Nieto MA. Cell movements during in the developing mouse embryo. J Biol Chem 2002;277: 10307–15. vertebrate development: integrated tissue behaviour 27294–304. 15. Pavel E, Nadella K, Towns WH II, Kirschner LS. versus individual cell migration. Curr Opin Genet Dev 4. Kirschner LS, Carney JA, Pack SD, et al. Mutations of Mutation of Prkar1a Causes Osteoblast Neoplasia 2001;11:464–9. the gene encoding the protein kinase A type I-a Driven by Dysregulation of PKA. Mol Endocrinol 2007. 28. Nieto MA. The snail superfamily of zinc-finger regulatory subunit in patients with the Carney complex. Epub 2007 Oct 11. transcription factors. Nat Rev Mol Cell Biol 2002;3: Nat Genet 2000;26:89–92. 16. Soriano P. Generalized lacZ expression with the 155–66. 5. Kirschner LS, Sandrini F, Monbo J, Lin JP, Carney ROSA26 Cre reporter strain. Nat Genet 1999;21:70–1. 29. Chaffer CL, Brennan JP, Slavin JL, Blick T, JA, Stratakis CA. Genetic heterogeneity and spec- 17. Teng Y, Zeisberg M, Kalluri R. Transcriptional Thompson EW, Williams ED. Mesenchymal-to-epithe- trum of mutations of the PRKAR1A gene in regulation of epithelial-mesenchymal transition. J Clin lial transition facilitates bladder cancer metastasis: patients with the Carney complex. Hum Mol Genet Invest 2007;117:304–6. role of fibroblast growth factor receptor-2. Cancer Res 2000;9:3037–46. 18. Stratakis CA, Kirschner LS, Carney JA. Clinical and 2006;66:11271–8. 6. Casey M, Vaughan CJ, He J, et al. Mutations in the molecular features of the Carney complex: diagnostic 30. Auersperg N, Pan J, Grove BD, et al. E-cadherin protein kinase A R1a regulatory subunit cause familial criteria and recommendations for patient evaluation. induces mesenchymal-to-epithelial transition in human cardiac myxomas and Carney complex. J Clin Invest J Clin Endocrinol Metab 2001;86:4041–6. ovarian surface epithelium. Proc Natl Acad Sci U S A 2000;106:R31–8. 19. Groussin L, Jullian E, Perlemoine K, et al. Mutations 1999;96:6249–54. 7. Bertherat J, Groussin L, Sandrini F, et al. Molecular and of the PRKAR1A gene in Cushing’s syndrome due to 31. Sheng W, Wang G, La Pierre DP, et al. Versican functional analysis of PRKAR1A and its locus (17q22-24) sporadic primary pigmented nodular adrenocortical mediates mesenchymal-epithelial transition. Mol Biol in sporadic adrenocortical tumors: 17q losses, somatic disease. J Clin Endocrinol Metab 2002;87:4324–9. Cell 2006;17:2009–20. mutations, and protein kinase A expression and activity. 20. Mavrakis M, Lippincott-Schwartz J, Stratakis CA, 32. Yang Y, Pan X, Lei W, et al. Regulation of trans- Cancer Res 2003;63:5308–19. Bossis I. Depletion of type IA regulatory subunit (RIa)of forming growth factor-{h}1-induced apoptosis and 8. Sandrini F, Matyakhina L, Sarlis NJ, et al. Regulatory protein kinase A (PKA) in mammalian cells and tissues epithelial-to-mesenchymal transition by protein kinase subunit type I-a of protein kinase A (PRKAR1A): a activates mTOR and causes autophagic deficiency. Hum A and signal transducers and activators of transcription tumor-suppressor gene for sporadic thyroid cancer. Mol Genet 2006;15:2962–71. 3. Cancer Res 2006;66:8617–24. Genes Chromosomes Cancer 2002;35:182–92. 21. Griffin KJ, Kirschner LS, Matyakhina L, et al. Down- 33. Sakai D, Suzuki T, Osumi N, Wakamatsu Y. 9. Kirschner LS, Kusewitt DF, Matyakhina L, et al. A regulation of regulatory subunit type 1A of protein Cooperative action of Sox9, Snail2 and PKA signaling mouse model for the Carney complex tumor syndrome kinase A leads to endocrine and other tumors. Cancer in early neural crest development. Development 2006; develops neoplasia in cyclic AMP-responsive tissues. Res 2004;64:8811–5. 133:1323–33. Cancer Res 2005;65:4506–44. 22. Veugelers M, Wilkes D, Burton K, et al. Comparative 34. Lamb NJ, Fernandez A, Feramisco JR, Welch WJ. 10. Goldman BI, Frydman C, Harpaz N, Ryan SF, PRKAR1A genotype-phenotype analyses in humans with Modulation of vimentin containing intermediate fila- Loiterman D. Glandular cardiac myxomas. Histologic, Carney complex and prkar1a haploinsufficient mice. ment distribution and phosphorylation in living fibro- immunohistochemical, and ultrastructural evidence of Proc Natl Acad Sci U S A 2004;101:14222–7. blasts by the cAMP-dependent protein kinase. J Cell Biol epithelial differentiation. Cancer 1987;59:1767–75. 23. Thiery JP, Sleeman JP. Complex networks orchestrate 1989;108:2409–22.

Cancer Res 2008; 68: (8).April 15, 2008 2676 www.aacrjournals.org

35. Inagaki M, Nishi Y, Nishizawa K, Matsuyama M, 38. Nicoli S, Gilardelli CN, Pozzoli O, Presta M, Cotelli F. 41. Kim HA, DeClue JE, Ratner N. cAMP-dependent Sato C. Site-specific phosphorylation induces disas- Regulated expression pattern of gremlin during zebra- protein kinase A is required for Schwann cell growth: sembly of vimentin filaments in vitro. Nature 1987;328: fish development. Gene Expr Patterns 2005;5:539–44. interactions between the cAMP and neuregulin/ 649–52. 39. Lee JM, Dedhar S, Kalluri R, Thompson EW. The tyrosine kinase pathways. J Neurosci Res 1997;49: 36. Kohler K, Louvard D, Zahraoui A. Rab13 regulates epithelial-mesenchymal transition: new insights in 236–47. PKA signaling during tight junction assembly. J Cell Biol signaling, development, and disease. J Cell Biol 2006; 42. Sobue G, Shuman S, Pleasure D. Schwann cell 2004;165:175–80. 172:973–81. responses to cyclic AMP: proliferation, change in shape, 37. Azumi N, Battifora H. The distribution of vimentin 40. Reincke M, Mora P, Beuschlein F, Arlt W, Chrousos and appearance of surface galactocerebroside. Brain Res and keratin in epithelial and nonepithelial neoplasms. A GP, Allolio B. Deletion of the adrenocorticotropin 1986;362:23–32. comprehensive immunohistochemical study on forma- receptor gene in human adrenocortical tumors: impli- 43. Scott JD. A-kinase-anchoring proteins and cyto- lin- and alcohol-fixed tumors. Am J Clin Pathol 1987;88: cations for tumorigenesis. J Clin Endocrinol Metab 1997; skeletal signalling events. Biochem Soc Trans 2003;31: 286–96. 82:3054–8. 87–9.

www.aacrjournals.org 2677 Cancer Res 2008; 68: (8).April 15, 2008

Downloaded from cancerres.aacrjournals.org on September 24, 2021. © 2008 American Association for Cancer Research. Targeted Deletion of Prkar1a Reveals a Role for Protein Kinase A in Mesenchymal-to-Epithelial Transition

Kiran S. Nadella, Georgette N. Jones, Anthony Trimboli, et al.

Cancer Res 2008;68:2671-2677.

Updated version Access the most recent version of this article at: http://cancerres.aacrjournals.org/content/68/8/2671

Supplementary Access the most recent supplemental material at: Material http://cancerres.aacrjournals.org/content/suppl/2008/04/14/68.8.2671.DC1

Cited articles This article cites 42 articles, 17 of which you can access for free at: http://cancerres.aacrjournals.org/content/68/8/2671.full#ref-list-1

Citing articles This article has been cited by 6 HighWire-hosted articles. Access the articles at: http://cancerres.aacrjournals.org/content/68/8/2671.full#related-urls

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/68/8/2671. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.