Β-Catenin Plays a Key Role in Metastasis of Human Hepatocellular Carcinoma

Β-Catenin Plays a Key Role in Metastasis of Human Hepatocellular Carcinoma

ONCOLOGY REPORTS 26: 415-422, 2011 β-catenin plays a key role in metastasis of human hepatocellular carcinoma TUNG-YUAN LAI1,5, CHENG-CHUAN SU6-8, WEI-WEN KUO2, YU-LAN YEH9, WU-HSIEN KUO10, FUU-JEN TSAI3, CHANG-HAI TSAI12, YI-JIUN WENG4*, CHIH-YaNG HUANG3,4,13* and LI-MIEN CHEN11* 1School of Post-Baccalaureate Chinese Medicine, College of Chinese Medicine, 2Department of Biological Science and Technology, 3Graduate Institute of Chinese Medical Science, 4Graduate Institute of Basic Medical Science, China Medical University; 5Department of Chinese Medicine, China Medical University Hospital, Taichung; Departments of 6Clinical Pathology and 7Anatomic Pathology, Buddhist Dalin Tzu Chi General Hospital, Chiayi; 8Department of Pathology, School of Medicine, Tzu Chi University, Hualien; 9Department of Pathology, Changhua Christian Hospital, Changhua; 10Division of Gastroenterology, Department of Internal Medicine, 11Department of Internal Medicine, Armed Forces Taichung General Hospital; Departments of 12Healthcare Administration, 13Health and Nutrition Biotechnology, Asia University, Taichung, Taiwan, R.O.C. Received October 9, 2010; Accepted February 4, 2011 DOI: 10.3892/or.2011.1323 Abstract. Currently, there are no diagnostic or metastatic oligonucleotides resulted in inhibition of cell migration and markers that can be used in early diagnosis and treatment invasion of HA22T cells. Taken together, these results suggest of human hepatocellular carcinoma (HCC). The aim of this that β-catenin may be a suitable diagnostic marker of metas- study was to find a molecular marker that regulated migration tasis in human HCC. and metastasis in HCC. We analyzed the gene expression of β-catenin, c-Myc and IL-8 in human HCC tissue by RT-PCR Introduction and immunohistochemistry and analyzed five variously differentiated HCC cell lines by Western blotting and migra- Hepatocellular carcinoma (HCC) is one of the most frequent tion and invasion assays to find markers for HCC diagnosis malignancies found in South China, Sub-Saharan Africa and and HCC metastasis. mRNA expression of β-catenin was Southeastern Asia, including Taiwan. HCCs are genetically significantly higher in the tumor area compared to the non- heterogeneous neoplasms and this genetic heterogeneity corre- tumor area and was more abundant in specimens of late-stage lates with a variety of etiological factors (1). The molecular HCC. Immunohistochemistry revealed that the translocation mechanisms, however, remain largely unknown. Recent of β-catenin into the nucleus was closely correlated with IL-8 studies have revealed that neoplastic transformation of liver protein levels and tumor stage. Similarly, the level of expres- cells is due in large part to the aberrant expression of a number sion and nuclear translocation of β-catenin was greater in of genes, including activation of cellular oncogenes, inactiva- HA22T cells with high proliferative activity than in HCC cell tion of tumor suppressor genes and overexpression of growth lines with low proliferative activity (PLC, Hep3B, HepG2). factors (2). Once metastasis occurs it causes 90% of human Knockdown of the β-catenin gene with β-catenin antisense cancer deaths (3). Therefore, finding the switch to metastasis stage is urgent to control tumor development. Several classes of proteins involved in the tethering of cells to their surroundings in a tissue are altered in cells possessing invasive or metastatic capabilities. The affected Correspondence to: Dr Li-Mien Chen, Department of Internal proteins include cell-cell adhesion molecules (CAMs), notably Medicine, Armed Forces Taichung General Hospital, Taichung, Taiwan, R.O.C. members of the immunoglobulin and calcium-dependent E-mail: [email protected] cadherin families, both of which mediate cell-to-cell interac- tions, and integrins, which link cells to extra-cellular matrix Dr Chih-Yang Huang, Graduate Institute of Basic Medical Science, substrates (4). The most widely observed alteration in cell- China Medical University, No. 91, Hsueh-Shih Road, Taichung 404, to-environment interactions in cancer involves E-cadherin, Taiwan, R.O.C. a homotypic cell-to-cell interaction molecule ubiquitously E-mail: [email protected] expressed on epithelial cells. β-catenin, binds the cytoplasmic *Contributed equally domain of cadherin along with the actin binding protein, to bridge the extracellular adhesive activity of cadherins with the Key words: β-catenin, migration, hepatocellular carcinoma, HA22T, underlying actin cytoskeleton (5). Tyrosine phosphorylation of invasion β-catenin leads to its dissociation from the adherens complex and probable transfer of the protein to the cytosol where it 416 LAI et al: β-CATENIN IN METASTASIS OF HUmaN HEPATOCELLULAR CARCINOma exists in a soluble, monomeric state. Cytosolic β-catenin may cool to room temperature for 30 min. The slides were then subsequently be degraded or be translocated into the nucleus rinsed with PBS buffer for 10 min. Non-specific binding was and regulate the downstream gene expression. The coupling blocked with 5% FBS for 10 min. A 1:50 dilution of polyclonal between adjacent cells by E-cadherin bridges results in the β-catenin or IL-8 antibody (Santa Cruz Biotechnology, CA, transmission of antigrowth and other signals via cytoplasmic USA) was then added to each slide and allowed to incubate contacts with β-catenin to intra-cellular signaling circuits. at 37˚C for 1 h. The slides were then washed with PBS for The function of E-cadherin is apparently lost in a majority 10 min followed by the application of a secondary antibody of epithelial cancers by mechanisms that include mutational (dilution of 1:100; Santa Cruz Biotechnology) for 30 min. The inactivation of the E-cadherin or β-catenin genes, transcrip- slides were then washed again using PBS buffer for 10 min. tional repression or proteolysis of the extra-cellular cadherin Immunoreactivity was visualized with DAB chromogen domain (6,7). (3,3'-diaminobenzidine) using a DAB substrate kit (Roche, In recent years, many studies have shown that the Wnt Mannheim, Germany). signaling pathway plays a crucial role in tumorigenesis (8,9). The central member of the Wnt pathway is β-catenin. Intra- Cell culture and transfection. Chang liver cells were grown cellular protein complexes, including Dishevelled (Dvl/Dsh), in Basal Medium Eagle (BME) (Sigma, St. Louis, MO, USA). glycogen synthase kinase-3β (GSK-3β), Axin and adenomatous Hep3B, HepG2 and PLC were grown in Minimum Essential polyposis coli (APC) protein regulate cytosolic β-catenin Medium (MEM) (Sigma). HA22T was grown in Dulbecco's protein levels. Overexpression of β-catenin, due to either a modified Eagle's medium (DMEM) (Sigma). All media were non-functioning APC protein or to mutations that eliminate supplemented with 10% fetal bovine serum (FBS) (HyClone, the phosphorylation sites within β-catenin, is associated with Logan, UT, USA), 1% penicillin, 0.1 mM non-essential several human cancers, including colon carcinomas, mela- amino acids, 1.5 g/l sodium bicarbonate and 1 mM sodium nomas, pilomatricomas and HCC (10-15). pyruvate at 37˚C in 5% CO2. Cells were seeded onto 100-mm β-catenin mutations were found to range from 9 to 75% in dishes in DMEM containing 10% FBS. On the next day, mouse liver tumors induced using chemical carcinogens (16). the medium was replaced with serum-free medium with no The expression level and mutation frequency of β-catenin have penicillin. Antisense oligonucleotides were introduced into been reported to be different in HCC from different countries the cells in the indicated amounts (10 and 100 µM) using or regions. Especially, the rates of overexpression of β-catenin Lipofectamine™ 2000 (Invitrogen, Carlsbad, CA, USA) in the nuclei range from 2.4 to 24.8% in HCC (17,18). The according to the manufacturer's guidelines. Six hours later, reduction or loss of β-catenin might disrupt the stability and the cells were fed with fresh DMEM medium containing 10% integrity of the E-cadherin-catenin complex and disturbs FBS. The β-catenin antisense oligonucleotide sequence was the cellular adhesive junction, resulting in cell proliferation, TAAGAGCTTAACCACAACTG and the β-catenin sense tumor invasion and metastasis (19). The clinical implication oligonucleotide sequence was CAGTAACTGAATAGCTACCA of aberrant β-catenin expression in HCC, however, remains (MDBio, Taipei, Taiwan). unclear (20). The purpose of this study was to investigate the role that β-catenin plays in HCC. We measured the expression Isolation and purification of total RNA.T otal RNA was extracted levels of β-catenin in different histological grades of human from HCC tissues using the Ultraspec RNA Isolation System HCC tissues and five different differentiated HCC cell lines (Biotecx Laboratories, Houston, TX, USA) according to the (HA22T, PLC, Hep3B, HepG2 and normal chang liver cells) manufacturer's instructions. Following homogenization, the and investigated the correlation between β-catenin and homogenate was stored for 5 min at 4˚C to permit the complete metastasis in HCC. dissociation of nucleoprotein complexes. Then, 0.2 ml of chloroform per 1 ml of Ultraspec™ RNA was added. The Materials and methods samples were tightly covered, shaken vigorously for 15 sec, and then placed on ice at 4˚C for 5 min. The homogenate was Specimens. We collected different histological grades of then centrifuged at 12,000 g at 4˚C for 15 min. The resulting human HCC tissues obtained from 30 patients (23 men and homogenate consisted of three phases: a lower organic phase 7 women) at the Changhua Christian Hospital, Changhua, and an inter-phase, each containing DNA and protein, and an Taiwan during the period 1998-2001. The specimens included upper aqueous phase containing RNA. About 500 µl of the grade I HCC (n=6), grade II HCC (n=17) and grade III HCC aqueous phase was carefully transferred to a fresh tube while (n=7). The patient ages ranged from 31 to 79 years. Disease taking care not to disturb the inter-phase. Isopropanol (500 µl) history, tumor grade, tumor size and level of differentiation in was then added and mixed.

View Full Text

Details

  • File Type
    pdf
  • Upload Time
    -
  • Content Languages
    English
  • Upload User
    Anonymous/Not logged-in
  • File Pages
    8 Page
  • File Size
    -

Download

Channel Download Status
Express Download Enable

Copyright

We respect the copyrights and intellectual property rights of all users. All uploaded documents are either original works of the uploader or authorized works of the rightful owners.

  • Not to be reproduced or distributed without explicit permission.
  • Not used for commercial purposes outside of approved use cases.
  • Not used to infringe on the rights of the original creators.
  • If you believe any content infringes your copyright, please contact us immediately.

Support

For help with questions, suggestions, or problems, please contact us