Priority Report The Threshold Level of Adenomatous Polyposis Coli Protein for Mouse Intestinal Tumorigenesis Qin Li,1 Tomo-o Ishikawa,1,2 Masanobu Oshima,1 and Makoto M. Taketo1 1Department of Pharmacology, Graduate School of Medicine, Kyoto University, Kyoto, Japan and 2Department of Pharmacology, David Geffen School of Medicine, University of California at Los Angeles, Los Angeles, California Abstract coding region are lacking in some intestinal tumors with The adenomatous polyposis coli (APC) gene, whose mutations significantly reduced APC levels (5). are responsible for familial adenomatous polyposis, is a major Several lines of Apc mutant mice have been established as B models for intestinal polyposis. Interestingly, they develop negative controller of the Wnt/ -catenin pathway. To inves- D716 f tigate the dose-dependent effects of APC protein in suppress- different tumor numbers. Apc form 300 polyps, whereas ApcMin and Apc1638N develop f30 and f3, respectively (6–8). In ing intestinal tumorigenesis, we constructed mutant mice neoR carrying hypomorphic Apc alleles ApcneoR and ApcneoF whose contrast, Apc is a hypomorphic allele whose expression is attenuated to f20% of the wild-type Apc allele (9, 10). Notably, expression levels were reduced to 20% and 10% of the wild neoR type, respectively. Although both hypomorphic heterozygotes heterozygous Apc mice develop very small numbers of intestinal polyps. However, the molecular mechanism has not been developed intestinal polyps, tumor multiplicities were much lower than that in ApcD716 mice, heterozygotes of an Apc null investigated regarding the low polyp multiplicity. To determine the allele. Like in ApcD716 mice, loss of the wild-type Apc allele was dosage effects of the Apc gene activity on suppression of intestinal confirmed for all polyps examined in the ApcneoR and ApcneoF tumorigenesis, we have constructed another hypomorphic Apc allele ApcneoF that expresses even lower level of APC than ApcneoR. mice. In the embryonic stem cells homozygous for these neoF neoR D716 hypomorphic Apc alleles, the level of the APC protein was By comparison of Apc and Apc heterozygotes with Apc B mice, we show that the amount of APC protein is inversely inversely correlated with both the -catenin accumulation and h B-catenin/T-cell factor transcriptional activity. These results correlated with Wnt/ -catenin transcriptional activity that seems suggest that the reduced APC protein level increases intes- to regulate polyp multiplicity. tinal polyp multiplicity through quantitative stimulation of the B-catenin/T-cell factor transcription. We further esti- Materials and Methods mated the threshold of APC protein level that forms one Recombinant embryonic stem cells and animals. Recombinant polyp per mouse as f15% of the wild type. These results also embryonic stem (ES) cells (Apc+/neoF and ApcneoF/neoF) and ApcneoF mice suggest therapeutic implications concerning Wnt signaling were constructed as previously described (9). All Apc mutant strains were inhibitors. (Cancer Res 2005; 65(19): 8622-7) generated in ES cells of 129 strain, and backcrossed to C57BL/6 strain. Backcross generations were >30 for ApcD716, 11 for ApcneoR , and 8 for ApcneoF. Introduction Western blotting and reporter assay. Western blotting for APC and h-catenin, and h-catenin/TCF reporter assay were done as described Germ line mutations in the adenomatous polyposis coli (APC) previously (9). gene are responsible for familial adenomatous polyposis (FAP), Northern blotting. Polyadenylated RNA was extracted from the mouse an inherited autosomal dominant disease characterized by embryos and analyzed in 5 Ag aliquots. Fragments of mouse Apc cDNA development of multiple adenomas in the colon. Mutations in (nucleotides 33-920) and mouse glyceraldehyde-3-phosphate dehydrogenase APC are also detected in the majority of sporadic colon cancer (GAPDH) cDNA were used as probes. and early adenomas (1). The APC protein functions as a tumor Immunohistochemistry. Paraffin-embedded sections (4 Am thick) suppressor through regulation of the unphosphorylated cytoplas- were prepared by a standard method. The ES cells attached to 0.2% mic h-catenin levels (1, 2). In the absence of functional APC, gelatin coated glass chamber were fixed with 4% paraformaldehyde for h-catenin is accumulated in the cytoplasm, resulting in trans- 10 minutes. These specimens were incubated with the primary antibody h location to the nucleus with T-cell factor (TCF), followed by for -catenin (1:500; Sigma, St. Louis, MO) or cyclooxygenase-2 (COX-2; 1:200; Cayman Chemical, Ann Arbor, MI) for 1 hour at room tem- transcriptional activation of the Wnt target genes (1, 2). perature. Activation of Akt was determined using an anti–phospho-Akt Consistent with Knudson’s two-hit principle, both APC alleles antibody (1:50; Cell Signaling, Beverly, MA) as described previously (11). are inactivated in the majority of intestinal tumors (3). However, Immunostaining signals were visualized using Vectastain Elite kit (Vector it has been suggested that mutations in APC gene in FAP Laboratories, Burlingame, CA). To determine the cell proliferation rates, patients do not always follow the two-hit model. For example, sections were stained with an anti–Ki-67 antibody (1:100, MIB-5; reduced levels of APC expression from one allele are found in DAKOCytomation, Carpinteria, CA) as described previously (12). The some FAP patients (4). Moreover, obvious mutations in the APC labeling index for Ki-67 was calculated as the number of positive cells/ 5,000 tumor epithelial cells. Scoring polyps and histologic preparations. The number of polyps was scored as described previously (6). Fixed specimens were stained with 0.5% methylene blue (Sigma-Aldrich, St. Louis, MO). For histologic analyses, Requests for reprints: Makoto M. Taketo, Department of Pharmacology, Graduate formalin-fixed and paraffin-embedded sections were stained with H&E. School of Medicine, Kyoto University, Yoshida-konoe´-cho, Sakyo-ku, Kyoto, Japan. Loss of heterozygosity analysis of the Apc locus. Tumor DNA was Phone: 81-75-753-4391; Fax: 81-75-753-4402; E-mail: [email protected]. I2005 American Association for Cancer Research. isolated from paraffin sections and amplified by PCR as described doi:10.1158/0008-5472.CAN-05-2145 previously (6). Primers used for the wild-type Apc allele were as follows: Cancer Res 2005; 65: (19). October 1, 2005 8622 www.aacrjournals.org Downloaded from cancerres.aacrjournals.org on September 27, 2021. © 2005 American Association for Cancer Research. Tumorigenesis in Hypomorphic Apc Mice Apc-intron13-5V (GCCATACTTTAACACAAGCC) and Apc-intron13-3V found in the ApcD716 mice at 3 months (Table 1). Moreover, the neoF neoR (AAAGGCTGCATGAGAGCACTT). To detect the Apc and Apc alleles, tumor incidence was 50% and 19% in the 15-month-old ApcneoF and primers PR1 (CAGACTGCCTTGGGAAAAGC) paired with Apc-intron13-3V ApcneoR mice, respectively (Table 1), whereas 100% of ApcD716 mice V and Apc-intron13-5 were used, respectively. developed intestinal polyps at 7 weeks of age (6). Small micro- adenomas (<0.5 mm in diameter) that were frequently found in the Results ApcD716 mice under a dissecting microscope were rarely detected in Generation of hypomorphic ApcneoF mice. We have recently ApcneoF and ApcneoR mice (Table 1; ref. 6). generated ApcneoR (i.e., Apc+/neoR , where ‘‘R’’ stands for reverse B-Catenin localization in polyps of respective Apc mutants. orientation) mice by insertion of a PGK-neo cassette into intron Histologically, polyps in both ApcneoF and ApcneoR mice consisted of 13 of Apc gene in the opposite orientation to that of transcription dysplastic adenomas that were similar to those in ApcD716 mice (Fig. 1A, bottom). In this mutant, the decrease in the Apc mRNA (Fig. 2B and C). In the ApcD716 mouse polyps, h-catenin was was likely caused by promoter attenuation due to the loxP-PGK- localized predominantly to nuclei of the adenoma epithelial cells, neo cassette inserted into an enhancer site in intron 13 (9). Here, with some weak staining in the membrane (Fig. 2D and G). In the we constructed ApcneoF (F for forward) allele with the same PGK- polyps of ApcneoF and ApcneoR mice, however, cells with nuclear neo cassette inserted at the same site of Apc, but in the same h-catenin were found only sparsely (Fig. 2E, F, H,andI). orientation as that of transcription (Fig. 1A, top). After Accordingly, h-catenin is less stabilized in the polyps of the confirmation of homologous recombination in ES cells (Fig. 1B), ApcneoF and ApcneoR mice than in those of the ApcD716 mice. we injected the clones into blastocysts and established germ line– Importantly, proliferation of adenoma cells determined by Ki-67 transmitted mutant mice (Fig. 1C). The heterozygous Apc+/neoF labeling index was not much different among the polyps of the mice (hereafter ApcneoF mice) were viable, although homozygous ApcD716, ApcneoF, and ApcneoR mice (Fig. 2J-L, and S). These results ApcneoF/neoF mice were embryonically lethal at f9 days of indicate that the nuclear h-catenin localization is not necessarily gestation (data not shown). The homozygous and heterozygous correlated with adenoma cell proliferation. ApcneoF embryos expressed Apc mRNA at f10% and 55% levels of We have previously shown that induction of COX-2 in the polyp the wild-type, respectively (Fig. 1D), indicating that ApcneoF is a stroma is critical for polyp formation (12, 13). In the polyps of ApcneoF hypomorphic allele similar to ApcneoR. and ApcneoR mice, expression of COX-2 was detected in the luminal Intestinal polyps in ApcneoF and ApcneoR mice. Both ApcneoF side of polyp stroma like in the ApcD716 mice (Fig. 2M-O). We next and ApcneoR mutant strains developed intestinal polyps. However, examined activation of Akt by detection of its phosphorylated form their polyp multiplicities were much lower than that in the ApcD716 because Akt is constitutively activated in stem cells where h-catenin mice (i.e., Apc+/D716; Fig. 2A). Namely, the mean polyp numbers in is accumulated in nuclei (11).