The Threshold Level of Adenomatous Polyposis Coli Protein for Mouse Intestinal Tumorigenesis

Priority Report

Qin Li,1 Tomo-o Ishikawa,1,2 Masanobu Oshima,1 and Makoto M. Taketo1

1Department of Pharmacology, Graduate School of Medicine, Kyoto University, Kyoto, Japan and 2Department of Pharmacology, David Geffen School of Medicine, University of California at Los Angeles, Los Angeles, California

Abstract coding region are lacking in some intestinal tumors with The adenomatous polyposis coli (APC) gene, whose mutations significantly reduced APC levels (5). are responsible for familial adenomatous polyposis, is a major Several lines of Apc mutant mice have been established as B models for intestinal polyposis. Interestingly, they develop negative controller of the Wnt/ -catenin pathway. To inves- D716 f tigate the dose-dependent effects of APC protein in suppress- different tumor numbers. Apc form 300 polyps, whereas ApcMin and Apc1638N develop f30 and f3, respectively (6–8). In ing intestinal tumorigenesis, we constructed mutant mice neoR carrying hypomorphic Apc alleles ApcneoR and ApcneoF whose contrast, Apc is a hypomorphic allele whose expression is attenuated to f20% of the wild-type Apc allele (9, 10). Notably, expression levels were reduced to 20% and 10% of the wild neoR type, respectively. Although both hypomorphic heterozygotes heterozygous Apc mice develop very small numbers of intestinal polyps. However, the molecular mechanism has not been developed intestinal polyps, tumor multiplicities were much lower than that in ApcD716 mice, heterozygotes of an Apc null investigated regarding the low polyp multiplicity. To determine the allele. Like in ApcD716 mice, loss of the wild-type Apc allele was dosage effects of the Apc gene activity on suppression of intestinal confirmed for all polyps examined in the ApcneoR and ApcneoF tumorigenesis, we have constructed another hypomorphic Apc allele ApcneoF that expresses even lower level of APC than ApcneoR. mice. In the embryonic stem cells homozygous for these neoF neoR D716 hypomorphic Apc alleles, the level of the APC protein was By comparison of Apc and Apc heterozygotes with Apc B mice, we show that the amount of APC protein is inversely inversely correlated with both the -catenin accumulation and h B-catenin/T-cell factor transcriptional activity. These results correlated with Wnt/ -catenin transcriptional activity that seems suggest that the reduced APC protein level increases intes- to regulate polyp multiplicity. tinal polyp multiplicity through quantitative stimulation of the B-catenin/T-cell factor transcription. We further esti- Materials and Methods mated the threshold of APC protein level that forms one Recombinant embryonic stem cells and animals. Recombinant polyp per mouse as f15% of the wild type. These results also embryonic stem (ES) cells (Apc+/neoF and ApcneoF/neoF) and ApcneoF mice suggest therapeutic implications concerning Wnt signaling were constructed as previously described (9). All Apc mutant strains were inhibitors. (Cancer Res 2005; 65(19): 8622-7) generated in ES cells of 129 strain, and backcrossed to C57BL/6 strain. Backcross generations were >30 for ApcD716, 11 for ApcneoR , and 8 for ApcneoF. Introduction Western blotting and reporter assay. Western blotting for APC and h-catenin, and h-catenin/TCF reporter assay were done as described Germ line mutations in the adenomatous polyposis coli (APC) previously (9). gene are responsible for familial adenomatous polyposis (FAP), Northern blotting. Polyadenylated RNA was extracted from the mouse an inherited autosomal dominant disease characterized by embryos and analyzed in 5 Ag aliquots. Fragments of mouse Apc cDNA development of multiple adenomas in the colon. Mutations in (nucleotides 33-920) and mouse glyceraldehyde-3-phosphate dehydrogenase APC are also detected in the majority of sporadic colon cancer (GAPDH) cDNA were used as probes. and early adenomas (1). The APC protein functions as a tumor Immunohistochemistry. Paraffin-embedded sections (4 Am thick) suppressor through regulation of the unphosphorylated cytoplas- were prepared by a standard method. The ES cells attached to 0.2% mic h-catenin levels (1, 2). In the absence of functional APC, gelatin coated glass chamber were fixed with 4% paraformaldehyde for h-catenin is accumulated in the cytoplasm, resulting in trans- 10 minutes. These specimens were incubated with the primary antibody h location to the nucleus with T-cell factor (TCF), followed by for -catenin (1:500; Sigma, St. Louis, MO) or cyclooxygenase-2 (COX-2; 1:200; Cayman Chemical, Ann Arbor, MI) for 1 hour at room tem- transcriptional activation of the Wnt target genes (1, 2). perature. Activation of Akt was determined using an anti–phospho-Akt Consistent with Knudson’s two-hit principle, both APC alleles antibody (1:50; Cell Signaling, Beverly, MA) as described previously (11). are inactivated in the majority of intestinal tumors (3). However, Immunostaining signals were visualized using Vectastain Elite kit (Vector it has been suggested that mutations in APC gene in FAP Laboratories, Burlingame, CA). To determine the cell proliferation rates, patients do not always follow the two-hit model. For example, sections were stained with an anti–Ki-67 antibody (1:100, MIB-5; reduced levels of APC expression from one allele are found in DAKOCytomation, Carpinteria, CA) as described previously (12). The some FAP patients (4). Moreover, obvious mutations in the APC labeling index for Ki-67 was calculated as the number of positive cells/ 5,000 tumor epithelial cells. Scoring polyps and histologic preparations. The number of polyps was scored as described previously (6). Fixed specimens were stained with 0.5% methylene blue (Sigma-Aldrich, St. Louis, MO). For histologic analyses, Requests for reprints: Makoto M. Taketo, Department of Pharmacology, Graduate formalin-fixed and paraffin-embedded sections were stained with H&E. School of Medicine, Kyoto University, Yoshida-konoe´-cho, Sakyo-ku, Kyoto, Japan. Loss of heterozygosity analysis of the Apc locus. Tumor DNA was Phone: 81-75-753-4391; Fax: 81-75-753-4402; E-mail: [email protected]. I2005 American Association for Cancer Research. isolated from paraffin sections and amplified by PCR as described doi:10.1158/0008-5472.CAN-05-2145 previously (6). Primers used for the wild-type Apc allele were as follows:

Cancer Res 2005; 65: (19). October 1, 2005 8622 www.aacrjournals.org

Apc-intron13-5V (GCCATACTTTAACACAAGCC) and Apc-intron13-3V found in the ApcD716 mice at 3 months (Table 1). Moreover, the neoF neoR (AAAGGCTGCATGAGAGCACTT). To detect the Apc and Apc alleles, tumor incidence was 50% and 19% in the 15-month-old ApcneoF and primers PR1 (CAGACTGCCTTGGGAAAAGC) paired with Apc-intron13-3V ApcneoR mice, respectively (Table 1), whereas 100% of ApcD716 mice V and Apc-intron13-5 were used, respectively. developed intestinal polyps at 7 weeks of age (6). Small micro- adenomas (<0.5 mm in diameter) that were frequently found in the Results ApcD716 mice under a dissecting microscope were rarely detected in Generation of hypomorphic ApcneoF mice. We have recently ApcneoF and ApcneoR mice (Table 1; ref. 6). generated ApcneoR (i.e., Apc+/neoR , where ‘‘R’’ stands for reverse B-Catenin localization in polyps of respective Apc mutants. orientation) mice by insertion of a PGK-neo cassette into intron Histologically, polyps in both ApcneoF and ApcneoR mice consisted of 13 of Apc gene in the opposite orientation to that of transcription dysplastic adenomas that were similar to those in ApcD716 mice (Fig. 1A, bottom). In this mutant, the decrease in the Apc mRNA (Fig. 2B and C). In the ApcD716 mouse polyps, h-catenin was was likely caused by promoter attenuation due to the loxP-PGK- localized predominantly to nuclei of the adenoma epithelial cells, neo cassette inserted into an enhancer site in intron 13 (9). Here, with some weak staining in the membrane (Fig. 2D and G). In the we constructed ApcneoF (F for forward) allele with the same PGK- polyps of ApcneoF and ApcneoR mice, however, cells with nuclear neo cassette inserted at the same site of Apc, but in the same h-catenin were found only sparsely (Fig. 2E, F, H,andI). orientation as that of transcription (Fig. 1A, top). After Accordingly, h-catenin is less stabilized in the polyps of the confirmation of homologous recombination in ES cells (Fig. 1B), ApcneoF and ApcneoR mice than in those of the ApcD716 mice. we injected the clones into blastocysts and established germ line– Importantly, proliferation of adenoma cells determined by Ki-67 transmitted mutant mice (Fig. 1C). The heterozygous Apc+/neoF labeling index was not much different among the polyps of the mice (hereafter ApcneoF mice) were viable, although homozygous ApcD716, ApcneoF, and ApcneoR mice (Fig. 2J-L, and S). These results ApcneoF/neoF mice were embryonically lethal at f9 days of indicate that the nuclear h-catenin localization is not necessarily gestation (data not shown). The homozygous and heterozygous correlated with adenoma cell proliferation. ApcneoF embryos expressed Apc mRNA at f10% and 55% levels of We have previously shown that induction of COX-2 in the polyp the wild-type, respectively (Fig. 1D), indicating that ApcneoF is a stroma is critical for polyp formation (12, 13). In the polyps of ApcneoF hypomorphic allele similar to ApcneoR. and ApcneoR mice, expression of COX-2 was detected in the luminal Intestinal polyps in ApcneoF and ApcneoR mice. Both ApcneoF side of polyp stroma like in the ApcD716 mice (Fig. 2M-O). We next and ApcneoR mutant strains developed intestinal polyps. However, examined activation of Akt by detection of its phosphorylated form their polyp multiplicities were much lower than that in the ApcD716 because Akt is constitutively activated in stem cells where h-catenin mice (i.e., Apc+/D716; Fig. 2A). Namely, the mean polyp numbers in is accumulated in nuclei (11). Interestingly, we found phospho-Akt in ApcneoF and ApcneoR mice were 1.09 F 0.85 and 0.26 F 0.54 at 15 cells of the entire adenoma in both ApcneoF and ApcneoR mouse months of age, respectively, whereas about a hundred polyps were polyps as in ApcD716 (Fig. 2P-R). Thus, induction of COX-2 pathway

Figure 1. Generation of hypomorphic ApcneoF mutant mice compared with that of ApcneoR. A, targeting strategy for ApcneoF (top, black) and ApcneoR (bottom, gray). Top, wild-type allele Apc+ ; middle, targeting vector; bottom, targeted allele. Filled boxes, exons; solid lines, intron sequences. The PGK-neo (neo) and PGK-DT (DT) cassettes are shown as open boxes with their transcriptional orientations (arrows). Triangles sandwiching exons 11 to 13 and the PGK-neo cassette indicate loxP sequences. Pairs of arrowheads, PCR primers; solid lines, Southern hybridization probe. The SacI fragments hybridizable to the probe are also shown (6.5 and 5.1 kb or 4.5 kb for the wild-type and targeted alleles, respectively). Sa,SacI sites. B, Southern hybridization of ApcneoF embryonic stem clone. Extracted DNA samples were digested with SacI and hybridized with the probe shown in (A). C, genomic PCR of the 8.5 dpc embryos from an intercross of heterozygous ApcneoF mice. Top, targeted allele; bottom, wild-type allele. Genotypes are indicated on top of the panels: +, wild-type; F, ApcneoF . D, Northern blotting of the Apc mRNA from the ApcneoF embryos. Genotypes are shown on top. Relative band intensities to the wild-type (+/+) are indicated at the bottom.

www.aacrjournals.org 8623 Cancer Res 2005; 65: (19). October 1, 2005

Figure 2. Morphologic and immunohistochemical analyses of intestinal polyps. A, representative dissection micrographs of the ileum from Apc D716 , Apc neoF, and Apc neoR mice (methylene blue staining). Arrowheads, polyps. Bar, 3 mm. B and C, histology of small intestinal polyps of Apc neoF and Apc neoR mice, respectively (H&E staining). Brackets indicate adenoma lesions. Bars, 40 Am. D to I, immunostaining for h-catenin in polyps of Apc D716 (D, G), Apc neoF (E, H), and Apc neoR (F, I) mice, respectively. (G)to (I) are higher magnification of the boxed areas from (D)to(F), respectively. Arrows (H and I), h-catenin–positive nuclei. Bars, 20 Am(D-F) and 100 Am(G-I). J to L, immunostaining for Ki-67 in polyps of ApcD716 (J), Apc neoF (K), and Apc neoR (L) mice. Bars, 50 Am. M to O, immunostaining for COX-2 in polyps of Apc D716 (M), Apc neoF (N), and Apc neoR (O) mice. Bars, 20 Am. P to R, immunostaining for phospho-Akt in polyps of Apc D716 (P), Apc neoF (Q), and Apc neoR (R) mice. Bars, 30 Am. S, Ki-67 labeling index for polyps of Apc D716 , Apc neoF, and Apc neoR mice. Columns, mean; bars, SD.

and activation of PI3K-Akt signaling are independent of h-catenin suggesting that polyp initiation was triggered by Apc gene loss of translocation to nuclei of adenoma cells. heterozygosity (LOH) as in the ApcD716 mice (6). Because Apc LOH We next examined the Apc genotype of polyp tissues by genomic is caused by recombination at the centromeric rDNA cluster on PCR. The wild-type Apc allele (Apc+) was lost in all polyps mouse chromosome 18 (14), it is expected that all adenoma cells examined in both hypomorphic Apc mutants (Fig. 3A and B), are in fact homozygous for the mutant Apc alleles (i.e., ApcneoF/neoF

Cancer Res 2005; 65: (19). October 1, 2005 8624 www.aacrjournals.org

Table 1. Small intestinal polyposis in Apc neoF and Apc neoR mice compared with that in Apc D716

Genotype Age (mo) Incidence, Mean Mean polyp Polyp size distribution affected/total (%) polyp no. size (mm) <0.5 mm >0.5 mm

ApcD716 3 11/11 (100) 99.4 F 45.4 1.24 F 1.18 42.3 F 27.1 57.1 F 18.3 ApcneoF 15 5/10 (50) 1.09 F 0.85 1.50 F 1.65 0 1.09 F 0.85 12 6/16 (38) 0.47 F 0.64 0.50 F 0.73 0 0.47 F 0.64 9 3/13 (23) 0.22 F 0.45 0.23 F 0.43 0 0.22 F 0.45 6 2/15 (13) 0.08 F 0.21 0.13 F 0.35 0 0.08 F 0.21 3 0/15 (0) NA NA NA NA ApcneoR 15 6/31 (19) 0.26 F 0.54 0.23 F 0.50 0 0.26 F 0.54 12 3/24 (13) 0.12 F 0.36 0.13 F 0.34 0 0.12 F 0.36 9 2/31 (6) 0.05 F 0.18 0.06 F 0.25 0 0.05 F 0.18 6 0/19 (0) NA NA NA NA 3 0/10 (0) NA NA NA NA WT 15 0/5 (0) NA NA NA NA 9 0/5 (0) NA NA NA NA 6 0/5 (0) NA NA NA NA 3 0/7 (0) NA NA NA NA

Abbreviations: WT, wild type; NA, not applicable.

and ApcneoR/neoR , respectively). These results are consistent with the 14, and 6.2 times of the wild-type level, respectively (Fig. 3L). These interpretation that Wnt signaling activation is necessary for the results, taken together, indicate that Wnt signaling activity is polyp initiation to a level higher than that caused by Apc+/D716 inversely and quantitatively correlated with the APC level both heterozygosity itself (see below). in vivo and in vitro. Adenomatous polyposis coli protein levels and B-catenin accumulation in Apc mutant polyps. We next determined the Discussion APC protein levels in the polyps by Western blotting. The We have shown here that the intestinal polyp multiplicity is relative amounts of APC in the normal (i.e., nonpolyp) small inversely correlated with the APC level, mediated by the strength intestine in the ApcneoR, ApcneoF, and ApcD716 mice were 75%, of Wnt/h-catenin signaling. Namely, the more reduced levels of 65%, and 50% of the wild-type level, respectively (Fig. 3C). The APC lead to the stronger activation of Wnt/h-catenin signaling, slightly lower APC level in the ApcneoF than ApcneoR may have resulting in the higher polyp numbers. Based on the present results, been caused by the insertional orientation of the PGK-neo we propose an ‘‘expression dosage’’ model that explains different cassette. Notably, we found faint bands for full-length APC in the intestinal polyp multiplicity among the respective Apc mutant polyps of ApcneoR and ApcneoF mice, whereas none in the ApcD716 alleles. The threshold level of APC that produces one intestinal polyps (Fig. 3C). In contrast, the h-catenin level was much polyp per mouse is f15% of the wild type (Fig. 3M). Consistent higher in the polyps of ApcD716 mice than ApcneoF or ApcneoR with these results, it has been suggested that predisposition to (Fig. 3D). These results indicate that the level of stabilized h- human colon polyposis is dependent on the reduced level of APC catenin is inversely correlated with the residual amount of wild- expression. Approximately 25% decrease in APC expression, which type APC. causes f75% reduction by further APC LOH, may predispose to Molecular basis of polyp multiplicity difference among FAP (4). Likewise, Wnt/h-catenin signaling controls ES cell Apc mutants. To determine the transcriptional activities by h- differentiation and intestinal tumorigenesis in a quantitative catenin/TCF complex in the respective Apc mutants in vitro,we manner at various levels of the pathway (10, 15, 16). generated homozygous ES cell lines for ApcneoR , ApcneoF, The attenuated form of FAP (AAPC) is characterized by smaller and ApcD716 alleles. The APC levels in the homozygous ApcneoR and polyp number and delayed age of onset than the common form, and ApcneoF ES cells were 20% and 10% of that in the Apc+/+ ES cells, phenotypically similar to the ApcneoF and ApcneoR mice. However, the respectively, whereas no APC protein was detected in the molecular mechanisms seem to be different slightly between human homozygous ApcD716 ES cells (Fig. 3E). Furthermore, the h-catenin AAPC and ApcneoF or ApcneoR mice. Germ line mutations in familial levels in the homozygous ApcneoR, ApcneoF, and ApcD716 ES cells adenomatous polyposis suggest that there is a need for a third were inversely correlated with the APC levels; f2.1, 3.1, and 12 mutation because the inherited alleles are leaky or may express times of that in the wild type, respectively (Fig. 3F). Accumulation amino-terminally truncated proteins when the allele is mutated in of h-catenin in the ApcneoR and ApcneoF cells was milder than that the 5V region (17). The amino-terminal mutation is followed by in the ApcD716 cells (Fig. 3G-J). Consistently, the nuclear staining reinitiation of the mRNA translation from an internal ribosomal entry index for h-catenin was significantly lower in the ApcneoR and site, resulting in reduced expression of nearly full-length functional ApcneoF cells than that in ApcD716 (Fig. 3K). Moreover, homozygous APC (18, 19). ApcD716 ES cells showed the highest transcriptional activity by Although it has been suggested that some truncated APC h-catenin/TCF complex, followed by ApcneoF and ApcneoR with 41, proteins have dominant effects in tumorigenesis through www.aacrjournals.org 8625 Cancer Res 2005; 65: (19). October 1, 2005

Downloaded from cancerres.aacrjournals.org on September 27, 2021. © 2005 American Association for Cancer Research. Cancer Research chromosomal instability (20, 21), hypomorphic alleles Apc neoF or We have reported recently that significantly decreased levels ApcneoR did not produce any truncated products (ref. 9 and data of APC and CDX2 proteins in the distal colon of the ApcD716 not shown). We have also shown that ApcD716 allele does not Cdx2+/À compound mutant mice cause numerous colonic show any dominant effects in intestinal tumorigenesis when adenomas due to an increased anaphase bridge index that expressed in the intestines as a transgene (22). caused Apc LOH (23). In contrast, the normal (nonpolyp)

Figure 3. Inverse correlation between the APC level and Wnt/h-catenin transcriptional activity. A and B, Apc LOH in Apc neoF (A) and Apc neoR (B) polyps analyzed for the adenoma (T ) compared with normal intestine (N). WT, wild-type allele; KO, knockout alleles. Western blotting for APC (C) and h-catenin (D) in the intestines of Apc neoR (top), Apc neoF (middle), and Apc D716 (bottom). Representative results are shown of normal intestinal tissues (N1 and N2) and polyp samples (T1 and T2) of mutant mice, compared with wild-type littermate tissues (C1 and C2). E and F, Western blot analyses of APC and h-catenin in the wild-type (+/+) and homozygous Apc neoR (R/R), Apc neoF (F/F), and Apc D716 (D/D) ES cells. Quantified band intensities are also shown. G to J, immunostaining for h-catenin in wild-type (G) and homozygous Apc neoR (H), Apc neoF (I ), and Apc D716 (J ) ES cells. Bars, 10 Am. K, percentage of ES cells with nuclear h-catenin localization. Columns, mean; bars, SD. L, luciferase reporter assays for h-catenin/TCF transcription in the homozygous Apc neoR (R/R), Apc neoF (F/F ), and Apc D716 (D/D) ES cells as well as in the wild-type (+/+). Three independent clones were used. Luciferase activity of the TOPFLASH or FOPFLASH reporter calibrated to the activity of LacZ (lower axis) is shown for each ES line in triplicate transfections. The upper axis indicates the TOPFLASH/FOPFLASH ratios for the respective ES cell lines. M, correlation of the APC protein level and polyp numbers. The threshold of APC level required for formation of one polyp per mouse is estimated to be f15%.

Cancer Res 2005; 65: (19). October 1, 2005 8626 www.aacrjournals.org

Downloaded from cancerres.aacrjournals.org on September 27, 2021. © 2005 American Association for Cancer Research. Tumorigenesis in Hypomorphic Apc Mice epithelium of ApcD716 small intestine showed similar anaphase In conclusion, we have determined the APC expression levels in bridge index to the wild type (data not shown). Accordingly, it relation to the intestinal polyp multiplicity and found that the is possible that frequencies of Apc LOH in the intestinal polyp number is inversely correlated with the Wnt/h-catenin epithelium of the ApcneoF and ApcneoR mice are also similar to transcriptional activity. We have estimated that one polyp is that in the wild type. Therefore, it is conceivable that the formed per mouse when APC protein level decreases to f15% of difference in the polyp multiplicity among the ApcD716, ApcneoF, that in the wild type. These results also suggest therapeutic and ApcneoR mice are caused by some events controlled by Wnt implications concerning Wnt signaling inhibitors. signaling after the polyp initiation. Despite the difference in the h nuclear -catenin staining and Wnt transcriptional activation Acknowledgments between ApcD716 and ApcneoF or ApcneoR polyps, the Ki-67 labeling index was similar among them (Fig. 2). Likewise, Received 6/20/2005; revised 7/13/2005; accepted 8/5/2005. Grant support: Ministry of Education, Culture, Sports, Science and Technology expression of COX-2 and the level of phospho-Akt were also of Japan. similar (Fig. 2). Thus, it remains to be investigated what The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance particular molecules are responsible for the difference in the with 18 U.S.C. Section 1734 solely to indicate this fact. polyp multiplicity. We thank A. Matsunaga, H. Takeda, K. Aoki, and H. Oshima for help and discussion.

References chain-termination mutation in the mouse Apc gene 16. Suzuki H, Watkins DN, Jair KW, et al. Epigenetic results in multiple intestinal tumors. Proc Natl Acad inactivation of SFRP genes allows constitutive WNT 1. Sieber OM, Tomlinson IP, Lamlum H. The adeno- Sci U S A 1994;91:8969–73. signaling in colorectal cancer. Nat Genet 2004;36:417–22. matous polyposis coli (APC) tumor suppressor— 9. Ishikawa TO, Tamai Y, Li Q, Oshima M, Taketo MM. 17. Spirio L, Samowitz W, Robertson J, et al. Alleles of genetics, function and disease. Mol Med Today 2000; Requirement for tumor suppressor Apc in the morpho- APC modulate the frequency and classes of mutations 6:462–9. genesis of anterior and ventral mouse embryo. Dev Biol that lead to colon polyps. Nat Genet 1998;20:385–8. 2. Giles RH, Van Es JH, Clevers H. Caught up in a Wnt 2003;253:230–46. 18. Spirio L, Olschwang S, Groden J, et al. Alleles of the storm: Wnt signaling in cancer. Biochim Biophys Acta 10. Kielman MF, Rindapaa M, Gaspar C, et al. Apc APC gene: an attenuated form of familial polyposis. Cell 2003;1653:1–24. modulates embryonic stem-cell differentiation by con- 1993;75:951–7. 3. Powell SM, Zilz N, Beazer-Barclay Y, et al. APC trolling the dosage of h-catenin signaling. Nat Genet 19. Heppner Goss KH, Trzepacz C, et al. Attenuated mutations occur early during colorectal tumorigenesis. 2002;32:594–605. APC alleles produce functional protein from internal Nature 1992;359:235–7. 11. He XC, Zhang J, Tong WG, et al. BMP signaling translation initiation. Proc Natl Acad Sci U S A 2002; 4. Yan H, Dobbie Z, Gruber SB, et al. Small changes in inhibits intestinal stem cell self-renewal through sup- 11:8161–6. expression affect predisposition to tumorigenesis. Nat pression of Wnt-h-catenin signaling. Nat Genet 2004;36: 20. Fodde R, Kujpers J, Roseberg C, et al. Mutations in Genet 2002;30:25–6. 1117–21. the APC tumour suppressor gene cause chromosomal 5. Laken SJ, Papadopoulos N, Petersen GM, et al. Analysis 12. Takeda H, Sonoshita M, Oshima H, et al. Cooperation instability. Nat Cell Biol 2001;3:433–8. of masked mutations in familial adenomatous polyposis. of cyclooxygenase 1 and cyclooxygenase 2 in intestinal 21. Kaplan KB, Burds AA, Swedlow JR, et al. A role for Proc Natl Acad Sci U S A 1999;96:2322–6. polyposis. Cancer Res 2003;63:4872–7. the adenomatous polyposis coli protein in chromosome 6. Oshima M, Oshima H, Kitagawa K, Kobayashi M, 13. Oshima M, Dinchuk JE, Kargman SL, et al. Suppres- segregation. Nat Cell Biol 2001;3:429–32. Itakura I, Taketo M. Loss of Apc heterozygosity and sion of intestinal polyposis in ApcD716 knockout mice by 22. Oshima M, Oshima H, Kobayashi M, et al. Evidence abnormal tissue building in nascent intestinal polyps in inhibition of cyclooxygenase 2 (COX-2). Cell 1996;87: against dominant negative mechanisms of intestinal mice carrying a truncated Apc gene. Proc Natl Acad Sci 803–9. polyp formation by Apc gene mutations. Cancer Res U S A 1995;92:4482–6. 14. Haigis KM, Dove WF. A Robertsonian translocation 1995;55:2719–22. 7. Moser AR, Pitot HC, Dove WF. A dominant mutation suppresses a somatic recombinant pathway to loss of 23. Aoki K, Tamai Y, Horiike S, et al. Colonic poly- that predisposes to multiple intestinal neoplasia in the heterozygosity. Nat Genet 2003;33:33–9. posis caused by mTOR-mediated chromosomal insta- mouse. Science 1990;247:322–4. 15. Taketo MM. Shutting down Wnt signal-activated bility in Apc+/D716Cdx2+/À compound mutant mice. 8. Fodde R, Edelmann W, Yang K, et al. A targeted cancer. Nat Genet 2004;36:320–2. Nat Genet 2003;35:323–30.

www.aacrjournals.org 8627 Cancer Res 2005; 65: (19). October 1, 2005

Downloaded from cancerres.aacrjournals.org on September 27, 2021. © 2005 American Association for Cancer Research. The Threshold Level of Adenomatous Polyposis Coli Protein for Mouse Intestinal Tumorigenesis

Qin Li, Tomo-o Ishikawa, Masanobu Oshima, et al.

Cancer Res 2005;65:8622-8627.

Updated version Access the most recent version of this article at: http://cancerres.aacrjournals.org/content/65/19/8622

Cited articles This article cites 22 articles, 6 of which you can access for free at: http://cancerres.aacrjournals.org/content/65/19/8622.full#ref-list-1

Citing articles This article has been cited by 9 HighWire-hosted articles. Access the articles at: http://cancerres.aacrjournals.org/content/65/19/8622.full#related-urls

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/65/19/8622. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.