DOCSLIB.ORG

Β-Catenin Plays a Key Role in Metastasis of Human Hepatocellular Carcinoma

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Β-Catenin Plays a Key Role in Metastasis of Human Hepatocellular Carcinoma ONCOLOGY REPORTS 26: 415-422, 2011 β-catenin plays a key role in metastasis of human hepatocellular carcinoma TUNG-YUAN LAI1,5, CHENG-CHUAN SU6-8, WEI-WEN KUO2, YU-LAN YEH9, WU-HSIEN KUO10, FUU-JEN TSAI3, CHANG-HAI TSAI12, YI-JIUN WENG4*, CHIH-YaNG HUANG3,4,13* and LI-MIEN CHEN11* 1School of Post-Baccalaureate Chinese Medicine, College of Chinese Medicine, 2Department of Biological Science and Technology, 3Graduate Institute of Chinese Medical Science, 4Graduate Institute of Basic Medical Science, China Medical University; 5Department of Chinese Medicine, China Medical University Hospital, Taichung; Departments of 6Clinical Pathology and 7Anatomic Pathology, Buddhist Dalin Tzu Chi General Hospital, Chiayi; 8Department of Pathology, School of Medicine, Tzu Chi University, Hualien; 9Department of Pathology, Changhua Christian Hospital, Changhua; 10Division of Gastroenterology, Department of Internal Medicine, 11Department of Internal Medicine, Armed Forces Taichung General Hospital; Departments of 12Healthcare Administration, 13Health and Nutrition Biotechnology, Asia University, Taichung, Taiwan, R.O.C. Received October 9, 2010; Accepted February 4, 2011 DOI: 10.3892/or.2011.1323 Abstract. Currently, there are no diagnostic or metastatic oligonucleotides resulted in inhibition of cell migration and markers that can be used in early diagnosis and treatment invasion of HA22T cells. Taken together, these results suggest of human hepatocellular carcinoma (HCC). The aim of this that β-catenin may be a suitable diagnostic marker of metas- study was to find a molecular marker that regulated migration tasis in human HCC. and metastasis in HCC. We analyzed the gene expression of β-catenin, c-Myc and IL-8 in human HCC tissue by RT-PCR Introduction and immunohistochemistry and analyzed five variously differentiated HCC cell lines by Western blotting and migra- Hepatocellular carcinoma (HCC) is one of the most frequent tion and invasion assays to find markers for HCC diagnosis malignancies found in South China, Sub-Saharan Africa and and HCC metastasis. mRNA expression of β-catenin was Southeastern Asia, including Taiwan. HCCs are genetically significantly higher in the tumor area compared to the non- heterogeneous neoplasms and this genetic heterogeneity corre- tumor area and was more abundant in specimens of late-stage lates with a variety of etiological factors (1). The molecular HCC. Immunohistochemistry revealed that the translocation mechanisms, however, remain largely unknown. Recent of β-catenin into the nucleus was closely correlated with IL-8 studies have revealed that neoplastic transformation of liver protein levels and tumor stage. Similarly, the level of expres- cells is due in large part to the aberrant expression of a number sion and nuclear translocation of β-catenin was greater in of genes, including activation of cellular oncogenes, inactiva- HA22T cells with high proliferative activity than in HCC cell tion of tumor suppressor genes and overexpression of growth lines with low proliferative activity (PLC, Hep3B, HepG2). factors (2). Once metastasis occurs it causes 90% of human Knockdown of the β-catenin gene with β-catenin antisense cancer deaths (3). Therefore, finding the switch to metastasis stage is urgent to control tumor development. Several classes of proteins involved in the tethering of cells to their surroundings in a tissue are altered in cells possessing invasive or metastatic capabilities. The affected Correspondence to: Dr Li-Mien Chen, Department of Internal proteins include cell-cell adhesion molecules (CAMs), notably Medicine, Armed Forces Taichung General Hospital, Taichung, Taiwan, R.O.C. members of the immunoglobulin and calcium-dependent E-mail: [email protected] cadherin families, both of which mediate cell-to-cell interac- tions, and integrins, which link cells to extra-cellular matrix Dr Chih-Yang Huang, Graduate Institute of Basic Medical Science, substrates (4). The most widely observed alteration in cell- China Medical University, No. 91, Hsueh-Shih Road, Taichung 404, to-environment interactions in cancer involves E-cadherin, Taiwan, R.O.C. a homotypic cell-to-cell interaction molecule ubiquitously E-mail: [email protected] expressed on epithelial cells. β-catenin, binds the cytoplasmic *Contributed equally domain of cadherin along with the actin binding protein, to bridge the extracellular adhesive activity of cadherins with the Key words: β-catenin, migration, hepatocellular carcinoma, HA22T, underlying actin cytoskeleton (5). Tyrosine phosphorylation of invasion β-catenin leads to its dissociation from the adherens complex and probable transfer of the protein to the cytosol where it 416 LAI et al: β-CATENIN IN METASTASIS OF HUmaN HEPATOCELLULAR CARCINOma exists in a soluble, monomeric state. Cytosolic β-catenin may cool to room temperature for 30 min. The slides were then subsequently be degraded or be translocated into the nucleus rinsed with PBS buffer for 10 min. Non-specific binding was and regulate the downstream gene expression. The coupling blocked with 5% FBS for 10 min. A 1:50 dilution of polyclonal between adjacent cells by E-cadherin bridges results in the β-catenin or IL-8 antibody (Santa Cruz Biotechnology, CA, transmission of antigrowth and other signals via cytoplasmic USA) was then added to each slide and allowed to incubate contacts with β-catenin to intra-cellular signaling circuits. at 37˚C for 1 h. The slides were then washed with PBS for The function of E-cadherin is apparently lost in a majority 10 min followed by the application of a secondary antibody of epithelial cancers by mechanisms that include mutational (dilution of 1:100; Santa Cruz Biotechnology) for 30 min. The inactivation of the E-cadherin or β-catenin genes, transcrip- slides were then washed again using PBS buffer for 10 min. tional repression or proteolysis of the extra-cellular cadherin Immunoreactivity was visualized with DAB chromogen domain (6,7). (3,3'-diaminobenzidine) using a DAB substrate kit (Roche, In recent years, many studies have shown that the Wnt Mannheim, Germany). signaling pathway plays a crucial role in tumorigenesis (8,9). The central member of the Wnt pathway is β-catenin. Intra- Cell culture and transfection. Chang liver cells were grown cellular protein complexes, including Dishevelled (Dvl/Dsh), in Basal Medium Eagle (BME) (Sigma, St. Louis, MO, USA). glycogen synthase kinase-3β (GSK-3β), Axin and adenomatous Hep3B, HepG2 and PLC were grown in Minimum Essential polyposis coli (APC) protein regulate cytosolic β-catenin Medium (MEM) (Sigma). HA22T was grown in Dulbecco's protein levels. Overexpression of β-catenin, due to either a modified Eagle's medium (DMEM) (Sigma). All media were non-functioning APC protein or to mutations that eliminate supplemented with 10% fetal bovine serum (FBS) (HyClone, the phosphorylation sites within β-catenin, is associated with Logan, UT, USA), 1% penicillin, 0.1 mM non-essential several human cancers, including colon carcinomas, mela- amino acids, 1.5 g/l sodium bicarbonate and 1 mM sodium nomas, pilomatricomas and HCC (10-15). pyruvate at 37˚C in 5% CO2. Cells were seeded onto 100-mm β-catenin mutations were found to range from 9 to 75% in dishes in DMEM containing 10% FBS. On the next day, mouse liver tumors induced using chemical carcinogens (16). the medium was replaced with serum-free medium with no The expression level and mutation frequency of β-catenin have penicillin. Antisense oligonucleotides were introduced into been reported to be different in HCC from different countries the cells in the indicated amounts (10 and 100 µM) using or regions. Especially, the rates of overexpression of β-catenin Lipofectamine™ 2000 (Invitrogen, Carlsbad, CA, USA) in the nuclei range from 2.4 to 24.8% in HCC (17,18). The according to the manufacturer's guidelines. Six hours later, reduction or loss of β-catenin might disrupt the stability and the cells were fed with fresh DMEM medium containing 10% integrity of the E-cadherin-catenin complex and disturbs FBS. The β-catenin antisense oligonucleotide sequence was the cellular adhesive junction, resulting in cell proliferation, TAAGAGCTTAACCACAACTG and the β-catenin sense tumor invasion and metastasis (19). The clinical implication oligonucleotide sequence was CAGTAACTGAATAGCTACCA of aberrant β-catenin expression in HCC, however, remains (MDBio, Taipei, Taiwan). unclear (20). The purpose of this study was to investigate the role that β-catenin plays in HCC. We measured the expression Isolation and purification of total RNA.T otal RNA was extracted levels of β-catenin in different histological grades of human from HCC tissues using the Ultraspec RNA Isolation System HCC tissues and five different differentiated HCC cell lines (Biotecx Laboratories, Houston, TX, USA) according to the (HA22T, PLC, Hep3B, HepG2 and normal chang liver cells) manufacturer's instructions. Following homogenization, the and investigated the correlation between β-catenin and homogenate was stored for 5 min at 4˚C to permit the complete metastasis in HCC. dissociation of nucleoprotein complexes. Then, 0.2 ml of chloroform per 1 ml of Ultraspec™ RNA was added. The Materials and methods samples were tightly covered, shaken vigorously for 15 sec, and then placed on ice at 4˚C for 5 min. The homogenate was Specimens. We collected different histological grades of then centrifuged at 12,000 g at 4˚C for 15 min. The resulting human HCC tissues obtained from 30 patients (23 men and homogenate consisted of three phases: a lower organic phase 7 women) at the Changhua Christian Hospital, Changhua, and an inter-phase, each containing DNA and protein, and an Taiwan during the period 1998-2001. The specimens included upper aqueous phase containing RNA. About 500 µl of the grade I HCC (n=6), grade II HCC (n=17) and grade III HCC aqueous phase was carefully transferred to a fresh tube while (n=7). The patient ages ranged from 31 to 79 years. Disease taking care not to disturb the inter-phase. Isopropanol (500 µl) history, tumor grade, tumor size and level of differentiation in was then added and mixed.
Load more

Recommended publications
  • Loss of At-Catenin Alters the Hybrid Adhering Junctions in the Heart and Leads to Dilated Cardiomyopathy and Ventricular Arrhythmia Following Acute Ischemia
    1058 Research Article Loss of aT-catenin alters the hybrid adhering junctions in the heart and leads to dilated cardiomyopathy and ventricular arrhythmia following acute ischemia Jifen Li1,*, Steven Goossens2,3,`, Jolanda van Hengel2,3,`, Erhe Gao1, Lan Cheng1, Koen Tyberghein2,3, Xiying Shang1, Riet De Rycke2, Frans van Roy2,3,* and Glenn L. Radice1 1Center for Translational Medicine, Department of Medicine, Thomas Jefferson University, Philadelphia, PA, USA 2Department for Molecular Biomedical Research, Flanders Institute for Biotechnology (VIB), B-9052 Ghent, Belgium 3Department of Biomedical Molecular Biology, Ghent University, B-9052 Ghent, Belgium *Authors for correspondence ([email protected]; [email protected]) `These authors contributed equally to this work Accepted 4 October 2011 Journal of Cell Science 125, 1058–1067 ß 2012. Published by The Company of Biologists Ltd doi: 10.1242/jcs.098640 Summary It is generally accepted that the intercalated disc (ICD) required for mechano-electrical coupling in the heart consists of three distinct junctional complexes: adherens junctions, desmosomes and gap junctions. However, recent morphological and molecular data indicate a mixing of adherens junctional and desmosomal components, resulting in a ‘hybrid adhering junction’ or ‘area composita’. The a-catenin family member aT-catenin, part of the N-cadherin–catenin adhesion complex in the heart, is the only a-catenin that interacts with the desmosomal protein plakophilin-2 (PKP2). Thus, it has been postulated that aT-catenin might serve as a molecular integrator of the two adhesion complexes in the area composita. To investigate the role of aT-catenin in the heart, gene targeting technology was used to delete the Ctnna3 gene, encoding aT-catenin, in the mouse.
    [Show full text]
  • 82135357.Pdf
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector Developmental Biology 319 (2008) 298–308 Contents lists available at ScienceDirect Developmental Biology journal homepage: www.elsevier.com/developmentalbiology Identification of a novel intermediate filament-linked N-cadherin/γ-catenin complex involved in the establishment of the cytoarchitecture of differentiated lens fiber cells Michelle Leonard, Yim Chan, A. Sue Menko ⁎ Department of Pathology, Anatomy and Cell Biology, Thomas Jefferson University, 571 Jefferson Alumni Hall, 1020 Locust Street, Philadelphia, PA 19107, USA article info abstract Article history: Tissue morphogenesis and maintenance of complex tissue architecture requires a variety of cell–cell junctions. Received for publication 17 December 2007 Typically, cells adhere to one another through cadherin junctions, both adherens and desmosomal junctions, Revised 14 April 2008 strengthened by association with cytoskeletal networks during development. Both β-andγ-catenins are Accepted 18 April 2008 reported to link classical cadherins to the actin cytoskeleton, but only γ-catenin binds to the desmosomal Available online 8 May 2008 cadherins, which links them to intermediate filaments through its association with desmoplakin. Here we fi γ Keywords: provide the rst biochemical evidence that, in vivo, -catenin also mediates interactions between classical fi γ-catenin cadherins and the intermediate lament cytoskeleton, linked through desmoplakin. In the developing lens, Cadherin which has no desmosomes, we discovered that vimentin became linked to N-cadherin complexes in a Intermediate filament differentiation-state specific manner. This newly identified junctional complex was tissue specific but not Vimentin unique to the lens. To determine whether in this junction N-cadherin was linked to vimentin through γ- Lens development catenin or β-catenin we developed an innovative “double” immunoprecipitation technique.
    [Show full text]
  • Overexpression of Vimentin Contributes to Prostate Cancer Invasion and Metastasis Via Src Regulation
    ANTICANCER RESEARCH 28: 327-334 (2008) Overexpression of Vimentin Contributes to Prostate Cancer Invasion and Metastasis via Src Regulation JUNCHENG WEI*, GANG XU*, MINGFU WU, YONGTAO ZHANG, QIONG LI, PING LIU, TAO ZHU, ANPING SONG, LIANGPIN ZHAO, ZHIQIANG HAN, GANG CHEN, SHIXUAN WANG, LI MENG, JIANFENG ZHOU, YUNPING LU, SHIXUAN WANG and DING MA Cancer Biology Research Center, Tongji Hospital, Tongji Medical College, Huazhong University of Science and Technology, Wuhan, Hubei 430030, P.R. China Abstract. A significant proportion of prostate cancer patients Prostate carcinoma is the second leading cause of cancer- treated with curative intent develop advanced disease. At a related death in the United States and Europe (1), mainly fundamental biological level, very little is known about what due to its high potential for bone metastasis. However, the makes the disease aggressive and metastatic. Observational molecular mechanisms of prostate cancer metastasis are not pathology reports and experimental data suggest that an well understood. Among the currently available techniques, epithelial-mesenchymal transition (EMT) is involved in prostate cancer proteomics permits the analysis of thousands of cancer invasiveness. The mechanism by which vimentin modified or unmodified proteins simultaneously and has promotes prostate cancer cell invasion and metastasis was become increasingly popular for identifying biomarkers for examined. The highly metastatic human prostate epithelial cell the early detection, classification and prognosis of tumors, line PC-3M-1E8 (1E8-H) and the low metastatic line PC-3M- as well as for pinpointing molecular targets for improving 2B4 (2B4-L) were used for comparative proteomic analysis by treatment outcomes (2). two-dimensional gel electrophoresis, followed by matrix-assisted It is known that tumor progression to malignancy requires laser desorption/time of flight mass spectrometry (MALDI- a change from an epithelial phenotype to a fibroblast or TOF-MS).
    [Show full text]
  • Daam2 Couples Translocation and Clustering of Wnt Receptor Signalosomes Through Rac1 Carlo D
    © 2021. Published by The Company of Biologists Ltd | Journal of Cell Science (2021) 134, jcs251140. doi:10.1242/jcs.251140 RESEARCH ARTICLE Daam2 couples translocation and clustering of Wnt receptor signalosomes through Rac1 Carlo D. Cristobal1,QiYe2, Juyeon Jo2, Xiaoyun Ding3, Chih-Yen Wang2, Diego Cortes2, Zheng Chen4 and Hyun Kyoung Lee1,3,5,* ABSTRACT Dynamic polymerization of the Dishevelled proteins functions at Wnt signaling plays a critical role in development across species and the core of the Wnt signalosome by interacting with both the is dysregulated in a host of human diseases. A key step in signal Frizzled Wnt receptors and low-density lipoprotein receptor-related transduction is the formation of Wnt receptor signalosomes, during protein 5/6 (LRP5/6), leading to recruitment of Axin proteins β which a large number of components translocate to the membrane, from the -catenin destruction complex (MacDonald et al., 2009; cluster together and amplify downstream signaling. However, the Schwarz-Romond et al., 2007). However, the exact composition molecular processes that coordinate these events remain poorly and mechanisms of signalosome assembly at the plasma membrane defined. Here, we show that Daam2 regulates canonical Wnt remain unclear. signaling via the PIP –PIP5K axis through its association with Rac1. The hallmark of canonical Wnt signaling is the accumulation and 2 β Clustering of Daam2-mediated Wnt receptor complexes requires both translocation of -catenin into the nucleus for gene transcription, β Rac1 and PIP5K, and PIP5K promotes membrane localization of these whereas non-canonical Wnt signaling is -catenin independent and complexes in a Rac1-dependent manner. Importantly, the localization involves assembly/disassembly of the actin cytoskeleton, polarized of Daam2 complexes and Daam2-mediated canonical Wnt signaling is cell shape changes and cell migration (Niehrs, 2012; Schlessinger dependent upon actin polymerization.
    [Show full text]
  • Plakoglobin Is Required for Effective Intermediate Filament Anchorage to Desmosomes Devrim Acehan1, Christopher Petzold1, Iwona Gumper2, David D
    ORIGINAL ARTICLE Plakoglobin Is Required for Effective Intermediate Filament Anchorage to Desmosomes Devrim Acehan1, Christopher Petzold1, Iwona Gumper2, David D. Sabatini2, Eliane J. Mu¨ller3, Pamela Cowin2,4 and David L. Stokes1,2,5 Desmosomes are adhesive junctions that provide mechanical coupling between cells. Plakoglobin (PG) is a major component of the intracellular plaque that serves to connect transmembrane elements to the cytoskeleton. We have used electron tomography and immunolabeling to investigate the consequences of PG knockout on the molecular architecture of the intracellular plaque in cultured keratinocytes. Although knockout keratinocytes form substantial numbers of desmosome-like junctions and have a relatively normal intercellular distribution of desmosomal cadherins, their cytoplasmic plaques are sparse and anchoring of intermediate filaments is defective. In the knockout, b-catenin appears to substitute for PG in the clustering of cadherins, but is unable to recruit normal levels of plakophilin-1 and desmoplakin to the plaque. By comparing tomograms of wild type and knockout desmosomes, we have assigned particular densities to desmoplakin and described their interaction with intermediate filaments. Desmoplakin molecules are more extended in wild type than knockout desmosomes, as if intermediate filament connections produced tension within the plaque. On the basis of our observations, we propose a particular assembly sequence, beginning with cadherin clustering within the plasma membrane, followed by recruitment of plakophilin and desmoplakin to the plaque, and ending with anchoring of intermediate filaments, which represents the key to adhesive strength. Journal of Investigative Dermatology (2008) 128, 2665–2675; doi:10.1038/jid.2008.141; published online 22 May 2008 INTRODUCTION dense plaque that is further from the membrane and that Desmosomes are large macromolecular complexes that mediates the binding of intermediate filaments.
    [Show full text]
  • Diagnostic Use of Nuclear B-Catenin Expression for the Assessment of Endometrial Stromal Tumors
    Modern Pathology (2008) 21, 756–763 & 2008 USCAP, Inc All rights reserved 0893-3952/08 $30.00 www.modernpathology.org Diagnostic use of nuclear b-catenin expression for the assessment of endometrial stromal tumors Chan-Kwon Jung1, Ji-Han Jung1, Ahwon Lee1, Youn-Soo Lee1, Yeong-Jin Choi1, Seung-Kew Yoon2 and Kyo-Young Lee1 1Department of Hospital Pathology, College of Medicine, The Catholic University of Korea, Seoul, Republic of Korea and 2Department of Internal Medicine, College of Medicine, The Catholic University of Korea, Seoul, Republic of Korea Alterations in b-catenin degradation cause it to accumulate to immunohistochemically detectable levels in the nuclei of tumor cells. Although it has been shown that nuclear b-catenin immunostaining is useful for the diagnosis of some mesenchymal tumors, there is little known about b-catenin expression in endometrial stromal tumors. In this study, nuclear b-catenin immunoreactivity was evaluated in normal endometrium and endometrial mesenchymal tumors and then compared with that of CD10. The endometrial mesenchymal tumors evaluated included endometrial stromal nodules (n ¼ 2), low-grade endometrial stromal sarcomas (n ¼ 12), undifferentiated endometrial sarcomas (n ¼ 8) and uterine cellular leiomyomata (n ¼ 9). In addition, direct DNA sequencing of b-catenin exon 3 was conducted in 15 endometrial stromal tumors. Normal endometrial stromal cells showed strong cytoplasmic reactivity for CD10 but no detectable reactivity for b-catenin. Nuclear b-catenin immunoreactivity was detected in 11 low-grade endometrial stromal sarcomas (92%) and 6 undifferentiated endometrial sarcomas (75%). Ten low-grade endometrial stromal sarcomas (83%) and six undifferentiated endometrial sarcomas (75%) were positive for CD10.
    [Show full text]
  • Β-Catenin Concentrated and Prediluted Monoclonal Antibody 901-406-040819
    β-Catenin Concentrated and Prediluted Monoclonal Antibody 901-406-040819 Catalog Number: CM 406 A, C PM 406 AA VLTM 406 G20 Description: 0.1, 1.0 mL, conc. 6.0 mL, RTU 20 mL, RTU Dilution: 1:200 Ready-to-use Ready-to-use Diluent: Da Vinci Green N/A N/A Intended Use: Storage and Stability: For In Vitro Diagnostic Use Store at 2ºC to 8ºC. The product is stable to the expiration date printed β-Catenin [14] is a mouse monoclonal antibody that is intended for on the label, when stored under these conditions. Do not use after laboratory use in the qualitative identification of β-Catenin protein by expiration date. Diluted reagents should be used promptly; any immunohistochemistry (IHC) in formalin-fixed paraffin-embedded remaining reagent should be stored at 2ºC to 8ºC. (FFPE) human tissues. The clinical interpretation of any staining or its absence should be complemented by morphological studies using proper Protocol Recommendations (VALENT® Automated Slide controls and should be evaluated within the context of the patient’s Staining Platform): clinical history and other diagnostic tests by a qualified pathologist. VLTM406 is intended for use with the VALENT. Refer to the User Manual Summary and Explanation: for specific instructions for use. Protocol parameters in the Protocol Beta-catenin is involved in cell adhesion through catenin-cadherin Manager should be programmed as follows: complexes and as a transcriptional regulator in the Wnt signaling Deparaffinization: Deparaffinize for 8 minutes with Val DePar. pathway. Its deregulation is important in the genesis of a number of Pretreatment: Perform heat retrieval at 98°C for 60 minutes using Val human malignancies, particularly colorectal cancer.
    [Show full text]
  • The Ubiquitin-Proteasome Pathway Mediates Gelsolin Protein Downregulation in Pancreatic Cancer
    The Ubiquitin-Proteasome Pathway Mediates Gelsolin Protein Downregulation in Pancreatic Cancer Xiao-Guang Ni,1 Lu Zhou,2 Gui-Qi Wang,1 Shang-Mei Liu,3 Xiao-Feng Bai,4 Fang Liu,5 Maikel P Peppelenbosch,2 and Ping Zhao4 1Department of Endoscopy, Cancer Institute and Hospital, Chinese Academy of Medical Sciences and Peking Union Medical College, Beijing, China; 2Department of Cell Biology, University Medical Center Groningen, University of Groningen, Groningen, The Netherlands; 3Department of Pathology, 4Department of Abdominal Surgery, and 5State Key Laboratory of Molecular Oncology, Cancer Institute and Hospital, Chinese Academy of Medical Sciences and Peking Union Medical College, Beijing, China A well-known observation with respect to cancer biology is that transformed cells display a disturbed cytoskeleton. The under- lying mechanisms, however, remain only partly understood. In an effort to identify possible mechanisms, we compared the pro- teome of pancreatic cancer with matched normal pancreas and observed diminished protein levels of gelsolin—an actin fila- ment severing and capping protein of crucial importance for maintaining cytoskeletal integrity—in pancreatic cancer. Additionally, pancreatic ductal adenocarcinomas displayed substantially decreased levels of gelsolin as judged by Western blot and immunohistochemical analyses of tissue micoarrays, when compared with cancerous and untransformed tissue from the same patients (P < 0.05). Importantly, no marked downregulation of gelsolin mRNA was observed (P > 0.05), suggesting that post- transcriptional mechanisms mediate low gelsolin protein levels. In apparent agreement, high activity ubiquitin-proteasome path- way in both patient samples and the BxPC-3 pancreatic cancer cell line was detected, and inhibition of the 26s proteasome sys- tem quickly restored gelsolin protein levels in the latter cell line.
    [Show full text]
  • Beta;-Catenin Signaling in Rhabdomyosarcoma
    Laboratory Investigation (2013) 93, 1090–1099 & 2013 USCAP, Inc All rights reserved 0023-6837/13 Characterization of Wnt/b-catenin signaling in rhabdomyosarcoma Srinivas R Annavarapu1,8,9, Samantha Cialfi2,9, Carlo Dominici2,3, George K Kokai4, Stefania Uccini5, Simona Ceccarelli6, Heather P McDowell2,3,7 and Timothy R Helliwell1 Rhabdomyosarcoma (RMS) is the most common soft tissue sarcoma in children and accounts for about 5% of all malignant paediatric tumours. b-Catenin, a multifunctional nuclear transcription factor in the canonical Wnt signaling pathway, is active in myogenesis and embryonal somite patterning. Dysregulation of Wnt signaling facilitates tumour invasion and metastasis. This study characterizes Wnt/b-catenin signaling and functional activity in paediatric embryonal and alveolar RMS. Immunohistochemical assessment of paraffin-embedded tissues from 44 RMS showed b-catenin expression in 26 cases with cytoplasmic/membranous expression in 9/14 cases of alveolar RMS, and 15/30 cases of embryonal RMS, whereas nuclear expression was only seen in 2 cases of embryonal RMS. The potential functional significance of b-catenin expression was tested in four RMS cell lines, two derived from embryonal (RD and RD18) RMS and two from alveolar (Rh4 and Rh30) RMS. Western blot analysis demonstrated the expression of Wnt-associated proteins including b-catenin, glycogen synthase kinase-3b, disheveled, axin-1, naked, LRP-6 and cadherins in all cell lines. Cell fractionation and immunofluorescence studies of the cell lines (after stimulation by human recombinant Wnt3a) showed reduced phosphorylation of b-catenin, stabilization of the active cytosolic form and nuclear translocation of b-catenin. Reporter gene assay demonstrated a T-cell factor/lymphoid-enhancing factor-mediated transactivation in these cells.
    [Show full text]
  • New Partners Identified by Mass Spectrometry Assay Reveal Functions of NCAM2 in Neural Cytoskeleton Organization
    International Journal of Molecular Sciences Article New Partners Identified by Mass Spectrometry Assay Reveal Functions of NCAM2 in Neural Cytoskeleton Organization Antoni Parcerisas 1,2,3,*,† , Alba Ortega-Gascó 1,2,† , Marc Hernaiz-Llorens 1,2 , Maria Antonia Odena 4, Fausto Ulloa 1,2, Eliandre de Oliveira 4, Miquel Bosch 3 , Lluís Pujadas 1,2 and Eduardo Soriano 1,2,* 1 Department of Cell Biology, Physiology and Immunology, University of Barcelona and Institute of Neurosciences, 08028 Barcelona, Spain; [email protected] (A.O.-G.); [email protected] (M.H.-L.); [email protected] (F.U.); [email protected] (L.P.) 2 Centro de Investigación Biomédica en Red sobre Enfermedades Neurodegenerativas (CIBERNED), 28031 Madrid, Spain 3 Department of Basic Sciences, Universitat Internacional de Catalunya, 08195 Sant Cugat del Vallès, Spain; [email protected] 4 Plataforma de Proteòmica, Parc Científic de Barcelona (PCB), 08028 Barcelona, Spain; [email protected] (M.A.O.); [email protected] (E.d.O.) * Correspondence: [email protected] (A.P.); [email protected] (E.S.) † A.P. and A.O.-G. contributed equally. Abstract: Neuronal cell adhesion molecule 2 (NCAM2) is a membrane protein with an important role in the morphological development of neurons. In the cortex and the hippocampus, NCAM2 is essential for proper neuronal differentiation, dendritic and axonal outgrowth and synapse forma- tion. However, little is known about NCAM2 functional mechanisms and its interactive partners Citation: Parcerisas, A.; during brain development. Here we used mass spectrometry to study the molecular interactome Ortega-Gascó, A.; Hernaiz-Llorens, of NCAM2 in the second postnatal week of the mouse cerebral cortex.
    [Show full text]
  • Cytoskeletal Remodeling in Cancer
    biology Review Cytoskeletal Remodeling in Cancer Jaya Aseervatham Department of Ophthalmology, University of Texas Health Science Center at Houston, Houston, TX 77054, USA; [email protected]; Tel.: +146-9767-0166 Received: 15 October 2020; Accepted: 4 November 2020; Published: 7 November 2020 Simple Summary: Cell migration is an essential process from embryogenesis to cell death. This is tightly regulated by numerous proteins that help in proper functioning of the cell. In diseases like cancer, this process is deregulated and helps in the dissemination of tumor cells from the primary site to secondary sites initiating the process of metastasis. For metastasis to be efficient, cytoskeletal components like actin, myosin, and intermediate filaments and their associated proteins should co-ordinate in an orderly fashion leading to the formation of many cellular protrusions-like lamellipodia and filopodia and invadopodia. Knowledge of this process is the key to control metastasis of cancer cells that leads to death in 90% of the patients. The focus of this review is giving an overall understanding of these process, concentrating on the changes in protein association and regulation and how the tumor cells use it to their advantage. Since the expression of cytoskeletal proteins can be directly related to the degree of malignancy, knowledge about these proteins will provide powerful tools to improve both cancer prognosis and treatment. Abstract: Successful metastasis depends on cell invasion, migration, host immune escape, extravasation, and angiogenesis. The process of cell invasion and migration relies on the dynamic changes taking place in the cytoskeletal components; actin, tubulin and intermediate filaments. This is possible due to the plasticity of the cytoskeleton and coordinated action of all the three, is crucial for the process of metastasis from the primary site.
    [Show full text]
  • Restoring Wnt/Β-Catenin Signaling Is a Promising Therapeutic Strategy for Alzheimer’S Disease Lin Jia1,2, Juan Piña-Crespo3 and Yonghe Li1*
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Xiamen University Institutional Repository Jia et al. Molecular Brain (2019) 12:104 https://doi.org/10.1186/s13041-019-0525-5 REVIEW Open Access Restoring Wnt/β-catenin signaling is a promising therapeutic strategy for Alzheimer’s disease Lin Jia1,2, Juan Piña-Crespo3 and Yonghe Li1* Abstract Alzheimer’s disease (AD) is an aging-related neurological disorder characterized by synaptic loss and dementia. Wnt/β-catenin signaling is an essential signal transduction pathway that regulates numerous cellular processes including cell survival. In brain, Wnt/β-catenin signaling is not only crucial for neuronal survival and neurogenesis, but it plays important roles in regulating synaptic plasticity and blood-brain barrier integrity and function. Moreover, activation of Wnt/β-catenin signaling inhibits amyloid-β production and tau protein hyperphosphorylation in the brain. Critically, Wnt/β-catenin signaling is greatly suppressed in AD brain via multiple pathogenic mechanisms. As such, restoring Wnt/β-catenin signaling represents a unique opportunity for the rational design of novel AD therapies. Keywords: Wnt, Alzheimer’s disease, Neuronal survival, Neurogenesis, Synaptic plasticity, Drug target Introduction differentiation, and Wnt proteins are key drivers of adult Alzheimer’s disease (AD) is the most common form of stem cells in mammals [6]. Studies have shown that dys- dementia accompanied by detrimental cognitive deficits regulated Wnt/β-catenin signaling plays an important and pathological accumulation of amyloid-β (Aβ) pla- role in the pathogenesis of AD [7]. In this review, we ques and tau-containing neurofibrillary tangles [1].
    [Show full text]