DOCSLIB.ORG

(12) Patent Application Publication (10) Pub. No.: US 2008/0216185 A1 CHESNUT Et Al

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
(12) Patent Application Publication (10) Pub. No.: US 2008/0216185 A1 CHESNUT Et Al US 20080216185A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2008/0216185 A1 CHESNUT et al. (43) Pub. Date: Sep. 4, 2008 (54) COMPOSITIONS AND METHODS FOR Related U.S. Application Data GENETIC MANIPULATION AND (60) Provisional application No. 60/885,843, filed on Jan. MONITORING OF CELL LINES 19, 2007, provisional application No. 60/969,051, (75) Inventors: Jonathan CHESNUT, Carlsbad, filed on Aug. 30, 2007. CA (US); Antje Taliana, Carlsbad, CA (US); Bhaskar Thyagarajan, Publication Classification Temecula, CA (US); Mahendra Rao, Timonium, MD (US); Pauline (51) Int. C. Lieu, San Diego, CA (US); Robert CI2N IS/00 (2006.01) Bennett, Encinitas, CA (US); CI2N 15/87 (2006.01) Robert Burrier, Clarence Center, CI2O I/68 (2006.01) NY (US) (52) U.S. Cl. ................ 800/21: 435/463; 435/6: 435/462 Correspondence Address: INVITROGEN CORPORATION CFO INTELLEVATE (57) ABSTRACT P.O. BOX S2OSO The disclosure relates generally to stem cell biology and more MINNEAPOLIS, MN 55402 (US) specifically to genetic manipulation of stem cells. Methods Assignee: INVITROGEN CORPORATION, and compositions using recombinational cloning techniques (73) are disclosed which allow the construction and insertion of Carlsbad, CA (US) complex genetic constructs into embryonic and adult stem (21) Appl. No.: 12/016,415 cells and progenitor cells. The methods disclosed will allow the harvesting of adult stem cells pre-engineered with inte (22) Filed: Jan. 18, 2008 gration sites to facilitate early passage genetic modification. GENETIC TOOL BOX (ENTRYCLONES) EMBRYONIC STEM CELL INSERT TARGET EXPRESSION VECTOR SITE EMBRYONIC STEM CELL + TARGET SITE BLASTOCYST ENGINEERED PLATFORM EMBRYONIC STEM MOUSE CELL STEM CELL + BLASTOCYST IN VIVO AND IN TARGET SITE VITROUSES ENGINEERED STEM TRAF3.ENGINEERED MOUSE CELL Patent Application Publication Sep. 4, 2008 Sheet 1 of 24 US 2008/0216185 A1 GENETIC TOOL BOX (ENTRYCLONES) EMBRYONIC STEM CELL INSERT TARGET EXPRESSION VECTOR SITE EMBRYONIC STEM CELL + TARGET SITE BLASTOCYST ENGINEERED PLATFORM EMBRYONIC STEM MOUSE CELL TARGETSTEM CELL SITE + BLASTOCYST INY NEN ENGINEERED ENGINEED STEM TRAS3. MOUSE FIG. I. Patent Application Publication Sep. 4, 2008 Sheet 2 of 24 US 2008/0216185 A1 GENETIC TOOL BOX (ENTRY CLONES) INSERT TARGET EXPRESSION VECTOR SITE ADULTSTEM CELL + TARGET SITE ENGINEERED ADULT STEM CELL INVIVO AND INVITRO USES FIG. 2 Patent Application Publication Sep. 4, 2008 Sheet 3 of 24 US 2008/0216185 A1 R3 POS R4 R1 NEG R2 P1 P2 DIFFERENTIATION DIFFERENTIATION PATHWAY PATHWAY NEGATIVE POSITIVE SELECTION SELECTION DETECTION CELL ENRICHFORCELLS EA DETECTION EXPRESSING P2 PROMOTERACTIVITY FIG. 3 Patent Application Publication Sep. 4, 2008 Sheet 4 of 24 US 2008/0216185 A1 PCR T T AMPLIFICATION OF ELEMENT TA CLONING FIG. 4A ATTBSITE PRIMERS (ANNEAL TO VECTOR SEQUENCE) 2 B E O RWARD REVERSE Patent Application Publication Sep. 4, 2008 Sheet 5 of 24 US 2008/0216185 A1 ATTB1 ATTB6 -CH ATTP1 CCDB ATTP6 n a. Y M Y5 L5 DNA L4 4 f 1 L1 DNA1 L6 6 O f LR Cs-d / COMBINATION Patent Application Publication Sep. 4, 2008 Sheet 6 of 24 US 2008/0216185 A1 CTGCTTTTTTGTACAAACTTG attB1 CAGCTTTCTTGTACAAAGTTG attB2 CAACTTTATTATACAAAGTTG attE3 CAACTTTTCTATACAAAGTTG attB4 CAACTTTTGTATACAAAGTTG attB5 CAACTTTTTAATACAAAGTTG attB6 FIG. 5 Patent Application Publication Sep. 4, 2008 Sheet 7 of 24 US 2008/0216185 A1 P3 CCdB P2 CDNA-1 CDNA-2 B1 s B3 B2 MODULARDESTINATION VECTOR BPREACTION2 B1CDNA-1B4 R3 L3CDNA-3 L2 cDNA-3 LRREACTION ) L3 B4 B5 L2 O LRREACTION FIG. 6 Patent Application Publication Sep. 4, 2008 Sheet 8 of 24 US 2008/0216185 A1 EXPRESSION VECTOR LINEAGE SPECIFIC PROMOTER -> os Balsh () --PROMOTER GENOMIC TARGET SITE R4 attP NEO INTEGRATED CONSTRUCT att DNA1 DNA2 DNA3 attr NEO FIG. 7 Patent Application Publication Sep. 4, 2008 Sheet 9 of 24 US 2008/0216185 A1 M13 (40) FORWARD PRIMER M13 (-20) FORWARD PRIMER HSV-TK T7 PRIMER ATTB5 HYG(R) OCT-4 HSVTKpA OCT-4 PROMOTER OR HOKGREAL 9540 bp HOCT4 PROMOTER ATTB1 PHIC31 ATTB FIG. 8 Patent Application Publication Sep. 4, 2008 Sheet 10 of 24 US 2008/0216185 A1 s Patent Application Publication Sep. 4, 2008 Sheet 11 of 24 US 2008/0216185 A1 100 100 75 GFP MEAN = 18.2 GFP MEAN 17.5 50 25 O 10eO 1 Oe1 10e2 10e3 10e4 10eO 10e 1 10e2 10e3 10e4 PM 11 GREEN FLUORESCENCE PM 11 GREEN FLUORESCENCE DAYO DAY 18 100 75 GFP MEAN = 12.9 50 25 10eO 10e 1 10e2 10e3 10e4 PM 11 GREEN FLUORESCENCE DAY 39 FIG. I.0 Patent Application Publication Sep. 4, 2008 Sheet 12 of 24 US 2008/0216185 A1 100 100 CLONED1 EB 75 - ESC 75 1.1% 89.1% GFP POSITIVE 3.4 18.1% PM1 MEAN 50 50 25 25 O O 10eO 10e 1 10e2 10e3 10e4 10eO 10e 1 10e2 10e3 10e4 PM 11 GREEN FLUORESCENCE PM 11 GREEN FLUORESCENCE DAYO DAY 21 FIG. I. I Patent Application Publication Sep. 4, 2008 Sheet 13 of 24 US 2008/0216185 A1 phOct4 at B1 phiC31 attB TRANSFECTION INTO e phiC31INTEGRATION MEDIATED phiC31 attl phiC31 attR gDNA phOct4 GFP TK-HYG-pA AMPgDNA FIG. I2A phiC31 INTEGRASE FIG. I.2B Patent Application Publication Sep. 4, 2008 Sheet 14 of 24 US 2008/0216185 A1 d c. c - d C C D - d d a co - c - d e is e - - - a - - - e - e s s - - - e s - - d. c s - a c s cd c. c - c. cd Ed cd cd - - H H d c d e H. H. H. H. H. C. H. C. H. et H is d co c cd c s ed d d - ) c s c s d d - H re. re. H re. H C H H H H H co e s d e o X s. co e a d - - - - d g g o O - - - - - - r s - - - ) co - - - - c s - - H. H. H. c. cd H. H. cd co C - c. co - H. C. c. H H a sc set is a a CD set H re. H a H H a set \; 9 9 0 y y? y 9 W 9 O W O W 0 0 W 0 €) 9 0 9 W O 9 9 - - - - - a - - d e - - - - e. e. a - - - - - - - - - - e - e. e. e. - C - a - - - - e. e. H - d - d H H H d H D H Cld d cd cd H H d d - d - Co WgI• d g c H d H cd cd a a cd a tag d e. e - d. c. - x - d. c - - d. c ed e - a at a - a a a - - - e. - e. is H at as H at a H. at a H H a as a H is a ?INH sel H H H H e H a se a H H C re C () d e H H re. H H H re. d e a H d e re e d - c e ad a d d c co ed a c. co d H 9 - c. - C - Cup so - c. co - - ) is e - - e - d - d . a e cd a e - e - c e co e a e - e d - a - - O 0 0 O 0 1 0 0 0 | 1 1 1 O 1 y \} 0 0 O O 1 O Patent Application Publication Sep. 4, 2008 Sheet 15 of 24 US 2008/0216185 A1 CA A a ke a N. cro YA1403 EG101 FIG. 14A Patent Application Publication Sep. 4, 2008 Sheet 16 of 24 US 2008/0216185 A1 TOHINOO[L] {{#7I'OIH TOHINOO[L] TOHINOO[L] Patent Application Publication Sep. 4, 2008 Sheet 17 of 24 US 2008/0216185 A1 Patent Application Publication Sep. 4, 2008 Sheet 18 of 24 US 2008/0216185 A1 ESC EB CONTROL 1 10 100 1000 1 10 100 1000 GFP INTENSITY GFPINTENSITY 1 10 100 1000 1 10 100 1000 GFP INTENSITY GFP INTENSITY FIG. I6 Patent Application Publication Sep. 4, 2008 Sheet 19 of 24 US 2008/0216185 A1 uoneiffelülo?uuoueº Patent Application Publication Sep. 4, 2008 Sheet 20 of 24 US 2008/0216185 A1 SERH| Patent Application Publication Sep. 4, 2008 Sheet 21 of 24 US 2008/0216185 A1 SnOOTO?uuoueº Patent Application Publication Sep. 4, 2008 Sheet 22 of 24 US 2008/0216185 A1 8=u(u?uu-xeuu)5OAV IoodLeolud8wdºl Patent Application Publication Patent Application Publication Sep. 4, 2008 Sheet 24 of 24 US 2008/0216185 A1 US 2008/0216.185 A1 Sep. 4, 2008 COMPOSITIONS AND METHODS FOR constructs while in other embodiments, disclosed methods GENETIC MANIPULATION AND allow for rapid assembly of complex genetic constructs. The MONITORING OF CELL LINES present invention also allows for harvesting of cells (e.g., stem cells) pre-engineered with integration sites to facilitate early passage genetic modification. In some embodiments, 0001. This application claims the benefit under 35 U.S.C. harvested cells are stem cells and in further embodiments S 119(e) of Provisional Application Ser. Nos. 60/885,843 cells are harvested from an animal, for example, a rodent Such filed on Jan. 19, 2007, and 60/969,051, filed Aug. 30, 2007, as a mouse. The invention makes use, in part, of site-specific the disclosures of which are hereby incorporated in their recombination sites inserted into the genomes of cells. In entireties by reference. Some aspects, the inserted recombination sites allow for tar geted insertion of nucleic acid molecules, for example com BACKGROUND OF THE INVENTION plex genetic constructs, into the genome of the cell. 0008. Some aspects of the invention employ recombina 0002 1. Field of the Invention tional cloning techniques. These techniques involve, but are 0003. The invention relates generally to cell biology and not limited to, homologous recombination and site specific more specifically to genetic manipulation of cells Such as recombination.
Load more

Recommended publications
  • Genetic Diagnosis and Respiratory Management Of
    UITNODIGING GENETIC DIAGNOSIS Voor het bijwonen van de openbare verdediging van AND RESPIRATORY het proefschrift Genetic diagnosis and respiratory management of primary ciliary dyskinesia dyskinesia ciliary of primary management respiratory and diagnosis Genetic GENETIC DIAGNOSIS MANAGEMENT OF AND RESPIRATORY MANAGEMENT OF PRIMARY CILIARY PRIMARY CILIARY DYSKINESIA DYSKINESIA Door Tamara Paff Tamara Paff dinsdag 7 november 2017 11:45 uur in de aula van de Vrije Universiteit de Boelelaan, 1105 TE Amsterdam Receptie aansluitend in Grand cafe The Basket op de VU campus Tamara Paff Johann Keplerstraat 8-1 hoog 1098 HL, Amsterdam +31645364292/ [email protected] Tamara Paff Tamara | Paranimfen Marian van der Meij [email protected] 06-15500488 Marc van der Schee [email protected] 06-40883602 14759 - Paff_R11,5_OMS_DEF.indd 1 25-09-17 10:25 UITNODIGING GENETIC DIAGNOSIS Voor het bijwonen van de openbare verdediging van AND RESPIRATORY het proefschrift Genetic diagnosis and respiratory management of primary ciliary dyskinesia dyskinesia ciliary of primary management respiratory and diagnosis Genetic GENETIC DIAGNOSIS MANAGEMENT OF AND RESPIRATORY MANAGEMENT OF PRIMARY CILIARY PRIMARY CILIARY DYSKINESIA DYSKINESIA Door Tamara Paff Tamara Paff Dag datum tijdstip in de aula van de Vrije Universiteit de Boelelaan, 1105 TE Amsterdam Receptie aansluitend in Grand cafe The Basket op de VU campus Tamara Paff Johann Keplerstraat 8-1 hoog 1098 HL, Amsterdam +31645364292/ [email protected] Tamara Paff Tamara Paranimfen Marian van der Meij | [email protected] 06-15500488 Marc van der Schee [email protected] 06-40883602 14759_TPaff_BW.indd 1 19-09-17 13:08 ProefschriftTamaraPaff_Cover+Bladwijzer.indd All Pages 15-08-17 12:47 The studies performed in this thesis were financially supported by the PCD support group (PCD belangengroep), Fonds NutsOhra, the “Dutch mudder” team and Chiesi.
    [Show full text]
  • TCTE1 Is a Conserved Component of the Dynein Regulatory Complex and Is Required for Motility and Metabolism in Mouse Spermatozoa
    TCTE1 is a conserved component of the dynein PNAS PLUS regulatory complex and is required for motility and metabolism in mouse spermatozoa Julio M. Castanedaa,b,1, Rong Huac,d,1, Haruhiko Miyatab, Asami Ojib,e, Yueshuai Guoc,d, Yiwei Chengc,d, Tao Zhouc,d, Xuejiang Guoc,d, Yiqiang Cuic,d, Bin Shenc, Zibin Wangc, Zhibin Huc,f, Zuomin Zhouc,d, Jiahao Shac,d, Renata Prunskaite-Hyyrylainena,g,h, Zhifeng Yua,i, Ramiro Ramirez-Solisj, Masahito Ikawab,e,k,2, Martin M. Matzuka,g,i,l,m,n,2, and Mingxi Liuc,d,2 aDepartment of Pathology and Immunology, Baylor College of Medicine, Houston, TX 77030; bResearch Institute for Microbial Diseases, Osaka University, Suita, Osaka 5650871, Japan; cState Key Laboratory of Reproductive Medicine, Nanjing Medical University, Nanjing 210029, People’s Republic of China; dDepartment of Histology and Embryology, Nanjing Medical University, Nanjing 210029, People’s Republic of China; eGraduate School of Pharmaceutical Sciences, Osaka University, Suita, Osaka 5650871, Japan; fAnimal Core Facility of Nanjing Medical University, Nanjing 210029, People’s Republic of China; gCenter for Reproductive Medicine, Baylor College of Medicine, Houston, TX 77030; hFaculty of Biochemistry and Molecular Medicine, University of Oulu, Oulu FI-90014, Finland; iCenter for Drug Discovery, Baylor College of Medicine, Houston, TX 77030; jWellcome Trust Sanger Institute, Hinxton CB10 1SA, United Kingdom; kThe Institute of Medical Science, The University of Tokyo, Minato-ku, Tokyo 1088639, Japan; lDepartment of Molecular and Cellular Biology, Baylor College of Medicine, Houston, TX 77030; mDepartment of Molecular and Human Genetics, Baylor College of Medicine, Houston, TX 77030; and nDepartment of Pharmacology, Baylor College of Medicine, Houston, TX 77030 Contributed by Martin M.
    [Show full text]
  • Whole Genome Sequencing of Familial Non-Medullary Thyroid Cancer Identifies Germline Alterations in MAPK/ERK and PI3K/AKT Signaling Pathways
    biomolecules Article Whole Genome Sequencing of Familial Non-Medullary Thyroid Cancer Identifies Germline Alterations in MAPK/ERK and PI3K/AKT Signaling Pathways Aayushi Srivastava 1,2,3,4 , Abhishek Kumar 1,5,6 , Sara Giangiobbe 1, Elena Bonora 7, Kari Hemminki 1, Asta Försti 1,2,3 and Obul Reddy Bandapalli 1,2,3,* 1 Division of Molecular Genetic Epidemiology, German Cancer Research Center (DKFZ), D-69120 Heidelberg, Germany; [email protected] (A.S.); [email protected] (A.K.); [email protected] (S.G.); [email protected] (K.H.); [email protected] (A.F.) 2 Hopp Children’s Cancer Center (KiTZ), D-69120 Heidelberg, Germany 3 Division of Pediatric Neurooncology, German Cancer Research Center (DKFZ), German Cancer Consortium (DKTK), D-69120 Heidelberg, Germany 4 Medical Faculty, Heidelberg University, D-69120 Heidelberg, Germany 5 Institute of Bioinformatics, International Technology Park, Bangalore 560066, India 6 Manipal Academy of Higher Education (MAHE), Manipal, Karnataka 576104, India 7 S.Orsola-Malphigi Hospital, Unit of Medical Genetics, 40138 Bologna, Italy; [email protected] * Correspondence: [email protected]; Tel.: +49-6221-42-1709 Received: 29 August 2019; Accepted: 10 October 2019; Published: 13 October 2019 Abstract: Evidence of familial inheritance in non-medullary thyroid cancer (NMTC) has accumulated over the last few decades. However, known variants account for a very small percentage of the genetic burden. Here, we focused on the identification of common pathways and networks enriched in NMTC families to better understand its pathogenesis with the final aim of identifying one novel high/moderate-penetrance germline predisposition variant segregating with the disease in each studied family.
    [Show full text]
  • PCM1 Is Necessary for Focal Ciliary Integrity and Is a Candidate for Severe Schizophrenia
    ARTICLE https://doi.org/10.1038/s41467-020-19637-5 OPEN PCM1 is necessary for focal ciliary integrity and is a candidate for severe schizophrenia Tanner O. Monroe 1,2, Melanie E. Garrett3, Maria Kousi4, Ramona M. Rodriguiz5,6, Sungjin Moon7, Yushi Bai8, Steven C. Brodar8, Karen L. Soldano3, Jeremiah Savage9, Thomas F. Hansen10,11, Donna M. Muzny12,13, Richard A. Gibbs12,13, Lawrence Barak8, Patrick F. Sullivan14,15,16, Allison E. Ashley-Koch 3, ✉ Akira Sawa 17,18,19,20, William C. Wetsel 5,6,8,21, Thomas Werge 10,11,22,23 & Nicholas Katsanis 1,2 1234567890():,; The neuronal primary cilium and centriolar satellites have functions in neurogenesis, but little is known about their roles in the postnatal brain. We show that ablation of pericentriolar material 1 in the mouse leads to progressive ciliary, anatomical, psychomotor, and cognitive abnormalities. RNAseq reveals changes in amine- and G-protein coupled receptor pathways. The physiological relevance of this phenotype is supported by decreased available dopamine D2 receptor (D2R) levels and the failure of antipsychotic drugs to rescue adult behavioral defects. Immunoprecipitations show an association with Pcm1 and D2Rs. Finally, we sequence PCM1 in two human cohorts with severe schizophrenia. Systematic modeling of all discovered rare alleles by zebrafish in vivo complementation reveals an enrichment for pathogenic alleles. Our data emphasize a role for the pericentriolar material in the postnatal brain, with progressive degenerative ciliary and behavioral phenotypes; and they support a contributory role for PCM1 in some individuals diagnosed with schizophrenia. 1 Department of Pediatrics, Northwestern University Feinberg School of Medicine, Chicago, IL 60611, USA.
    [Show full text]
  • Attractor Molecular Signatures and Their Applications for Prognostic Biomarkers Wei-Yi Cheng
    Attractor Molecular Signatures and Their Applications for Prognostic Biomarkers Wei-Yi Cheng Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy of the Graduate School of Arts and Science COLUMBIA UNIVERSITY 2014 c 2013 Wei-Yi Cheng All rights reserved ABSTRACT Attractor Molecular Signatures and Their Applications for Prognostic Biomarkers Wei-Yi Cheng This dissertation presents a novel data mining algorithm identifying molecular sig- natures, called attractor metagenes, from large biological data sets. It also presents a computational model for combining such signatures to create prognostic biomarkers. Us- ing the algorithm on multiple cancer data sets, we identified three such gene co-expression signatures that are present in nearly identical form in different tumor types represent- ing biomolecular events in cancer, namely mitotic chromosomal instability, mesenchymal transition, and lymphocyte infiltration. A comprehensive experimental investigation us- ing mouse xenograft models on the mesenchymal transition attractor metagene showed that the signature was expressed in the human cancer cells, but not in the mouse stroma. The attractor metagenes were used to build the winning model of a breast cancer prog- nosis challenge. When applied on larger data sets from 12 different cancer types from The Cancer Genome Atlas \Pan-Cancer" project, the algorithm identified additional pan-cancer molecular signatures, some of which involve methylation sites, microRNA expression, and protein activity. Contents List of Figures iv List of Tables vi 1 Introduction 1 1.1 Background . 1 1.2 Previous Work on Identifying Cancer-Related Gene Signatures . 3 1.3 Contributions of the Thesis . 9 2 Attractor Metagenes 11 2.1 Derivation of an Attractor Metagene .
    [Show full text]
  • Nº Ref Uniprot Proteína Péptidos Identificados Por MS/MS 1 P01024
    Document downloaded from http://www.elsevier.es, day 26/09/2021. This copy is for personal use. Any transmission of this document by any media or format is strictly prohibited. Nº Ref Uniprot Proteína Péptidos identificados 1 P01024 CO3_HUMAN Complement C3 OS=Homo sapiens GN=C3 PE=1 SV=2 por 162MS/MS 2 P02751 FINC_HUMAN Fibronectin OS=Homo sapiens GN=FN1 PE=1 SV=4 131 3 P01023 A2MG_HUMAN Alpha-2-macroglobulin OS=Homo sapiens GN=A2M PE=1 SV=3 128 4 P0C0L4 CO4A_HUMAN Complement C4-A OS=Homo sapiens GN=C4A PE=1 SV=1 95 5 P04275 VWF_HUMAN von Willebrand factor OS=Homo sapiens GN=VWF PE=1 SV=4 81 6 P02675 FIBB_HUMAN Fibrinogen beta chain OS=Homo sapiens GN=FGB PE=1 SV=2 78 7 P01031 CO5_HUMAN Complement C5 OS=Homo sapiens GN=C5 PE=1 SV=4 66 8 P02768 ALBU_HUMAN Serum albumin OS=Homo sapiens GN=ALB PE=1 SV=2 66 9 P00450 CERU_HUMAN Ceruloplasmin OS=Homo sapiens GN=CP PE=1 SV=1 64 10 P02671 FIBA_HUMAN Fibrinogen alpha chain OS=Homo sapiens GN=FGA PE=1 SV=2 58 11 P08603 CFAH_HUMAN Complement factor H OS=Homo sapiens GN=CFH PE=1 SV=4 56 12 P02787 TRFE_HUMAN Serotransferrin OS=Homo sapiens GN=TF PE=1 SV=3 54 13 P00747 PLMN_HUMAN Plasminogen OS=Homo sapiens GN=PLG PE=1 SV=2 48 14 P02679 FIBG_HUMAN Fibrinogen gamma chain OS=Homo sapiens GN=FGG PE=1 SV=3 47 15 P01871 IGHM_HUMAN Ig mu chain C region OS=Homo sapiens GN=IGHM PE=1 SV=3 41 16 P04003 C4BPA_HUMAN C4b-binding protein alpha chain OS=Homo sapiens GN=C4BPA PE=1 SV=2 37 17 Q9Y6R7 FCGBP_HUMAN IgGFc-binding protein OS=Homo sapiens GN=FCGBP PE=1 SV=3 30 18 O43866 CD5L_HUMAN CD5 antigen-like OS=Homo
    [Show full text]
  • Evolution and Diversity of Copy Number Variation in the Great Ape Lineage
    Downloaded from genome.cshlp.org on September 24, 2021 - Published by Cold Spring Harbor Laboratory Press Evolution and diversity of copy number variation in the great ape lineage Peter H. Sudmant1, John Huddleston1,7, Claudia R. Catacchio2, Maika Malig1, LaDeana W. Hillier3, Carl Baker1, Kiana Mohajeri1, Ivanela Kondova4, Ronald E. Bontrop4, Stephan Persengiev4, Francesca Antonacci2, Mario Ventura2, Javier Prado-Martinez5, Tomas 5,6 1,7 Marques-Bonet , and Evan E. Eichler 1. Department of Genome Sciences, University of Washington, Seattle, WA, USA 2. University of Bari, Bari, Italy 3. The Genome Institute, Washington University School of Medicine, St. Louis, MO, USA 4. Department of Comparative Genetics, Biomedical Primate Research Centre, Rijswijk, The Netherlands 5. Institut de Biologia Evolutiva, (UPF-CSIC) Barcelona, Spain 6. Institució Catalana de Recerca i Estudis Avançats (ICREA), Barcelona, Spain 7. Howard Hughes Medical Institute, University of Washington, Seattle, WA, USA Correspondence to: Evan Eichler Department of Genome Sciences University of Washington School of Medicine Foege S-413A, Box 355065 3720 15th Ave NE Seattle, WA 98195 E-mail: [email protected] 1 Downloaded from genome.cshlp.org on September 24, 2021 - Published by Cold Spring Harbor Laboratory Press ABSTRACT Copy number variation (CNV) contributes to the genetic basis of disease and has significantly restructured the genomes of humans and great apes. The diversity and rate of this process, however, has not been extensively explored among the great ape lineages. We analyzed 97 deeply sequenced great ape and human genomes and estimate that 16% (469 Mbp) of the hominid genome has been affected by recent copy number changes.
    [Show full text]
  • Investigation of Gene Splicing Variants Contributing Risk to Psychiatric Disorders
    Investigation of Gene Splicing Variants Contributing Risk to Psychiatric Disorders by Emma Reble A thesis submitted in conformity with the requirements for the degree of Master of Science Institute of Medical Science University of Toronto © Copyright by Emma Reble 2017 Investigation of Gene Splicing Variants Contributing Risk to Psychiatric Disorders Emma Reble Master of Science Institute of Medical Science University of Toronto 2017 Abstract The majority of the variants found through genome-wide association studies (GWAS) to be associated with psychiatric disorders are not found to cause a protein coding change, therefore it is predicted that these variants are causing gene expression changes, including changes to alternative splicing. Datasets of variants associated with alternative splicing changes in the general population have also been curated with the aim of aiding the search for functional GWAS variants. This study uses these datasets to identify variants associated with alternatively spliced isoforms in schizophrenia and bipolar disorder. Alternatively spliced isoforms in four genes (APOPT1, AS3MT, NEK4 and RPGRIP1L) were identified that converge on the mitochondria and cilia, implicating these cellular structures in psychiatric disease and providing avenues of genes and pathways for further study. A method to study alternative splicing changes in psychiatric disorders is presented that would also be a useful tool for studying other complex genetic disorders. ii Table of Contents Table of Contents ............................................................................................................
    [Show full text]
  • NIH Public Access Author Manuscript J Bone Miner Res
    NIH Public Access Author Manuscript J Bone Miner Res. Author manuscript; available in PMC 2015 July 01. NIH-PA Author ManuscriptPublished NIH-PA Author Manuscript in final edited NIH-PA Author Manuscript form as: J Bone Miner Res. 2014 July ; 29(7): 1619–1626. doi:10.1002/jbmr.2195. High-Resolution Genome Screen for Bone Mineral Density in Heterogeneous Stock Rat Imranul Alama, Daniel L. Kollerb, Toni Cañeted, Gloria Blázquezd, Regina López-Aumatellc, Esther Martínez-Membrivesd, Sira Díaz-Moránd, Adolf Tobeñad, Alberto Fernández-Terueld, Pernilla Stridhe, Margarita Dieze, Tomas Olssone, Martina Johannessone, Amelie Baudc, Michael J. Econsa,b, and Tatiana Forouda,b aMedicine, Indiana University School of Medicine, IN, USA bMedical and Molecular Genetics, Indiana University School of Medicine, IN, USA cWellcome Trust Center for Human Genetics, Oxford OX3 7BN, United Kingdom dDepartment of Psychiatry and Forensic Medicine, Institute of Neurosciences, School of Medicine, Universitat Autònoma deBarcelona, 08193-Bellaterra, Barcelona, Spain eClinical Neuroscience, Center for Molecular Medicine, Neuroimmunolgy Unit, Karolinska Institutet, S171 76 Stockholm, Sweden Abstract We previously demonstrated that skeletal mass, structure and biomechanical properties vary considerably in heterogeneous stock (HS) rat strains. In addition, we observed strong heritability for several of these skeletal phenotypes in the HS rat model, suggesting that it represents a unique genetic resource for dissecting the complex genetics underlying bone fragility. The purpose of this study was to identify and localize genes associated with bone mineral density in HS rats. We measured bone phenotypes from 1524 adult male and female HS rats between 17 to 20 weeks of age. Phenotypes included DXA measurements for bone mineral content and areal bone mineral density for femur and lumbar spine (L3-5), and volumetric BMD measurements by CT for the midshaft and distal femur, femur neck and 5th lumbar vertebra.
    [Show full text]
  • HER2 Is Not a Cancer Subtype but Rather a Pan-Cancer Event and Is Highly Enriched in AR-Driven Breast Tumors Anneleen Daemen* and Gerard Manning*
    Daemen and Manning Breast Cancer Research (2018) 20:8 DOI 10.1186/s13058-018-0933-y RESEARCHARTICLE Open Access HER2 is not a cancer subtype but rather a pan-cancer event and is highly enriched in AR-driven breast tumors Anneleen Daemen* and Gerard Manning* Abstract Background: Approximately one in five breast cancers are driven by amplification and overexpression of the human epidermal growth factor receptor 2 (HER2) receptor kinase, and HER2-enriched (HER2E) is one of four major transcriptional subtypes of breast cancer. We set out to understand the genomics of HER2 amplification independent of subtype, and the underlying drivers and biology of HER2E tumors. Methods: We investigated published genomic data from 3155 breast tumors and 5391 non-breast tumors. Results: HER2 amplification is a distinct driver event seen in all breast cancer subtypes, rather than a subtype marker, with major characteristics restricted to amplification and overexpression of HER2 and neighboring genes. The HER2E subtype has a distinctive transcriptional landscape independent of HER2A that reflects androgen receptor signaling as replacement for estrogen receptor (ER)-driven tumorigenesis. HER2 amplification is also an event in 1.8% of non-breast tumors. Conclusions: These discoveries reveal therapeutic opportunities for combining anti-HER2 therapy with anti-androgen agents in breast cancer, and highlight the potential for broader therapeutic use of HER2 inhibitors. Keywords: Breast cancer, Cancer, Amplification, ERBB2, Genomic characterization, PAM50, Molecular apocrine, HER2- targeted treatment Background based on copy number and transcriptional profiling are Transcriptional profiling has enabled the classification of the 10 integrative clusters (IntClusts), with distinct copy many cancers into distinct gene expression subtypes, number profiles and genomic drivers, and with HER2+ allowing improved diagnosis and treatment selection.
    [Show full text]
  • Table S1. 103 Ferroptosis-Related Genes Retrieved from the Genecards
    Table S1. 103 ferroptosis-related genes retrieved from the GeneCards. Gene Symbol Description Category GPX4 Glutathione Peroxidase 4 Protein Coding AIFM2 Apoptosis Inducing Factor Mitochondria Associated 2 Protein Coding TP53 Tumor Protein P53 Protein Coding ACSL4 Acyl-CoA Synthetase Long Chain Family Member 4 Protein Coding SLC7A11 Solute Carrier Family 7 Member 11 Protein Coding VDAC2 Voltage Dependent Anion Channel 2 Protein Coding VDAC3 Voltage Dependent Anion Channel 3 Protein Coding ATG5 Autophagy Related 5 Protein Coding ATG7 Autophagy Related 7 Protein Coding NCOA4 Nuclear Receptor Coactivator 4 Protein Coding HMOX1 Heme Oxygenase 1 Protein Coding SLC3A2 Solute Carrier Family 3 Member 2 Protein Coding ALOX15 Arachidonate 15-Lipoxygenase Protein Coding BECN1 Beclin 1 Protein Coding PRKAA1 Protein Kinase AMP-Activated Catalytic Subunit Alpha 1 Protein Coding SAT1 Spermidine/Spermine N1-Acetyltransferase 1 Protein Coding NF2 Neurofibromin 2 Protein Coding YAP1 Yes1 Associated Transcriptional Regulator Protein Coding FTH1 Ferritin Heavy Chain 1 Protein Coding TF Transferrin Protein Coding TFRC Transferrin Receptor Protein Coding FTL Ferritin Light Chain Protein Coding CYBB Cytochrome B-245 Beta Chain Protein Coding GSS Glutathione Synthetase Protein Coding CP Ceruloplasmin Protein Coding PRNP Prion Protein Protein Coding SLC11A2 Solute Carrier Family 11 Member 2 Protein Coding SLC40A1 Solute Carrier Family 40 Member 1 Protein Coding STEAP3 STEAP3 Metalloreductase Protein Coding ACSL1 Acyl-CoA Synthetase Long Chain Family Member 1 Protein
    [Show full text]
  • The Role of 3D Human Genome Architecture in Mutability – from Predicting Penetrance/Gene Fusions to Discovering Novel Schizophrenia- Associated Variants
    The Role of 3D Human Genome Architecture in Mutability – From Predicting Penetrance/Gene Fusions to Discovering Novel Schizophrenia- Associated Variants A thesis by Daniel Buxton submitted in partial fulfilment of the requirements of Nottingham Trent University for the degree of Doctor of Philosophy. Department of Physics & Mathematics Nottingham Trent University December 2017. © Daniel Buxton, 2017. ii Declaration I hereby declare that the dissertation submitted for the degree of Doctor of Philosophy in Bioinformatics on “the role of 3D human genome architecture in mutability – from predicting penetrance/gene fusions to discovering novel schizophrenia-associated variants” at Nottingham Trent University, is my own original work and has not previously been submitted to any institution or university, or quoted as indicated and acknowledged by means of a comprehensive list of references. Copyright Statement This work is the intellectual property of the author. You may copy up to 5% of this work for private study, or personal, non-commercial research. Any re-use of the information contained within this document should be fully referenced, quoting the author, title, university, degree level and pagination. Queries or requests for any other use, or if a more substantial copy is required, should be directed in the owner(s) of the Intellectual Property Rights. iii iv Acknowledgements I would like to express gratitude to my supervisor, Professor Nadia Chuzhanova, for her invaluable guidance and support during my PhD studies. My journey has been full of new experiences and challenges, and I am grateful to have had a supervisor that was more than willing to help me through each step.
    [Show full text]