BRION ALLEN BERMAN Studies of a Novel Hemerythrin-like Protein from the Anaerobic, Hyperthermophilic Archaeon, Methanococcus jannaschii (Under the Direction of DONALD M. KURTZ)

Hemerythrin (Hr) is a non-heme iron protein, which originally had only

been found in marine invertebrates where it functions as an oxygen-transport or storage

protein. Hrs typically contain an oxo-/hydroxo-bridged non-heme diiron site surrounded

by a four-helical bundle protein fold. All Hrs have seven conserved amino acids that

furnish iron ligands, namely five histidines, one aspartate and one glutamate.

Subsequently, homologues have been found in other organisms. Through protein

and nucleotide searches, a previously undescribed protein having the Hr-like sequence

motif (MjHr), was discovered in the Methanococcus jannaschii genome. MjHr exhibits structural and spectral properties resembling those of previously characterized Hrs. This

Hr-like protein is the first to be described from archaea. Unlike Hrs that function as O2- carrying proteins, MjHr is proposed to function as an O2 sensor or scavenger within this

methanogenic anaerobe.

INDEX WORDS: Hemerythrin, Methanococcus jannaschii, O2-binding, Stopped-

flow spectrophotometry, Electron paramagnetic resonance (EPR),

Circular dichroism (CD), Western-blot, Metalloprotein,

Reconstitution, Overexpression, Protein Purification STUDIES OF A NOVEL HEMERYTHRIN-LIKE PROTEIN FROM THE

ANAEROBIC, HYPERTHERMOPHILIC ARCHAEON, METHANOCOCCUS

JANNASCHII

by

BRION ALLEN BERMAN

B.S., The University of South Alabama, 1999

A Thesis Submitted to the Graduate Faculty of The University Georgia in Partial

Fulfillment of the Requirements for the Degree

MASTER OF SCIENCE

ATHENS, GEORGIA

2001 © 2001

Brion Allen Berman

All Rights Reserved STUDIES OF A NOVEL HEMERYTHRIN-LIKE PROTEIN FROM THE

ANAEROBIC, HYPERTHERMOPHILIC ARCHAEON, METHANOCOCCUS

JANNASCHII

by

BRION ALLEN BERMAN

Approved: August 7, 2001

Major Professor: Donald M. Kurtz

Committee: Michael K. Johnson Robert S. Phillips

Electronic Version Approved:

Gordhan L. Patel Dean of the Graduate School The University of Georgia December 2001 IN MEMORY OF

Milton “Pop” Kozlove

(1917-1995)

iv ACKNOWLEDGMENTS

First, I would like to thank my family. I am indebted to my parents for their love, support, and pointing me in the right direction. I do not know what I would have done without the endless conversations and exhausted worrying from Mom. I undoubtedly would like to thank Dad for taking time to play golf and touring around the country with me, as well as, making sure I stay on top of things. I do not know if I could have stayed sane throughout graduate school without Jason taking me to different soccer tournaments and getting me outdoors. I especially would like to thank my grandparents, Jean Rose and Pop, for all the good times we spent together.

I would like to thank Leigh for being supportive, understanding, and patient. I know it has not been easy. I do not know how I would have survived without the needed breaks from reality with the “Mexicali” crew: Cindy, Bryan, and Joe. It has been a fun time!!!

I am grateful for Dr. Donald M. Kurtz, Jr. for his guidance and his financial support during my studies in his lab. I would also like to thank Drs. Robert Phillips and

Michael Johnson for serving on my committee.

I cannot begin to say enough about my labmates, Dr. Eric Coulter, Zanna

Beharry, Joseph Emerson, Radu Silaghi, Shi Jim, and Dr. Kim Ng, for all the stimulating discussions, guidance, and moral support. Eric and Zanna, I do not know where to even start for all your help. I am deeply grateful.

v TABLE OF CONTENTS

Page

ACKNOWLEDGEMENTS...... v

CHAPTER

1. INTRODUCTION ...... 1

A. Oxygen-Carrying Proteins ...... 1

B. Properties of Dioxygen and Its Metal Complexes ...... 2

C. Properties of Hrs...... 3

D. Hemerythrin-like Proteins From Other Organisms...... 6

E. Goals of This Research...... 7

2. EXPERIMENTAL...... 23

A. Cloning of the M. jannaschii Hr-like Protein ...... 23

B. Overexpression and Purification of Recombinant MjHr...... 25

C. Characterization of MjHr ...... 28

D. Preparation of Polyclonal Antibodies Against MjHr...... 33

E. Western Blot Analyses of Recombinant and Native MjHr ...... 34

F. Kinetics of O2 Reactions with Recombinant deoxyMjHr...... 35

3. RESULTS AND DISCUSSION...... 39

A. Characterization of Recombinant MjHr...... 39

B. Spectral Properties of Recombinant MjHr...... 41

vi vii

C. Exogenous Ligand Binding to MjHr...... 42

D. Activity of MjHr ...... 44

E. Tests for Hydrogen Peroxide Production During Autoxidation of MjHr....45

F. Kinetics of O2 Reactions with deoxyMjHr...... 45

G. Discussion ...... 47

REFERENCES ...... 69 CHAPTER 1

INTRODUCTION

A. Oxygen-Carrying Proteins

There are three categories of O2-carrying proteins found in nature, all of which contain metal in their active sites. These oxygen-carrying proteins include the heme containing proteins, hemoglobin (Hb)/ myoglobin (Mb), the non-heme diiron proteins, hemerythrin (Hr)/ myohemerythrin (myoHr), and the copper-containing protein, hemocyanin (Hc). These proteins and homologues can be found in a wide variety of organisms ranging from vertebrates and invertebrates for Hb and Mb to arthropods and mollusks for Hc and to marine invertebrates and bacteria for Hr and myoHr. A rationale for the natural selection of iron and copper for reversible oxygen binding is the relativelyhigh bioavailabilities of both metals and their abilities to complex with dioxygen. The deoxy- and oxy- active site structures are shown in Figure 1-1 [1] and the protein backbone structures are shown in Figure 1-2 for all three types. Some properties of each of these proteins are compared in Table 1-1[2].

The most-studied and most naturally abundant of O2-carrying proteins are Hb and

Mb. The active sites of hemoglobin and myoglobin (the monomeric analog of Hb) incorporate iron via a protoporphyrin IX (heme) group and a “proximal” histidine from the protein. The reduced forms of Hb and Mb have the heme in a five-coordinate high- spin Fe(II) complex. Dioxygen binds to the open, axial position on the iron in a bent, end-on fashion to the iron with 115-160° Fe-O-O bond angles (cf. Figure 1-1). The O2 is

1 2 formally reduced to the superoxide level, while the iron is formally oxidized to low-spin

III - Fe(III). The Fe -O2 adduct is stabilized by hydrogen bonding to the “distal” histidine,

which lies on the opposite side of the heme from the “proximal” histidine (not shown in

Figure 1-1) [2].

The second most abundant O2-carrier is hemocyanin. Recently, X-ray crystal

structures of the deoxy- and oxy- forms of L. polyphemus became available [3, 4]. In deoxyHc, there are two Cu(I) atoms each coordinated by three histidine residues. Upon oxygenation, the O2 is formally reduced to peroxide and binds in a side-on, bridging manner between the two Cu atoms, which are formally oxidized to Cu(II).

The third class of O2-carrying proteins, hemerythrin and myohemerythrin

(monomeric analogue of Hr) is found in a few marine invertebrates, such as sipunculids,

brachiopods, priapulids, and annelids [5]. Despite the name, Hr does not contain a heme

group, but rather a non-heme diiron site that reversibly binds oxygen. Since Hr is the

focus of this research, its structure and function is discussed in greater depth below.

B. Properties of Dioxygen and Its Metal Complexes

In order to understand the ability of these proteins to bind dioxygen, some

properties of dioxygen itself are first discussed. O2 is known to be reduced to superoxide

- 2- (O2 ) or peroxide (O2 ) in biochemical systems. Dioxygen is readily reduced thermodynamically, but not kinetically. This difference between the thermodynamic and kinetic properties can be understood from the energy difference between the highest- occupied molecular orbitals (HOMO) and the lowest-unoccupied molecular orbitals

(LUMO) of O2 (Figure 1-3) [1]. The slow kinetic reactivity can be rationalized because 3

O2 has a triplet ground state whereas organic molecules typically have singlet ground

states, thus making them spin-forbidden from reacting with O2. Transition metal ions

often have one or more unpaired d-electrons, and are therefore, not spin-forbidden from

reacting with O2. Since transition metal-ions can have multiple positive oxidation states

and since O2 is readily reduced, metal-dioxygen complexation generally occurs through a

shift in electron density from the metal to dioxygen. Figure 1-4 [1] shows the various

modes of interaction between O2 and metal-ions. As Figures 1-3 and 1-4 illustrate, metal

d-electron density shifts into the O2 π* anti-bonding orbitals of O2 resulting in the

elongation of the O-O distances and the lowering of the O-O stretching frequencies

compared to molecular oxygen (Table 1-2) [1].

C. Properties of Hrs

C.1. Amino Acid Sequence of Hr

Figure 1-5 shows the amino acid sequence alignments of several Hrs. Seven

conserved amino acid residues provide iron ligands in all known Hrs. These residues

consist of five terminally ligated histidines/imidazoles, two bridging carboxylates (one

from aspartate and one from glutamate). There are also several conserved residues that

line the O2 binding pocket, as seen in Figures 1-5 and 1-6. As shown in Figure 1-1, this

ligation creates an asymmetric coordination environment in the deoxy form, where one

iron, Fe1, is hexa-coordinate and the other iron, Fe2, is penta-coordinate leaving an open

coordination sight for O2. 4

C.2. Quaternary and Tertiary Structures of Hemerythrin

Hr most often occurs as an octamer, but other oligomers have been isolated, namely, tetramer, dimer, trimer, and monomer [6]. X-ray crystal structures are available for Themiste zostericola myoHr [7], Phascolopsis gouldii Hr [8], and Themiste dyscritum

Hr [9-12]. The subunit structures closely resemble one another. The tertiary structure of a Hr subunit consists of four α-helices (cf. Figure 1-2), which enclose a binuclear diiron center with a hydrophobic O2 pocket (Figure 1-6). The most widely studied Hr is that

from Phascolopsis gouldii [13], which is octameric and has a subunit molecular weight of

~13,500 kD.

C.3. Redox Interconversion and Active Site Structure of Hr

The diiron site of Hr and myoHr can exist in various oxidation levels as

diagrammed in Figures 1-7 and 1-8. The O2 binding reaction, shown horizontally in

Figure 1-8, converts the two Fe(II) of deoxyHr to two Fe(III) and the coordinated O2 to

peroxide in oxyHr. Since Fe1 has an occupied sixth coordination position in the deoxy

form, O2 binding occurs at the open coordination site of Fe2 during conversion to oxyHr

(Figure 1-7). MetHr forms spontaneously upon the loss of H2O2 from oxyHr (Figure 1-7)

in a process termed autoxidation shown vertically in Figure 1-8. Azide binds to the open

coordination site of Fe2 in met Hr with a geometry mimicking that of O2 binding shown

in Figure 1-7, lower right. P. gouldii myoHr autoxidizes with a half time of about 10

hours at room termperature. This slow autoxidation has been attributed to the small and

hydrophobic O2 binding pocket (Figure 1-6), which does not allow for facile diffusion of solvent to the active site [14, 15]. The addition of small anions such as azide to the oxy 5 form or lowering of pH of oxyHr solutions increases the rate of autoxidation. Semi- metHr has a mixed-valent diiron site, namely, [FeII, FeIII](semi-met)R or [FeIII, FeII]

(semi-met)O, the subscript indicating that it was derived from either the reduction of met

(R) or oxidation of deoxy (O) states.

Several spectroscopic techniques have been used to characterize these various

forms of Hr. DeoxyHr is colorless due to the two high spin ferrous irons, which allows

for easy monitoring of its conversion to the colored oxy form. The best evidence for

oxidation states of the iron and O2 has been obtained by Mössbauer [16, 17] and

resonance Raman [12, 18] and UV-vis absorption spectroscopies. OxyHr shows intense

-1 -1 -1 -1 absorption peaks at 330 nm (ε 330 = 6,800 M cm ) and 360 nm (ε 360 = 5,450 M cm ),

III 2- III -1 -1 characteristic of the Fe -O -Fe moiety, and a peak at 500 nm (ε 500 = 2,200 M cm ),

characteristic of a peroxo ! Fe(III) ligand-to-metal charge-transfer transition (LMCT)

(Figure 1-9) [19]. The UV-vis absorption spectrum of metHr is similar to that of oxyHr

-1 -1 -1 -1 with absorptions at 330 nm (ε 330 = 6,600 M cm ) and 380 nm (ε 380 = 6,000 M cm ) consistent with retention of the FeIII-O2--FeIII unit, but the met form lacks the absorption

feature at 500 nm characteristic of peroxo ! Fe(III) LMCT (Figure 1-9) [19]. There are

also two weaker absorption features in the spectrum of metHr, namely a shoulder at

-1 -1 -1 ~480 (ε 480 = 550 M cm ) and a broad feature maximizing at ~610 nm (ε 610 = 150 M

cm-1), which are also due to the FeIII-O2--FeIII moiety. Azide binding to the met form is

-1 also readily seen in its absorption spectrum with maxima at ~325 nm (ε 325 = 6,800 M

-1 -1 -1 -1 -1 cm ), 380 nm (shoulder) (ε 380 = 4,300 M cm ), and 445 nm (ε 445 = 3,700 M cm )

(Figure 1-9) [19]. Electron paramagnetic resonance (EPR) can differentiate the two semi-met forms of Hr, which have a ground spin state S = ½ due to antiferromagnetic 6

coupling of the iron d-electrons, as shown in Figure 1-10. (Semi-met)R has a rhombic

line shape, whereas (semi-met)O has an axial line shape [20].

C.4. Kinetics of O2 and Hr

Kinetics of O2 binding to Hr and myoHr have been studied in vitro using

temperature-jump, laser flash photolysis, and stopped-flow spectrophotometry [21-24].

The rates of O2 binding (kon) and dissociation (koff) of all studied Hrs and myoHrs are in

good agreement with each other. Table 1-3 [25] gives a summary of the currently

available kinetic data.

A schematic depiction of the O2 binding reaction is shown in Figure 1-11. The

intermediate depicted in Figure 1-11 has never been detected, so it is unclear whether

proton transfer from the hydroxo-bridge occurs prior to, concomitant with, or following

oxidation of Fe1. Brunhold and Solomon have proposed a concerted two-electron, one-

proton transfer in which such an intermediate would not accumulate [26].

D. Hemerythrin-like Proteins From Other Organisms

A BLAST [27-29] similarity search (Table 1-4) identified Hr homologues in the

Methanococcus jannaschii genome [30] (cf. Figure 1-5), (PIR accession number

C64393), as well as in many other microbes. Other microbial genomes showing Hr

homologues include: Desulfovibrio vulgaris [31], Pseudomonas aeruginosa [32], Aquifex aeolicus [33], and Campylobacter jejuni [34]. As mentioned previously, Hr and

homologues have been isolated from all types of organisms except archaea. A Hr-like

protein was recently characterized from the sulfate-reducing bacteria, D. vulgaris 7

(Hildenborough), namely DcrH-Hr [35]. However, the archaeal Hr homologue from

Methanococcus jannaschii has not been characterized.

D.2. Methanococcus jannaschii

A research submarine Alvin discovered Methanococcus (M.) jannaschii three kilometers below the Pacific Ocean in a “deep-sea hydrothermal chimney” in 1982. The organism appeared as “colonies of plumed worms and mats of bacteria” [36] that clung to the chimney vents, which had a grayish-white fluid that spiraled out. The submarine’s arm reached in and pulled out a previously unknown microbe. It was classified into the

Methanococcus lineage, because it was a methane-producing organism and the name jannaschii was derived from its discoverer Holger Jannasch. M. jannaschii lives at temperatures from 48 to 94 °C and at more than 200 atmospheres of pressure. It is an autotroph, which exists solely on carbon dioxide, nitrogen, and hydrogen. M. jannaschii was the first archaeon to have its genome completely sequenced.

E. Goals of This Research

The goals of this research were to overexpress, purify, and characterize the newfound Hr homologue from M. jannaschii. Various spectroscopic techniques, including: EPR, circular dichroism (CD), and UV-vis absorption, were used to determine the protein conformation, type of iron site, oxidation states of the irons, and accessibility of the exogenous ligand binding pocket. Kinetics studies of O2 binding to MjHr were

also conducted using stopped-flow spectrophotometry. 8 (a)

O Fe 2

(b)

O Fe1 Fe2 2

(c)

O2 CuB CuA

Figure 1-1. The active sites of dioxygen-carrying proteins. Active sites are shown schematically for (a) sperm whale Mb, (b) Themiste dyscritum (“peanut” worm) Hr and (c) Limulus polyphemus (horseshoe crab) Hc. Deoxy forms are shown on the left, and oxy forms on the right. Metal ligands are represented as atom-undifferentiated line drawings. Darker blue spheres represent either iron or copper ions, and lighter blue spheres represent bound dioxygen atoms. Black spheres in (b) represent oxo (oxy) or hydroxo (deoxy) ions. The drawings are based on X-ray crystal structure coordinates deposited in the Brookhaven Protein Data Bank (Mb, 1MBD, 1MBO; Hr, 1HMD, 1HMO; Hc, 1LLA, 1OXY) (adapted from [1]). 9

(a) (b)

(c)

Figure 1-2. Protein backbone structures of oxygen-carrying proteins. (a) Sperm whale Mb, (b) Themiste zostericola (“peanut” worm) Hr and (c) Limulus polyphemus (horseshoe crab) Hc. Red spheres represent iron and blue spheres represent copper atoms. Ligands to the metals are shown in yellow wireframe representation. Polypeptide backbones are shown in ribbon representation. Figures were drawn using RASMOL [37] with coordinates from PDB files 1MBD, 2MHR, and 1LLA, respectively [4, 38, 39]. 10

Table 1-1. Some properties of O2-carrying proteins, adapted from [2].

hemoglobin (Hb) hemerythrin (Hr) hemocyanin(Hc) Property myoglobin (Mb) myohemerythrin (myoHr) metal Fe Fe Cu metal:O2 Fe:O2 2Fe:O2 2Cu:O2 -1 νO-O (cm ) 1100 844 750 metal oxidation state: deoxy Fe(II) 2Fe(II) 2Cu(I) oxy Fe(II) 2Fe(III) 2Cu(II) coordination of Porphyrin plus His, Asp, Glu His residues metal His residue residues, oxo/hydroxo no. of subunits 1, 4, 80 1, 2, 3, 4, 8 6, 12, 24, 48 in oligomer subunit mol. wt. (Da) 16,000 13,500 55,000 or 75,000 color: deoxy red-purple colorless colorless oxy red burgundy blue 11

(A) (B) (C)

dioxygen superoxide peroxide - 2- O2 oxidation state: O2 O2 O2

O-O bond order: 2 1.5 1

σ LUMO: σ*2p ______. .

π π HOMOs: *2px, *2py ______. .

Figure 1-3. HOMOs and LUMO of the dioxygen molecule and its one- and two- electron reduced forms. (A) Dioxygen; (B) superoxide; (C) peroxide. Shapes of the HOMOs and LUMO are shown to the right of the π* and σ* energy levels, respectively, with the O-O bond axis (defined as the z-axis) oriented horizontally. Only one of the two identically shaped HOMOs is shown. The other HOMO would have its lobes oriented perpendicular to the plane of the page [1]. 12

z z

o o O o o M O M xyM

σ π side-on end-on

Figure 1-4. Molecular orbital description of metal-dioxygen adducts using metal d-orbitals and O2 π*-orbitals. Bonding of O2 to metal ions (M) in an end-on and side-on modes is illustrated [1]. 13

Table 1-2. Metal-ion complexation weakens the O-O bond.a

-1 νO-O (cm ) O-O bond length (Å)

Dioxygen 1555 1.21 metal-superoxo 1100-1200 1.24-1.31 metal-peroxo 750-900 1.35-1.5 aData from [40]. 14

1 50 MjHr ...MKKEIIK WSKDFETGIK AFDDEHKILV KTLNDIYNLL EGKRDEAKE DcrH ..GDADVLVK WSEDL.ANLP SIDTQHKRLV DYINDLYRAA RRDMDKARE TzmHr .GWEIPEPYV WDESFRVFYE QLDEEHKKIF KGIFDC..IR NS.APNLAT PgHr MGFPIPDPYV WDPSFRTFYS IIDDEHKTLF NGIFHL..AI DN.ADNLGE TdHr .GFPIPDPYC WDISFRTFYT IVDDEHKTLF NGILLL..SQ DN.ADHLNE NfHr MATTIPSPFN WDSSFCVGNN ELNEQHKKLF ALINAL..DA RSSASALKE TtHr MVFEIPEPYQ WDETFEVFYE KLDEEHKGLF KGIKDL..SD PACSETLEK

51 100 MjHr LLKRRVVNYA AKHFKHEEEV MEKYGYPDLE RHRKTHEIFV TVIEKLLPK DcrH VFDA.LKNYA VEHFGYEERL FADYAYPEAT RHKEIHRRFV TVL.KWEKQ TzmHr LVK.....VT TNHFTHEEAM MDAAKYSEVV PHKKMHKDFL ...... K PgHr LRR.....CT GKHFLNEQVL MQASQYQFYD EHKKEHETFI A...... TdHr LRR.....CT GKHFLNEQQL MQASQYAGYA EHKKAHDDFI K...... NfHr LLD.....FV VMHFKAEEDL FAKVNFSDST SHKETHDKFV D...... TtHr LVK.....LI EDHFTDEEEM MKSKSYEDLD SHKKIHSDFV T......

101 150 MjHr IEEGSENDFR SALSFLVGWL TMHIAKPDKK YGEWFKEKGI IEDEAVKID DcrH LAAGDPEVVM TTLRGLVDWL VNHIMKEDKK YEAYLRERGV ...... TzmHr IGGLSAPVDA KNVDYCKEWL VNHIKGTDFK YKGKL...... PgHr LDNWKG.... .DVKWAKSWL VNHIKTIDFK YKGKI...... TdHr LDTWDG.... .DVTYAKNWL VNHIKTIDFK YRGKI...... NfHr ALGLKT.VGD AEIQFIKQWL VNHIKGSDMK YKGVL...... TtHr LKGVKAPVSE ENIKMAKEWL VNHIKGTDFK YKGKL......

Figure 1-5. Amino acid sequences of Hrs, myoHrs, and Hr-like proteins. Conserved residues are in blue, residues lining the O2 binding pocket are highlighted in yellow, and those furnishing iron ligands are in red. Abbreviations listed above are: MjHr, Methanococcus jannaschii Hr; DcrH, hemerythrin-like domain protein from Desulfovibrio vulgaris (Hildenborough) DcrH; TzmHr, Themiste zostericola myoHr; PgHr, Phascolopsis gouldii Hr; TdHr, Themiste dyscritum Hr; NfHr, Naegleria fowleri myoHr; TtHr, Theromyzon tessulatum myoHr. 15

H77

F55

E58 L103 W102 H54 Fe2

I28 L103 H25

Figure 1-6. View of some amino acid side chains in T. zostericola myoHr lining the O2 binding pocket. The protein backbone is shown in strand representation and the non- hydrogen atoms of the amino acid side chains and heteroatoms are shown in a space- filling representation. Residues lining the O2 binding pocket are in blue, the iron binding ligands are shown in yellow, and the iron that binds O2, Fe2, is shown in red. Drawings were generated in RASMOL [37] using coordinates from the PDB file, 2MHR [39]. 16

His101

His101 His77 His54 His77 His54

Fe1 Fe2 His25 His73 Fe1 Fe2 His25 His73

Asp106 Glu58 Asp106 Glu58

II II III III - deoxy = [Fe (µ-OH)Fe ] oxy = [Fe (µ-O)Fe O2H ]

His101 His101 His77 His54 His77 His54

Fe1 Fe2 His25 His73 Fe1 Fe2 His73 His25

Glu58 Asp106 Glu58 Asp106

III III III III - met = [Fe (µ-O)Fe ] azidomet = [Fe (µ-O)Fe N3 ]

Figure 1-7. Schematic structures of the diiron sites in deoxy-, oxy-, met-, and azidometHrs from T. dyscritum. The drawings are based on the coordinates of PDB entries 1HMD (deoxy), 1HMO (oxy), 2HMQ (met) and 2HMZ (azidomet). The oxidation levels of iron and O2 are indicated below each structure. In the deoxy form the oxo bridge is protonated whereas, in the oxy form, O2 is protonated, and hydrogen bonded to the oxo bridge. Adapted from [19]. 17

+O2 - Fe(II), Fe(II) Fe(III), Fe(III)O2(H) deoxy oxy -O2 ox.

red.

H+, X- Fe(III), Fe(II) (semi-met)O

H2O2 ox.

red. Fe(II), Fe(III) (semi-met)R Fe(III), Fe(III) met

Figure 1-8. Redox interconversions of the diiron sites in Hr, adapted from [19]. 18

1.5

1.0 Absorbance

oxy 0.5

azidomet

met 0.0 300 400 500 600 700 800 Wavelength (nm)

Figure 1-9. UV-vis absorption spectra of met, azidomet, and oxy adducts of P. gouldii myoHr in 50 mM Tris, 200 mM KCl, pH 8.0, adapted from [19]. 19

g = 1.95

(A) (semi-met)o g = 1.72

H

g = 1.69

gz = 1.95 (B) (semi-met)R

gy = 1.87

H gx = 1.67

Figure 1-10. X-band EPR spectra of semi-met T. zostericola Hr [20]. (A) (semi- metHr)O was generated by K3Fe(CN)6 oxidation of deoxyHr at pH 8.2 under anaerobic conditions. After incubation for 90 s at 23 °C the solution was frozen and the EPR spectrum recorded at 4 K. (B) (semi-metHr)R was generated by light irradiation of metmyoHr in a solution containing 3 µM riboflavin and 5 mM EDTA at pH 8.2 in an EPR tube under 1 atm of N2. After 90 sec. of irradiation, the solution was frozen and the EPR spectrum recorded at 4 K. 20

His His His His His His His His His Fe1 Fe Fe O O 1 O 1 O + O2 O O Glu OH Glu O H Glu O - O2 H Asp O Asp O O Asp O O binding O O O Fe2 Fe2 Fe2 pocket O O His His His His His His

deoxyHr oxyHr

+ Figure 1-11. Currently accepted mechanism of O2 binding and internal H transfer between deoxy- and oxyHr. 21

Table 1-3. Kinetic data of O2-binding to Hr and myoHr [14, 15, 19, 25].

a -6 a a 6 Protein kon x 10 koff Kd x 10 Conditions Method (M-1 s-1) (s-1) (M)

Lingula unguis Hr 0.44 15 34 0.08 M Phosphate, pH 6.8, 17 °C s.f. (octamer) 0.63 61 97 0.08 M Phosphate, 0.1 NaCl, pH 6.8, 15 °C t.j.

Siphonosoma cumanese Hr 11.3 9.1 1.24 0.08 M Phosphate, 0.1 NaCl, pH 6.8, 15 °C t.j. (trimer) Themiste zostericola 78 315 4 0.05 M Tris, pH 6.8, I = 0.1, 25 °C t.j. myoHr 1.4 209 0.25 0.3 M Tris-sulfate, pH 8.0, 25 °C t.j.

Themiste zostericola Hr 7.5 82 10.9 0.05 M Tris, pH 6.8, I = 0.10, 25 °C t.j. (octamer) Sipunclus nudus Hr 26 120 4.6 0.08 M Phosphate, pH 6.8, 25 °C t.j.

Phascolopsis gouldii Hr 7.4 51 6.9 0.05 M Tris, pH 6.8, I = 0.1, 25 °C t.j. (octamer) 3.3 51 15.5 50 mM HEPES, 200 mM Na2SO4, pH 7.5, 25 °C s.f.

Phascolopsis gouldii myoHr >70 240 50 mM Tris, 200 mM KCl, pH 8.0, 25 °C s.f.

a kon and koff indicate O2 association and dissociation rates, respectively. Kd is the ratio of koff/kon and is a measure of the equilibrium dissociation constant for O2 binding. Abbreviations are: t.j., temperature-jump, and s.f., stopped-flow. 22

Table 1-4. Hemerythrins and homologues found from a BLAST [27-29] sequence similarity search using one subunit of P. gouldii Hr as the query sequence.

Organism Taxonomy Protein

Methanococcus jannaschii [euryarchaeotes] Hemerythrin homolog MJ0747

Desulfovibrio vulgaris [δ-proteobacteria] DcrH [Desulfovibrio vulgaris]

Pseudomonas aeruginosa [γ-proteobacteria] Hypothetical protein PA1673

Campylobacter jejuni [ε-proteobacteria] Probable iron-binding protein Cj1224

Naegleria fowleri [eukaryotes] Myohemerythrin

Themiste zostericola [sipunculid worms] Hemerythrin

Theromyzon tessulatum [segmented worms] Myohemerythrin

Phascolopsis gouldii [sipunculid worms] Hemerythrin

Lingula reevii [brachiopods] Hemerythrin alpha chain

Themiste dyscritum [sipunculid worms] Chain A, Hemerythrin (Oxy)

Lingula anatina [brachiopods] Hemerythrin alpha chain

Siphonosoma cumanense [sipunculid worms] Hemerythrin

Aquifex aeolicus [aquificales] Hemerythrin homolog aq_1719 CHAPTER 2

EXPERIMENTAL

A. Cloning of the M. jannaschii Hr-like Protein

Molecular biology procedures followed those described in Molecular Cloning: A

Laboratory Manual [41] or in Current Protocols in Molecular Biology [42]. E. coli cell

cultures were grown in Luria-Bertani (LB) medium containing 100 µg mL-1 ampicillin

(LB/amp). The colonies were grown on plates consisting of LB agar containing 100 µg

mL-1 ampicillin (LA/amp). DNA sequences were verified by nucleotide sequencing at

the Molecular Genetics Instrumentation Facility at the University of Georgia.

Oligonucleotide primers were obtained from Integrated DNA Technologies.

Dr. Barny Whitman in the Department of Microbiology at the University of

Georgia graciously provided the Methanococcus jannaschii (Mj) genomic DNA. The

DNA encoding the MjHr gene was amplified from the M. jannaschii genomic DNA by

PCR using a N-terminal primer, MjHr-5, which contained an NdeI restriction site overlapping the start codon followed by a nucleotide sequence encoding the first four residues of the protein Mj0747 (NCBI Genbank accession number C64393 starting from residue 23 of the deposited sequence). The complementary C-terminal primer, MjHr-4, contained a TAA stop codon followed by a HindIII restriction site and the complement of the sequence encoding the C-terminal 8 amino acid residues. The primers have nucleotide sequences as follows:

23 24

NdeI start MjHr-5 5'-GGAGATATATACATATGAAAAAAGAGATA-3'

HindIII stop MjHr-4 5'-ATCGATGATAAGCTTTTAATCAATTTTAACTGCTTCATCCTC-3'

The PCR amplification used Taq DNA polymerase (Sigma). The PCR cycling parameters consisted of: a “hot-start” at 95 °C for 5 min, followed by thirty cycles of: denaturation at 94 °C for 1 min., annealing at 52 °C for 1 min., and extension at 68 °C for

1 min. The PCR mixture was brought to 4 °C and stored indefinitely. A “Wizard PCR product purification kit” (Promega, Inc.) was used to purify the PCR product. After

NdeI/HindIII double digestion of the PCR product and pT7-7 separately (Figure 2-1) [43] for 24 hours at 37 °C. The PCR product was ligated into plasmid pT7-7 by incubation with T4 DNA ligase (Boehringer Mannheim) at 15 °C for 20 hours. The ligation mixture was transformed into E. coli 71/18 cells using the “simple and efficient method” (SEM)

[44]. Colonies grown on LA/amp plates were used to inoculate 1-mL LB/amp cultures.

After growth overnight at 37 °C, standard alkaline lysis minipreps and NdeI, HindIII digestion were performed to verify that the plasmid contained an insert of the size expected for the MjHr gene. Positive clones were then cultured overnight at 37 °C in 50

mL of LB/amp. Plasmid DNA was purified using Qiagen Midi Prep plasmid DNA

preparation kits (Qiagen, Inc.) and the sequence was verified at the Molecular Genetics

Instrumentation Facility (Figure 2-2). A plasmid with the correct sequence (pDMK-6)

was then transformed by the SEM protocol into E. coli BL21(DE3) cells for

overexpression. Dr. Chris Farmer had isolated the Mj genomic DNA and cloned the

MjHr gene into pT7-7. 25

B. Overexpression and Purification of Recombinant MjHr

Cultures transformed into E. coli BL21(DE3) containing pDMK-6 were incubated overnight in 20 mL of LB/amp at 37 °C while shaking at 250 rpm. The 20-mL culture was then used to inoculate 4 x 800-mL cultures of LB/amp under the same temperature and shaking conditions. Each 800-mL culture was then used to inoculate a 100-L fermenter of LB/amp under the same temperature and shaking conditions in the

Fermentation Plant at the University of Georgia. When OD600 of the cultures reached

~0.6-1.0 (ca. 3-4 hrs.), isopropyl-β-D-thiogalactopyranoside (IPTG) was added to a final

concentration of 0.4 mM to induce overexpression of the MjHr gene. Incubation

continued until OD600 reached ~2.0 (ca. 3-4 hrs.), at which time the cells were harvested by centrifugation at 5000 x g at 4 °C (typically yielding 300-350 g cell paste). This cell paste was then split into 4-5 portions consisting of ~80 g each, which were stored at -80

°C. The cell paste from one 80 g portion was thawed for ~1 hr. at room temperature and resuspended in ~200 mL of 50 mM HEPES/150 mM Na2SO4/pH 7.5 (Buffer A). The

cells were then sonicated in ~35-mL portions on ice using a Sonic Dismembranator

(Fischer Scientific). The conditions for sonication were 10 seconds pulse at 50 % power,

followed by 10 seconds off, for 2 minutes. The lysed cells were then centrifuged at

30,000 x g for 30 min. at 4 °C. The supernatant (ca. 150-250 mL) was then transferred to

a 400-mL beaker containing a magnetic stir bar. Successive ammonium sulfate

precipitation/centrifugation at 30,000 x g (ammonium sulfate cuts) were performed and

Tricine-sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) analysis

[45] was used to monitor the supernatant and precipitate for MjHr. The MjHr protein

remained soluble in 150-250 mL of the supernatant after the first addition of 35.1-58.5 g 26 of ammonium sulfate/centrifugation, which represents a 0-41 % ammonium sulfate cut.

The MjHr still remained soluble after a second 41-62 % ammonium sulfate cut (ranging from 19.0-31.8 g ammonium sulfate to 150-250 mL solution, respectively). However, upon addition of 20.9-34.8 g of ammonium sulfate to 150-250 mL to achieve a 62-82 % ammonium sulfate cut, the MjHr precipitated out of solution. The pellet containing MjHr was then resuspended in 50 mM HEPES/pH 7.5 (~15-20 mL) and transferred to 3,500-

MWCO dialysis tubing (Fischer) and dialyzed against 4 L of the same buffer overnight at

4 °C to dilute the ammonium sulfate. The dialyzed fraction was then concentrated to ~4 mL under argon pressure by ultrafiltration (Amicon YM3 membrane, 3,000 MWCO).

All subsequent column chromatographies were conducted at room temperature. The concentrated, crude MjHr solution was loaded in two 2-mL runs on a 5-mL HiTrap Q HP column (Amersham Pharmacia Biotech) pre-equilibrated in 50 mM HEPES/pH 7.5. The

MjHr did not stick to the HiTrap column and the flow-through fractions were collected and concentrated to 2-3 mL by ultrafiltration in an Amicon cell (YM3). A few crystals of potassium ferricyanide were added to the Amicon cell to convert all the MjHr to the met form. The protein solution was then filtered through a microfilter (0.2 µm, Millipore,

Inc.) and loaded onto a HiPrep 16/60 Sephacryl S-100 HR (Amersham Pharmacia

Biotech) column pre-equilibrated in Buffer A. The MjHr was eluted with Buffer A at a flow rate of 0.5 mL min-1 as the major 280-nm absorbing band (~145-150 min.). Tubes ranging in elution time from 140-180 minutes and containing MjHr, as determined from

SDS-PAGE, were pooled and concentrated to ~15 mL by ultrafiltration in an Amicon cell

(YM3) along with a few crystals of potassium ferricyanide. The MjHr solution was then dialyzed again against 4 L of 50 mM HEPES/pH 7.5 in dialysis tubing (3,500 MWCO) 27 overnight at 4 °C. The dialyzed MjHr was then concentrated to ~4 mL by ultrafiltration in an Amicon cell (YM3). The concentrate was run again over the HiTrap Q HP column, described above, pre-equilibrated in 50 mM HEPES/pH 7.5. The MjHr, again, eluted in the flow-through. This protein, referred to as, as-isolated, was then concentrated to ~1 mL by ultrafiltration in an Amicon cell (YM3) and stored at -80 °C until further use. See

2.C. for protein determination and metal content.

If significantly less than 2 mols Fe/mol MjHr was found, the purified as-isolated

MjHr was reconstituted similarly to the procedure used for Phascolopsis gouldii Hr [15].

(Note: the reconstitution procedure described below was also successfully carried out on

MjHr just after the 62-82 % ammonium sulfate precipitation and dialysis to remove ammonium sulfate). All steps were carried out at room temperature except centrifugations and Amicon concentrations, which were carried out at 4 °C. After the last

HiTrap column, the concentrated, purified as-isolated MjHr (~1-2 mL) was transferred to a 500-mL Schlenk flask, containing ~20 mL of 6M guanidine-HCl in Buffer A, 200 µL of 2-mercaptoethanol and a magnetic stir bar, fitted with a pressure-equalizing addition funnel containing 150-200 mL of Buffer A. The side-arm of the Schlenk flask was attached to a vacuum manifold and the flask was alternately evacuated and flushed with argon. With a positive pressure of argon in the system, the addition funnel was removed briefly while ~0.1 g of solid ferrous ammonium sulfate was added. The addition funnel was then reattached and the system was again alternatively evacuated and flushed with argon (3-5 times). The system was then sealed under positive pressure of argon and buffer from the addition funnel was added in a dropwise manner over ~10-12 hour time period, while the solution was stirring. After the entire volume of buffer had been added, 28 the solution was centrifuged at 30,000 x g for 30 min. at 4 °C. The resulting solution was concentrated by ultrafiltration in an Amicon cell (YM3) to ~5 mL. Buffer was added to the Amicon cell to a final volume of 50 mL to dilute the guanidine-HCl and the MjHr was then reconcentrated to ~5 mL under argon. Two more rounds of the dilution/re- concentration were performed. After the third re-concentration to ~5 mL, a few crystals of potassium ferricyanide were added to convert all the protein to the met form and the solution was allowed to stir for ~1 hr. The MjHr solution was then filtered through a microfilter (0.2 µm) and loaded onto a HiPrep 16/60 Sephacryl S-100 HR column pre- equilibrated in Buffer A. The MjHr was eluted with Buffer A at a flow rate of 0.5 mL min.-1 as the major 280-nm absorbing band (~145-150 min.). Fractions eluting between

140-170 minutes contained MjHr, as determined from SDS-PAGE. These fractions were

pooled and concentrated to ~1 mL by ultrafiltration in an Amicon cell (YM3). This

protein, referred to as, reconstituted MjHr, was stored at -80 °C until further use. Typical yields of recombinant MjHr was ~40 mg per 80 g cell pellet for both the as-isolated and reconstituted proteins.

C. Characterization of MjHr

MjHr in the met form, which was yellow in color, in 50 mM HEPES/150 mM

Na2SO4/pH 7.5 (Buffer A) was used as the starting point for preparation of all other

derivatives. All assays and UV-vis absorption spectra were conducted in 1-cm

pathlength cuvettes using a Shimadzu UV/2401 PC spectrophotometer. 29

C.1. Protein Determination and Metal Content

Amino acid analysis was performed on purified MjHr at the University of

Nebraska Medical Center Protein Structure Core Facility. Metal content was determined by inductively coupled plasma atomic emission at the Chemical Analysis Laboratory at the University of Georgia.

C.2. Molecular Weight of MjHr

The solution molecular weight of native MjHr was determined by passage over a

HiPrep 16/60 Sephacryl S-100 HR equilibrated in Buffer A after calibration with carbonic anhydrase (29,000), cytochrome c (12,400), and aprotinin (65,000). Molecular weight of apo-MjHr was determined at the University of Georgia’s Chemical and

Biological Sciences Mass Spectrometry Facility by liquid chromatography-electrospray ionization-mass spectrometry (LC-ESI-MS).

C.3. Preparation of MjHr Derivatives

The azide derivative of MjHr in Buffer A was prepared by adding azide from a

1 M stock of NaN3 to a final concentration of 50 mM NaN3 to 22 µM MjHr and

incubation at room temperature for 15-20 minutes. The phenol derivative of MjHr was

prepared by adding a drop of water-saturated phenol to an Eppendorf tube containing 1

mL of 22 µM MjHr, which was later centrifuged to remove any precipitate. UV-vis

absorption spectra of the azide and phenol adducts were then obtained. DeoxyHr was

prepared by anaerobic dialysis of a few milliliters of 42 µM metHr against 600 mL of

~50 mM sodium dithionite in Buffer A for at ~24 hours in a Coy anaerobic chamber at 30 room temperature. The protein was then dialyzed 3-5 times against 600 mL of deoxygenated Buffer A to remove excess dithionite. The deoxy form, which was determined by the featureless UV-vis absorption spectrum, was then used for kinetics experiments.

C.4. Activity Assays of Recombinant MjHr

Catalase and a modified procedure of the glucose oxidase activity assays were conducted according to those found at the Worthington Biochemical website in the

Enzyme Manual [46]. Catalase activity was monitored as change in absorbance at 240 nm due to loss of H2O2. The assay was carried out in 0.633 mL of 50 mM potassium

phosphate buffer, pH 7.0 by adding 0.333 mL of 59 mM H2O2 in 50 mM potassium phosphate buffer, pH 7.0 and 0.034 mL of 1 µM MjHr.

The modified procedure of the horseradish peroxidase (HRP)/glucose oxidase- couple assay [46] was used to detect H2O2 generation from MjHr upon autoxidation of

deoxyMjHr. This assay detects H2O2 using HRP-catalyzed oxidation of o-dianisidine

(3,3′-dimethoxy-4,4′-diaminobiphenyl, oDD) according to the equations below [47-49],

• where [PPIX+ Fe(IV)=O] represents a two-electron oxidized heme [50]:

+• H2O2 + [PPIXFe(III)]HRP [PPIX Fe(IV)=O]HRP + H2O

• oDD + [PPIX+ Fe(IV)=O]HRP oDD quinonediimine + [PPIXFe(III)]HRP

HRP and oDD were used as purchased from Sigma Chemical Co. Inc. The assay

was carried out by mixing 225 µL of ~20 µM of deoxy-MjHr with 50 µL of O2 saturated 31

Buffer A for 1 min. The solution was then transferred to a cuvette containing 250 µL of the HRP/oDD-buffer mix. H2O2-dependent oxidation of oDD was monitored as

described in the Worthington Biochemical Enzyme Manual [46], except the total reaction

volume was 0.515 mL. Hydrogen peroxide was quanitated by measuring absorbance at

4 -1 -1 460 nm (ε460 = 1.13 x 10 M cm ) as a result of o-dianisidine oxidation. In order to test

the sensitivity of this assay, 10 µL of HRP was added to 500 µL of oDD-buffer mix and

the reaction was initiated by addition of H2O2 to concentrations of 2, 7, 10, or 50 µM.

Superoxide dismutase (SOD) activity of MjHr was tested using a standard assay

described by Beyer and Fridovich [51]. This assay measures the inhibition of

cytochrome c reduction by superoxide, which is generated from a xanthine/xanthine oxidase solution. One micromolar of as-isolated MjHr was used and specific activities were calculated as the quantity of protein, in milligrams, needed for 50 % inhibition of cytochrome c reduction.

Para-Phenylene diamine (pPD) oxidase and pPD peroxidase activities [49] were

carried out as well. These assays were carried out in 1.1 mL of 50 mM HEPES/1 mM

diethylenetriaminepentaacetic acid (DTPA)/pH 7.0 and used 1 µM MjHr, 0.1 mM H2O2

(for peroxidase or buffer for oxidase), and 33 µL of pPD from a 1 % w/v stock solution.

Activity was followed by monitoring absorbance increase at 485 nm.

Reduction of MjHr by NADPH catalyzed by ferredoxin-NADP(+) reductase from

Spinach leaves (FNR) and rubredoxin (Rub) was carried out as described for reduction of

ruberythrin by Coulter and Kurtz [52]. The reaction was carried out anaerobically in 50

mM HEPES/1 mM DTPA/pH 7.0 in a volume of 0.6-mL. UV-vis absorption spectra

were obtained after addition of NADPH to 17 µM and FNR to 0.5 µM to 17 µM MjHr. 32

The reaction was initiated by addition of 0.5 µM Desulfovibrio (D.) vulgaris Rub (Note:

Pyrococcus (P.) furiosus Rub was also used in place of D. vulgaris Rub). Evidence of reduction was seen by reoxidation upon exposure to air by the partial restoration of the metMjHr spectrum. Since MjHr was found to be reduced by this method (see 3.C.),

NADPH oxidase, peroxidase, and superoxide oxidoreductase (SOR) could be tested.

The NADPH peroxidase assay monitored NADPH consumption as decrease in absorbance at 340 nm v. time. The reaction was carried out aerobically in Buffer A using

0.5 µM for all proteins, 121 µM NADPH, and 250 µM H2O2 in a 1-mL total volume.

Oxidase activity was measured in this reaction mixture prior to the addition of peroxide.

Likewise, SOR activity monitored as ∆A340 nm was performed aerobically in

Buffer A as described by Coulter and Kurtz [52]. Protein concentrations were added as

follows: 0.2 mM xanthine, 100 µM NADPH, 0.9 µM FNR, 0.5 µM D. v. Rub, 1 µM

- -1 MjHr, and finally XO sufficient to generate 11.9 µM O2 min. (as determined by the rate

of increase in absorbance at 550 nm upon reduction of 100 µM cytochrome c).

Ferroxidase activity was assayed similarly to a procedure described by Bonomi et

al. [53]. The assay was carried out in 1 mL of 50 mM HEPES/200 mM Na2SO4/pH 7.0

using 120 µM ferrous ammonium sulfate from a 15-mM stock in Buffer A. Addition of 1

µM MjHr started the reaction and activity was monitored as the rate of absorbance increase at 315 nm.

C.5. Far-UV Circular Dichroism (CD) Spectroscopy

Far-UV CD spectra were recorded on a Jasco 710 CD spectrometer equipped with

a nitrogen purge. Spectra were recorded using 14 µM MjHr in 50 mM HEPES/150 33

Na2SO4/pH 7.5. The spectra, an average of 5 accumulations, were obtained at 25 °C

using: a 0.1-cm pathlength cylindrical quartz cuvette, 1-nm resolution, 10-nm bandwidth,

20-mdeg sensitivity, 2 sec. response time, and 100 nm/min. scan speed.

C.6. Electron Paramagnetic Resonance (EPR) Spectroscopy

EPR spectra were obtained using a Bruker ESP-300E spectrometer equipped with

an ER-4116 dual-mode cavity and an Oxford Instruments ESR-9 flow cryostat. The EPR

conditions were as follows: 200 µM MjHr in 50 mM HEPES/150 mM Na2SO4/pH 7.5,

4.0 K, 9.58 GHz frequency, 2.0 mW power, 6.366 G modulation amplitude, 100 kHz

modulation frequency.

D. Preparation of Polyclonal Antibodies Against MjHr

Antisera were raised in rabbits against purified MjHr at the Animal Resource

Facility at the University of Georgia. Purified MjHr in 20 mM potassium phosphate, pH

7.0 buffer was submitted to the facility. A pre-immune blood sample was taken prior to

the initial injection of MjHr (day 1). Then, a boost injection was given on day 21.

Subsequently, three boost injections were given at 3- or 4- week intervals. The serum

was collected 10 days after the fourth injection. The antisera were then precipitated by

addition of ammonium sulfate to 50 % saturation. The precipitated antibodies were

collected by centrifugation at 30,000 x g for 30 min. The pellet was then resuspended in

50 mM HEPES/ 200 mM KCl/ pH 7.5 and passed over a 5-mL Sephadex G-25 column

(Amersham Pharmacia). The antibodies that eluted were then dialyzed (MWCO 3,500)

against 2 L of 50 mM HEPES/ 200 mM KCl/ pH 7.5 for 48 hours at 4 °C. The dialyzed 34 antibodies were then centrifuged at 30,000 x g for 15 min. at 4 °C. The purified antibody solution was then separated into 1-mL aliquots and stored at -20 °C until further use.

E. Western Blot Analyses of Recombinant and Native MjHr

Procedures described in Current Protocols in Molecular Biology [54] for immunoblotting and immunodetection of the hemerythrin-like protein from the native M. jannaschii and the overexpressed MjHr from E. coli were followed. A Tricine SDS-

PAGE (4-20 %) was performed on the MjHr protein samples and M. jannaschii cell extracts. Upon completion of electrophoresis, the protein samples and cell extracts from the gel were transferred to a nylon membrane (Boehringer Mannheim, Inc.) via a tank transfer system (BioRad, Inc.). After the transfer procedure was completed, the membrane was incubated at ambient temperature for one hour in blocking buffer (100 mM potassium phosphate, 0.9 % sodium chloride, pH 7.5 (PBS), plus 10 % w/v non-fat dried milk). Then, the primary antibody (anti-MjHr) was added in a 1:500 dilution and was allowed to incubate for 4 hours at room temperature with constant, but mild stirring on an Orbit shaker (Labline, Inc.). After incubation with anti-MjHr, the membrane was washed three times with PBS buffer and further incubated for one hour with 1:1000 dilution of the secondary antibody alkaline phosphatase-anti-(rabbit-IgG) (Boehringer

Mannheim, Inc.) in TBS blocking buffer (100 mM Tris, 0.9 % NaCl, pH 7.5 (TBS), plus

10 % w/v non-fat dried milk). Following incubation with the secondary antibody, the membrane was washed three times with TBS and then incubated for 2 minutes in detection buffer (100 mM Tris-HCl, 100 mM NaCl, 5 mM MgCl2, pH 9.5). Target

proteins were detected using 1:100 dilution of a chromogenic visualization solution 35

(BCIP/NBT, Boehringer Mannheim, Inc.) (see 3.A. for gel of western blot analysis of native and recombinant MjHr). Dr. Heather Lumppio performed the Western Blot.

F. Kinetics of O2 Reactions with Recombinant deoxyMjHr

Anaerobic deoxyMjHr prepared as described in 2.C. in 50 mM HEPES/150 mM

Na2SO4/pH 7.5 was used as the starting form for all reactions. Rates of O2 oxidation and

autoxidation of deoxyMjHr were measured by stopped-flow spectrophotometry using a

rapid-scanning monochromator (OLIS, Inc.) in the laboratory of Professor Robert Phillips

at the University of Georgia. A depiction of the OLIS RSM 1000 system and a schematic

diagram of the instrument are shown in Figure 2-3. DeoxyMjHr protein concentrations

were 10-36 µM in diiron sites after mixing. A small amount of deoxyMjHr was exposed

-1 -1 to air to determine metMjHr protein concentration using ε280 = 31,500 M cm , since this

is the final product from oxygenation and autoxidation of deoxyMjHr.

First, both drive syringes were deoxygenated by incubation for at least 30 minutes

with sodium dithionite to remove traces of O2 in the syringes. The drive syringes were

then flushed 3 times with anaerobic Buffer A to remove dithionite. DeoxyMjHr was

transferred to one drive syringe, under argon flow, using a gas tight syringe. The other

drive syringe was loaded with buffer containing various concentrations of O2 (0.6, 0.125,

0.025 mM after mixing, assuming air-saturated buffer contains 0.250 mM O2 and pure

oxygen saturated buffer contains 1.2 mM O2, [55]) and temperatures of O2 solutions (25

or 50 °C). After rapid mixing of the two solutions in the stopped-flow (~2 msec. dead-

time), absorbance increases at 370 nm and 500 nm were monitored. Alternatively,

absorption spectra were collected at 1-ms intervals from 320-550 nm by rapid-scanning. 36

bla ClaI HindIII HincII PstI SalI pT7-7 XbaI BamHI ColE1 origin 2473 bp SmaI EcoRI BglI NdeI ∅ 10) ATG ( rbs Xba

T7 promoter (∅ 10)

TTCTGATAGACTTCGAAATTAATACGACTCACTATAGGGAGACCACAA

rbs CGGTTTCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATAC

ATATGGCTAGAATTCGCGCCCGGGGATCCTCTAGAGTCGACCTGCAGC| | | | | | | NdeI EcoRI SamI BamHI XbaI SalI PstI

CCAAGCTTATCATCGAT HindIII CalI

Figure 2-1. Restriction map of the plasmid, pT7-7 [43]. The MjHr gene was inserted into the NdeI and HindIII restriction sites. The ribosome binding-site (rbs), ampicillin resistance region (bla), and T7 promoter region are indicated. 37

1 ATGAAAAAAGAGATAATCAAATGGAGTAAAGATTTTGAAACGGGAATTAAAGCATTTGAT 60 M K K E I I K W S K D F E T G I K A F D

61 GATGAGCATAAAATTTTGGTTAAAACACTTAACGATATTTACAACCTACTAAACGAAGGA 120 D E H K I L V K T L N D I Y N L L N E G

121 AAAAGAGACGAAGCAAAAGAACTTTTAAAGAGAAGGGTTGTTAATTATGCTGCAAAGCAT 180 K R D E A K E L L K R R V V N Y A A K H

181 TTTAAGCATGAAGAGGAAGTTATGGAGAAATATGGTTATCCAGACTTAGAAAGGCATAGA 240 F K H E E E V M E K Y G Y P D L E R H R

241 AAAACTCATGAGATTTTTGTTAAAACAGTTATAGAAAAGTTACTTCCAAAGATCGAAGAA 300 K T H E I F V K T V I E K L L P K I E E

301 GGATCAGAAAATGATTTTAGGAGTGCTCTATCTTTCTTAGTGGGATGGCTCACAATGCAC 360 G S E N D F R S A L S F L V G W L T M H

361 ATAGCAAAACCAGATAAAAAATACGGAGAGTGGTTTAAAGAGAAAGGTATTGTTATCGAG 420 I A K P D K K Y G E W F K E K G I V I E

421 GATGAAGCAGTTAAAATTGATTAA 444 D E A V K I D *

Figure 2-2. Nucleotide and amino acid sequences of MjHr in the plasmid, pDMK-6. The translated amino acid sequence is shown below the nucleotide sequence. The amino acid sequence uses methionine-23 of MJ0747 (accession number C64393) as the start. 38

Reservoir Syringes

Stop Syringe

(A) Flow Plunger

Monochromator

Reservoir Syringes Light Input from Monochromator and Mirror Box (B)

Mixing Jet

Drive Stop Syringe Syringes

Drain Valve Block Valve Block

Observation Flow Cuvette Chamber Plunger

Light Output to Photomultiplier Tube

Figure 2-3. (A) The OLIS RSM 1000 Rapid Scanning Spectrophotometer; (B) Schematic diagram of the stopped-flow apparatus. Adapted from [19]. CHAPTER 3

RESULTS AND DISCUSSION

A. Characterization of Recombinant MjHr

It was determined that the recombinant MjHr protein could incorporate iron and

fold correctly when the plasmid pDMK-6 was overexpressed in E. coli BL21(DE3).

MjHr was isolated from the soluble, supernatant of the cell lysate (Figure 3-1). After

purification by ammonium sulfate precipitation, anion-exchange, and gel filtration

column chromatographies (as-isolated) and/or reconstitution with iron after ammonium

sulfate precipitation (reconstituted) (cf. Figure 3-2), the yield of overexpressed, purified,

iron-incorporated, yellow metMjHr was ~40 mg from ~80 g of E. coli cell paste. Metal

-1 -1 and protein analyses, using ε280 = 31,500 M cm (cf. 2.C.), confirmed the iron

incorporation as 2.0 ± 0.2 mols Fe/mol protein into the as-isolated MjHr, which was reproducible 2 out of 4 times with the remaining times having a mol Fe/mol protein ratio of 1.3 ± 0.2. Metal and protein analyses, i.e. 2.0 ± 0.2 mols Fe/mol protein, were reproducible in all five preparations of the reconstituted MjHr.

The calculated subunit molecular weight based on the amino acid sequence (cf.

Figure 2-2), 17,478 (assuming retention of the N-terminal methionine), is in good agreement with the molecular weight determined by LC-ESI-MS, 17478 ± 1 amu (Figure

3-3), performed under denaturing conditions. Both as-isolated and reconstituted MjHr eluted from a HiPrep 16/60 Sephacryl S-100 HR gel filtration column at a calibrated

39 40

retention time for a protein of Mr ~17,000 (Figure 3-4). Therefore, recombinant MjHr was determined to be monomeric in 50 mM HEPES/150 mM Na2SO4/pH 7.5. The peaks

eluting at 100 and 120 minutes, in the chromatogram of Figure 3-4, correspond to larger

molecular weight proteins, whereas the peak at 220 minutes corresponds to a smaller

mass protein.

The cloned MjHr gene was detected by immunoblotting (Western-blot) using

antibody against MjHr (anti-MjHr). Western-blot analysis confirmed the existence of a

~17,000 kD protein band in native M. jannaschii cell extracts that reacted with the anti-

MjHr antibody (Figure 3-5). The close alignment of the bands in the cell extract and

recombinant MjHr lanes reaffirm that the recombinant MjHr (starting from Met23 in the

NCBI Genbank accession number C64393) is the same protein as in the native organism,

as opposed to the full sequence (i. e., starting at Met 1 of the deposited sequence), which

would give a band at ~20,000 kD.

Homology modeling was performed using the 3D-JIGSAW (Comparative

Modeling Server) [56] and "SDSC1" - SDSC Protein Structure Homology Modeling

Server [57] to predict the tertiary structure of MjHr (Figure 3-6). Although the two

severs returned homology models with differing loop configurations, Figures 3-6 and 3-7

shows that both programs predict a four-helix bundle in about the same sequence region

of MjHr. Both the 3D-JIGSAW and SDSC1 servers modeled only the N-terminal 132

out of the 147 amino acid residues. Secondary structure prediction performed on the

MjHr amino acid sequence using the HMM-based Protein Sequence Analysis, SAM-T99

[58], predicted additional alpha-helical content between isoleucine 139 and lysine 145

(Figure 3-7). 41

B. Spectral Properties of Recombinant MjHr

-1 -1 An extinction coefficient ε280 = 31,500 M cm was determined for MjHr from

an average of two amino acid analyses using Val and Leu amounts and the amino acid

content listed in Figure 2-2. This value is in agreement with the calculated ε 280 = 23,470

M-1 cm-1 based on aromatic amino acid content without iron. This value was calculated

using the ProtParam tool on the Expert Protein Analysis System (ExPASy) Molecular

Biology Server [59].

The as-isolated and reconstituted MjHr proteins have UV-vis absorption spectra

closely resembling each other (Figure 3-8) and that of metmyoHr from P. gouldii (cf.

Figure 1-10). The spectrum of the as-isolated protein proves that iron incorporation into

MjHr can be accomplished without human intervention. The absorption spectra of

metMjHr (Figure 3-8) show maxima at 325 and 380 nm and shoulders at 490 and 625 nm

in both the as-isolated and reconstituted MjHr, which are indicative of a FeIII-O2--FeIII

moiety. The extinction coefficients were calculated from protein concentrations using

-1 -1 ε280 = 31,500 M cm and absorbances via Beer’s law, A = εlc. The extinction

-1 -1 -1 coefficients were found to be: 325 nm (ε325 = 6,000 M cm ), 380 nm (ε380 = 5,400 M

-1 -1 -1 -1 -1 cm ), 490 nm (ε490 = 560 M cm ), 625 nm (ε625 = 180 M cm ), for the reconstituted

-1 -1 -1 -1 MjHr and 325 nm (ε325 = 5,300 M cm ), 380 nm (ε380 = 3,900 M cm ), 490 nm (ε490 =

-1 -1 -1 -1 560 M cm ), 625 nm (ε625 = 190 M cm ), for the as-isolated protein. The slight

differences in the extinction coefficients of the as-isolated vs. reconstituted MjHr lie in the oxidation state of the proteins, since both have 2 mols Fe/mol protein. The as- isolated MjHr has an A280/A325 ratio of 6.0, whereas the reconstituted protein has a ratio

of 5.2, implying that the as-isolated protein was not fully converted to the met form. The 42 as-isolated MjHr showed similar UV-vis absorption, CD and EPR spectra, kinetic rates, and activities. However, due to the lower A280/A325 ratio in the as-isolated MjHr, the

remaining results discussed were all done on the reconstituted form.

Evidence of the four α-helix secondary structure in MjHr can be seen from the

far-UV CD spectrum in Figure 3-9. The CD spectrum shows a double minimum at ~210

2 and 220 nm with a molar ellipticity at 222 nm ([θ]222) of -60,000 deg cm /dmol. The

double minimum is characteristic of proteins with mostly helical content. The spectrum

in Figure 3-9 closely resembles the CD spectrum of P. gouldii metmyoHr [60]. The percentage α-helical content in MjHr, ~72 %, was calculated using the method described

2 by Ghadiri and Choi using [θ]222 = -35,000 deg cm /dmol for 100 % and +3,000 deg cm2/dmol for 0 % helix [61].

The MjHr proteins should not have an EPR signal in the met form due to two

antiferromagnetically coupled Fe(III). However, the EPR spectrum (Figure 3-10) of both

the as-isolated and reconstituted MjHr show signals with similar g-values (~1.93, ~1.84,

~1.64) corresponding to a S = ½ spin state. The g-values are consistent with a (semi-

met)R [Fe(II), Fe(III)] spectrum due to incomplete conversion to metMjHr. The signal-

to-noise is higher in the as-isolated spectrum, implying a higher proportion of semi-met,

consistent with the UV-vis absorption spectra of Figure 3-8.

C. Exogenous Ligand Binding to MjHr

Exogenous ligand binding to MjHr was examined using the metMjHr as the

starting form and the UV-vis absorption spectrum of each adduct are shown in Figure 3-

11. Upon addition of 50 mM azide to metMjHr and short incubation, formation of two 43

-1 -1 -1 -1 distinct peaks at 325 nm (ε325 = 5,300 M cm ) and 440 nm (ε440 = 4,500 M cm ), a

-1 -1 small shoulder at 380 nm (ε38 = 4,100 M cm ), and a broad absorbance at 680 nm (ε680

-1 -1 = 190 M cm ) in the absorption spectrum can be seen. By comparison to Figure 1-9,

these absorption peaks are indicative of an azidomet adduct of MjHr. Absorption

changes from met to azidomet are rapid, i.e. within mixing time, whereas the azidomet

adduct of P. gouldii myoHr takes several hours to form under the same conditions [14].

It has been previously determined that phenol does not bind to P. gouldii metmyoHr

(i. e., addition of phenol does not change the UV-vis absorption spectra), presumably

because the ligand binding pocket cannot accommodate a molecule as large as phenol

[35]. However, Hr-like proteins, DcrH-Hr, from Desulfovibrio vulgaris (Hildenborough)

[35], and Pseudomonas aeruginosa Hr [19], were found to bind phenol, apparently due to

a larger binding pocket. When phenol is added to metMjHr, a rapid change in the

absorption spectrum in the region of 495 nm occurs. This absorption change is assigned

to a ligand-to-metal charge-transfer (LMCT) transition of a FeIII-phenolate adduct [62].

The absorption features at 325 and 380 nm, indicative of an FeIII-O2--FeIII moiety, are both retained after the addition of phenol, thereby supporting the existence of a larger exogenous ligand binding pocket.

MetMjHr can be reduced to the colorless deoxyMjHr by sodium dithionite. The absorption spectrum of deoxyMjHr after removal of dithionite is shown in Figure 3-12.

Upon exposure to air, the deoxyMjHr extremely rapidly changed from colorless back to yellow. The color change back to yellow is indicative of autoxidation. There was no evidence of a stable oxyMjHr form, unlike P. gouldii myoHr [14], which has a stable (t1/2

~10 hours at room temperature) oxy form. The "oxy" absorption spectrum shown in 44

Figure 3-12 was recorded on a Shimadzu spectrophotometer after removing the rubber septum from the top of the cuvette and shaking the cuvette gently in air for ~2 seconds prior to recording the spectrum. A small feature at 500 nm could be seen transiently in the absorption spectrum, as well as absorptions at 325 and 380 nm. By comparing the absorption spectra of oxyMjHr and oxy P. gouldii myoHr (cf. Figure 1-9), the peak at

500 nm is indicative of a peroxo ! Fe(III) LMCT and O2 binding. The features at 325

and 380 nm are representative of the FeIII-O2--FeIII moiety.

D. Activities of MjHr

The reduction of rubredoxin (Rub) by NADPH catalyzed by spinach ferredoxin-

NADP+ oxidoreductase (FNR) has been well-characterized [63]. It has also been shown that the diiron center in D. vulgaris ruberythrin (Rbr) can be rapidly reduced using

NADPH/FNR/Rub under anaerobic conditions [52]. We, therefore, tested whether MjHr could be similarly reduced. In fact, 17 µM MjHr was shown to be reduced by NADPH

catalyzed by FNR and D. v. Rub, as monitored by UV-vis absorption spectra (Figure 3-

13). Addition of a catalytic amount of FNR resulted in a negligible increase in the MjHr

absorption spectrum. After addition of NADPH to MjHr/FNR, an increase in absorbance

at 340 nm is observed due to NADPH. Upon reaction initiation by addition of Rub, a

decrease in absorbance at 340 nm is observed, indicative of 17 µM NADPH oxidation.

FNR and Rub were required for reduction of MjHr and all were required for NADPH

consumption. Therefore, the electron transfer pathway for this reaction must be NADPH

→ FNR → Rub → MjHr. Upon exposure to air, the metMjHr UV-vis absorption spectrum could be quickly and quantitatively be regenerated. Since MjHr could be 45 reduced by this method, it was then reasonable to test NADPH oxidase, peroxidase, and superoxide oxidoreductase (SOR) activities of FNR/Rub/MjHr.

MjHr was shown to have low SOD activity, comparable to that of Rbr and nigerythrin (Ngr) from D. vulgaris in the standard assay [64]. An average of three assays showed MjHr has 47.6 ± 0.2 units/mg of SOD activity, whereas Rbr and Ngr have 51 ± 1 and 60 ± 1 units/mg, respectively (Figure 3-14) [64]. This activity, however, is only ~1

% of “true” SODs [65].

Similarly to Hr, MjHr tested negative for catalase, peroxidase (using p-phenylene diamine (pPD) and NADPH assays), oxidase (using pPD and NADPH assays), ferroxidase, and SOR activities when assayed as described in 2.C.4.

E. Tests for Hydrogen Peroxide Production During Autoxidation of MjHr

MjHr tested negative for H2O2 production 1 min. after mixing the deoxy form with O2 using the HRP/o-dianisidine assay. This assay is based on oxidation of o-

dianisidine through a peroxidase-coupled system, as described in 2.C.4. H2O2

concentrations from 2 to 50 µM were detected under the conditions described in 2.C.4.

F. Kinetics of O2 Reactions with deoxyMjHr

Autoxidation rates of deoxyMjHr were measured by stopped-flow

spectrophotometry, and the rate constants determined from fitting A500 vs. time and A370

vs. time plots are summarized in Table 3-1. Because MjHr does not form a stable oxy

complex, the O2 dissociation rate (koff) could not be measured. The time courses in

Figure 3-15 A and B show rapid increases in absorbance at both 370 and 500 nm upon 46

mixing O2 with deoxyMjHr. These absorbance increases, referred to as k1, occurred too

rapidly to measure a rate, but given the dead-time of the stopped-flow mixing (2 msec.),

the rate constants for these rapid increases in absorbance must be >300 s-1. If it is

assumed that these rapid increases are due to formation of oxy and that the MjHr oxy

absorption spectrum is similar to that of invertebrate oxyHrs, then the magnitude of the

increase in A500 is consistent with 45 % of the deoxyMjHr being converted to oxy (cf.

Table 3-2). After these rapid increases, the time courses (Figure 3-15 A and B) showed a decrease in absorbance at 500 nm and a further increase at 370 nm with similar rate

-1 constants designated k2, of 1-2 s . Assuming that this second increase in A370 and

-1 -1 decrease in A500 is due to formation of met, then, using ε370 = 5,400 M cm ,

approximately 67 % of deoxyMjHr underwent conversion to met at the end of the k2

phase (cf. Table 3-2). Following k2, a slower increase in absorbance at both 370 and 500

-1 nm, designated k3, having a rate constant of approximately 0.04 s , was observed over

approximately 60 sec. Once again assuming these slowest increases in A370 and A500 are due to formation of met, then, after 60 sec., deoxyMjHr was quantitatively converted to metMjHr based on the absorption spectra in Figures 3-16 and the data in Table 3-2.

The kinetic studies described above were carried out at 25 °C. Analogous stopped-flow studies carried out at 50 °C showed rapid absorbance increases at 370 nm and 500 nm with rates constants >300 s-1 (Figure 3-17). After these rapid increases, a

decrease in absorbance at 500 nm and a further increase at 370 nm with a rate constant of

-1 approximately 5 s , i. e., similar to but 2.5-5 times faster than k2 at 25 °C, was observed

(Figures 3-17 A and B and Table 3-1). Based on the absorbance increase at 370 nm and

-1 -1 ε370 = 5,400 M cm , approximately 50 % of deoxyMjHr underwent conversion to met 47 within 2 sec. at 50 °C. Unfortunately, stopped-flow measurements beyond 2 sec. were not carried out at 50 °C.

G. Discussion

Western blots show that MjHr, is, in fact, expressed in M. jannaschii.

Spectroscopic evidence demonstrates that the recombinant MjHr can fold into a stable protein containing a four-helix bundle and a Hr-type diiron site. Homology modeling of

MjHr provides further support for a four-helix bundle structure similar to those found in other Hrs. The two homology models, 3D-JIGSAW and SDSC1, account for 58 % and

66 %, respectively, of the alpha helical content of MjHr, whereas the predicted secondary structure accounted for 80 % of the alpha-helix content. When compared to the helix content experimentally determined from the far-UV CD spectrum (72 %), the SDSC1 model more accurately depicts the tertiary structure of MjHr.

At 25 °C, the stopped-flow kinetic data are consistent with deoxyMjHr being rapidly converted to oxyMjHr upon reaction with O2, which is followed by a slower

autoxidation to metMjHr. During the k1 phase, deoxyMjHr is converted to oxy by reacting with O2, corresponding to rates of increases in absorbance at 370 nm and 500 nm

-1 of >300 s . Approximately 67 % autoxidation to met occurred during k2, corresponding

to an absorbance increase at 370 nm and decrease at 500 nm that occurred on the same

-1 time scale (1-2 s ). The remaining 33 % of MjHr was converted to met during k3, corresponding to increases at both 370 and 500 nm. More than one mechanism of MjHr autoxidation is consistent with the kinetic data. Various possibilities are diagrammed in

Figure 3-18. The k2:k3 ratio of ~50 is inconsistent with the 67:33 conversion ratio to met 48

via k2 and k3 from a single deoxy species. Therefore, an alternative species, deoxy´, which undergoes “outer sphere” autoxidation, is invoked for the k3 pathway.

Alternatively, if the MjHr were incompletely reduced to deoxy prior to the stopped-flow

mixing with O2, then the k3 phase could be oxidation of semi-met to met. However, 33 %

contamination of the deoxyMjHr by semi-met seems unlikely. A third interpretation is

that H2O2 is lost during the rapid autoxidation, k2, which could then react with deoxy´ via

the k3 pathway. However, this last interpretation seems unlikely because generation of

H2O2 was not detected during autoxidation using the HRP/o-dianisidine assay. However,

this assay is not conclusive due to the amount of time MjHr was allowed to react before

mixing with the HRP/o-dianisidine mixture. Reactions at 50 ºC indicate ~50 %

conversion of deoxy to oxy to metMjHr after 2 sec. However, since time courses were

not measured beyond 2 sec. at 50 °C, nothing more can be concluded about the behavior

at higher temperatures.

The rapid autoxidation suggests that MjHr has a different role than carrying O2.

Based on the rapid autoxidation of MjHr and the ability to bind phenol and azide, MjHr

appears to have a larger ligand-binding pocket than does Hr from marine invertebrates.

What is the possible function of MjHr? In marine invertebrates, the Hr-diiron site was

evolved to reversibly bind O2. When life first began, it has been suggested that the

atmosphere was rather reducing, and evolved into an oxidizing environment [66]. Since

Methanococcus jannaschii is classified as a methanogenic archaeon living in an

anaerobic environment, one can speculate that the organism contains a Hr-like protein to

either sense or scavenge O2. Since this study failed to demonstrate catalytic reduction of

O2 by MjHr, a sensing function may be more likely. 49

1 2 3 4 5

kD 40.0

31.0

21.5

MjHr 14.4

1. Mid-Range Molecular Weight Markers 2. Cells before induction with IPTG 3. Cells after induction with IPTG 4. Supernatant after sonication of cells 5. Pellet after sonication of cells

Figure 3-1. Tricine SDS-PAGE of overexpression of MjHr in E. coli BL21(DE3). 50

1 2 3

kD 30 25

MjHr MjHr 15 14.3

10

1. Purified reconstituted MjHr (~12 µg/µL) 2. Amersham Full Range Rainbow molecular weight markers 3. Purified reconstituted MjHr (~8 µg/µL)

Figure 3-2. Tricine SDS-PAGE of purified recombinant reconstituted MjHr. 51 Rel. intensity

16 15 14

Figure 3-3. Liquid-Chromatography-Electrospray Ionization Mass Spectrum (LC-ESI-MS) of MjHr. (top) Elution profile of the MjHr sample from HPLC before loading onto the ESI-MS. (middle) Electrospray ionization mass spectrum of protein after the HPLC. The numbers in red indicate the mass-to-charge ratio of ionized protein. (bottom) Reconstructed mass spectrum of correlated HPLC and electrospray data indicating the measured molecular weight. 52

MjHr 280 A

0 40 80 120 160 180 220

Time (min.)

Figure 3-4. Gel filtration elution profile of reconstituted MjHr on a HiPrep 16/60 Sephacryl S-100 HR column in 50 mM HEPES/150 mM Na2SO4/pH 7.5. Sample was from supernatant from lysed cell pellet containing pDMK-6 from E. coli BL21(DE3) and iron incorporation as described in 2.B. 53

1 2 3 4

Figure 3-5. Western-blot of MjHr probed with anti-MjHr antibody after blotting from a 4- 20 % SDS-PAGE gel. Lanes 1 and 4 contain purified, recombinant MjHr (rHr) from E. coli BL21(DE3). Lanes 2 and 3 contain M. jannaschii cell extracts (CE). This blot was obtained by Dr. Heather Lumppio. 54

Met1 Met1

Phe132 Phe132

Figure 3-6. Predicted tertiary structure of MjHr using 3D-JIGSAW (Comparative Modeling Server) (left) [56] and "SDSC1" - SDSC Protein Structure Homology Modeling Server (right) [57]. Iron binding ligands are shown in yellow wireframe representation. Polypeptide backbones are shown in ribbon representation. 55

nd Mj-2 Helix 1 Helix 2 MjHr MKKEIIK WSKDFETGIK AFDDEHKILV KTLNDIYNLL EGKRDEAKELLK

3D-JIG Helix 1 Helix 2

SDSC1 Helix 1 Helix 2

Mj-2nd Helix 2 Helix 3

MjHr RRVVNYA AKHFKHEEEV MEKYGYPDLE RHRKTHEIFV TVIEKLLPKIEE β 3D-JIG Helix 2 Helix 3 -sheet

Helix 2 Helix 3 SDSC1

Mj-2nd Helix 4 Helix 5

MjHr GSENDFR SALSFLVGWL TMHIAKPDKK YGEWFKEKGI IEDEAVKID β-sheet 3D-JIG Helix 4

Helix 4 SDSC1

Figure 3-7. Secondary structure of MjHr and 3D-JIGSAW [56] and SDSC1 [57] homology models. Mj-2nd represents a secondary structure prediction of MjHr using SAM-T99 [58]. 3D-JIG and SDSC1 are secondary structures from atomic coordinates generated from 3D-JIGSAW and SDSC1 models, respectively, and their predicted sequences are highlighted in grey. Conserved residues are in blue, residues lining the O2 binding pocket are highlighted in yellow, and those furnishing iron ligands are in red. 56

3.0 0.8

2.5 0.6 ce n 2.0 0.4 ba r as-isolated bso 1.5 A 0.2 Absorbance 1.0 reconstituted 0.0 300 400 500 600 700 800 Wavelength (nm) 0.5 as-isolated

0.0 reconstituted 300 400 500 600 700 800

Wavelength (nm)

Figure 3-8. UV-vis absorption spectra of as-isolated, dashed line, and reconstituted, solid line, recombinant MjHr in 50 mM HEPES/150 Na2SO4/pH 7.5. The as-isolated spectrum is offset vertically for clarity. 57

0

-10

-20 /dmol) 2 -30

-40 (deg cm 3

-50 ] x 10 θ θ θ θ [ -60

-70 200 210 220 230 240 250

Wavelength (nm)

Figure 3-9. Far-UV circular dichroism spectra of recombinant MjHr (14 µM) in 50 mM HEPES/150 mM Na2SO4/pH 7.5. The spectrum is an average of 5 accumulations and was obtained at 25 °C using: a 0.1-cm pathlength cylindrical quartz cuvette, 1-nm resolution, 10-nm bandwidth, 20-mdeg sensitivity, 2 sec. response time, and 100 nm/min. scan speed. 58

25000 g = 1.93 (A) 20000

15000

g = 1.84 10000

5000

0

-5000 g = 1.99 g = 1.64

-10000 3000 3500 4000 4500 Gauss

8000 g = 1.93 (B)

6000

g = 1.86 4000

2000 g = 1.62

0

g = 2.02 -2000 3000 3500 4000 4500 Gauss

Figure 3-10. EPR spectrum of as-isolated and reconstituted MjHr. (A) EPR spectrum of as-isolated MjHr. (B) EPR spectrum of reconstituted MjHr. The EPR conditions were: 200 µM MjHr in 50 mM HEPES/150 mM Na2SO4/pH 7.5, 4.0 K, 9.58 GHz frequency, 2.0 mW power, 6.366 G modulation amplitude, 100 kHz modulation frequency. 59

0.8 0.4

0.3 azide

0.6 0.2

0.1 met Absorbance phenol met 0.4 0.0 azide 400 500 600 700

Absorbance Wavelength (nm)

0.2

phenol 0.0 300 400 500 600 700 Wavelength (nm)

Figure 3-11. UV-vis absorption spectra of MjHr derivatives. The spectra shown are: met, solid line, met + 50 mM azide, dashed line, and met + water-saturated phenol, dotted line. Each sample (22 µM MjHr) is in 50 mM HEPES/150 mM Na2SO4/pH 7.5. All spectra were obtained at room- temperature in 1-cm pathlength cuvettes. 60

0.9 0.2

0.1 0.6 met

Absorbance deoxy "oxy" met

Absorbance 0.0 400 500 600 700 0.3 Wavelength (nm)

deoxy "oxy" 0.0 300 400 500 600 700 Wavelength (nm)

Figure 3-12. UV-vis absorption spectra MjHr derivatives. The spectra shown are: met, solid line, deoxy, dashed line, and “oxy”, dotted line. Each sample (22 µM MjHr) is in 50 mM HEPES/150 mM Na2SO4/pH 7.5. All spectra were obtained at room-temperature in 1-cm pathlength cuvettes. 61

0.2

0.1 Absorbance

0.0 300 400 500 600 700 800 Wavelength (nm)

Figure 3-13. FNR-catalyzed reduction of 17 µM MjHr by FNR/Rub under anaerobic conditions. The black spectrum corresponds to metMjHr. The green spectrum was taken after the addition of 0.5 µM FNR to metMjHr, while the blue spectrum corresponds to addition of FNR and 17 NADPH to metMjHr. The red spectrum was taken immediately after addition of 0.5 µM Rub. Finally, the pink spectrum shows the mixture upon exposure to air. All spectra were obtained at room-temperature in 1-cm pathlength cuvettes in 50 mM HEPES/150 mM Na2SO4/pH 7.5. 62

Figure 3-14. SOD activity of MjHr. The black line shows the rate of reduction of cytochrome c. The red, green, and blue, lines represent three separate assays indicating 50% inhibition of cytochrome c reduction, upon the addition of 1 µM MjHr. 63

(A) 500 nm 2.4

k3 2.3 +2 2.2

2.1 +2 2.8 k2 2.0 1.9 Absorbance x Absorbance 10 Abs. x 10 1.9 1.0 • 1.8 0.0 0 0.2 0.4 0.6 0.8 1.0 0 0.2 0.4Time 0.6 ( sec. 0.8) 1.0 1.7 0 10 20 30 40 50 60 Time (sec.)

(B) 370 nm

11

+2 10 k3

9.0 +2 7.5 k2 6.0 8.0 4.5 Abs. x 10 Abs. Absorbance x Absorbance 10 3.0 • 7.0 2.0 0 0.2 0.4 0.6 0.8 1.0 Time (sec.) 6.0 0 10 20 30 40 50 60 Time (sec.)

Figure 3-15. Representative time courses of absorbance changes at (A) 500 nm and (B) 370 nm following stopped-flow mixing of deoxyMjHr with O2 solution. The • represents the absorbance of deoxyMjHr when mixed with anaerobic buffer at 0.1 sec. The conditions, after mixing, were [O2] = 0.025 mM and [deoxyMjHr] = 0.021 mM at 25 °C. 64

12 3.0

10 +2 2.5 +2

8.0 Abs. x 10 2.0

6.0 1.5 450 500 550 Wavelength (nm) Absorbance x Absorbance 10 4.0

2.0

0.0 350 400 450 500 550 Wavelength (nm)

Figure 3-16. Representative absorption spectra obtained by stopped-flow scanning spectrophotometry following mixing of deoxyMjHr with O2 solution. The bottom (i. e., lowest absorbing) spectrum was obtained following stopped-flow mixing (0.1 sec.) of the same deoxyMjHr solution with the same volume of anaerobic buffer as used for the O2 solutions. The higher-absorbing spectra were obtained, from bottom to top, at 0.1, 1.6, 7, 13, 19, 26, 38, and 51 sec., respectively, following rapid mixing deoxyMjHr with O2.. The inset shows spectra at 0.1, 1.6, 19, and 51 sec. from lowest to highest absorbance at 500 nm. The conditions after mixing, were [O2] = 0.600 mM and [deoxyMjHr] = 0.021 mM in 50 mM HEPES/150 mM Na2SO4/pH 7.5 at 25 °C. 65

(A) 500 (B) 370

2 3.6 +2 1.5 + 3.2 1.2 2.8 0.9 2.4 0.6 bsorbance x 10 2.0 A

• x Absorbance 10 0.3 1.6 • 0 0.4 0.8 1.2 1.6 2.0 0 0.4 0.8 1.2 1.6 2.0 Time Time

6.0 (C) +2 4.0

2.0 Absorbance x Absorbance 10

0.0 350 400 450 500 550 Wavelength (nm)

Figure 3-17. Representative time course measurements and absorption spectra following stopped-flow mixing of deoxyMjHr with O2 solution at 50 °C. (A) Absorbance time course at 500 nm. (B) Absorbance time course at 370 nm. The • represents absorbance of the same solution of deoxyMjHr following mixing with anaerobic buffer at 0.1 sec. (C) Absorption spectra were obtained, from bottom to top, at 0.08, 0.8, in black, and 1.6 sec. ( in grey) following mixing. The conditions, after mixing, were [O2] = 0.250 mM and [deoxyMjHr] = 0.011 mM in 50 mM HEPES/150 mM Na2SO4/pH 7.5 at 50 °C. 66

Table 3-1. Rate constants obtained from A500 vs. time and A370 vs. time plots from stopped-flow reactions of recombinant deoxyMjHr with O2. a MjHr [O2] Temperature A500 A370 A500 A370 a -1 b -1 b -1 b -1 b concentration (°C) k2 (s ) k2 (s ) k3 (s ) k3 (s )

0.021 mM 0.025 mM 25 1.8 ± 0.35 0.90 ± 0.05 0.038 ± 0.003 0.030 ± 0.006 reconstituted 0.021 mM 0.125 mM 25 2.1 ± 0.30 0.95 ± 0.15 0.042 ± 0.004 0.042 ± 0.003 reconstituted 0.021 mM 0.600 mM 25 1.6 ± 0.25 1.6 ± 0.25 0.044 ± 0.005 0.036 ± 0.02 reconstituted 0.011 mM 0.025 mM 50 5.3 ± 1.4 4.7 ± 0.80 n.o.c n.o.c reconstituted 0.036 mM 0.120 mM 25 2.9 ± 0.75 1.6 ± 0.7 n.d.d n.d.d as-isolated a b Concentrations are after mixing. All rates were measured in 50 mM HEPES/150 mM Na2SO4/pH 7.5. Values determined from an average of three measurements. cNot observed. dNot determined. 67

Table 3-2. Absolute absorbances and calculated concentrations of MjHr species formed at various times following stopped-flow mixing of deoxyMjHr with O2 solution. Concentration Percentage of a a Time After Mixing A370 nm A500 nm (Species Formed, µM) Total MjHr 0.056 0.020 9.1b 45d ~2 msec. (oxy)

0.074 0.016 13.7c 67d ~2 sec. (met) 0.11 0.023 20.4c 100 ~60 sec. (met) a b -1 -1 Values determined from data shown in Figure III-15. Estimated using ε500 = 2,200 M cm reported for c -1 -1 P. gouldii oxyHr [19]. Determined using ε370 = 5,400 M cm determined in this work for metMjHr. dPercentage of oxy or met present at times indicated in column 1 assuming total protein concentration of MjHr to be 20.4 µM from column 4. 68

k1 deoxy oxy >300 s-1

-1 ~2 s k2

H2O2 ?

met

-1 -1 ~0.04 s ~0.04 s k3 k3 deoxy´ semi-met

deoxy [FeII(µ-OH) FeII] deoxy´ [FeII(µ-OH) FeII] III III - oxy [Fe (µ -O)Fe O2H ] met [FeIII(µ -O)FeIII] semi-met [FeIII FeII] or [FeII FeIII]

Figure 3-18. Proposed schemes for reaction of deoxyMjHr with O2. REFERENCES

1. Kurtz, D.M., Jr. (1999) in Essays in Biochemistry, D.P. Ballou, Editor, Portland

Press Ltd.: London. p. 85-100.

2. Lippard, S.J., Berg, J. M. (1994) in Principles of Bioinorganic Chemistry,

University Science Books: Mill Valley, CA. p. 284-285.

3. Magnus, K.A., Ton-That, H., Carpenter, J. E. (1994) Chem. Rev., 94, 727-735

4. Magnus, K.A., Hazes, B., Ton-That, H., Bonaventura, C., Bonaventura, J., Hol,

W. G. J. (1994) Proteins: Struct. Funct. Genet., 19, 302-309

5. Wilkins, R.G., Harrington, P. C. (1983) Adv. Inorg. Biochem., 5, 51-85

6. Stenkamp, R.E. (1994) Chem. Rev., 94, 715-726

7. Sheriff, S., Hendrickson, W. A., Smith, J. L. (1987) J. Mol. Biol., 197, 273-296

8. Farmer, C.S., Kurtz, D. M., Jr., Liu, Z. J., Wang, B. C., Rose, J., Ai, J., Sanders-

Loehr, J. (2001) J. Biol. Inorg. Chem., 6, 418-29.

9. Seiker, L.C., Stenkamp, R. E., Jensen, L. H. (1982) in The Biological Chemistry

of Iron, H.B. Dunford, Dolphin, D., Raymond, K. S., Seiker, L. C., Editor. p. 161-

175.

10. Stenkamp, R.E., Seiker, L. C., Jensen, L. H. (1978) J. Mol. Biol., 126, 457-466

11. Stenkamp, R.E., Seiker, L. C., Jensen, L. H. (1984) J. Am. Chem. Soc., 106, 618-

622

69 70

12. Stenkamp, R.E., Seiker, L. C., Jensen, L. H., MaCallum, J. D., Sanders-Loehr, J.

(1985) Proc. Natl. Acad. Sci. USA, 82, 713-716

13. Ward, K.B., Hendrickson, W. A., Klippenstein, G. L. (1975) Nature, 275, 818-

821

14. Xiong, J., Phillips, R. S., Kurtz, D. M., Jr., Jin, S., Ai, J., Sanders-Loehr, J. (2000)

Biochemistry, 39, 8526-36.

15. Farmer, C.S., Kurtz, D. M., Jr., Phillips, R. S., Ai, J., Sanders-Loehr, J. (2000) J.

Biol. Chem., 275, 17043-50.

16. Okamura, M.Y., Klotz, I. M., Johnson, C. E., Winter, M. R., Williams, R. J.

(1969) Biochemistry, 8, 1951-8

17. Garbett, K., Johnson, C. E., Klotz, I. M., Okamura, M. Y., Williams, R. J. (1971)

Arch. Biochem. Biophys., 142, 574-83

18. Freier, S.M., Duff, L. L., Shriver, D. F., Klotz, I. M. (1980) Arch. Biochem.

Biophys., 205, 449-63

19. Xiong, J. (1998) Ph. D. thesis, University of Georgia, Athens, GA

20. Muhoberac, B.B., Wharton, D. C., Babcock, L. M., Harrinton, P. C., Wilkins, R.

G. (1980) Biochim. Biophys. Acta., 626, 337-45.

21. Zimmer, J.R., Tachi-iri, Y., Takizawa, H., Handa, T., Yamamura, T., Kihara, H.

(1986) Biochim. Biophys. Acta, 874, 174-180

22. Wilkins, P.C., Wilkins, R. G. (1987) Coord. Chem. Rev., 79, 195

23. Garbett, L.D., D. W., Klotz, I. M. (1971) Arch. Biochem. Biophys., 142, 471

24. DePhillips, H.A., Jr. (1971) Arch. Biochem. Biophys., 144, 122

25. Feig, A., Lippard, S. (1994) Chem. Rev., 94, 759-805 71

26. Brunhold, T.C., Solomon, E. I. (1999) J. Am. Chem. Soc., 121, 8288-8295

27. Altschul, S.F., Madden, T. L., Schaffer, A. A., Zhang, J., Zhang, Z., Miller, W.,

Lipman, D. J., (1997) Nucleic Acids Res, 25, 3389-402.

28. Madden, T.L., Tatusov, R. L., Zhang, J. (1996) Meth. Enzymol., 266, 131-141

29. Needleman, S.B., Wunsch, C. D. (1970) J. Mol. Biol., 48, 443-53.

30. Bult, C.J., White, O., Olsen, G. J., Zhou, L., Fleischmann, R. D., Sutton, G. G.,

Blake, J. A., FitzGerald, L. M., Clayton, R. A., Gocayne, J. D., Kerlavage, A. R.,

Dougherty, B. A., Tomb, J. F., Adams, M. D., Reich, C. I., Overbeek, R.,

Kirkness, E. F., Weinstock, K (1996) Science, 273, 1058-73.

31. Deckers, H.M., Voordouw, G. (1996) Antonie Van Leeuwenhoek, 70, 21-9.

32. The Pseudomonas Genome Project (http://www.pseudomonas.com)

33. Deckert, G., Warren, P. V., Gaasterland, T., Young, W. G., Lenox, A. L.,

Graham, D. E., Overbeek, R., Snead, M. A., Keller, M., Aujay, M., Huber, R.,

Feldman, R. A., Short, J. M., Olsen, G. J., Swanson, R. V. (1998) Nature, 392,

353-8.

34. Parkhill, J., Wren, B. W., Mungall, K., Ketley, J. M., Churcher, C., Basham, D.,

Chillingworth, T., Davies, R. M., Feltwell, T., Holroyd, S., Jagels, K., Karlyshev,

A. V., Moule, S., Pallen, M. J., Penn, C. W., Quail, M. A., Rajandream, M. A.,

Rutherford, K. M., van Vl (2000) Nature, 403, 665-8.

35. Xiong, J., Kurtz, D. M., Jr., Ai, J., Sanders-Loehr, J. (2000) Biochemistry, 39,

5117-25.

36. Morell, V. (1996) Science, 273, 1043-5.

37. Sayle, R., Milner-White, E. J. (1995) Trends Biochem. Sci., 20, 374-76 72

38. Phillips, S.E.V. (1980) J. Mol. Biol., 142, 531-554

39. Hendrickson, W.A., G.L. Klippenstein, and K.B. Ward (1975) Proc. Natl. Acad.

Sci. U S A, 72, 2160-4.

40. Vaska, L. (1976) Acc. Chem. Res., 9, 175-183

41. Sambrook, J.F., Fritsch, E. F., Maniatis, T. (1989) in Molecular Cloning: A

Laboratory Manual, Cold Spring Harbor Laboratory Press: Cold Spring Harbor,

NY.

42. Ausbel, F.A., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J.

A., Struhl, K., ed. (1990) Current Protocols in Molecular Biology, Green

Publishing and Wiley-Interscience, New York

43. Tabor, S. (1990) in Current Protocols in Molecular Biology, F.A. Ausbel, Brent,

R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A., Struhl, K., Editor,

Green Publishing and Wiley-Interscience: New York. p. 16.2.1-16.2.11.

44. Inoue, H., H. Nojima, and H. Okayama (1990) Gene, 96, 23-8.

45. Schagger, H. and G. von Jagow (1987) Anal. Biochem., 166, 368-79.

46. Worthington-Biochemical (http://www.worthington-biochem.com)

47. Claiborne, A., Fridovich, I. (1979) Biochemistry, 18, 2324-2329

48. Claiborne, A., Fridovich, I. (1979) Biochemistry, 18, 2329-2335

49. Coulter, E.D., Shenvi, N. V., Beharry, Z., Smith, J. J., Prickril, B. C., Kurtz, D.

M., Jr. (2000) Inorg. Chim. Acta, 297, 231-234

50. Dawson, J.H. (1988) Science, 240, 433

51. Beyer, W.F. and I. Fridovich (1987) Analyt. Biochem., 161, 559-66.

52. Coulter, E.D., Kurtz, D. M., Jr. (2001) Arch. Biochem. Biophys., in press 73

53. Bonomi, F., Kurtz, D. M., Jr., Cui, X. (1996) J. Biol. Inorg. Chem., 1, 67-72

54. Gallagher, S., Winston, S. E., Fuller, S. A., Hurrell, J. G. R. (1990) in Current

Protocols in Molecular Biology, F.A. Ausbel, Brent, R., Kingston, R. E., Moore,

D. D., Seidman, J. G., Smith, J. A., Struhl, K., Editor, Green Publishing and

Wiley-Interscience: New York. p. 10.8.1-10.8.13.

55. Kaye, G.W.C., Laby, T. H. (1966) in Tables of Physical and Chemical Constants,

Longmans: London. p. 153.

56. 3D-JIGSAW (Comparative Modelling Server)

(http://www.bmm.icnet.uk/servers/3djigsaw/html/model.html)

57. "SDSC1" - SDSC Protein Structure Homology Modeling Server

(http://cl.sdsc.edu/hm.html)

58. HMM-based Protein Sequence Analysis, SAM-T99

(http://www.cse.ucsc.edu/research/compbio/HMM-apps/T99-query.html)

59. ExPASy ProtParam Tool (http://www.expasy.ch/tools/protparam.html)

60. Zhang, J.H., Kurtz, D. M., Jr. (1992) Proc. Natl. Acad. Sci. U. S. A., 89, 7065-9.

61. Ghadiri, M.R., Choi, C. (1990) J. Am. Chem. Soc., 112, 1630-1632

62. Averill, B., Davis, J., Burman, S., Zirino, T., Sanders-Loehr, J., Loehr, T., Sage,

J., Debrunner, P. (1987) J. Am. Chem. Soc., 109, 3760

63. Przysiecki, C.T., Bhattacharyya, A. K., Tollin, G., Cusanovich, M. A. (1985) J.

Biol. Chem., 260, 1452-8

64. Coulter, E.D., Shenvi, N. V., Kurtz, D. M., Jr. (1999) Biochem. Biophys. Res.

Commun., 255, 317-23. 74

65. Hatchikan, D.E., LeGall, J., Bell, G. R. (1977) in Superoxide and Superoxide

Sismutases, A.M. Michael, McCord, J. M., Fridovich, I., Editor, Academic Press:

New York. p. 159-172.

66. Brock, T.D., Madigan, M. T. (1991) in Biology of Microorganisms, Prentice Hall:

Englewood Cliffs, N. J. p. 677-681.