Oncogene (2000) 19, 1992 ± 2001 ã 2000 Macmillan Publishers Ltd All rights reserved 0950 ± 9232/00 $15.00 www.nature.com/onc Di€erential interaction of plakoglobin and b-catenin with the ubiquitin-proteasome system

Einat Sadot1, Inbal Simcha1, Kazuhiro Iwai2, Aaron Ciechanover3, Benjamin Geiger1 and Avri Ben-Ze'ev*,1

1Department of Molecular Cell Biology, The Weizmann Institute of Science, Rehovot 76100, Israel; 2Department of Molecular and System Biology, Kyoto University, Yoshida-Konoe-ChoSakyo-ku, Kyoto 606-8501, Japan; 3Faculty of Medicine and the Rappaport Institute for Research in the Medical Sciences, Technion-Israel Institute of Technology, Haifa 31096, Israel

b-Catenin and plakoglobin are closely related armadillo major role in the membrane anchorage of the family proteins with shared and distinct properties; Both cytoskeleton at cell-cell adherens junctions (Ozawa et are associated with cadherins in actin-containing ad- al., 1989; Ben-Ze'ev and Geiger, 1998). In adherens herens junctions. Plakoglobin is also found in desmo- junctions, b-catenin and plakoglobin independently somes where it anchors intermediate ®laments to the associate with the cytoplasmic domain of adhesion desmosomal plaques. b-Catenin, on the other hand, is a receptors of the cadherin family, linking them to the component of the Wnt signaling pathway, which is actin cytoskeleton via an association with a-catenin involved in embryonic morphogenesis and tumorigenesis. (Takeichi, 1990; Geiger and Ayalon, 1992; Kemler, A key step in the regulation of this pathway involves 1993; Adams and Nelson, 1998; Takeichi, 1995). In modulation of b-catenin stability. A multiprotein com- addition to this structural role in cell adhesion, b- plex, regulated by Wnt, directs the phosphorylation of b- catenin and its Drosophila homolog, armadillo, are key catenin and its degradation by the ubiquitin-proteasome components of the wg/wnt-signaling pathway (Peifer system. Plakoglobin can also associate with members of and Wieschaus, 1990; Peifer et al., 1993; Wodarz and this complex, but inhibition of proteasomal degradation Nusse, 1998) that regulates developmental processes, has little e€ect on its levels while dramatically increasing including speci®cation of the anterior-posterior seg- the levels of b-catenin. b-TrCP, an F-box protein of the ment polarity in Drosophila (Peifer et al., 1993), and SCF E3 ubiquitin ligase complex, was recently shown to axis determination in developing Xenopus embryos play a role in the turnover of b-catenin. To elucidate the (Heasman et al., 1994). Signaling by b-catenin is basis for the apparent di€erences in the turnover of b- carried out mainly by the nuclear pool of the protein, catenin and plakoglobin we compared the handling of and recruitment of this protein to adherens junctions, these two proteins by the ubiquitin-proteasome system. by overexpressing cadherins inhibits its signaling We show here that a deletion mutant of b-TrCP, lacking activity (Fagotto et al., 1996; Sanson et al., 1996; the F-box, can stabilize the endogenous b-catenin leading Simcha et al., 1998). to its nuclear translocation and induction of b-catenin/ Despite the close homology and colocalization in LEF-1-directed transcription, without a€ecting the levels adherens junctions b-catenin and plakoglobin display of plakoglobin. However, when plakoglobin was over- clear di€erences in their distribution and signaling expressed, it readily associated with b-TrCP, eciently activity. Thus, plakoglobin (but not b-catenin) is a competed with b-catenin for binding to b-TrCP and component of the submembranal plaque of desmo- became polyubiquitinated. Fractionation studies revealed somes (Cowin et al., 1986; Franke et al., 1989). In that about 85% of plakoglobin in 293 cells, is Triton X- addition, several lines of evidence suggest that the two 100-insoluble compared to 50% of b-catenin. These proteins di€er greatly in their signaling activity results suggest that while both plakoglobin and b-catenin (Simcha et al., 1998; Zhurinsky, Shtutman and Ben- can comparably interact with b-TrCP and the ubiquiti- Ze'ev, submitted). During Xenopus development, a nation system, the sequestration of plakoglobin by the reduction in b-catenin level (Heasman et al., 1994), membrane-cytoskeleton system renders it inaccessible to unlike in that of plakoglobin (Kofron et al., 1997), the proteolytic machinery and stabilizes it. Oncogene a€ects embryonic axis formation. The phenotypes of b- (2000) 19, 1992 ± 2001. catenin-null (Haegel et al., 1995) and plakoglobin-null mice (Bierkamp et al., 1996; Ruiz et al., 1996) are also Keywords: b-catenin; plakoglobin; b-TrCP; ubiquitina- di€erent: embryos that lack b-catenin die before tion gastrulation, while plakoglobin-null mice die much later due to heart failure (Bierkamp et al., 1996; Ruiz et al., 1996). Introduction In addition to its activation of wnt signaling, non- junctional b-catenin interacts with the ubiquitin- b-Catenin and plakoglobin (or g-catenin) are highly proteasome system that regulates its degradation homologous proteins of the armadillo family, playing a (Aberle et al., 1997; Orford et al., 1997; Simcha et al., 1998). The targeting of b-catenin for degradation involves the phosphorylation of its N-terminus by *Correspondence: A Ben-Ze'ev glycogen synthase kinase 3b (GSK) (Aberle et al., 1997; Received 29 November 1999; revised 14 February 2000; accepted Yost et al., 1996) which occurs in a multi-protein 14 February 2000 complex consisting of b-catenin, GSK, the adenoma- Regulation of b-catenin and plakoglobin turnover E Sadot et al 1993 tous polyposis coli (APC) tumor suppressor protein conditions (Huber et al., 1996; Simcha et al., 1998; and axin/conductin (Munemitsu et al., 1995; Rubinfeld Hecht et al., 1999). Elevation in plakoglobin expression et al., 1996; Zeng et al., 1997; Ikeda et al., 1998; was shown to lead to ectopic axis formation in Xenopus Behrens et al., 1998; Yamamoto et al., 1998). This (Karnovsky and Klymkowsky, 1995) and activation of complex associates with the ubiquitin ligase, b-TrCP LEF/TCF-dependent transcription in mammalian cells (b-transducin repeat-containing protein) that recog- (Simcha et al., 1998). The interpretation of these results nizes the N-terminally phosphorylated forms of b- is complicated however, by the fact that increased catenin and regulates its ubiquitination and degrada- levels of plakoglobin can also lead to compromised tion by the proteasome (Winston et al., 1999; Liu et al., degradation and nuclear accumulation of the endogen- 1999; Latres et al., 1999; Hart et al., 1999; Kitagawa et ous b-catenin (Miller and Moon, 1997; Simcha et al., al., 1999). b-TrCP associates through its F-box with 1998). Cul1/Skp1/ROC1 forming the modular ubiquitin ligase These studies on the regulation of plakoglobin and SCF complex (Latres et al., 1999; Tan et al., 1999) and b-catenin levels, raised the question of possible via its WD repeat motif with the phosphorylated b- di€erences in the interaction of the two proteins with catenin (Winston et al., 1999; Liu et al., 1999; Hart et the ubiquitin-proteasome system. In principle, a al., 1999), thus forming a multimolecular complex di€erence in the regulation of their turnover could consisting of b-TrCP/b-catenin/Axin/GSK/APC (Liu et result from intrinsic variations in their ability to al., 1999; Kitagawa et al., 1999). b-TrCP and its interact with the ubiquitin system, or from di€erences Drosophila homolog Slimb were implicated in the in their subcellular localization and sequestration by regulation of wnt/wg signaling (Jiang and Struhl, complexing with other cellular compartments. In this 1998) and the DF-b-TrCP mutant, lacking the F-box, study, we have compared the association of the two was shown to induce axis duplication in Xenopus proteins with the recently described b-TrCP. We show (Marikawa and Elinson, 1998; Liu et al., 1999), and that plakoglobin, when overexpressed in cells, is loss of function mutations in Slimb, induce the capable of interacting with the b-TrCP ubiquitin ligase, accumulation of armadillo in Drosophila (Jiang and similar to b-catenin. However, unlike b-catenin whose Struhl, 1998). Plakoglobin is also capable of associat- level and transcriptional activity increase following ing with the GSK/APC/Axin complex (Hulsken et al., overexpression of the dominant negative DF-b-TrCP, 1994; Rubinfeld et al., 1995; Kodama et al., 1999), but the endogenous plakoglobin level remains largely its degradation by the ubiquitin-proteasome system is una€ected by this treatment. In view of the much less pronounced than that of b-catenin (Simcha et al., lower levels of Triton-soluble plakoglobin, compared 1998), and its mode of interaction with the b-TrCP to b-catenin, we propose that these di€erences are ubiquitin ligase was not determined. attributable to the more strict and tight sequestration The binding of wnt to its receptor frizzled, results in of plakoglobin by the membrane-cytoskeleton com- the inhibition of GSK activity (Cook et al., 1996) and a partment, rendering it largely unavailable to the subsequent elevation in b-catenin level (Papko€ et al., ubiquitination system. 1996). This is followed by the translocation of b- catenin into the nucleus and its interaction with LEF/ TCF family transcription factors (Behrens et al., 1996; Results Huber et al., 1996; Molenaar et al., 1996), leading to the transactivation of LEF/TCF-responsive target DF-b-TrCP increases the levels of b-catenin, induces its genes (Molenaar et al., 1996; van de Wetering et al., nuclear translocation and potentiates its transactivation 1997). capacity Constitutive activation of b-catenin signaling, that may result from stabilization of b-catenin in cells CHO cells express low levels of N-cadherin and b- carrying inactivating mutations in APC or mutations in catenin, thus providing a sensitive system to study the the N-terminus of b-catenin, is associated with tumors modulation of b-catenin degradation (Sadot et al., in a variety of tissues (Korinek et al., 1997; Morin et 1998). When CHO cells are transfected with N- al., 1997; Rubinfeld et al., 1997; de La Coste et al., cadherin, b-catenin levels are increased since b-catenin 1998; Miyoshi et al., 1998; Palacios and Gamallo, 1998; is sequestered at cell-cell junctions and protected from Sparks et al., 1998; Voeller et al., 1998; Zurawel et al., degradation (Sadot et al., 1998). When b-TrCP, the 1998; Chan et al., 1999). In line with these ®ndings, the ubiquitin ligase that interacts with b-catenin and target genes of b-catenin/LEF/TCF in mammalian cells regulates its activity (Polakis, 1999), or its dominant include oncogenes such as c-myc (He et al., 1998) and negative mutant lacking the F-box, (DF) were cyclin D1 (Tetsu and McCormick, 1999; Shtutman et transfected into CHO cells, b-catenin levels increased al., 1999). In contrast, the level of plakoglobin is often six- or 11.5-fold respectively (Figure 1). To determine reduced in cancer cells (Navarro et al., 1993; Aberle et the subcellular distribution of b-catenin that accumu- al., 1995; Simcha et al., 1996) and the human lates in these cells, HA-tagged b-TrCP or DF were plakoglobin gene displays loss of heterozygosity in transiently transfected into CHO and 293T cells. The certain tumors (Aberle et al., 1995). Moreover, cells were then double stained for b-TrCP or DF using plakoglobin was shown to suppress tumorigenicity antibodies to HA and against b-catenin. In both cell when overexpressed in various transformed cell lines types, the b-catenin that accumulated after transfection (Simcha et al., 1996). with b-TrCP and DF was primarily localized in the Despite these di€erences between b-catenin and nuclei of the transfected cells (Figure 2b,e). Interest- plakoglobin in tumor cells, plakoglobin was shown to ingly, most of the transfected b-TrCP and DF proteins contain a potent transactivation domain (Simcha et al., were also localized in the nucleus (Figure 2a,d). Similar 1998) and it can bind to LEF-1 under certain nuclear localization was also observed in other cell

Oncogene Regulation of b-catenin and plakoglobin turnover E Sadot et al 1994 types including MDCK, 3T3 and CHO (data not TrCP, on the other hand, increased b-catenin levels shown). Quantitation of the nuclear immuno¯uores- only when highly overexpressed in cells (Figure 2d,e cence, using digital microscopy, revealed strong arrows), and its e€ect was weaker than that of DF correlation between the intensity of DF ¯uorescence (Figure 2f), in agreement with the results obtained with (FITC) and that of b-catenin (Rhodamine) within the CHO cells (Figure 1). Thus, in such overexpressing same nuclei (correlation coecient r40.9). The cells, a linear correlation between the nuclear immu- di€erence in the intensity of nuclear b-catenin staining nostaining intensities of b-TrCP (FITC) and b-catenin between DF-transfected and non-transfected cells was (Rhodamine) was observed (r40.9, Figure 2d ± f). The highly signi®cant (P50.0005, Figure 2c). The intact b- di€erence between b-catenin staining in the nuclei of transfected and non-transfected cells was highly signi®cant (P50.005). To test whether the b-catenin that accumulated in the nuclei of cells after transfection with b-TrCP and DF was transcriptionally active, 293T cells were co- transfected with a LEF-1-responsive reporter plasmid (van de Wetering et al., 1997). The ability to activate this reporter was compared to that of transfected wt b- catenin, or a stable mutant of b-catenin (S33Y). The results summarized in Figure 3, show that DFisa potent activator of the LEF-1 reporter, similar to the stable mutant of b-catenin S33Y (130+22 and 185+8- fold increase in luciferase activity over the level obtained with the reporter plasmid alone). In contrast, under the same experimental conditions, wt b-catenin- mediated transactivation was only about 44-fold and that of b-TrCP 15-fold higher than the basal level. Luciferase activity of the control plasmid remained unaltered when cotransfected with b-TrCP constructs. Figure 1 b-TrCP and DF elevate b-catenin levels in CHO cells. Cells were transiently transfected with HA-tagged b-TrCP (lane 2) DF-b-TrCP stabilizes overexpressed but not the or DF (lane 3). The levels of the endogenous b-catenin (top endogenous plakoglobin panel), of the HA-tagged transfected proteins (middle panel) and of a-tubulin (used as loading control, the lower panel) were The e€ect of b-TrCP and DF on endogenous determined by Western blotting. An extract of non-transfected cells was loaded in lane 1. b-Catenin levels are expressed as fold plakoglobin level in 293T cells was also tested. Cells increase over its level in non-transfected cells. (*), A non-speci®c were transfected with b-TrCP or DF and stained for band recognized by the HA antibody the transfected protein and the endogenous plakoglo-

Figure 2 b-TrCP and DF transfection induce translocation of endogenous b-catenin into the nucleus. 293T cells were transiently transfected with HA-tagged DF(a, b) or with b-TrCP (d, e) and double stained with anti HA (a, d) and anti b-catenin (b, e). The quantitative analysis of nuclear staining for b-catenin in DForb-TrCP-transfected as well as in non-transfected cells is shown in c and f. Note that while DF transfection resulted in the elevation of nuclear b-catenin in all the transfected cells, b-TrCP could only induced this e€ect in highly transfected cells (arrows), but not in weakly transfected cells (arrowheads). au, arbitrary units. The bar represents 10 mm

Oncogene Regulation of b-catenin and plakoglobin turnover E Sadot et al 1995 bin. The results summarized in Figure 4 demonstrate inducible MMTV promoter (Salomon et al., 1997). In that there was no signi®cant change in the intensity of the absence of dexamethasone, only low levels of plakoglobin immuno¯uorescence in nontransfected plakoglobin are expressed in these cells, whereas upon versus DForb-TrCP-transfected cells (Figure 4a ± f). treatment with dexamethasone the expression of Moreover, quantitation of the immuno¯uorescence plakoglobin increases dramatically (Salomon et al., using the DeltaVision digital microscope system 1997). These cells were transiently transfected with revealed that there was no correlation between the HA-tagged DF in the presence or absence of ¯uorescence intensities of b-TrCP or DF and the low dexamethasone and double immunostained for the levels of plakoglobin staining within the same nuclei transfected protein and for plakoglobin. In the absence (Figure 4c,f). The average intensities for plakoglobin of dexamethasone, only a small increase in plakoglobin immuno¯uorescence in both DF and b-TrCP trans- level was observed after transfection with DF (Figure fected and non-transfected cells did not di€er sig- 5a ± c). Quantitation of the immuno¯uorescence re- ni®cantly (P40.5). Thus, in contrast to b-catenin, vealed a linear correlation between the levels of DF neither b-TrCP nor DF could a€ect the level of expression and of plakoglobin (r40.9). The di€erence endogenous plakoglobin in 293T cells. between nuclear staining of plakoglobin in transfected The e€ect of DF on plakoglobin was further tested in versus non-transfected cells was statistically signi®cant the HT1080 human ®brosarcoma cells that were stably (P50.5). When the cells were treated with dexametha- transfected with plakoglobin under a dexamethasone- sone, the e€ect of DF on plakoglobin was more dramatic and high levels of plakoglobin accumulated in the nuclei of the transfected cells (Figure 5d ± f). Quantitation of the immuno¯uorescence showed a linear correlation between the intensities of DF and plakoglobin staining in the same nuclei (r40.9). In addition to analysing the e€ect on plakoglobin, we have also tested in these cells the e€ect of DFonb- catenin (without dexamethasone treatment) and found that b-catenin accumulated in the nuclei of DF- transfected HT1080 cells (Figure 5g ± i), similar to the results obtained with 293T cells (Figure 2). Taken together, these results suggest that in HT1080 cells DF can induce nuclear accumulation of endogenous b- catenin and of stably transfected plakoglobin, while in Figure 3 DF triggers the induction of transactivation by the b- 293T cells only the endogenous b-catenin was catenin/LEF-1 complex. 293T cells were transiently transfected translocated into the nucleus and became active in with a LEF-1 responsive reporter (TOPFLASH) or with a mutant transcription whereas plakoglobin remained una€ected. reporter (FOPFLASH), together with either: wt b-catenin, mutant b-catenin Y33, DF, or b-TrCP. Luciferase activity was normalized To study the hypothesis that the observed di€erences to b-gal activity from co-transfected LacZ in b-catenin and plakoglobin's response to DF transfec-

Figure 4 b-TrCP and DF do not a€ect the subcellular localization of endogenous plakoglobin in 293T cells. Cells were transiently transfected with HA-tagged DF(a, b), or b-TrCP (d, e) and double stained for HA (a, d) and for plakoglobin (b, e). c and f show quantitative analysis of nuclear staining for plakoglobin in DForb-TrCP-transfected and non-transfected cells. au-arbitrary units. The bar represents 10 mm

Oncogene Regulation of b-catenin and plakoglobin turnover E Sadot et al 1996

Figure 6 Di€erent solubility in Triton X-100 of b-catenin and plakoglobin in various cell types. 293T cells (lanes 1,2) and HT1080 cells, either non-treated (lanes 3,4) or treated with dexamethasone (dex) (lanes 5,6) were extracted with Triton X-100 and the levels of b-catenin and plakoglobin in the soluble (s) and insoluble (ins) fractions were determined by Western blot analysis

phorylation site (Aberle et al., 1997), serving as the docking domain for b-TrCP (Winston et al., 1999; Hart et al., 1999; Liu et al., 1999). To test whether plakoglobin indeed interacts with b-TrCP similar to b-catenin, 293T cells were cotransfected with HA-tagged DF and either VSV-tagged b-catenin or plakoglobin and cell lysates were immunoprecipitated with anti HA antibody followed by immunoblotting with anti VSV antibody. As shown in Figure 7a both VSV-plakoglobin and VSV- b-catenin were comparably co-immunoprecipitated with HA-DF-b-TrCP (Figure 7a, lanes 3 and 4). We have previously shown that the transfection of plakoglobin into 293T cells results in the elevation of the endogenous b-catenin, probably by the protection of b- catenin from the degradation machinery (Simcha et al., Figure 5 DF induces translocation of stably transfected, over- 1998). To determine whether plakoglobin can displace b- expressed plakoglobin into the nucleus. HT1080 human ®bro- catenin from its complex with b-TrCP in living cells, sarcoma cells stably expressing plakoglobin under a constant amounts of DNA encoding HA-DF and VSV- dexamethasone-inducible promoter were transiently transfected b-catenin were co-transfected into 293T cells with with HA-DF. Untreated (a,b,g,h) and dexamethasone (dex) treated (d,e) DF-transfected cells were double stained with anti increasing amounts of VSV-plakoglobin DNA. The HA (a,d,g) and anti plakoglobin (b,e) or anti b-catenin abs (h). complexes were immunoprecipitated with anti HA Quantitative analysis of nuclear staining for plakoglobin (c,f) and antibody and immunoblotted with anti VSV antibody. b-catenin (i) in transfected and non-transfected cells was The results, shown in Figure 7b demonstrate that determined as described for Figure 2. au, arbitrary units. The bar represents 10 mm plakoglobin could e€ectively displace b-catenin from its complex with HA-DF in a dose dependent manner (Figure 7b, lanes 3 and 4). Thus, b-catenin and tion may be due to di€erences in the availability of the plakoglobin appear to bind to the same site on b-TrCP. two proteins for interaction with the proteolytic system, we examined the Triton X-100 soluble and insoluble The ubiquitination of both b-catenin and plakoglobin is fractions from 293T and HT1080 cells for the relative inhibited by DF-b-TrCP amounts of the two proteins. The results shown in Figure 6 demonstrate that while about 50% of b-catenin To determine whether following their interaction with b- was Triton X-100 soluble in both 293T and HT1080 TrCP, both plakoglobin and b-catenin became ubiqui- cells, most of the plakoglobin (85%) was associated with tinated in cells, VSV-tagged plakoglobin or b-catenin the Triton-insoluble fraction of 293T cells. In this were transfected into 293T cells together with HA-tagged fraction, plakoglobin is presumably protected from ubiquitin, and 6xHis-tagged b-TrCP or DF. Immune degradation by its interaction with membrane-cytoske- complexes were precipitated using anti VSV antibody letal complexes, while the Triton X-100 soluble b-catenin and blotted with anti HA antibody. SDS ± PAGE may be available for ubiquitination and degradation by analysis of the immune complexes revealed the presence the proteasome. In HT1080 cells, in contrast, after of a ladder of HA-ubiquitinated proteins in cells dexamethasone induction, plakoglobin was mainly expressing either VSV-b-catenin or VSV-plakoglobin enriched in the Triton-soluble fraction (73%) (Figure (Figure 8a, lanes 2 and 5 respectively). Since the lower 6) where it was available to interact with the ubiquitina- molecular weight bands in these ladders (*100 kD) are tion and degradation machinery, similar to b-catenin. higher than that of b-catenin and plakoglobin approxi- mately by the size of a single ubiquitin molecule (*10 kD), we propose that the ladders seen in Figure DF-bTrCP can interact with both b-catenin and 8a correspond to the ubiquitinated forms of these plakoglobin molecules. It was previously reported that F-box Plakoglobin and b-catenin posses a highly homologous proteins themselves can undergo ubiquitination (Zhou N-terminal sequence that contains the GSK3b phos- and Howley 1998). However, b-TrCP has a lower

Oncogene Regulation of b-catenin and plakoglobin turnover E Sadot et al 1997

Figure 8 Plakoglobin and b-catenin are ubiquitinated in trans- fected cells and their ubiquitination is inhibited by DF. 293T cells were transfected with VSV-b-catenin (lanes 1 ± 3) or VSV- plakoglobin (lanes 4 ± 6) and HA-ubiquitin (lanes 2, 3, 5 and 6), and with either 6xHis-b-TrCP (lanes 2 and 5) or 6xHis-DF (lanes 3 and 6). Complexes were immunoprecipitated (IP) with anti VSV antibody and immunoblotted (IB) with anti HA antibody (a). The levels of VSV b-catenin and VSV-plakoglobin in cell lysates were detected with anti VSV antibody (b)

domain of the molecules, and were shown to ful®ll similar functions in the assembly of adherens junctions. Yet, these two proteins are di€erent in various important aspects related to their structural role in adhesion, in the mechanisms responsible for the regulation of their cellular levels, and their signaling Figure 7 b-Catenin and plakoglobin can bind to DF. (a) 293T abilities (see for review Ben-Ze'ev and Geiger, 1998). cells were transfected with VSV-tagged plakoglobin (lanes 1 and Thus, while the two proteins are associated with 3) or with VSV-tagged b-catenin (lanes 2 and 4) together with adherens junctions, only plakoglobin is present in HA-tagged DF-b-TrCP (DF) (lanes 3 and 4). Complexes were desmosomes (Cowin et al., 1986; Franke et al., 1989). immunoprecipitated (IP) with anti HA antibody. The levels of VSV-b-catenin and VSV-plakoglobin in cell extracts (top panel) In addition, the elimination of b-catenin and plakoglo- and in the HA-immunoprecipitates (middle and lower panels) bin genes (Haegel et al., 1995; Bierkamp et al., 1996; were analysed by immunoblotting (IB). (b) 293T cells were Ruiz et al., 1996), or interference with the function of transfected with a constant amount of b-catenin and HA-DF and maternal b-catenin (Heasman et al., 1994) and increasing amounts of plakoglobin as indicated. Complexes containing HA-DF were immunoprecipitated (IP) with anti HA plakoglobin (Kofron et al., 1997) in Xenopus embryos, antibody. The levels of VSV-b-catenin and VSV-plakoglobin in lead to distinct phenotypes. Furthermore, mutations in cell extracts (top panel) and the HA-immunoprecipitates were b-catenin or APC which lead to accumulation of b- analysed by immunoblotting (IB). VSV-b-catenin and VSV- catenin, are associated with oncogenic transformation plakoglobin were detected in complex with DF using anti VSV (reviewed in Ben-Ze'ev and Geiger, 1998; Polakis, and anti plakoglobin antibodies respectively (two middle panels). The lower panel shows the levels of HA-DF in these complexes 1999), probably by directing the transcription of oncogenes such as c-myc and cyclin D1 (He et al., 1998; Tetsu and McCormick, 1999; Shtutman et al., 1999) and the invasion-promoting secreted protease matrilysin (Crawford et al., 1999). In contrast, the molecular weight (*60 kb) than b-catenin and plako- levels of plakoglobin are often reduced in cancer cells globin, and thus its ubiquitination ladder is expected to (Navarro et al., 1993; Sommers et al., 1994; Aberle et run faster on the SDS gel. When DF was co-transfected, al., 1995; Simcha et al., 1996) and overexpression of the ubiquitination of both b-catenin and plakoglobin plakoglobin may suppress tumorigenicity (Simcha et was inhibited (Figure 8a, lanes 3 and 6). Interestingly, the al., 1996). total level of the transfected b-catenin or plakoglobin The major aim of this study was to explore the was increased ®ve- and twofold respectively by transfec- di€erences in the interaction of b-catenin and plako- tion with b-TrCP, and to a greater extent (seven- and globin with the ubiquitin-mediated degradation ma- threefold respectively), by transfection with DF (Figure chinery that could be responsible for their di€erent 8b). Taken together, these results indicate that both turnover and signaling activity. Previous studies have plakoglobin and b-catenin are eciently ubiquitinated demonstrated that plakoglobin, similar to b-catenin, when overexpressed in 293 cells and that the ubiquitina- can interact with the GSK/APC/Axin system that tion can be inhibited by the DF mutant of b-TrCP. regulates b-catenin stability (Hulsken et al., 1994; Rubinfeld et al., 1995; Kodama et al., 1999). In principle, di€erences in the interaction of the two Discussion catenins with the ubiquitin-proteasome system could be due to either di€erential phosphorylation of the two b-Catenin and plakoglobin display a high degree of proteins by the GSK/APC/Axin complex, or to sequence homology, especially in the armadillo repeat di€erent processing by the ubiquitin system.

Oncogene Regulation of b-catenin and plakoglobin turnover E Sadot et al 1998 In this study, we have compared the interaction of b-catenin, i.e. it induces the accumulation of the protein the two proteins with the recently discovered SCF and its nuclear translocation. In addition, while b- component b-TrCP (Margottin et al., 1998). This catenin is about equally distributed between the Triton protein contains two main domains, an F-box motif X-100-soluble and -insoluble fractions, most of the that binds to Skp1 and enables its assembly with the plakoglobin is Triton X-100-insoluble in nontransfected Skp1/Cul1 complex, and the WD domain that cells. In contrast, in cells overexpressing plakoglobin, speci®cally binds to the target protein (for reviews see the distribution of plakoglobin and that of b-catenin in Hershko and Ciechanover, 1998; Ciechanover, 1998; these two subcellular fractions is similar. Elledge and Harper, 1998). Cdc53/Cul1 interacts with A di€erential interaction of the two molecules with the E2 ubiquitin-conjugating enzyme that functions in their di€erent molecular partners was also suggested to conjunction with the Skp1-b-TrCP complex to link explain their di€erent association with LEF-1 (Simcha ubiquitin to lysine residues in the target protein (Patton et al., 1998). While transfection of LEF-1 can readily et al., 1998). The importance of b-TrCP in regulating bring about the accumulation and nuclear transloca- various signaling pathways, by controlling speci®c tion of b-catenin in MDCK cells (Behrens et al., 1996; protein turnover, was recently highlighted in studies Simcha et al., 1998), it has no e€ect on plakoglobin demonstrating that b-TrCP and its Drosophila homolog localization in the same cells (Simcha et al., 1998). Slimb regulate three di€erent signaling pathways (see Nevertheless, when plakoglobin is overexpressed along for review Maniatis, 1999); namely, NF-kB, Wnt/ with LEF-1, it colocalizes with LEF-1 in the nuclei of Wingless and Hedgehog (Yaron et al., 1998; Jiang and the transfected cells (Simcha et al., 1998). It is Struhl, 1998). The regulation of NF-kB signaling is noteworthy, that in MDCK cells, similar to 293T and achieved by controlling the turnover of IkBa (Yaron et HT1080 cells (Figure 6), the Triton X-100-soluble pool al., 1998; Spencer et al., 1999; Fuchs et al., 1999), while of b-catenin is much larger than that of plakoglobin, the stabilization of b-catenin by a dominant negative again pointing to a di€erential availability of the two DF-b-TrCP mutant, lacking the F-box, induces axis catenins to other partner molecules. duplication in Xenopus (Marikawa and Elinson, 1998; The basis for the reduced levels of Triton-soluble Liu et al., 1999), and loss of function mutations in plakoglobin is not yet clear. Nevertheless, it is well Drosophila Slimb, induce accumulation of armadillo established that while both molecules are part of the and cubitus interuptus (Jiang and Struhl, 1998). cytoplasmic plaque of adherens junctions, only plako- We showed here that both b-catenin and plakoglobin globin can interact with desmosomes (Cowin et al., are capable of interacting with b-TrCP when over- 1986; see for review Ben-Ze'ev and Geiger, 1998). This expressed in cells, and are ubiquitinated in the additional structural interaction of plakoglobin may transfected cells, and that plakoglobin can compete with further reduce the free plakoglobin pool. Indeed, the b-catenin for b-TrCP binding. The endogenous b-catenin rate of plakoglobin degradation in transfected cells and plakoglobin however, di€ered signi®cantly in their decreased 15 ± 20-fold when plakoglobin is co-trans- response to overexpression of the dominant negative DF fected with its desmosomal partners, desmoglein or mutant. While the level of endogenous b-catenin was desmocollin (Kowalczyk et al., 1994). It is noteworthy elevated, most probably by its binding to DF that that both MDCK and 293T cells, that were used in the sequestered it away from the degradation system, in present and previous studies (Simcha et al., 1998), are agreement with other studies (Liu et al., 1999; Kitagawa epithelial and contain desmosomes. et al., 1999; Hart et al., 1999), the level of plakoglobin Regulation of the signaling function of catenins remained una€ected in such cells. Furthermore, the depends, to a large extent, on the equilibrium between increase in b-catenin levels was associated with its the free and junctional associated catenins. An increase nuclear accumulation resulting in a very ecient in the expression of the junctional partners of b-catenin activation of a LEF/TCF-responsive reporter, further (for example cadherin and a-catenin) results in a supporting the importance of the regulation of b-catenin signi®cantly reduced b-catenin signaling (Fagotto et stability in the control of its signaling activity. Interest- al., 1996; Sanson et al., 1996; Simcha et al., 1998; ingly, overexpression, of intact b-TrCP also resulted in Sadot et al., 1998). Moreover, changes in the level of the stabilization of b-catenin in both CHO and 293T plakoglobin were also shown to in¯uence this balance cells, but to a lesser extent than with DF. This in b-catenin's availability, by a€ecting b-catenin's observation can be attributed to the sequestration of stability in the cell (Miller and Moon, 1997; Salomon the other SCF components by the excess b-TrCP et al., 1997; Simcha et al., 1998). (Spencer et al., 1999). Alternatively, b-TrCP may bind While the results of this study imply a di€erence in to b-catenin but fail to eciently ubiquitinate it (at least availability of the two proteins for interaction with b- in the cells tested here) and thereby block the TrCP, an intrinsic di€erence in the abilities of the two degradation of b-catenin and plakoglobin via an molecules to interact with b-TrCP, and other compo- alternative, yet unidenti®ed protein. It is noteworthy, nents of the ubiquitin-proteasomal system, cannot be however, that when overexpressed in HeLa cells, b-TrCP entirely excluded. It was recently suggested that an reduces b-catenin levels (Hart et al., 1999). intrinsic di€erence in the capacity of the two molecules to Since both overexpressed b-catenin and plakoglobin complex with transcriptional partners may explain the bind to b-TrCP in cells and become ubiquitinated, we weak potential of plakoglobin, in contrast to b-catenin, propose that the lack of DF e€ect on plakoglobin results to function in transactivation (Simcha et al., 1998). This from the unavailability of the endogenous plakoglobin is supported by our ®nding that the ability of the two molecules to interact with DF in the cells used in this molecules to form a ternary complex consisting of study. This is supported by our ®nding that in cells catenin/LEF/DNA is di€erent in vitro and in cells overexpressing plakoglobin under an inducible promo- transfected with the two molecules (J Zhurinsky, M ter the e€ect of DF on plakoglobin is similar to that on Shtutman and A Ben-Ze'ev, manuscript submitted).

Oncogene Regulation of b-catenin and plakoglobin turnover E Sadot et al 1999 Taken together, these results imply that a ®ne-tuned expressing vector was co-transfected in the transactivation balance, regulated at multiple levels, has evolved in assays as an internal control for transfection eciency. After mammalian cells to control the level and availability 24 h, the cells were lysed and both luciferase and b- and thus the signaling by b-catenin. This includes the galactosidase activities were determined by enzyme assay kits regulation of junction assembly, the activation or (Promega). For Western blots and immunoprecipitations (IP) cells were harvested 24 h after transfection and lysed in either inactivation of the GSK/APC/Axin system and the Laemmli's sample bu€er or IP bu€er (see below), respec- availability to the ubiquitination machinery. The ability tively. of excess plakoglobin to interact with some of these systems can exert complex e€ects on b-catenin levels and signaling. Thus, competition on the degradation Immunoblotting and immunoprecipitations pathway may lead to protection followed by accumula- Equal amounts of total protein from the di€erent transfected tion and an increase in b-catenin's transactivation cells were separated by SDS ± PAGE, and subjected to potential. Competition on cadherin binding, on the Western blotting using the following antibodies: monoclonal other hand, may release b-catenin from a protected anti HA (clone 12CA5 Boehringer Mannheim), polyclonal junctional pool making it available for transactivation, anti HA (a gift from M Oren, Weizmann Institute of Science, Rehovot, Israel), polyclonal anti VSV (a gift from JC degradation, or both (Miller and Moon, 1997; Perriard, Swiss Federal Institute of Technology, Zurich Salomon et al., 1997; Simcha et al., 1998). Such Switzerland), polyclonal anti b-catenin and monoclonal anti conditions most probably prevail during embryonal a-tubulin (both from Sigma) and monoclonal anti plakoglo- development when cells extensively modulate their bin (Salomon et al., 1997). For immunoprecipitation, cells junctions, when Wnt signaling is activated (Klymkows- were lysed in IP bu€er containing 20 mM Tris HCl pH 8.0, ky et al., 1999), or during epithelial mesenchymal 1% Triton X-100, 140 mM NaCl, 10% glycerol, 1 mM transition that is associated with dramatic changes in EGTA, 1.5 mM MgCl2,1mM DTT, 1 mM sodium vanadate junctional assembly (Eger et al., 2000). Future studies and 50 mg/ml PMSF. Equal amounts of protein were will have to unravel the details of this very complex, incubated with 2 ml of the antibody and 20 ml of protein A/ multimolecular regulation of b-catenin level and its G-agarose beads (Santa Cruz) for 4 h at 48C. The beads were washed ®ve times with 20 m Tris HCl bu€er pH 8.0 signaling role in mammalian cell function. M containing 150 mM NaCl and 0.5% NP40, and the immune complexes recovered by boiling in Laemmli's sample bu€er and resolved by SDS ± PAGE. Blots were developed using the Material and methods ECL method (Amersham). Autoradiograms were scanned by a GS-700 imaging densitometer (Bio Rad) and quantitated Plasmids using the FotoLook PS 2.07.2 software. The intensity of the b-TrCP cDNA was isolated from 293 cells by RT ± PCR bands was quantitated using NIH image 1.61 software. using the following primers: 5'-TGGCCTCGGCGATTATG- GAC-3' and 5'-GGGTCCTGGGCAAGTATGAG-3'. The b- Cell fractionation TrCP PCR product was inserted into pCR-TOPO2.1 (Invitrogen) by TA cloning. An F-box deletion mutant of Fractionation into Triton X-100-soluble and -insoluble b-TrCP (DF) in which nucleotides 93 ± 536 were removed was fractions was carried out with cells cultured on 35 mm tissue generated by two step PCR as described (Higuchi et al., 1988) culture plates that were extracted, at room temperature, with using the following primers: inside 5'-TAATGGCGAAC- 0.5 ml of 50 mM MES bu€er pH 6.8 containing 2.5 mM CCCCTAGGTACCGAGTGACCTTTGA-3' and 5'-TCA- EGTA, 5 mM MgCl2 and 0.5% Triton X-100, for 3 min. GA GGTCACTCGGTACCTAGGGGGTTCGCC AT TA-3', The Triton X-100-soluble fraction was removed and the outside: a T7 primer (a 17 oligomer), and 5'-AGGACT- insoluble fraction was scraped into 0.5 ml of the same bu€er. GAACCTGTATGG-3'. The b-TrCP and DF mutant were Equal volumes of the two fractions were analysed by SDS ± cloned into the pCAGGS expression vector (Niwa et al., PAGE. 1991) containing a 6xHis tag between the XhoI and EcoRI sites. HA tagged b-TrCP and DF were generated by Immunofluorescence microscopy subcloning their cDNAs into the pCGN-HA vector. In brief, the N-termini of the full-length b-TrCP and that of DF were Cells were cultured on glass coverslips, ®xed with 3% generated by PCR using the following primers; 5'-CGTCTA- paraformaldehyde in phosphate-bu€ered saline and permea- GAATGGACCCGGCCGAGGCGGT-3' and 5'-CTCTCG- bilized with 0.5% Triton X-100. Monoclonal or polyclonal ATAAGCTTCTTCCAC-3'. The XbaI±HindIII PCR frag- antibodies to HA were used to label the transfected HA- ments were joined to the HindIII ± BamHI C-terminal part of tagged b-TrCP or DF. The secondary antibodies were Alexa b-TrCP and cloned into XbaI±BamHI cleaved pCGN-HA. 488 goat anti mouse or anti rabbit IgG (Molecular Probes). VSV-tagged b-catenin and plakoglobin (Simcha et al., 1998), Plakoglobin was detected by a monoclonal antibody 11E4 the pCGN-HA containing the S33Y b-catenin mutant (Salomon et al., 1997) and b-catenin by a polyclonal antibody (Shtutman et al., 1999), the TOPFLASH and FOPFLASH (Sigma). The secondary antibodies were Cy3 goat anti mouse luciferase reporter vectors (van de Wetering et al., 1997) and or anti rabbit IgG (Jackson ImmunoResearch Laboratories, the HA-ubiquitin expressing vector (Treier et al., 1994) were West Grove, PA, USA). Image acquisition was performed described. using the DeltaVision system (Applied Precision, Issaquah WA, USA), equipped with a Zeiss Axiovert 100 microscope (Oberkochen, Germany) and Photometrics 300 series scien- Cell lines and transfections ti®c-grade cooled CCD camera (Tucson, AZ, USA) reading CHO, 293T and HT1080 cells were maintained in DMEM 12 bit images using a 10061.3 NA plan-Neo¯uar objective with 10% calf serum. HT1080 stably expressing an inducible (Zeiss, Oberkochen, Germany). For quantitative evaluation plakoglobin from the MMTV promoter (Salomon et al., of the immuno¯uorescence, nuclei identi®ed by the b-TrCP/ 1997) were treated with 0.1 mM dexamethasone. Transient DF labeling, or by phase contrast, were enclosed in a polygon transfections were performed using the calcium phosphate and marked using the Priism software (Kam et al., 1993). The precipitation methods for 293T and HT1080 cells and by ¯uorescence intensity values were calculated for both b-TrCP, Lipofectamine (GIBCO) in CHO cells. A b-galactosidase- or DF and b-catenin, or plakoglobin in the corresponding

Oncogene Regulation of b-catenin and plakoglobin turnover E Sadot et al 2000 nuclei. At least 30 transfected and 30 non-transfected cells ment (A Ben-Ze'ev) the Cooperation Program in Cancer were examined in each experiment. Research between DKFZ and IMOSA (A Ben-Ze'ev and B Geiger), by the Yad Abraham Center for Cancer Diagnosis and Therapy and the Minerva Foundation (B Geiger). A Ben-Ze'ev holds the Lunenfeld-Kunin Chair in Cell Acknowledgments Biology and Genetics. B Geiger. Is the incumbent of the This study was supported by grants from the German- Erwin Neter chair in Cell and Tumor Biology. Israeli Foundation for Scienti®c Research and Develop-

References

Aberle H, Bierkamp C, Torchard D, Serova O, Wagner T, Higuchi R, Krummel B and Saiki RK. (1988). Nucleic Acids Natt E, Wirsching J, Heidkamper C, Montagna M and Res., 16, 7351 ± 7367. Lynch H. (1995). Proc. Natl. Acad. Sci. USA, 92, 6384 ± HuberO,KornR,McLaughlinJ,OhsugiM,HerrmannBG 6388. and Kemler R. (1996). Mech. Dev., 59, 3 ± 10. Aberle H, Bauer J, Stappert A, Kispert A and Kemler R. Hulsken J, Birchmeier W and Behrens J. (1994). J. Cell. Biol., (1997). EMBO J., 16, 3797 ± 3804. 127, 2061 ± 2069. Adams C and Nelson W. (1998). Curr. Opin. Cell Biol., 10, Ikeda S, Kishida S, Yamamoto H, Murai H, Koyama S and 572 ± 577. Kikuchi A. (1998). EMBO J., 17, 1371 ± 1384. Behrens J, von Kries JP, Kuhl M, Bruhn L, Wedlich D, Jiang J and Struhl G. (1998). Nature, 391, 493 ± 496. Grosschedl R and Birchmeier W. (1996). Nature, 382, Kam Z, Jones MO, Chen H, Agad DA and Sedat JW. (1993). 638 ± 642. Bioimaging, 1, 71 ± 81. Behrens J, Jerchow B, Wurtele M, Grimm J, Asbrand C, Karnovsky A and Klymkowsky MW. (1995). Proc. Natl. Wirtz R, Kuhl M, Wedlich D and Birchmeier W. (1998). Acad.Sci.USA,92, 4522 ± 4526. Science, 280, 596 ± 599. Kemler R. (1993). Trends Genet., 9, 317 ± 321. Ben-Ze'ev A and Geiger B. (1998). Curr. Opin. Cell Biol., 10, Kitagawa M, Hatakeyama S, Shirane M, Matsumoto M, 629 ± 639. Ishida N, Hattori K, Nakamichi I, Kikuchi A, Nakayama Bierkamp C, Mclaughlin KJ, Schwarz H, Huber O and K and Nakayama K. (1999). EMBO J., 18, 2401 ± 2410. Kemler R. (1996). Dev. Biol., 180, 780 ± 785. Klymkowsky M, Williams B, Barish G, Varmus H and Chan E, Gat U, McNi€ J and Fuchs E. (1999). Nat. Genet., Vourgourakis Y. (1999). Mol. Cell. Biol., 10, 3151 ± 3169. 21, 410 ± 413. Kodama S, Ikeda S, Asahara T, Kishida M and Kikuchi A. Ciechanover A. (1998). EMBO J., 17, 7151 ± 7160. (1999). J. Biol. Chem., 274, 27682 ± 27688. Cook D, Fry M, Hughes K, Sumathipala R, Woodgett J and Kofron M, Spagnuolo A, Klymkowsky M, Wylie C and Dale T. (1996). EMBO J., 15, 4526 ± 4536. Heasman J. (1997). Development, 124, 1553 ± 1560. Cowin P, Kapprell HP, Franke WW, Tamkun J and Hynes Korinek V, Barker N, Morin PJ, van Wichen D, de Weger R, R. (1986). Cell, 46, 1063 ± 1073. Kinzler KW, Vogelstein B and Clevers H. (1997). Science, Crawford H, Fingleton B, Rudolph-Owen L, Goss K, 275, 1784 ± 1787. Rubinfeld B, Polakis P and Matrisian L. (1999). Kowalczyk AP, Palka HL, Luu HH, Nilles LA, Anderson Oncogene, 18, 2883 ± 2891. JE, Wheelock MJ and Green KJ. (1994). J. Biol. Chem., de La Coste A, Romagnolo B, Billuart P, Renard CA, 269, 31214 ± 31223. Buendia MA, Soubrane O, Fabre M, Chelly J, Beldjord C, Latres E, Chiaur DS and Pagano M. (1999). Oncogene, 18, Kahn A and Perret C. (1998). Proc. Natl. Acad. Sci. USA, 849 ± 854. 95, 8847 ± 8851. Levenberg S, Yarden A, Kam Z and Geiger B. (1998). Eger A, Stockinger A, Scha€hauser B, Beug H and Foisner Oncogene, 18, 869 ± 876. R. (2000). J. Cell. Biol., 148, 173 ± 187. LiuC,KatoY,ZhangZ,DoVM,YanknerBAandHeX. Elledge SJ and Harper JW. (1998). Biochim. Biophys. Acta, (1999). Proc. Natl. Acad. Sci. USA, 96, 6273 ± 6278. 1377, M61 ± 70. Maniatis T. (1999). Genes Dev., 13, 505 ± 510. Fagotto F, Funayama N, Gluck U and Gumbiner B. (1996). Margottin F, Bour SP, Durand H, Selig L, Benichou S, J. Cell. Biol., 132, 1105 ± 1114. Richard V, Thomas D, Strebel K and Benarous R. (1998). Franke W, Goldschmidt MD, Zimbelmann R, Mueller HM, Mol. Cell., 1, 565 ± 574. Schiller DL and Cowin P. (1989). Proc. Natl. Acad. Sci. Marikawa Y and Elinson RP. (1998). Mech. Dev., 77, 75 ± 80. USA, 86, 4027 ± 4031. Miller J and Moon RT. (1997). J. Cell. Biol., 139, 229 ± 243. Fuchs SY, Chen A, Xiong Y, Pan ZQ and Ronai Z. (1999). MiyoshiY,IwaoK,NawaG,YoshikawaH,OchiTand Oncogene, 18, 2039 ± 2046. Nakamura Y. (1998). Oncol. Res., 10, 591 ± 594. Geiger B and Ayalon O. (1992). Annu. Rev. Cell. Biol., 8, Molenaar M, van de Wetering M, Oosterwegel M, Peterson- 307 ± 332. Maduro J, Godsave S, Korinek V, Roose J, Destree O and Haegel H, Larue L, Ohsugi M, Fedorov L, Herrenknecht K Clevers H. (1996). Cell, 86, 391 ± 399. and Kemler R. (1995). Development, 121, 3529 ± 3537. Morin P, Sparks AB, Korinek V, Barker N, Clevers H, Hart M, Concordet JP, Lassot I, Albert I, del los Santos R, Vogelstein B and Kinzler KW. (1997). Science, 275, 1787 ± Durand H, Perret C, Rubinfeld B, Margottin F, Benarous 1790. R and Polakis P. (1999). Curr. Biol., 9, 207 ± 210. MunemitsuS,AlbertI,SouzaB,RubinfeldBandPolakisP. HeT,SparksAB,RagoC,HermekingH,ZawelL,daCosta (1995). Proc. Natl. Acad. Sci. USA, 92, 3046 ± 3050. LT, Morin PJ, Vogelstein B and Kinzler KW. (1998). Navarro P, Lozano E and Cano A. (1993). J. Cell. Sci., 105, Science, 281, 1509 ± 1512. 923 ± 934. Heasman J, Crawford A, Goldstone K, Garner-Hamrick P, Niwa H, Yamamura K and Miyazaki J. (1991). Gene, 108, Gumbiner B, McCrea P, Kintner C, Noro CY and Wylie 193 ± 199. C. (1994). Cell, 79, 791 ± 803. Orford K, Crockett C, Jensen J, Weissman A and Byers S. Hecht A, Litterst CM, Huber O and Kemler R. (1999). J. (1997). J. Biol. Chem., 272, 24735 ± 24738. Biol. Chem., 274, 18017 ± 18025. Ozawa M, Baribault H and Kemler R. (1989). EMBO J., 8, Hershko A and Ciechanover A. (1998). Annu.Rev.Biochem., 1711 ± 1717. 67, 425 ± 479.

Oncogene Regulation of b-catenin and plakoglobin turnover E Sadot et al 2001 Palacios J and Gamallo C. (1998). Cancer Res., 58, 1344 ± Sparks A, Morin PJ, Vogelstein B and Kinzler KW. (1998). 1347. Cancer Res., 58, 1130 ± 1134. Papko€ J, Rubinfeld B, Schryver B and Polakis P. (1996). Spencer E, Jiang J and Chen ZJ. (1999). Genes Dev., 13, 284 ± Mol. Cell. Biol., 16, 2128 ± 21234. 294. Patton EE, Willems AR, Sa D, Kuras L, Thomas D, Craig Tan P, Fuchs SY, Chen A, Wu K, Gomez C, Ronai Z and KL and Tyers M. (1998). Genes Dev., 12, 692 ± 705. Pan Z-Q. (1999). Mol. Cell., 3, 527 ± 533. Peifer M and Wieschaus E. (1990). Cell, 63, 1167 ± 1176. Takeichi M. (1990). Annu.Rev.Biochem.,59, 237 ± 252. Peifer M, Orsulic S, Pai L and Loureiro J. (1993). Dev. Takeichi M. (1995). Curr. Opin. Cell Biol., 7, 619 ± 627. Suppl., 163 ± 176. Tetsu O and McCormick F. (1999). Nature, 398, 422 ± 426. Polakis P. (1999). Curr.Opin.Genet.Dev.,9, 15 ± 21. Treier M, Staszewski LM and Bohmann D. (1994). Cell, 78, Rubinfeld B, Souza B, Albert I, Munemitsu S and Polakis P. 787 ± 798. (1995). J. Biol. Chem., 270, 5549 ± 5555. van de Wetering M, Cavallo R, Dooijes D, van Beest M, van Rubinfeld B, Albert I, Por®ri E, Fiol C, Munemitsu S and Es J, Loureiro J, Ypma AHD, Jones T, Bejsovec A, Peifer Polakis P. (1996). Science, 272, 1023 ± 1026. M, Mortin M and Clevers H. (1997). Cell, 88, 789 ± 799. Rubinfeld B, Robbins P, El-Gamil M, Albert I, Por®ri E and Voeller H, Truica CI and Gelmann EP. (1998). Cancer Res., Polakis P. (1997). Science, 275, 1790 ± 1792. 58, 2520 ± 2523. Ruiz P, Brinkmann V, Ledermann B, Behrend M, Grund C, Winston JT, Strack P, Beer-Romero P, Chu CY, Elledge SJ ThalhammerC,VogelF,BirchmeierC,GunthertU, and Harper JW. (1999). Genes Dev., 13, 270 ± 283. Franke WW and Birchmeier W. (1996). J. Cell. Biol., 135, Wodarz A and Nusse R. (1998). Annu. Rev. Cell. Dev. Biol., 215 ± 225. 14, 59 ± 88. Sadot E, Simcha I, Shtutman M, Ben-Ze'ev A and Geiger B. Yamamoto H, Kishida S, Uochi T, Ikeda S, Koyama S, (1998). Proc. Natl. Acad. Sci. USA, 95, 15339 ± 15344. Asashima M and Kikuchi A. (1998). Mol. Cell. Biol., 18, Salomon D, Sacco PA, Guha-Roy S, Simcha I, Johnson KR, 2867 ± 2875. Wheelock MJ and Ben-Ze'ev A. (1997). J. Cell. Biol., 139, YaronA,HatzubaiA,DavisM,LavonI,AmitS,Manning 1325 ± 1335. AM, Andersen JS, Mann M, Mercurio F and Ben-Neriah Sanson B, White P and Vincent J. (1996). Nature, 383, 627 ± Y. (1998). Nature, 396, 590 ± 594. 630. Yost C, Torres M, Miller J, Huang E, Kimelman D and Shtutman M, Zhurinsky J, Simcha I, Albanese C, D'Amico Moon R. (1996). Genes Dev., 10, 1443 ± 1454. M, Pestell R and Ben-Ze'ev A. (1999). Proc. Natl. Acad. Zeng L, Fagotto F, Zhang T, Hsu W, Vasicek T, Perry W, Sci. USA, 96, 5522 ± 5527. Lee J, Tilghman S, Gumbiner B and Costantini F. (1997). Simcha I, Geiger B, Yehuda-Levenberg S, Salomon D and Cell, 90, 181 ± 192. Ben-Ze'ev A. (1996). J. Cell. Biol., 133, 199 ± 209. Zhou P and Howley. (1998). Mol. Cell., 2, 571 ± 580. Simcha I, Shtutman M, Salomon D, Zhurinsky J, Sadot E, Zurawel R, Chiappa SA, Alle C and Ra€el C. (1998). Cancer Geiger B and Ben-Ze'ev A. (1998). J. Cell. Biol., 141, Res., 58, 896 ± 899. 1433 ± 1448. Sommers C, Gelmann EP, Kemler R, Cowin P and Byers SW. (1994). Cancer Res., 54, 3544 ± 3552.

Oncogene