ORIGINAL ARTICLE Pediatric Acute Myeloid Leukemia with NPM1

Pediatric acute myeloid leukemia with NPM1 mutations is characterized by a gene expression proﬁle with dysregulated HOX gene expression distinct from MLL-rearranged leukemias

CG Mullighan, A Kennedy, X Zhou, I Radtke, LA Phillips, SA Shurtleff and JR Downing

Department of Pathology, St Jude Children’s Research Hospital, Memphis, TN, USA

Somatic mutations in nucleophosmin (NPM1) occur in approxi- NPM is also a nucleolar binding partner of p14Arf 17 and through mately 35% of adult acute myeloid leukemia (AML). To assess this interaction regulates the stress-induced activity of p53.18 the frequency of NPM1 mutations in pediatric AML, we sequenced NPM1 in the diagnostic blasts from 93 pediatric NPM1 is disrupted by several translocations in hematopoietic AML patients. Six cases harbored NPM1 mutations, with each malignancies that fuse the N terminus of NPM with partner case lacking common cytogenetic abnormalities. To explore the genes including anaplastic lymphoma kinase in lymphoma phenotype of the AMLs with NPM1 mutations, gene expression (NPM-ALK),19 retinoic acid receptor-a in premyelocytic leuke- profiles were obtained using Affymetrix U133A microarrays. mia (NPM-RARA),20 and myeloid leukemia factor 1 in NPM1 mutations were associated with increased expression of myelodysplasia (NPM-MLF1).21 These translocations appear to multiple homeobox genes including HOXA9, A10, B2, B6 and dysregulate the activity of the fusion partner,22 and translocate MEIS1. As dysregulated homeobox gene expression is also a 16 feature of MLL-rearranged leukemia, the gene expression NPM to the cytoplasm. In addition to these chromosomal 11,23,24 signatures of NPM1-mutated and MLL-rearranged leukemias rearrangements, recent efforts by Falini et al. demons- were compared. Significant differences were identified between trated the presence of mutations that disrupted the C terminus of these leukemia subtypes including the expression of different NPM and result in aberrant cytoplasmic localization of NPM in HOX genes, with NPM1-mutated AML showing higher levels of approximately one-third of cases of adult AML. This finding has expression of HOXB2, B3, B6 and D4. These results confirm recent reports of perturbed HOX expression in NPM1-mutated been validated by others and, collectively, these studies have adult AML, and provide the first evidence that the NPM1- found that NPM1 mutations are associated with older age, mutated signature is distinct from MLL-rearranged AML. These normal karyotype, lack of CD34 expression, monocytic mor- findings suggest that mutated NPM1 leads to dysregulated HOX phology and FLT3 internal tandem duplication mutations.9–14 expression via a different mechanism than MLL rearrangement. NPM1 mutations have also been associated with a favorable Leukemia (2007) 21, 2000–2009; doi:10.1038/sj.leu.2404808; response to induction chemotherapy and superior overall and published online 28 June 2007 event-free survival, at least in patients lacking FLT3 muta- Keywords: leukemia; nucleophosmin; gene expression profiling; 10–13 homeobox; MLL tions. Data in the pediatric setting are more limited, with existing reports suggesting NPM1-mutations are less frequent than in adult AML, and occur predominantly in older patients.25 The mechanisms by which NPM1 mutations contribute to Introduction 26 ARF leukemogenesis are unclear. NPM regulates the p14 -MDM2/ p53 pathway, and the identified NPM1 mutations result in Pediatric de novo acute myeloid leukemia (AML) is a hetero- ARF translocation of NPM and p14 to the cytoplasm, preventing geneous disease that consists of distinct subtypes characterized by 27 the interaction of ARF with Mdm2, the negative regulator of p53. specific genetic lesions. These include the t(15:17), t(8;21) and However, perturbation of ARF function appears insufficient to inv(16) chromosomal translocations, and rearrangement of MLL 27 explain the oncogenic effects of mutant NPM1. Gene expression at 11q23. These chromosomal abnormalities form the basis for a profiling is a powerful tool to investigate the pathogenesis of acute diagnostic classification that is used to risk stratify patients so that 28–30 leukemia. Existing data from NPM1-mutated adult AML have they can be optimally treated.1 Mutations have been identified in identified dysregulated expression of homeobox (HOX) and TALE AML blasts in the RUNX1 (AML1),FLT3, CEBPA, PU.1 and EVI1 13,31 2–8 genes known to be involved in hematopoietic development. genes, some of which influence prognosis. Recent studies in 28,32 This pattern is reminiscent of MLL-rearranged leukemias; adult AML have identified a high frequency of mutations of the however, the signatures of NPM1-mutant and MLL-rearranged nucleophosmin (NPM1) gene in cases that lack recurring leukemias have not been directly compared. cytogenetic abnormalities.9–14 Importantly, the presence of To investigate the importance of NPM1 mutations in pediatric NPM1 mutations has been associated with a favorable outcome. AML, we have investigated a cohort of 93 patients encompass- Nucleophosmin is a widely expressed protein predominantly ing all common diagnostic and cytogenetic subgroups. In located in the nucleolus that continuously shuttles between addition to NPM1 genotyping, gene expression profiling using nucleus and cytoplasm.15,16 Nucleophosmin is involved in Affymetrix U133A microarrays was used to define an expression multiple cellular functions, including ribosomal biogenesis, signature of NPM1-mutated leukemia. centrosomal duplication and maintenance of genomic integrity.

Correspondence: Dr JR Downing, Scientific Director and Chair, Materials and Methods Department of Pathology, St Jude Children’s Research Hospital, 332 N. Lauderdale, Memphis, TN 38105, USA. E-mail: [email protected] Samples Received 30 January 2007; revised 25 April 2007; accepted 14 May Ninety-three patients treated at St Jude Children’s Research 2007; published online 28 June 2007 Hospital from 1981 to 2005 were studied. Informed consent for Gene expression profiling of NPM1-mutated pediatric AML CG Mullighan et al 2001 the use of leukemic cells for research was obtained from with estimation of false discovery rate (FDR, q-value) and patients, parents or guardians in accordance with the Declara- proportion of differentially expressed genes (1Àp0) by the tion of Helsinki, and study approval was obtained from the method of Storey.35,36 Gene expression data were visualized SJCRH Institutional Review Board. The majority of patients were using GeneMaths XT 1.61 (Applied Maths, Austin, TX, USA). To treated on protocols AML80, AML83, AML87, AML91, AML97 define the gene expression signature of NPM1-mutant AML, and AML02.33 The t(15;17) cases were treated on POG9710 or gene expression profiles of NPM1-mutant cases were compared according to best clinical management. with profiles of NPM1-wild-type cases lacking common AML samples were classified according to revised FAB cytogenetic abnormalities (RUNX1-RUNX1T1, CBFB-SMMHC, criteria.34 Purification of mononuclear cells from diagnostic PML-RARA, MLL rearranged) or M7 phenotype, and by marrow (n ¼ 89) or peripheral blood (n ¼ 4) was performed as comparing NPM1-mutant cases with the entire NPM1-wild-type described previously.28 Samples were analyzed by conventional cohort. To compare the signatures of NPM1-mutant and MLL- cytogenetics and reverse–transcription (RT)–PCR for the pre- rearranged AML, the NPM1-mutant signature was defined by sence of PML-RARA, RUNX1-RUNX1T1 (AML1-ETO) and comparing the gene expression profile of NPM1-mutant cases CBFB-SMMHC transcripts. MLL rearrangement was identified with NPM1-wild-type, non-MLL rearranged AML, and the by cytogenetics, 11q23 fluorescence in situ hybridization (FISH) signature of MLL-rearranged AML was defined by comparing and/or RT–PCR for t(9;11)(MLL-AF9, n ¼ 4); t(11;19) (one MLL- MLL cases with non-MLL-rearranged, NPM1-wild-type AML. ENL positive case and two MLL-ELL positive cases confirmed by RT–PCR, and one t(11;19) case confirmed by FISH); one MLL- AF10 positive case (confirmed by RT–PCR); and one case each Quantitative real-time PCR with t(1;11) and t(6;11) (confirmed by FISH). Expression of HOXB2 and HOXB6 was measured in NPM1- mutated (n ¼ 4) and MLL-rearranged (n ¼ 12) samples using Taqman assays-on-demand Hs00609873_g1 (HOXB2) and NPM1 genotyping Hs00255831_s1 (HOXB6) (Applied Biosystems). RNA was Genomic DNA was extracted from cryopreserved mononuclear extracted using TRIzol (Invitrogen), and reverse transcribed cell preparations of diagnostic marrow or blood samples using the using random hexamer primers and Multiscribe Reverse Qiagen DNA blood mini kit (Qiagen, Valencia, CA, USA). Exon Transcriptase (Applied Biosystems). Taqman assays were per- 12 of NPM1 was amplified using Accuprime Pfx DNA polymerase formed using a 7500 real-time PCR system and 7500 System (Invitrogen, Carlsbad, CA, USA) and the primers NPM1-F Software (Applied Biosystems), using the 7500 universal cycling 50-TTAACTCTCTGGTGGTAGAATGAA and NPM1-R 50-CAAG conditions: 501C for 2 min, followed by 951C for 10 min, then ACTATTTGCCATTCCTAAC.11 PCR products were purified and 40 cycles of 951C for 1 min and 601C for 1 min. Standard curves sequenced directly using the NPM1_1112R primer 50-CCTGGA for GAPDH and HOXB2/B6 gene expression were generated CAACATTTATCAAACACGGTA and Big Dye Terminator (v.3.1) from 10-fold serial dilutions of the K562 (HOXB2) and CMK chemistry on 3730xl DNA analyzers (Applied Biosystems, Foster (HOXB6) cell lines (obtained from the Deutsche Sammlung von City, CA, USA). NPM1 mutations were confirmed by cloning PCR Mikroorganismen und Zellkulturen, DSMZ, Braunschweig, products into the pCR 2.1-TOPO vector (Invitrogen) and Germany). These normalized ratios were compared to each performing bidirectional sequencing of multiple clones. other for differences in overall levels of PAX5 expression. Assays were performed in duplicate and mean values reported.

FLT3 mutation detection Genomic DNA of FLT3 exons 14, 15 and 20 corresponding to Statistical analyses the juxtamembrane and tyrosine kinase domains were amplified Pairwise comparisons of patient clinical and laboratory variables using Accuprime Pfx using primers 50-CATTGTCGTT were performed using the Mann–Whitney test (continuous TTAACCCTGCT and 50-CCTTGAAACATGGCAAACAGT (exons variables) and the Fisher’s exact test (categorical variables). The 14/15) and 50-TCCATCACCGGTACCTCCTA and 50-CCATG Kaplan–Meier method was used to estimate the probabilities of ATAACGACACAACACAA (exon 20). PCR products were event-free and overall survival,37 and standard errors were purified and sequenced as described above. determined using the method of Peto and Pike.38 Event-free survival was defined as the time elapsed from study enrollment to first event (remission induction failure, relapse, death or second Gene expression profiling malignancy). When patients did not achieve remission, the event- RNA isolation from diagnostic bone marrow or peripheral blood free survival time was set to zero. Patients who had not yet mononuclear cell suspensions, cDNA and cRNA synthesis, experienced any of these events were censored at last follow-up. labeling, fragmentation, hybridization and scanning of Affy- Overall survival was defined as the time elapsed from study metrix HG-U133A oligonucleotide microarrays were performed enrollment to death, with those still living at last follow-up as described previously.28 Gene expression signals were scaled censored. The exact log-rank test was used to compare the event- to a target intensity of 500, and detection values were free and overall survival of those AML cases with NPM1 mutations determined using the default settings of Affymetrix Microarray to that of the NPM1-wild-type cases. These analyses of clinical Suite 5.0. Quality control criteria for inclusion in the study were features and outcome were not adjusted for multiple testing. greater than 10% present calls, and glyceraldehyde-3-phosphate dehydrogenase and b-actin 30 to 50 signal intensity ratios of p3. The mean present call rate was 3875.7% (range, 20.2–46.8%), Results and the mean glyceraldehyde-3-phosphate dehydrogenase (GAPDH)/actin ratio was 1.04770.335 (range 0.750–2.89) Clinical and laboratory features of NPM1-mutated (Supplementary Table 1). pediatric AML Analysis of differential gene expression was performed by Sequence analysis of exon 12 of NPM1 identified the presence t-test using the R statistical package (http://cran.r-project.org/), of mutations in 6 of the 93 pediatric AML cases analyzed (6.4%)

Leukemia Gene expression profiling of NPM1-mutated pediatric AML CG Mullighan et al 2002 (Tables 1 and 2). The mutations were tetranucleotide insertions Survival analyses did not detect associations between NPM1 at nucleotide position 960 (Genbank accession NM_002520) mutations and outcome, although this may be due to limited and corresponding to the previously described mutation types A, statistical power. The 6-year event-free survival was 55.6726.2 B and D of Falini et al.11 Each mutation led to the replacement and 37.677.2% for those with and without the mutation, of the seven C-terminal amino acids of NPM1 with 11 different respectively (P ¼ 0.186, Table 1). Similarly, the 6-year OS was residues that contained a nuclear export sequence. In each case, 41.7722.5 and 49.777.2% for those with and without the the mutations were heterozygous, and a wild-type NPM1 allele mutation, respectively (P ¼ 0.468). was retained. The clinical and laboratory characteristics of the patients stratified by NPM1 mutation status are shown in Table 1. The median age at diagnosis was significantly higher Gene expression signature of NPM1-mutated AML in patients with NPM1 mutations (14.6 vs 9.7 years, P ¼ 0.045). Unsupervised clustering of AML cases lacking recurring A similar age-dependent distribution of NPM1 mutations has cytogenetic abnormalities (n ¼ 41) was performed using the previously been described in both adult and pediatric AML squared Pearson similarity coefficient and the unweighted pair- cohorts.13,25 NPM1 mutations were only detected in cases of group method using arithmetic averages (UPGMA) clustering AML with normal karyotype (n ¼ 3) or nonrecurring cytogenetic algorithm in GeneMaths XT. This demonstrated partial cluster- anomalies (inv(5), add(17) and trisomy 4). There was no ing of NPM1-mutant cases, with four NPM1-mutated cases significant difference in presentation peripheral blood leukocyte clustering in two groups (Supplementary Figure 1). This suggests counts between NPM1-mutated and wild-type cases. Three of that NPM1 mutations influence, but are not the sole determinant the six NPM1-mutated cases displayed morphologic evidence of of, the overall gene expression profiles of NPM1-mutated AML monocytic differentiation. All cases showed low or absent cases. expression of CD34, and, where measured (n ¼ 4), CD117 and The gene expression signature for NPM1-mutated AML was CD133. One of the six NPM1-mutated cases had an FLT3 defined by comparing the six NPM1-mutant cases with all mutation (Table 2). NPM1-wild-type cases (NPM1-mutated signature 1), and also by

Table 1 Clinical and laboratory features of NPM1-mutated pediatric AML

All cases, n ¼ 93 NPM1-wild type, n ¼ 87 NPM1-mutated, n ¼ 6 P-values

Subgroup t(8;21) 18 (19.4) 18 0 0.592 inv/t(16;16) 13 (14.0) 13 0 0.590 t(15;17) 4 (4.3) 4 0 1.000 MLL rearranged 13 (14.0) 13 0 0.590 M7 4 (4.3) 4 0 1.000 Normal cytogenetics 19 (21.5) 16 3 0.142 Miscellaneous/complex cytogeneticsa 22 (23.7) 19 3 0.126

Gender Male 43 (46.2) 40 3 1.000 Female 50 (53.8) 47 3 1.000

Age at diagnosis (years) Median (range) 10.0 (0–21) 9.7 14.6 0.045 o1 6 6 0 1.000 1–5 17 17 0 0.588 5–10 22 21 1 1.000 410 48 43 5 0.205

WBC at diagnosis Median 36.5 38.0 35.3 0.941

FAB M0 3 3 0 1.000 M1 20 19 1 1.000 M2 23 21 2 0.635 M3 4 4 0 1.000 M4 22 19 3 0.142 M4Eo 3 3 0 1.000 M5 13 13 0 0.590 M6 0 0 0 1.000 M7 4 4 0 1.000 NC 1 1 0 1.000

Outcome CR n (%) 80 (86.0) 74 (85.1) 6 (100) 0.590 6-year EFS (7s.e.) 38.477.1 37.677.2 55.6726.2 0.186 6-year OS (7s.e.) 49.877.1 49.777.2 41.7722.5 0.468 Abbreviations: AML, acute myeloid leukemia; CR, complete remission; EFS, event-free survival; OS, overall survival; NC, not classiﬁed; WBC, peripheral blood leukocyte count. aIncludes three cases with trisomy 8, and two cases with t(6;9)(p23;q34). P-values were not corrected for multiple comparisons.

Leukemia Gene expression proﬁling of NPM1-mutated pediatric AML CG Mullighan et al 2003

/ limiting the comparison group to only those cases without 10 / 8 recurring cytogenetic abnormalities or M7 phenotype (n ¼ 34; 2 NPM1-mutated signature 2). At a FDR threshold of 20%, these analyses identiﬁed 444 probe sets and 412 unique genes

/46,XY differentially expressed in NPM1-mutated signature 1 (308 18 probe sets overexpressed and 136 underexpressed; Supplemen- 15 12 tary Table 2, Supplementary Figure 2), and 237 probe sets and 213 unique genes differentially expressed in NPM1-mutated 46,XX 46,XX signature 2 (152 probe sets overexpressed and 82 underexpressed; Supplementary Table 3, Figure 1 and Supplementary Figure 3). A total of 196 probe sets were shared by both NPM1- mutated signatures (Supplementary Table 4). The majority of the remaining 246 probe sets in the NPM1-mutated signature 1 also showed trends to differential expression in the NPM1-mutant vs he resulting terminal amino acid sequence normal/miscellaneous AML (signature 2) comparison, but did not meet the speciﬁed FDR criterion of 0.2 (125 probe sets with Po0.01 and 0.2oqo0.34; and 105 probe sets with are italicized. 0.01 P 0.1 and 0.34 q 0.64).

39 o o o o Both NPM1-mutated signatures were characterized by dysre- mutations gulated homeobox (HOX) gene expression, including increased expression of HOXA2, A5, A6, A7, A10, B2, B3 and B6, and reduced expression of HOXC4. Increased expression of HOXD4 NPM1 was also observed in NPM1-mutated signature 1. Expression of all HOX U133A probe sets is shown in Figure 2. NPM1-mutant cases also exhibited upregulation of the TALE homeodomain proteins MEIS1 (myeloid ecotropic viral integration site 1 homolog) and PBX3, and reduced expression of CD7, CD34, b status CD34 (%) CD117 (%) CD133 (%) Karyotype GAS6 (growth arrest-speciﬁc 6), the TGF regulatory gene LTBP4, and the putative tumor suppressor NBL1.

FLT3 The increased expression of members of the HOX gene family was reminiscent of acute leukemia with rearrangements of the MLL gene.32 To compare formally the signatures of NPM1- mutated and MLL-rearranged pediatric AML, we deﬁned an expression signature for MLL-rearranged leukemia by comparing

internal tandem duplication; ND, not done; WT, wild type. the proﬁles of MLL rearranged cases (n ¼ 13) to all MLL-wild- type cases (MLL signature 1; 744 differentially expressed probe

FLT3 sets at FDR ¼ 5%, Supplementary Table 5), and to MLL-wild- ...... type, NPM1-wild-type cases (MLL signature 2; 838 probe sets at FDR ¼ 5%, Supplementary Table 6). Both signatures were characterized by increased expression of HOXA4, A5, A6, A7, RK RK RK RK RK RK A9, A10, B9 and MEIS1, and reduced expression of HOXB2 L L L L L L (Supplementary Tables 5 and 6). To compare the gene S S S S S S expression proﬁles of NPM1-mutated and MLL-rearranged V V V V V V AML, we deﬁned a gene expression signature of NPM1-mutant AML excluding MLL-rearranged cases from the analysis (NPM1 status, karyotype and immunophenotype in pediatric AML cases with signature 3; 566 probe sets at FDR threshold of 20%, EE EE EE EE EE EE Supplementary Table 7), and examined overlap between this FLT3 signature and MLL signature 2 described above. V V V V V V Sixty-nine probe sets were common to both NPM1-mutated and MLL-rearranged leukemia signatures, including increased expression of HOXA4, A6, A7, A9 and B9, and the TALE genes

c ctg gca gtg gag gaa gtc tct tta aga aaac tag atg gca gtg gag gaa gtct tct ctg tta gca aga gtg aaa gag tag M2 gaa gtc tct tta aga aaat tag ctg gca gtg gag M4 gaa gtcc tct atg tta gca aga gtg aaa gag tag gaa ITD M4 gtct tct ctg tta gca aga gtg aaa gag tag gaa gtc tct tta WT M4 aga aaa tag M1 WT 30 M2MEIS1 WT 0 WTand 9 2 WTPBX3 2 5(Supplementary 0 7 0 38 9 9 46,XX, inv(5)(q33q35) ND Table 8 ND 46,XY 8). 6However, 46,XX, ND add(17)(p13) ND 46,XX 46, XY there 47,XY,+4 were CL A CL A CL A CL A CL A CL A signiﬁcant differences between the two signatures (Supplemen- L L L L L L tary Table 9 and Figure 3). The homeobox B family genes D LWQWRK SL. D D D D D D gat ctc tgg cag tgg agg aag tct ctt taa Nucleotide and coding sequence FAB HOXB2, B3, B5 and B6, as well as HOXD4 were overexpressed mutations and associated in NPM1-mutated AML but not MLL-rearranged leukemias. These differences in HOXB2 and HOXB6 expression were conﬁrmed by quantitative RT–PCR in cases with available NPM1 material (Figure 4). Genes including SERPINF1, the megakar- WT type (11) yocytic leukemia fusion partner MKL1, and members of the RAS

Type of superfamily RAB4A and RAC2 were overexpressed in MLL- rearranged leukemia but not NPM1-mutant AML. Of note, MLL-rearranged AML cases exhibited earlier age of diagnosis (median 4.00 vs 14.37 years, P ¼ 0.004, a trend to Table 2 1 D gat ctc tg Case Mutation 35 A6 gat ctc B tg A gat ctc tg gat ctc tg 24 B gat ctc A tg Abbreviations: FAB, French–American–British morphologicTetranucleotide classiﬁcation insertions of and AML; predicted ITD, codingchange sequence shown changes in are bold. shown Conserved based residues on of gat Genbank the accession ctc putative NM_002520. tg consensushigher Insertions nuclear are underlined, export and signal t motif in NPM mutant proteins (Lx(1–3)Lx(2–3)LxL) presentation peripheral blood leukocyte count

Leukemia Gene expression proﬁling of NPM1-mutated pediatric AML CG Mullighan et al 2004

Figure 1 Gene expression proﬁling of NPM1-mutated AML. Heat map displaying the top 30 upregulated and top 30 downregulated genes in NPM1-mutated AML compared to NPM1-wild-type cases lacking common cytogenetic abnormalities or M7 phenotype (NPM1-mutated signature 2), arranged by rank. Differentially expressed probe sets were identiﬁed by t-test at an FDR of 20%. Differentially expressed probe sets are listed in Supplementary Table 3, and a heatmap of all differentially expressed probe sets is shown in Supplementary Figure 3.

Leukemia Gene expression proﬁling of NPM1-mutated pediatric AML CG Mullighan et al 2005

Figure 2 HOX gene expression in NPM1-mutant and wild-type pediatric AML. Heatmap showing expression of all HOX probe sets on the HG-U133A chip for all cases of AML examined.

(P ¼ 0.136) and a strong association with myelomonocytic (FAB NPM1 mutations were identified in 6.4% of the analyzed M5) morphology in comparison with NPM1-mutated AML pediatric cases and this frequency increased to 15% of those (Supplementary Table 10). cases that lacked a common cytogenetic abnormality. Impor- tantly, however, the frequency of NPM1 mutations was significantly lower in pediatric AML cases than in adult AML Discussion cases. This observation is in agreement with previously reported data in pediatric AML.25 The NPM1 mutations detected in our Our analysis confirmed the occurrence of NPM1 mutations in cohort were identical to those previously described11 and in pediatric AML. As in prior studies, we found that NPM1 each case led to the acquisition of a new nuclear export mutations were confined to those cases lacking a common sequence at the protein’s C-terminus. The NPM1 mutations cytogenetic abnormality or M7 phenotype.11,13,25 Specifically, were associated with older age at diagnosis. In addition,

Leukemia Gene expression proﬁling of NPM1-mutated pediatric AML CG Mullighan et al 2006

Figure 3 Comparison of gene expression proﬁles of NPM1-mutant and MLL-rearranged AML. Heat map displaying the top 30 upregulated and top 30 downregulated genes in NPM1-mutated AML compared to MLL-rearranged AML, arranged by rank. Differentially expressed probe sets were identiﬁed by comparing the NPM1-mutated and MLL-rearranged signatures, as described in the text. A full listing of all differentially expressed probe sets is provided in Supplementary Table 9.

Leukemia Gene expression profiling of NPM1-mutated pediatric AML CG Mullighan et al 2007 cases (3.7-, 2.4- and 2.0-fold, respectively). These novel observations suggest that HOXB6 and B2 overexpression are biologically important markers of NPM1-mutated leukemia. HOX genes encode proteins that bind DNA through a conserved homeodomain. HOX genes are arranged in four groups (A–D) on different chromosomes.40 Orderly HOX gene expression is required both for normal embryogenesis and hematopoiesis, and the HOX genes have key roles in stem cell self-renewal and lineage commitment.40,41 Members of the HOX A and B paralog groups are particularly important for hematopoietic stem cell maintenance and expansion. Dysregu- lation of HOX gene expression is common in several types of leukemia,42,43 most notably in myeloid and lymphoid leukemias with MLL gene rearrangement,28,32,44 and is important in leukemogenesis. Enforced overexpression of HOX genes in murine hematopoietic precursors induces AML.45–47 The latency of HOX-induced leukemia is reduced when MEIS1, which is also overexpressed in NPM1-mutated leukemia, is also overexpressed.48 Our finding of increased expression of HOXB2, B3, B5, B6 and HOXD5 in NPM1-mutated but not MLL-rearranged cases suggests that dysregulated expression of these genes may be important in the pathogenesis of AML with NPM1 mutations. Overexpression of HOXB6 in murine bone marrow immortalizes a myelomonocytic precursor and results in AML in vivo, the latency of which is reduced with MEIS1 coexpression.49 Moreover, HOXB6 is selectively expressed in CD34À cells,42,50 and it is interesting to note that cases of NPM1-mutated AML are commonly of myelomonocytic or monocytic morphology, and lack CD34 expression. Recent data suggesting that NPM1-mutated AML is derived from a common myeloid or earlier progenitor are compatible with these observations.51 Overexpression of HOXB3 and HOXB4, which are also selectively upregulated in NPM1-mutant AML, also expands primitive hematopoietic precursors and promotes myeloproliferation.45,52,53 Although HOXB2 is one of the top- Figure 4 Quantitative RT–PCR analysis of (a) HOXB2 expression ranked genes in the NPM1-mutated signature, there is no data levels and (b) HOXB6 expression levels in NPM1-mutated and MLL- regarding the hematopoietic effects of overexpression of this rearranged AML. Expression of HOXB2 and HOXB6 is significantly gene. higher in NPM1-mutant cases than MLL-rearranged MLL. t-test P-values are shown. These observations suggest that this unique pattern of HOX gene dysregulation may be important in NPM1-mutation- mediated leukemogenesis. However, the mechanisms by which NPM1 mutations result in aberrant HOX expression and leukemic transformation remain unclear. Dysregulation of response to remission-induction therapy and survival appeared HOX expression in MLL-rearranged leukemia may be explained favorable for the NPM1-mutant cases, however, due to the small by the action of MLL as a transcriptional regulator of HOX number of these cases, the differences were not statistically genes, but this is unlikely to be the case for NPM. It is unclear if significant. In contrast to adult AML cohorts,10,12,13 and NPM directly influences HOX expression via a different path- consistent with previously reported pediatric AML data,25 we way, for example growth factor signaling pathways, or whether observed a low frequency of FLT3 mutations in NPM1-mutated NPM1 mutations result in arrested development of hematopoie- AML (1 of 6 cases). tic precursors at a primitive stage with high HOX expression. An analysis of the gene expression profiles of NPM1-mutant Recent studies have demonstrated that NPM is an abundant AML provided important insights into the biology of this disease. nucleolar protein that shuttles between nucleus and cytoplasm. Consistent with previous reports,13,31 NPM1-mutated AML NPM is likely to have a crucial role in normal cellular displayed increased expression of numerous HOX genes, as homeostasis, and subserves a number of cellular functions well as the TALE homeodomain proteins MEIS1 and PBX3. whose disruption may contribute to leukemogenesis in NPM1- A novel and important finding from this study was that the pattern mutated AML.54 These include regulation and stabilization of of HOX dysregulation in NPM1-mutant cases was distinct from tumor suppressors such as Arf and P53, maintenance of genomic that observed in MLL-rearranged leukemias. There was upregu- integrity and stability, regulation of apoptosis and nucleosomal lation of group B HOX genes in NPM1-mutated, but not MLL- biosynthesis. NPM1 mutation are, thus, likely to perturb rearranged AML. Notably, HOXB2 and B6 exhibited high multiple cellular pathways in addition to HOX gene regulation. absolute U133A expression levels (mean 777.7 and 2363.3, It is also likely that the biologic effects of NPM mutations are respectively) and over 12-fold higher expression in NPM1- dependent on cellular context, and that NPM1 mutations alone mutated AML in comparison to MLL rearranged cases (Supple- do not induce leukemia. Thus defining the overall collection of mentary Table 9). In contrast, HOXB3, HOXD4 and HOXB5 mutation that work collaboratively with NPM1 mutations should showed a less striking increased expression in NPM1-mutant provide valuable insights into the pathways that must be

Leukemia Gene expression profiling of NPM1-mutated pediatric AML CG Mullighan et al 2008 dysregulated to lead to transformation in this recently identified myeloid leukemia (AML): association with other gene abnormali- subtype of leukemia. ties and previously established gene expression signatures and their favorable prognostic significance. Blood 2005; 106: 3747–3754. Acknowledgements 14 Suzuki T, Kiyoi H, Ozeki K, Tomita A, Yamaji S, Suzuki R et al. Clinical characteristics and prognostic implications of NPM1 mutations in acute myeloid leukemia. Blood 2005; 106: We thank Stanley Pounds for statistical analyses and Zhongling 2854–2861. Cai for technical assistance. This work was supported in part by 15 Borer RA, Lehner CF, Eppenberger HM, Nigg EA. Major nucleolar National Cancer Institute grants P01 CA71907-10 (JRD), CA- proteins shuttle between nucleus and cytoplasm. Cell 1989; 56: 21765 (Cancer Center CORE grant to St Jude Children’s Research 379–390. Hospital) by the American Lebanese and Syrian Associated 16 Cordell JL, Pulford KA, Bigerna B, Roncador G, Banham A, Charities of St Jude Children’s Research Hospital. CGM is Colombo E et al. Detection of normal and chimeric nucleophos- supported by a St Jude Children’s Research Hospital Physician min in human cells. Blood 1999; 93: 632–642. 17 Brady SN, Yu Y, Maggi Jr LB, Weber JD. ARF impedes NPM/B23 Scientist Fellowship, a National Health and Medical Research shuttling in an Mdm2-sensitive tumor suppressor pathway. Mol Council (Australia) CJ Martin Fellowship, a Haematology Society Cell Biol 2004; 24: 9327–9338. of Australia and New Zealand/AMGEN Traveling Fellowship and 18 Colombo E, Marine JC, Danovi D, Falini B, Pelicci PG. a Royal College of Physicians of Australasia/CSL Fellowship. Nucleophosmin regulates the stability and transcriptional activity of p53. Nat Cell Biol 2002; 4: 529–533. 19 Morris SW, Kirstein MN, Valentine MB, Dittmer K, Shapiro DN, References Look AT et al. Fusion of a kinase gene, ALK, to a nucleolar protein gene, NPM, in non-Hodgkin’s lymphoma. Science 1995; 267: 316–317. 1 Raimondi SC, Chang MN, Ravindranath Y, Behm FG, Gresik MV, 20 Redner RL, Rush EA, Faas S, Rudert WA, Corey SJ. The t(5;17) Steuber CP et al. Chromosomal abnormalities in 478 children with acute myeloid leukemia: clinical characteristics and treatment variant of acute promyelocytic leukemia expresses a nucleophos- outcome in a cooperative pediatric oncology group study-POG min-retinoic acid receptor fusion. Blood 1996; 87: 882–886. 8821. Blood 1999; 94: 3707–3716. 21 Yoneda-Kato N, Look AT, Kirstein MN, Valentine MB, Raimondi 2 Meshinchi S, Stirewalt DL, Alonzo TA, Zhang Q, Sweetser DA, SC, Cohen KJ et al. The t(3;5)(q25.1;q34) of myelodysplastic Woods WG et al. Activating mutations of RTK/ras signal syndrome and acute myeloid leukemia produces a novel fusion transduction pathway in pediatric acute myeloid leukemia. Blood gene, NPM-MLF1. Oncogene 1996; 12: 265–275. 2003; 102: 1474–1479. 22 Bischof D, Pulford K, Mason DY, Morris SW. Role of the 3 Beghini A, Ripamonti CB, Cairoli R, Cazzaniga G, Colapietro P, nucleophosmin (NPM) portion of the non-Hodgkin’s lymphoma- Elice F et al. KIT activating mutations: incidence in adult and associated NPM-anaplastic lymphoma kinase fusion protein in pediatric acute myeloid leukemia, and identification of an internal oncogenesis. Mol Cell Biol 1997; 17: 2312–2325. tandem duplication. Haematologica 2004; 89: 920–925. 23 Falini B, Bolli N, Shan J, Martelli MP, Liso A, Pucciarini A et al. 4 Goemans BF, Zwaan CM, Miller M, Zimmermann M, Harlow A, Both carboxy-terminus NES motif and mutated tryptophan(s) are Meshinchi S et al. Mutations in KIT and RAS are frequent events in crucial for aberrant nuclear export of nucleophosmin leukemic pediatric core-binding factor acute myeloid leukemia. Leukemia mutants in NPMc+ AML. Blood 2006; 107: 4514–4523. 2005; 19: 1536–1542. 24 Falini B, Martelli MP, Bolli N, Bonasso R, Ghia E, Pallotta MT et al. 5 Kang HJ, Hong SH, Kim IH, Park BK, Han KS, Cho HI et al. Immunohistochemistry predicts nucleophosmin (NPM) mutations Prognostic significance of FLT3 mutations in pediatric in acute myeloid leukemia. Blood 2006; 108: 1999–2005. non-promyelocytic acute myeloid leukemia. Leuk Res 2005; 29: 25 Cazzaniga G, Dell’Oro MG, Mecucci C, Giarin E, Masetti R, 617–623. Rossi V et al. Nucleophosmin mutations in childhood acute 6 Liang DC, Shih LY, Huang CF, Hung IJ, Yang CP, Liu HC et al. myelogenous leukemia with normal karyotype. Blood 2005; 106: CEBPalpha mutations in childhood acute myeloid leukemia. 1419–1422. Leukemia 2005; 19: 410–414. 26 Grisendi S, Pandolfi PP. NPM mutations in acute myelogenous 7 Dohner K, Tobis K, Ulrich R, Frohling S, Benner A, Schlenk RF leukemia. N Engl J Med 2005; 352: 291–292. et al. Prognostic significance of partial tandem duplications 27 den Besten W, Kuo ML, Williams RT, Sherr CJ. Myeloid Leukemia- of the MLL gene in adult patients 16 to 60 years old with acute Associated Nucleophosmin Mutants Perturb p53-Dependent and myeloid leukemia and normal cytogenetics: a study of the Acute Independent Activities of the Arf Tumor Suppressor Protein. Cell Myeloid Leukemia Study Group Ulm. J Clin Oncol 2002; 20: Cycle 2005; 4: 1–6. 3254–3261. 28 Ross ME, Mahfouz R, Onciu M, Liu HC, Zhou X, Song G et al. 8 Schnittger S, Kinkelin U, Schoch C, Heinecke A, Haase D, Gene expression profiling of pediatric acute myelogenous Haferlach T et al. Screening for MLL tandem duplication in 387 leukemia. Blood 2004; 104: 3679–3687. unselected patients with AML identify a prognostically unfavorable 29 Ross ME, Zhou X, Song G, Shurtleff SA, Girtman K, Williams WK subset of AML. Leukemia 2000; 14: 796–804. et al. Classification of pediatric acute lymphoblastic leukemia by 9 Boissel N, Renneville A, Biggio V, Philippe N, Thomas X, Cayuela gene expression profiling. Blood 2003; 102: 2951–2959. JM et al. Prevalence, clinical profile, and prognosis of 30 Yeoh EJ, Ross ME, Shurtleff SA, Williams WK, Patel D, Mahfouz R NPM mutations in AML with normal karyotype. Blood 2005; et al. Classification, subtype discovery, and prediction of outcome 106: 3618–3620. in pediatric acute lymphoblastic leukemia by gene expression 10 Dohner K, Schlenk RF, Habdank M, Scholl C, Rucker FG, profiling. Cancer Cell 2002; 1: 133–143. Corbacioglu A et al. Mutant nucleophosmin (NPM1) predicts 31 Alcalay M, Tiacci E, Bergomas R, Bigerna B, Venturini E, Minardi favorable prognosis in younger adults with acute myeloid SP et al. Acute myeloid leukemia bearing cytoplasmic nucleo- leukemia and normal cytogenetics – interaction with other gene phosmin (NPMc+ AML) shows a distinct gene expression profile mutations. Blood 2005; 106: 3740–3746. characterized by up-regulation of genes involved in stem-cell 11 Falini B, Mecucci C, Tiacci E, Alcalay M, Rosati R, Pasqualucci L maintenance. Blood 2005; 106: 899–902. et al. Cytoplasmic nucleophosmin in acute myelogenous leukemia 32 Armstrong SA, Staunton JE, Silverman LB, Pieters R, den Boer ML, with a normal karyotype. N Engl J Med 2005; 352: 254–266. Minden MD et al. MLL translocations specify a distinct gene 12 Schnittger S, Schoch C, Kern W, Mecucci C, Tschulik C, Martelli expression profile that distinguishes a unique leukemia. Nat Genet MF et al. Nucleophosmin gene mutations are predictors of 2002; 30: 41–47. favourable prognosis in acute myelogenous leukemia with a 33 Ribeiro RC, Razzouk BI, Pounds S, Hijiya N, Pui CH, Rubnitz JE. normal karyotype. Blood 2005; 106: 3733–3739. Successive clinical trials for childhood acute myeloid leukemia at 13 Verhaak RG, Goudswaard CS, van Putten W, Bijl MA, Sanders St Jude Children’s Research Hospital, from 1980 to 2000. MA, Hugens W et al. Mutations in nucleophosmin NPM1 in acute Leukemia 2005; 19: 2125–2129.

Leukemia Gene expression profiling of NPM1-mutated pediatric AML CG Mullighan et al 2009 34 Bennett JM, Catovsky D, Daniel MT, Flandrin G, Galton DA, cells causes defective lymphoid development and progressive Gralnick HR et al. Proposed revised criteria for the classification myeloproliferation. Immunity 1997; 6: 13–22. of acute myeloid leukemia. A report of the French- 46 Thorsteinsdottir U, Sauvageau G, Hough MR, Dragowska W, American-British Cooperative Group. Ann Intern Med 1985; 103: Lansdorp PM, Lawrence HJ et al. Overexpression of HOXA10 in 620–625. murine hematopoietic cells perturbs both myeloid and lymphoid 35 Storey JD. A direct approach to false discovery rates. J R Stat Soc differentiation and leads to acute myeloid leukemia. Mol Cell Biol Ser B 2002; 64: 479–498. 1997; 17: 495–505. 36 Storey JD, Tibshirani R. Statistical significance for genomewide 47 Kroon E, Krosl J, Thorsteinsdottir U, Baban S, Buchberg AM, studies. Proc Natl Acad Sci USA 2003; 100: 9440–9445. Sauvageau G. Hoxa9 transforms primary bone marrow cells 37 Kaplen EL, Meier P. Nonparametric Estimation from Incomplete through specific collaboration with Meis1a but not Pbx1b. EMBO Observations. J Am Stat Assoc 1958; 53: 457–481. J 1998; 17: 3714–3725. 38 Peto R, Pike MC, Armitage P, Breslow NE, Cox DR, Howard SV 48 Thorsteinsdottir U, Kroon E, Jerome L, Blasi F, Sauvageau G. et al. Design and analysis of randomized clinical trials requiring Defining roles for HOX and MEIS1 genes in induction of acute prolonged observation of each patient. II. analysis and examples. myeloid leukemia. Mol Cell Biol 2001; 21: 224–234. Br J Cancer 1977; 35: 1–39. 49 Fischbach NA, Rozenfeld S, Shen W, Fong S, Chrobak D, 39 Nakagawa M, Kameoka Y, Suzuki R. Nucleophosmin in acute Ginzinger D et al. HOXB6 overexpression in murine bone marrow myelogenous leukemia. N Engl J Med 2005; 352: 1819–1820. immortalizes a myelomonocytic precursor in vitro and causes 40 Eklund EA. The role of HOX genes in myeloid leukemogenesis. hematopoietic stem cell expansion and acute myeloid leukemia in Curr Opin Hematol 2006; 13: 67–73. vivo. Blood 2005; 105: 1456–1466. 41 Abramovich C, Humphries RK. Hox regulation of normal and 50 Giampaolo A, Felli N, Diverio D, Morsilli O, Samoggia P, Breccia leukemic hematopoietic stem cells. Curr Opin Hematol 2005; 12: M et al. Expression pattern of HOXB6 homeobox gene in 210–216. myelomonocytic differentiation and acute myeloid leukemia. 42 Kawagoe H, Humphries RK, Blair A, Sutherland HJ, Hogge DE. Leukemia 2002; 16: 1293–1301. Expression of HOX genes, HOX cofactors, and MLL in phenoty- 51 Pasqualucci L, Liso A, Martelli MP, Bolli N, Pacini R, Tabarrini A pically and functionally defined subpopulations of leukemic et al. Mutated nucleophosmin detects clonal multilineage involve- and normal human hematopoietic cells. Leukemia 1999; 13: ment in acute myeloid leukemia: Impact on WHO classification. 687–698. Blood 2006; 108: 4146–4155. 43 Roche J, Zeng C, Baron A, Gadgil S, Gemmill RM, Tigaud I et al. 52 Sauvageau G, Thorsteinsdottir U, Eaves CJ, Lawrence HJ, Largman Hox expression in AML identifies a distinct subset of patients with C, Lansdorp PM et al. Overexpression of HOXB4 in hematopoietic intermediate cytogenetics. Leukemia 2004; 18: 1059–1063. cells causes the selective expansion of more primitive populations 44 Ferrando AA, Armstrong SA, Neuberg DS, Sallan SE, Silverman LB, in vitro and in vivo. Genes Dev 1995; 9: 1753–1765. Korsmeyer SJ et al. Gene expression signatures in MLL-rearranged 53 Antonchuk J, Sauvageau G, Humphries RK. HOXB4-induced T-lineage and B-precursor acute leukemias: dominance of HOX expansion of adult hematopoietic stem cells ex vivo. Cell 2002; dysregulation. Blood 2003; 102: 262–268. 109: 39–45. 45 Sauvageau G, Thorsteinsdottir U, Hough MR, Hugo P, Lawrence 54 Grisendi S, Mecucci C, Falini B, Pandolfi PP. Nucleophosmin and HJ, Largman C et al. Overexpression of HOXB3 in hematopoietic cancer. Nat Rev Cancer 2006; 6: 493–505.

Supplementary Information accompanies the paper on the Leukemia web site (http://www.nature.com/leu)

Leukemia