![(12) Patent Application Publication (10) Pub. No.: US 2008/0216185 A1 CHESNUT Et Al](https://data.docslib.org/img/3a60ab92a6e30910dab9bd827208bcff-1.webp)
US 20080216185A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2008/0216185 A1 CHESNUT et al. (43) Pub. Date: Sep. 4, 2008 (54) COMPOSITIONS AND METHODS FOR Related U.S. Application Data GENETIC MANIPULATION AND (60) Provisional application No. 60/885,843, filed on Jan. MONITORING OF CELL LINES 19, 2007, provisional application No. 60/969,051, (75) Inventors: Jonathan CHESNUT, Carlsbad, filed on Aug. 30, 2007. CA (US); Antje Taliana, Carlsbad, CA (US); Bhaskar Thyagarajan, Publication Classification Temecula, CA (US); Mahendra Rao, Timonium, MD (US); Pauline (51) Int. C. Lieu, San Diego, CA (US); Robert CI2N IS/00 (2006.01) Bennett, Encinitas, CA (US); CI2N 15/87 (2006.01) Robert Burrier, Clarence Center, CI2O I/68 (2006.01) NY (US) (52) U.S. Cl. ................ 800/21: 435/463; 435/6: 435/462 Correspondence Address: INVITROGEN CORPORATION CFO INTELLEVATE (57) ABSTRACT P.O. BOX S2OSO The disclosure relates generally to stem cell biology and more MINNEAPOLIS, MN 55402 (US) specifically to genetic manipulation of stem cells. Methods Assignee: INVITROGEN CORPORATION, and compositions using recombinational cloning techniques (73) are disclosed which allow the construction and insertion of Carlsbad, CA (US) complex genetic constructs into embryonic and adult stem (21) Appl. No.: 12/016,415 cells and progenitor cells. The methods disclosed will allow the harvesting of adult stem cells pre-engineered with inte (22) Filed: Jan. 18, 2008 gration sites to facilitate early passage genetic modification. GENETIC TOOL BOX (ENTRYCLONES) EMBRYONIC STEM CELL INSERT TARGET EXPRESSION VECTOR SITE EMBRYONIC STEM CELL + TARGET SITE BLASTOCYST ENGINEERED PLATFORM EMBRYONIC STEM MOUSE CELL STEM CELL + BLASTOCYST IN VIVO AND IN TARGET SITE VITROUSES ENGINEERED STEM TRAF3.ENGINEERED MOUSE CELL Patent Application Publication Sep. 4, 2008 Sheet 1 of 24 US 2008/0216185 A1 GENETIC TOOL BOX (ENTRYCLONES) EMBRYONIC STEM CELL INSERT TARGET EXPRESSION VECTOR SITE EMBRYONIC STEM CELL + TARGET SITE BLASTOCYST ENGINEERED PLATFORM EMBRYONIC STEM MOUSE CELL TARGETSTEM CELL SITE + BLASTOCYST INY NEN ENGINEERED ENGINEED STEM TRAS3. MOUSE FIG. I. Patent Application Publication Sep. 4, 2008 Sheet 2 of 24 US 2008/0216185 A1 GENETIC TOOL BOX (ENTRY CLONES) INSERT TARGET EXPRESSION VECTOR SITE ADULTSTEM CELL + TARGET SITE ENGINEERED ADULT STEM CELL INVIVO AND INVITRO USES FIG. 2 Patent Application Publication Sep. 4, 2008 Sheet 3 of 24 US 2008/0216185 A1 R3 POS R4 R1 NEG R2 P1 P2 DIFFERENTIATION DIFFERENTIATION PATHWAY PATHWAY NEGATIVE POSITIVE SELECTION SELECTION DETECTION CELL ENRICHFORCELLS EA DETECTION EXPRESSING P2 PROMOTERACTIVITY FIG. 3 Patent Application Publication Sep. 4, 2008 Sheet 4 of 24 US 2008/0216185 A1 PCR T T AMPLIFICATION OF ELEMENT TA CLONING FIG. 4A ATTBSITE PRIMERS (ANNEAL TO VECTOR SEQUENCE) 2 B E O RWARD REVERSE Patent Application Publication Sep. 4, 2008 Sheet 5 of 24 US 2008/0216185 A1 ATTB1 ATTB6 -CH ATTP1 CCDB ATTP6 n a. Y M Y5 L5 DNA L4 4 f 1 L1 DNA1 L6 6 O f LR Cs-d / COMBINATION Patent Application Publication Sep. 4, 2008 Sheet 6 of 24 US 2008/0216185 A1 CTGCTTTTTTGTACAAACTTG attB1 CAGCTTTCTTGTACAAAGTTG attB2 CAACTTTATTATACAAAGTTG attE3 CAACTTTTCTATACAAAGTTG attB4 CAACTTTTGTATACAAAGTTG attB5 CAACTTTTTAATACAAAGTTG attB6 FIG. 5 Patent Application Publication Sep. 4, 2008 Sheet 7 of 24 US 2008/0216185 A1 P3 CCdB P2 CDNA-1 CDNA-2 B1 s B3 B2 MODULARDESTINATION VECTOR BPREACTION2 B1CDNA-1B4 R3 L3CDNA-3 L2 cDNA-3 LRREACTION ) L3 B4 B5 L2 O LRREACTION FIG. 6 Patent Application Publication Sep. 4, 2008 Sheet 8 of 24 US 2008/0216185 A1 EXPRESSION VECTOR LINEAGE SPECIFIC PROMOTER -> os Balsh () --PROMOTER GENOMIC TARGET SITE R4 attP NEO INTEGRATED CONSTRUCT att DNA1 DNA2 DNA3 attr NEO FIG. 7 Patent Application Publication Sep. 4, 2008 Sheet 9 of 24 US 2008/0216185 A1 M13 (40) FORWARD PRIMER M13 (-20) FORWARD PRIMER HSV-TK T7 PRIMER ATTB5 HYG(R) OCT-4 HSVTKpA OCT-4 PROMOTER OR HOKGREAL 9540 bp HOCT4 PROMOTER ATTB1 PHIC31 ATTB FIG. 8 Patent Application Publication Sep. 4, 2008 Sheet 10 of 24 US 2008/0216185 A1 s Patent Application Publication Sep. 4, 2008 Sheet 11 of 24 US 2008/0216185 A1 100 100 75 GFP MEAN = 18.2 GFP MEAN 17.5 50 25 O 10eO 1 Oe1 10e2 10e3 10e4 10eO 10e 1 10e2 10e3 10e4 PM 11 GREEN FLUORESCENCE PM 11 GREEN FLUORESCENCE DAYO DAY 18 100 75 GFP MEAN = 12.9 50 25 10eO 10e 1 10e2 10e3 10e4 PM 11 GREEN FLUORESCENCE DAY 39 FIG. I.0 Patent Application Publication Sep. 4, 2008 Sheet 12 of 24 US 2008/0216185 A1 100 100 CLONED1 EB 75 - ESC 75 1.1% 89.1% GFP POSITIVE 3.4 18.1% PM1 MEAN 50 50 25 25 O O 10eO 10e 1 10e2 10e3 10e4 10eO 10e 1 10e2 10e3 10e4 PM 11 GREEN FLUORESCENCE PM 11 GREEN FLUORESCENCE DAYO DAY 21 FIG. I. I Patent Application Publication Sep. 4, 2008 Sheet 13 of 24 US 2008/0216185 A1 phOct4 at B1 phiC31 attB TRANSFECTION INTO e phiC31INTEGRATION MEDIATED phiC31 attl phiC31 attR gDNA phOct4 GFP TK-HYG-pA AMPgDNA FIG. I2A phiC31 INTEGRASE FIG. I.2B Patent Application Publication Sep. 4, 2008 Sheet 14 of 24 US 2008/0216185 A1 d c. c - d C C D - d d a co - c - d e is e - - - a - - - e - e s s - - - e s - - d. c s - a c s cd c. c - c. cd Ed cd cd - - H H d c d e H. H. H. H. H. C. H. C. H. et H is d co c cd c s ed d d - ) c s c s d d - H re. re. H re. H C H H H H H co e s d e o X s. co e a d - - - - d g g o O - - - - - - r s - - - ) co - - - - c s - - H. H. H. c. cd H. H. cd co C - c. co - H. C. c. H H a sc set is a a CD set H re. H a H H a set \; 9 9 0 y y? y 9 W 9 O W O W 0 0 W 0 €) 9 0 9 W O 9 9 - - - - - a - - d e - - - - e. e. a - - - - - - - - - - e - e. e. e. - C - a - - - - e. e. H - d - d H H H d H D H Cld d cd cd H H d d - d - Co WgI• d g c H d H cd cd a a cd a tag d e. e - d. c. - x - d. c - - d. c ed e - a at a - a a a - - - e. - e. is H at as H at a H. at a H H a as a H is a ?INH sel H H H H e H a se a H H C re C () d e H H re. H H H re. d e a H d e re e d - c e ad a d d c co ed a c. co d H 9 - c. - C - Cup so - c. co - - ) is e - - e - d - d . a e cd a e - e - c e co e a e - e d - a - - O 0 0 O 0 1 0 0 0 | 1 1 1 O 1 y \} 0 0 O O 1 O Patent Application Publication Sep. 4, 2008 Sheet 15 of 24 US 2008/0216185 A1 CA A a ke a N. cro YA1403 EG101 FIG. 14A Patent Application Publication Sep. 4, 2008 Sheet 16 of 24 US 2008/0216185 A1 TOHINOO[L] {{#7I'OIH TOHINOO[L] TOHINOO[L] Patent Application Publication Sep. 4, 2008 Sheet 17 of 24 US 2008/0216185 A1 Patent Application Publication Sep. 4, 2008 Sheet 18 of 24 US 2008/0216185 A1 ESC EB CONTROL 1 10 100 1000 1 10 100 1000 GFP INTENSITY GFPINTENSITY 1 10 100 1000 1 10 100 1000 GFP INTENSITY GFP INTENSITY FIG. I6 Patent Application Publication Sep. 4, 2008 Sheet 19 of 24 US 2008/0216185 A1 uoneiffelülo?uuoueº Patent Application Publication Sep. 4, 2008 Sheet 20 of 24 US 2008/0216185 A1 SERH| Patent Application Publication Sep. 4, 2008 Sheet 21 of 24 US 2008/0216185 A1 SnOOTO?uuoueº Patent Application Publication Sep. 4, 2008 Sheet 22 of 24 US 2008/0216185 A1 8=u(u?uu-xeuu)5OAV IoodLeolud8wdºl Patent Application Publication Patent Application Publication Sep. 4, 2008 Sheet 24 of 24 US 2008/0216185 A1 US 2008/0216.185 A1 Sep. 4, 2008 COMPOSITIONS AND METHODS FOR constructs while in other embodiments, disclosed methods GENETIC MANIPULATION AND allow for rapid assembly of complex genetic constructs. The MONITORING OF CELL LINES present invention also allows for harvesting of cells (e.g., stem cells) pre-engineered with integration sites to facilitate early passage genetic modification. In some embodiments, 0001. This application claims the benefit under 35 U.S.C. harvested cells are stem cells and in further embodiments S 119(e) of Provisional Application Ser. Nos. 60/885,843 cells are harvested from an animal, for example, a rodent Such filed on Jan. 19, 2007, and 60/969,051, filed Aug. 30, 2007, as a mouse. The invention makes use, in part, of site-specific the disclosures of which are hereby incorporated in their recombination sites inserted into the genomes of cells. In entireties by reference. Some aspects, the inserted recombination sites allow for tar geted insertion of nucleic acid molecules, for example com BACKGROUND OF THE INVENTION plex genetic constructs, into the genome of the cell. 0008. Some aspects of the invention employ recombina 0002 1. Field of the Invention tional cloning techniques. These techniques involve, but are 0003. The invention relates generally to cell biology and not limited to, homologous recombination and site specific more specifically to genetic manipulation of cells Such as recombination.
Details
-
File Typepdf
-
Upload Time-
-
Content LanguagesEnglish
-
Upload UserAnonymous/Not logged-in
-
File Pages54 Page
-
File Size-