MOLECULAR SYSTEMATICS of the GENUS Dichaea (ZYGOPETALINAE: ORCHIDACEAE)

MOLECULAR SYSTEMATICS OF THE GENUS Dichaea (ZYGOPETALINAE: ORCHIDACEAE)

KURT MAXIMILLIAN NEUBIG

A THESIS PRESENTED TO THE GRADUATE SCHOOL OF THE UNIVERSITY OF FLORIDA IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE

UNIVERSITY OF FLORIDA

2005

Kurt Maximillian Neubig

This thesis is dedicated to all people of planet Earth.

ACKNOWLEDGMENTS

I would like to thank my advisor, Norris H. Williams, for his guidance. He also chose my thesis topic and it was an excellent one. I would also like to thank

W. Mark Whitten, one of the smartest men I have ever met. Both Norris and

Mark have been invaluable contributors to this project and to my education.

Walter Judd has been an uncontainable source of enthusiasm for everything botanical. He has also been a generous member of my committee.

Franco Pupulin of Lankester Gardens in Costa Rica contributed many vouchered specimens and DNA sources from Costa Rica for this study. His insights into the quirks of taxonomy in Dichaea have been very enlightening. I would like to acknowledge the remarkable generosity of the Portillas of

Ecuagenera in Cuenca, Ecuador, who have been most helpful with their amazing collection of Ecuadorian orchids. Also, Bruce Holst allowed me to sample several dozen herbarium specimens for DNA at Marie Selby Botanical Gardens.

Mario Blanco has been willing to collect Dichaeas whenever he has been in the field.

Barbara Sue Carlsward helped me in so many different ways. She gave me unfathomable insight into computer software, advice about graduate student life in general, and has been a good friend. I would also like to thank all the other graduate students and faculty at the University of Florida who have enhanced my education.

iv Robert Dressler has always been willing to help me identify specimens and has always been willing to admit how befuddling they are. Calaway Dodson has on several occasions been willing to empathize with me on the difficulty and problems of Dichaea taxonomy. Gustavo Romero has generously spent his time to help me with a handful of citations.

The Lewis and Varina Vaughn Fellowship in Orchid Biology and the

American Orchid Society’s 11th World Orchid Conference Fellowship supported this research. In addition, much of the cost of lab work was supported by the generosity of Norris Williams and Mark Whitten.

I am grateful to my parents, Henry and Linda Neubig, who have doted upon me my entire life and who have always supported my poor choices (e.g., orchid systematics). I would also like to thank my wife, Julie Kay Neubig, who is perhaps the sweetest person I have ever met. She has been patient and very supportive. She is perfect in every way.

v TABLE OF CONTENTS

page

ACKNOWLEDGMENTS ...... iv

LIST OF TABLES ...... viii

LIST OF FIGURES ...... ix

ABSTRACT ...... xi

CHAPTER

1 INTRODUCTION...... 1

Taxonomic history...... 9 Morphology ...... 12 Anatomy...... 15 Karyology ...... 16 Distribution ...... 17 Pollination biology ...... 18

2 MATERIALS AND METHODS ...... 21

Plant Material ...... 21 Extraction ...... 23 Amplification...... 24 Sequencing ...... 27 Data Analysis ...... 28

3 RESULTS ...... 31

ITS Analyses of Dichaea...... 31 matK Analyses of Dichaea ...... 34 trnL-F Analyses of Dichaea...... 37 Combined Plastid Analyses of Dichaea ...... 40 Combined ITS and Plastid Analyses of Dichaea...... 43 Analysis of a Hybrid Accession of Dichaea schlechteri ...... 46

4 DISCUSSION...... 49

Section Dichaeopsis...... 50

vi Section Pseudodichaea ...... 54 Section Dichaea (Including Section Dichaeastrum) ...... 56 Summary...... 61

LIST OF REFERENCES ...... 63

BIOGRAPHICAL SKETCH ...... 68

vii

LIST OF TABLES

Table page

1-1 Taxonomic history of Dichaea and the sections of Dichaea...... 11

2-1 Taxa used for molecular phylogenetic study...... 21

2-2 Primer sequences for polymerase chain reaction...... 26

2-3 Components of polymerase chain reactions...... 26

2-4 Thermocycler programs for polymerase chain reaction...... 27

2-5 Thermocycler program for cycle sequencing...... 28

2-6 Cycle sequencing reagents...... 28

3-1 Comparison of tree statistics for each gene region and combinations of these gene regions for parsimony analyses...... 31

viii

LIST OF FIGURES

Figure page

1-1 Photos of flowers and plants vouchered in this study...... 2

1-2 Photos of flowers and plants vouchered in this study...... 3

1-3 Photos of flowers and plants vouchered in this study...... 4

1-4 Photos of flowers and plants vouchered in this study...... 5

1-5 Photos of flowers and plants vouchered in this study...... 6

1-6 Photos of flowers and plants vouchered in this study...... 7

1-7 Tree modified from Whitten et al. (2005) showing relationships in the Zygopetalinae based on ITS, matK, and trnL-F...... 8

1-8 Figure modified from Folsom (1987) indicating the hypothesized relationships of species within Dichaea section Dichaea...... 12

1-9 Photos of various aspects of morphology in Dichaea...... 13

1-10 Distribution of the genus Dichaea...... 18

2-1 Diagrams of selected gene regions (ITS, matK, and trnL-F) used in this study...... 25

3-1 One of 503 equally parsimonious ITS trees...... 32

3-2 Jackknife consensus tree from analysis of ITS data set ...... 33

3-3 One of 5991 equally parsimonious matK trees...... 35

3-4 Jackknife consensus tree from analysis of matK data set...... 36

3-5 One of >20,000 equally parsimonious trnL-F trees ...... 38

3-6 Jackknife consensus tree from analysis of trnL-F data set...... 39

3-7 One of >20,000 equally parsimonious plastid (matK and trnL-F) combined trees...... 41

ix 3-8 Jackknife consensus tree from analysis of plastid (matK and trnL-F) data set...... 42

3-9 One of >20,000 equally parsimonious three-gene (ITS, matK, and trnL-F) combined trees ...... 44

3-10 Jackknife consensus tree from analysis of three-gene (ITS, matK, and trnL- F) data set...... 45

3-11 50% majority-rule consensus tree of a Bayesian analysis of three-gene (ITS, matK, and trnL-F) data set...... 47

3-12 Branch and bound searches with branch lengths above each branch and jackknife and bootstrap percentages listed below...... 48

4-1 Leaf abscission layer character mapped on one of >20,000 most parsimonious trees based on three-gene (ITS, matK, and trnL-F) dataset (DELTRAN optimization)...... 51

4-2 Muricate ovary character mapped on one of >20,000 most parsimonious trees based on three-gene (ITS, matK, and trnL-F) dataset (DELTRAN optimization)...... 52

Abstract of Thesis Presented to the Graduate School of the University of Florida in Partial Fulfillment of the Requirements for the Degree of Master of Science

MOLECULAR SYSTEMATICS OF THE GENUS Dichaea (ZYGOPETALINAE: ORCHIDACEAE)

Kurt Maximillian Neubig

December 2005

Chair: Norris H. Williams Major Department: Botany

The genus Dichaea, with over 100 species found throughout the

Neotropics, is easily recognized by distichous leaves on long stems without pseudobulbs and flowers with infrastigmatic ligules. The genus has traditionally been divided into four sections based primarily on the presence or absence of muricate ovaries and the presence or absence of an abscission layer in the leaves. Sequence data of ITS nrDNA as well as plastid matK and trnL-F DNA were used to estimate the phylogenetic relationships within Dichaea. Each of the four sections was sampled, with the greatest sampling in section Dichaea, the most diverse and taxonomically puzzling group. Molecular and morphological data support Dichaea as a monophyletic genus. Results from molecular data indicate that section Dichaeopsis is polyphyletic and is based on symplesiomorphic features, such as deciduous leaves and smooth ovaries, which are commonly found in the Zygopetalinae. There are at least three distinct

xi clades within section Dichaeopsis. Section Pseudodichaea is a monophyletic group defined by muricate ovaries and leaves with an abscission layer, but its placement is uncertain within the genus. There are two distinct clades within section Pseudodichaea: one contains approximately three relatively large-leaved species (including D. morrisii) and the other contains all of the remaining smaller, delicate species. Sections Dichaea and Dichaeastrum form a monophyletic group supported by pendent habit and persistent leaves. Section Dichaeastrum, distinguished from section Dichaea primarily by a glabrous ovary, is potentially polyphyletic, arising several times within section Dichaea. The persistent leaf character is phylogenetically informative, occurring only in the derived sections

Dichaea and Dichaeastrum. The muricate fruit is a more homoplaseous character with numerous losses and gains within the genus.

xii

CHAPTER 1 INTRODUCTION

The genus Dichaea Lindl. consists of over 100 species (Figs. 1-1, 1-2, 1-3,

1-4, 1-5, and 1-6) in a subtribe (Zygopetalinae) of about 400 species (Chase et al., 2003). Zygopetalinae are placed within the tribe Cymbidieae (Chase et al.,

2003) or Maxillarieae (Dressler, 1993b), which are part of the subfamily

Epidendroideae. Zygopetalinae are part of an exclusively Neotropical clade that includes Coeliopsidinae, Eriopsidinae, Maxillariinae, Oncidiinae, and

Stanhopeinae. Zygopetalinae form a strongly supported monophyletic group, which is sister to Maxillariinae, Coeliopsidinae, and Stanhopeinae (Whitten et al.,

2000).

While the placement of Dichaea within Zygopetalinae was somewhat anomalous in the molecular phylogeny of Whitten et al. (2000), it was supported by the morphology of the inflorescence, the pollinarium, and pseudobulbless stems (Dressler, 1993b).

Szlachetko (1995) placed Dichaea in the monogeneric subtribe Dichaeinae, part of a larger tribe Dichaeeae including Vargasiella, Fernandezia, and

Pachyphyllum. However, Fernandezia and Pachyphyllum are distantly related in the Oncidiinae based on molecular data (Williams et al., 2001) and Vargasiella should probably be placed within Zygopetalinae (Dressler, 1993b).

According to Whitten et al. (2005), Dichaea was sister to the clade traditionally called Huntleyinae (Dressler, 1993b) (Fig. 1-7). Dichaea was united

1 2

Figure 1-1. Photos of flowers and plants vouchered in this study. a) Dichaea ancoraelabia (Whitten 2542, section Dichaeopsis), b) D. ancoraelabia (Neubig 1-2004), c) D. caveroi (Whitten 2417, section Dichaeopsis), d) D. caveroi (Whitten 2417), e) D. cryptarrhena (Whitten 2610, section Dichaea), f) D. cryptarrhena (Whitten 2610), g) D. ecuadorensis (Whitten 2416, section Pseudodichaea).

Figure 1-2. Photos of flowers and plants vouchered in this study. a) D. ecuadorensis (Whitten 2416, section Pseudodichaea), b) D. ecuadorensis (Whitten 1799), c) Dichaea globosa (Whitten 2582, section Pseudodichaea), d) D. globosa (Neubig 2-2005), e) D. cf. kegelii (Whitten 2429, section Pseudodichaea), f) D. cf. lagotis (Whitten 1801, section Dichaea), g) D. cf. lagotis (Whitten 2477).

Figure 1-3. Photos of flowers and plants vouchered in this study. a) Dichaea morrisii (Neubig 4-2005, section Pseudodichaea), b) D. morrisii (Neubig 3-2004), c) D. morrisii (Neubig 3-2004), d) D. muyuyacensis (Neubig 5-2004, section Dichaea), e) D. panamensis (Whitten 2348, section Dichaeopsis), f) D. panamensis (Whitten 2348), g) D. panamensis (Whitten 2556).

Figure 1-4. Photos of flowers and plants vouchered in this study. a) Dichaea poicillantha (Whitten 2557, section Dichaea), b) D. poicillantha (Blanco 2981), c) D. rubroviolacea (Whitten 2945, section Pseudodichaea), d) D. trulla (Whitten 2474, section Dichaeopsis), e) D. trulla (section Dichaeopsis).

Figure 1-5. Photos of flowers and plants vouchered in this study. a) Dichaea trulla (Whitten 2475, section Dichaeopsis), b) D. trulla (Whitten 2475), c) D. cf. violacea (Neubig 6-2004, section Dichaea), d) D. sp. (Neubig 4-2004, section Dichaea), e) D. sp. (Whitten 2434, section Dichaea), f) D. sp. (Whitten 2434).

Figure 1-6. Photos of flowers and plants vouchered in this study. a) Dichaea sp. (Whitten 2435, section Dichaea), b) D. sp. (Whitten 2708, section Dichaea), c) D. sp. (Whitten 2709, section Dichaea), d) D. sp. (Whitten 2731, section Pseudodichaea), e) D. sp. (Whitten 2731).

single-flowered Aetheorhyncha, Benzingia, Chaubardia, inflorescences Chaubardiella, Chondrorhyncha, Chondroscaphe, Cochleanthes, Daiotyla, Echinorhyncha, Euryblema, Huntleya, Chondrorhyncha Ixyophora, Kefersteinia, Pescatorea, alliance Stenia, Stenotyla, and Warczewiczella ("Huntleyinae")

Dichaea

Cryptarrhena

Acacallis, Aganisia, Batemannia, Galeottia, Koellensteinia, Neogardneria, Zygopetalum Otostylis, Pabstia, Paradisanthus, grade/clade Promenaea, Zygopetalum, Zygosepalum, Warrea, and Warreopsis

Maxillaria, Rudolfiella Outgroups

Figure 1-7. Tree modified from Whitten et al. (2005) showing relationships in the Zygopetalinae based on ITS, matK, and trnL-F. The single-flowered inflorescence is a synapomorphy for the Huntleyinae clade, including Dichaea.

morphologically with Huntleyinae by the one-flowered inflorescences, a likely

synapomorphy, and is considered here to be a part of Huntleyinae. Cryptarrhena

was poorly supported as sister to the clade containing Dichaea and the

Huntleyinae. Cryptarrhena is intermediate between Dichaea + Huntleyinae and

the Zygopetalum grade/clade because it has long, many-flowered inflorescences and reduced or absent pseudobulbs. Cryptarrhena and the Chondrorhyncha

alliance are united by duplicate leaves and pseudobulbs that are reduced to

absent. The remainder of the subtribe, the Zygopetalum grade/clade, is sister to

or paraphyletic to Cryptarrhena + the Chondrorhyncha alliance and has many-

flowered inflorescences and a distinct pseudobulb.

Only in recent years has the capability of using molecular markers to

estimate phylogeny become apparent. The authors of all the various sectional

segregations of Dichaea worked from the mid 1800s to the 1920s and obviously

did not use molecular techniques or even cladistic criteria for diagnosing groups.

Their concept of classification did not incorporate evolution and phylogeny as we

do today (Judd et al., 2002). Because the usage of molecular synapomorphies

to estimate phylogeny has not been shown previously in these plants, it was

considered appropriate to reevaluate the sections of Dichaea.

No sectional scheme of Dichaea has ever used clearly defined apomorphic

characters for all of the sections. Cogniaux (1906) based his section

Dichaeopsis on two plesiomorphic characters (glabrous ovaries and leaves with

abscission layers) found throughout Zygopetalinae. In the sectional schemes of

Pfitzer (1889), Kuntze (1904), Schlechter (1914), and Kraenzlin (1923), species

with muricate ovaries were separated into two different sections (or genera) and

intermixed with taxa with glabrous ovaries. The obvious implication is that

muricate ovaries evolved at least twice. Because the morphological characters

that distinguish the sections of Dichaea probably do not reflect actual

evolutionary history, the taxonomic groups were examined with molecular

sequence data (ITS, matK, and trnL-F). The purpose of this thesis was to test

the monophyly of both the genus Dichaea and the sections within Dichaea.

Taxonomic history

Early Dichaeas were described as species of Limodorum (Aublet, 1775),

Epidendrum (Swartz, 1788), Cymbidium (Swartz, 1799), Fernandezia (Ruiz &

Pavon, 1794), and Isochilus (Hooker, 1827). As more species were described,

Lindley (1833) circumscribed the genus Dichaea. Lindley did not base his

circumscription on any features that are characteristic for the genus. However,

he did place the genus in Vandeae, a tribe of monopodial plants.

Knowles and Westcott (1839) first assessed the relationships within

Dichaea (Table 1-1). They erected a second genus, Epithecia Knowles &

Westc., for species with articulating leaves. Pfitzer (1889) also described a

segregate genus, Dichaeopsis, to encompass species with articulating leaves, apparently ignoring the work of Knowles and Westcott. Kuntze (1904) reduced

the genus Dichaeopsis to a section within Dichaea. Cogniaux (1906) retained

Dichaea as a single genus of four sections: Dichaea (Eudichaea), Dichaeastrum

Cogn., Dichaeopsis (Pfitzer) Kuntze, and Pseudodichaea Cogn. Section

Dichaea was distinguished by muricate ovaries and nonarticulating leaves,

section Dichaeastrum by its glabrous ovaries and nonarticulating leaves, section

Dichaeopsis by its glabrous ovaries and articulating leaves, and section

Pseudodichaea by its muricate ovaries and articulating leaves. Although

Cogniaux’s treatment was limited to Brazilian Dichaea, his sections did

encompass all combinations of the two characters (i.e., abscission layer in leaves

and muricate ovaries) for the two different states (i.e., present and absent).

Schlechter (1914) accepted the four groups of Cogniaux, but preferred the

generic delimitation of Pfitzer (1889). Therefore he placed sections Dichaea and

Dichaeastrum in the genus Dichaea, while sections Dichaeopsis and

Pseudodichaea were placed in the genus Epithecia. Kraenzlin (1923) treated the

group as a single genus with three sections: Dichaea, Dichaeopsis, and

Maxillariopsis Kraenzl. However, Maxillariopsis (four species) properly belongs

in the genus Maxillaria (Maxillariinae). Senghas (1996), who followed Kraenzlin’s work very closely, erected two subgenera in Dichaea. Subgenus Dichaea

included section Dichaea and subgenus Epithecia included sections Dichaeopsis

and Maxillariopsis.

Table 1-1. Taxonomic history of Dichaea and the sections of Dichaea. Taxonomist Taxonomic arrangement Lindley (1833) genus Dichaea Lindl. Knowles and Westcott genus Dichaea Lindl. (1839) genus Epithecia Knowles & Westc. Pfitzer (1889) genus Dichaea Lindl. genus Dichaeopsis Pfitzer Kuntze (1904) genus Dichaea Lindl. section Dichaea section Dichaeopsis (Pfitzer) Kuntze Cogniaux (1906) genus Dichaea Lindl. section Dichaea section Dichaeastrum Cogn. section Dichaeopsis (Pfitzer) Kuntze section Pseudodichaea Cogn. Schlechter (1914) genus Dichaea Lindl. section Dichaea section Dichaeastrum Cogn. genus Epithecia Knowles & Westc. section Dichaeopsis (Pfitzer) Kuntze section Pseudodichaea Cogn. Kraenzlin (1923) genus Dichaea Lindl. section Dichaea section Dichaeopsis (Pfitzer) Kuntze section Maxillariopsis Kraenzl. (Maxillaria) Senghas (1996) genus Dichaea subgenus Dichaea section Dichaea subgenus Epithecia (Knowles & Westc.) Senghas section Dichaeopsis (Pfitzer) Kuntze section Maxillariopsis Kraenzl. (Maxillaria)

In his monograph of section Dichaea, Folsom (Folsom, 1987) excluded

several complexes that had been placed in section Dichaea. He also

diagrammed his ideas of the relationships within section Dichaea (Fig. 1-8).

Historically, taxonomy in Dichaea has shown virtually every combination of

subgeneric classification. And, all subgeneric groups have been defined using

only one to a few characters.

Figure 1-8. Figure modified from Folsom (1987) indicating the hypothesized relationships of species within Dichaea section Dichaea. The line in the middle represents the geographic separation between South America and Central America and the Caribbean Islands. The horizontal lines indicate taxa with strong cross-venation in the leaves. This diagram is based on the subjective assessments by Folsom of relationships in this group.

Morphology

Dichaea is easily distinguished from other orchids by its distichous leaves, anchor-shaped labellum, and, in many species, the muricate ovary and

nonarticulating leaves. In addition, monopodial habit and the infrastigmatic ligule are synapomorphies for the genus (Fig. 1-9).

Figure 1-9. Photos of various aspects of morphology in Dichaea. a) Flower of D. globosa (section Pseudodichaea), an = anther, ds = dorsal sepal, fb = floral bract, il = infrastigmatic ligule, la = labellum, ls = lateral sepal, p = petal, st = stigma, and vi = viscidium. b) Plant of D. sp. (section Dichaea) showing lack of an abscission layer at junction between sheath and blade of leaves. c) Plant of D. glauca (section Dichaeopsis), ab = abscission layer, o = glabrous ovary, r = rachis. d) D. sp. (section Dichaea) showing echinate fruit (photo by J. Richard Abbott). e) Pollinarium of D. ancoraelabia (section Dichaeopsis), ca = caudicle, po = pollinium, sp = stipe, vi = viscidium.

The roots of Dichaea arise from the node inside the sheath and are usually quite small, delicate and sparse. Dichaea glauca (section Dichaeopsis) is an exception, as it can have thick roots.

The stems are strongly pendent (section Dichaea) to strongly erect (D. glauca, section Dichaeopsis). The length of the internode varies and can be diagnostic for species identification. The correct categorization of the growth form of Dichaea is unclear (Schneckenburger, 1994); it has been treated as monopodial, pseudomonopodial, and sympodial. The axillary bud is borne subopposite a node, giving the appearance that the bud is opposite the leaf and therefore a terminal bud. However, the origin of the axillary bud is unclear, because anatomical studies have shown that the bud has vascular traces from both the previous node and the adjacent central vascular bundle (Folsom, 1987).

The leaves consist of a sheath and blade and may be thin textured to coriaceous (some section Dichaea) or even slightly succulent (D. ancoraelabia, section Dichaeopsis). Leaf size ranges from (0.7-10 x 0.3-2 cm) and can be diagnostic for determining species. The sheaths are closed (usually only basally) and are oriented so that the stem is completely obscured. The sheaths may possess markings or spots (D. neglecta, section Dichaea). The blades may be twisted, which is particularly evident in section Dichaea where the stems are pendent and the leaves all face the same side. The leaves may or may not have a distinct abscission layer. All leaves have lateral venation with few to many veins, but some species of section Dichaea (especially from South America) may also produce cross venation. The leaf margins are typically entire but can be ciliolate throughout (D. hystricina and D. ciliolata, section Dichaea), or only ciliolate towards the apex (most of section Dichaea). The leaf color can range from light to dark green or even a bronze or purple (D. morrisii, section

Pseudodichaea). The leaf may also be glaucous (D. panamensis and D. glauca,

section Dichaeopsis).

The inflorescences of Dichaea are almost always one-flowered. One

individual of D. ancoraelabia (Neubig 1-2004) was cultivated at the University of

Florida and had inflorescences of two flowers. The inflorescence is borne subopposite the adjacent node on the stem and grows out of the subtending

sheath. It consists of numerous internodes and two bracts, which subtend the

terminal flower.

The flowers are usually less than 1.5 cm across and can be rotate to

campanulate at maturity. Often a flower may not fully open during the day

because of environmental conditions. There are usually small tubercles on the

outer surface of the perianth. The perianth may be variously colored, but most

taxa are spotted. As in all Epidendroideae, there is only one anther. The

pollinarium consists of four, flattened pollinia made up of two pairs that are

slightly unequal, four caudicles, a stipe, and a viscidium.

The fruit is a capsule that dehisces along one side. It can be glabrous,

muricate or strongly spiny. Only sections Dichaea and Pseudodichaea have

ornamentations on the fruit. These ornamentations can become robust and prickle-like in some taxa of section Dichaea.

Anatomy

The anatomy of Dichaea has not been studied in great detail. Early

anatomical work was usually organ-based and gave little taxonomic

interpretation. Möbius (1887) remarked that Dichaea lacked hairs and fiber

bundles in the leaves. Hering (1900) studied the stem of D. neglecta and found a

thin, smooth cuticle, an exodermis of anticlinally oriented cells, and vascular

bundles organized in an irregular circle in the ground tissue.

Folsom (1987) examined the anatomy of section Dichaea using seven

species, but did not sample other sections for systematic comparison. He

confirmed Hering’s (1900) observations and reported 35-40 vascular bundles

within the “vascular zone.” This vascular zone became cruciform at the nodes

because of the distichous leaf arrangement. The vascular bundles that

supported lateral buds arose from the previous node and the vascular cylinder

immediately adjacent to the bud. The leaves were only 4-9 cells thick and

consisted of packed spongy mesophyll in between single-layered epidermises.

Stern et al. (2004) provided the most comprehensive survey of comparative

anatomy and created a dataset of eight anatomical and morphological characters. Although the characters were uninformative, Dichaea shared

identical character states with various taxa of The Chondrorhyncha alliance.

These characters are foliar water storage cells present, conical stegmata in

leaves present, stegmata in roots absent, tilosomes absent, foliar glands absent,

foliar fiber bundles absent, endodermal cell walls ∪-thickened, and pseudobulbs

absent.

Karyology

Little is known of the karyology of Dichaea or even Zygopetalinae. A

Brazilian survey of orchids has provided the most information on chromosome

counts (Felix & Guerra, 2000). They sampled five genera within the

Zygopetalinae, including two species of Dichaea. The four other genera,

including Koellensteinia (2n = 48 and 96), Promenaea (2n = 46), Warrea (2n=52),

and Zygopetalum (24, 48, and 96), are relatively closely related to each other

(Fig. 1-7) but not to Dichaea. The two species of Dichaea sampled include D.

neglecta (2n = 52, section Dichaea) and D. panamensis (2n = 52, section

Dichaeopsis). These two species are distantly related and may indicate that 52

is a consistent chromosome number throughout the genus. There are no

published chromosome counts for Cryptarrhena or The Chondrorhyncha alliance,

with the exception of Dichaea.

Distribution

Dichaea is distributed throughout the Neotropics, from Mexico to Brazil and

Bolivia (Fig. 1-10): the Antillean islands (Nir, 2000), Belize (Ames & Correll, 1985;

Balick et al., 2000), Bolivia (Vasquez et al., 2003), Brazil (Pabst & Dungs, 1977),

Columbia (Pedro Ortiz, pers. comm.), Costa Rica (Dressler, 1993a; Dressler,

2003), Ecuador (Jorgensen & Leon-Yanez, 1999), French Guiana (Boggan et al.,

1992), Guatemala (Ames & Correll, 1985), Guyana (Boggan et al., 1992), Mexico

(McVaugh, 1985; Sosa & Gomez-Pompa, 1994), Nicaragua (Hamer, 2001),

Panama (Dressler, 1993a), Peru (Brako & Zarucchi, 1995), Suriname (Boggan et

al., 1992), Venezuela (Carnevali & Ramirez- Morillo, 2003). The greatest

diversity of Dichaea is in the Andes (especially in Ecuador), but this may be an

artifact of the amount of study of the flora of Ecuador relative to surrounding

countries. In Ecuador, Dichaea can grow at altitudes ranging from 100 to 2800

m. However, the average altitude among 375 herbarium specimens of

Ecuadorian Dichaea is 930 m (Dodson, unpublished data). In Costa Rica, most

Dichaea are found at 1000-1300 m in lower montane wet forests (Pupulin,

2005b). This information is not readily available for other countries, but the same

range in elevation is likely to exist throughout the distribution of the Dichaea.

Figure 1-10. Distribution of the genus Dichaea. The numbers of species are placed in parentheses following the name of each country. Species numbers are based on floras and checklists. Countries without numbers lack reliable data to assess number of species.

Pollination biology

Almost exclusively, male euglossine bees pollinate the flowers of the

Zygopetalinae, using fragrances generated from the flowers as rewards

(Williams, 1982). This has been studied in great detail in the Stanhopeinae

(Dressler, 1968), where the pollination mechanisms are some of the most interesting because of the complex floral structures that have evolved. Relatively little is known about the pollination biology of Dichaea. Flowering in Dichaea often occurs successively on a given stem, especially in section Dichaea. A

19 unique synchrony within the genus occurs in D. glauca where most of the nodes along a stem flower simultaneously. Flowers in Dichaea are generally short- lived, lasting for only a few days to a week.

Folsom (1987) studied D. potamophila (section Dichaea) to determine pollinator specificity and pollen movement across a given region. The experiment used varying stains applied to pollinaria from different populations.

From his experiments, Folsom found that flowering time may be more synchronized than otherwise thought. Although the flowering time was rather broad (May through June) for D. potamophila, the flowering centered around three day periods. The pollinator, Eulaema meriana (Hymenoptera: Apidae), was probably specific to D. potamophila. The structure of the pollinarium changed shape after being removed from the column, which took 2-5 minutes to complete.

The shape of the pollinarium in Orchidaceae has been shown in many cases to change after a certain amount of time to increase cross-pollination (Peter &

Johnson, 2005). The pollinarium of Dichaea is placed on the top of the head of the bee (Dodson & Escobar, 1994).

In a study of the closely related species in the Chondrorhyncha alliance,

Cochleanthes lipscombiae (Rolfe) Garay, the pollinator was also found to be

Eulaema meriana, even though the flower sizes between Cochleanthes and

Dichaea differ greatly. Also, Dichaea appears to be pollinated by fragrance- foraging bees and Cochleanthes lipscombiae appears to be pollinated by nectar- foraging bees. Interestingly, the pollinators were both males and females of E.

20 meriana, rather than the exclusively male pollinating syndrome that is found in most Zygopetalinae.

CHAPTER 2 MATERIALS AND METHODS

Plant Material

Specimens were obtained from wild-collected plants, cultivated material,

and herbarium specimens (Table 2-1). All fresh-collected material was

preserved in silica gel to insure quick drying of tissue and preservation of

genomic DNA. All sections of Dichaea were sampled. Other members of the

Zygopetalinae and Maxillaria (Maxillariinae) were used as outgroups based on previous molecular analyses (Cameron, 2001; Cameron, 2004; Cameron et al.,

1999; Chase et al., 2003; Whitten et al., 2000).

Table 2-1. Taxa used for molecular phylogenetic study. The original countries from which each specimen was collected are listed. Gene regions sampled include: I = ITS, M = matK, and T = trnL-F. Vouchers are listed by collector and collector number; voucher location is the herbarium where the voucher is deposited. Taxon Country Gene Voucher (voucher region location) Chaubardia heteroclita (Poepp. & Endl.) Ecuador I, M, T W. Whitten 88023 (FLAS) Dodson & D.E.Benn. Cryptarrhena guatemalensis Schltr. Panama I, M, T W. Whitten 946 (FLAS) C. lunata R.Br. Panama I, M, T W. Whitten 952 (FLAS) Dichaea acroblephara Schltr. 1 Costa Rica I, M, T F. Pupulin 4795 (USJ-L) D. cf. acroblephara 2 Panama I M. Blanco 2994 (FLAS) D. cf. acroblephara 3 Panama I W. Whitten 2669 (FLAS) D. amparoana Schltr. Costa Rica I, M, T D. Bogarin 679 (USJ-L) D. ancoraelabia C.Schweinf. 1 Ecuador I, M K. Neubig 1-2004 (FLAS) D. ancoraelabia 2 Ecuador I, M, T W. Whitten 1851 (FLAS) D. ancoraelabia 3 Ecuador I, M, T W. Whitten 2542 (FLAS) D. caveroi D.E.Benn. & Christenson Ecuador I, M, T W. Whitten 2417 (FLAS) D. cf. ciliolata Rolfe Ecuador I, M, T W. Whitten 2329 (FLAS) D. cryptarrhena Rchb.f. ex Kraenzl. 1 Costa Rica I, M, T F. Pupulin 4436 (USJ-L) D. cryptarrhena 2 Panama I, M, T W. Whitten 2610 (FLAS) D. dammeriana Kraenzl. Costa Rica I, M, T D. Bogarín & H. León- Páez 197 (USJ-L) D. ecuadorensis Schltr. 1 Ecuador I, M W. Whitten 1799 (FLAS) D. ecuadorensis 2 Ecuador I, M, T W. Whitten 2416 (FLAS)

21 22

Table 2-1. Continued Taxon Country Gene Voucher (voucher region location) D. eligulata Folsom Costa Rica I, M, T F. Pupulin 1094 (USJ-L) D. elliptica Dressler & Folsom 1 Costa Rica I, M, T F. Pupulin 4945 (USJ-L) D. elliptica 2 Costa Rica I F. Pupulin 5133 (USJ-L) D. fragrantissima Folsom ssp. eburnea Costa Rica I, M M. Blanco 513 (USJ-L) Dressler & Pupulin 1 D. fragrantissima ssp. eburnea 2 Costa Rica I, M, T F. Pupulin 4601 (USJ-L) D. glauca (Sw.) Lindl. Costa Rica I, M, T F. Pupulin 4734 (USJ-L) D. globosa Dressler & Pupulin 1 Costa Rica I, M, T F. Pupulin 1189 (FLAS) D. globosa 2 Costa Rica I, T F. Pupulin 4517 (USJ-L) D. globosa 3 Panama I, M, T K. Neubig 2-2005 (FLAS) D. globosa 4 Panama I, M W. Whitten 2582 (FLAS) D. hystricina Rchb.f. 1 Costa Rica I, M, T F. Pupulin 2925 (USJ-L) D. hystricina 2 Costa Rica I, M, T F. Pupulin 3925 (USJ-L) D. hystricina 3 Costa Rica I, M, T F. Pupulin 4320 (USJ-L) D. cf. kegelii Rchb.f. Ecuador I, M, T W. Whitten 2429 (QCA) D. cf. lagotis Rchb.f. 1 Ecuador I, M, T W. Whitten 1801(FLAS) D. cf. lagotis 2 Ecuador I, M, T W. Whitten 2477 (QCA) D. cf. lagotis 3 Ecuador I, M, T W. Whitten 2523 (QCA) D. lankesteri Ames 1 Panama I M. Blanco 2993 (FLAS) D. lankesteri 2 Costa Rica I, M, T F. Pupulin 3030 (USJ-L) D. longa Schltr. 1 Ecuador I, M W. Whitten 2684 (FLAS) D. longa 2 Ecuador I, M, T W. Whitten 2685 (FLAS) D. morrisii Fawc. & Rendl. 1 Costa Rica I W. Whitten 2171 (USJ-L) D. cf. morrisii 2 Ecuador I W. Whitten 1792 (FLAS) D. morrisii 3 Panama I, M, T K. Neubig 3-2004 (FLAS) D. muricatoides Hamer & Garay Costa Rica I J. Morales 4381 (FLAS) D. muyuyacensis Dodson 1 Ecuador I, M W. Whitten 1512 (FLAS) D. muyuyacensis 2 Panama I, M, T K. Neubig 5-2005 (FLAS) D. neglecta Schltr. Mexico I, M, T Higgins 1005 (FLAS) D. obovatipetala Folsom 1 Costa Rica I, M, T F. Pupulin 4202 (USJ-L) D. obovatipetala 2 Costa Rica I, M, T F. Pupulin 5023 (USJ-L) D. oxyglossa Schltr. Costa Rica I, M, T D. Bogarín & H. León- Páez 186 (USJ-L) D. panamensis Lindl. 1 Costa Rica I, M, T F. Pupulin 3667 (USJ-L) D. panamensis 2 Ecuador I, M W. Whitten 1531 (FLAS) D. panamensis 3 Ecuador I, M, T W. Whitten 2348 (FLAS) D. panamensis 4 Panama I, M W. Whitten 2556 (FLAS) D. pendula (Aubl.) Cogn. Costa Rica I, M, T F. Pupulin 3024 (USJ-L) D. poicillantha Schltr. 1 Costa Rica I, M, T F. Pupulin 4662 (USJ-L) D. poicillantha 2 Costa Rica I, M, T W. Whitten 2030 (USJ-L) D. poicillantha 3 Panama I, M, T M. Blanco 2981 (FLAS) D. poicillantha 4 Panama I, M, T W. Whitten 2557 (FLAS) D. poicillantha 5 Panama I, M, T W. Whitten 2788 (FLAS) D. rubroviolacea Dodson Ecuador I, M, T W. Whitten 2945 (FLAS) D. sarapiquinsis Folsom Costa Rica I, M, T F. Pupulin 4856 (USJ-L) D. schlechteri Costa Rica I, M, T D. Bogarín 329 (USJ-L) D. squarrosa Lindl. Costa Rica I, M, T F. Pupulin 5127 (USJ-L) D. trichocarpa (Sw.) Lindl. 1 Costa Rica I, M, T D. Bogarín 173 (USJ-L)

Table 2-1. Continued Taxon Country Gene Voucher (voucher region location) D. trichocarpa 2 Dominican I B. Holst, W. Berg, M. Republic Feliz, J. Jenkins, & I. Montero 6282 (SEL) D. trulla Rchb.f. 1 Costa Rica I, M, T W. Whitten 2096 (USJ-L) D. trulla 2 Ecuador I, M, T W. Whitten 2474 (QCA) D. trulla 3 Ecuador I, M, T W. Whitten 2475 (FLAS) D. tuerckheimii Schltr. Costa Rica I, M, T W. Whitten 2097 (USJ-L) D. cf. violacea Folsom Panama I, M, T K. Neubig 6-2004 (FLAS) D. viridula Pupulin (ined.) Costa Rica I, M, T F. Pupulin 4752 (USJ-L) D. sp. 1 Ecuador I W. Whitten 1526 (FLAS) D. sp. 2 Ecuador I, M W. Whitten 1724 (FLAS) D. sp. 3 Ecuador I, M, T W. Whitten 2434 (QCA) D. sp. 4 Ecuador I, M, T W. Whitten 2435 (QCA) D. sp. 5 Ecuador I, M, T W. Whitten 2476 (QCA) D. sp. 6 Ecuador I, M, T W. Whitten 2708 (QCA) D. sp. 7 Ecuador I, M, T W. Whitten 2709 (FLAS) D. sp. 8 Ecuador I, M, T W. Whitten 2731 (FLAS) D. sp. 9 Peru I, M, T K. Neubig 4-2004 (FLAS) Huntleya wallisii (Rchb.f.) Rolfe Venezuela I, M, T W. Whitten 1858 (FLAS) Maxillaria sophronitis (Rchb.f.) Garay Venezuela I, M, T W. Whitten 2296 (FLAS) Warrea warreana (Lodd. ex Lindl.) cultivated I, M, T M. Chase 87050 (FLAS) C.Schweinf. Zygopetalum maxillare Lodd. cultivated I, M, T W. Whitten 94103 (FLAS)

Extraction

Genomic DNA from fresh, silica gel-dried, and herbarium specimens was extracted using a modified cetyl trimethylammonium bromide (CTAB) technique

(Doyle & Doyle, 1987), scaled down to a 1 mL volume reaction. Approximately

11 mg of fresh tissue or 10 mg of dried tissue were ground using a mortar and pestle with 1 mL of CTAB 2X buffer and either 8 μL of β-mercaptoethanol or 10

μL of Proteinase-K. The homogenized mixture was then transferred to a 1.5 mL

Eppendorf tube and incubated at 50-65°C for 1-5 hours, vortexing every 30 minutes. Material from herbarium specimens was allowed to incubate for up to

24 hours to insure maximum yield of DNA.

After incubation, 500 μL of chloroform: isoamyl alcohol (24:1) were added to the CTAB/tissue-homogenate mixture and then vortexed until milky. This

solution was then centrifuged at 10,000 rotations per minute (rpm) for 4 minutes.

From the top aqueous layer, 750 μL were removed and added to a clean 1.5 mL tube. To this aqueous solution, 30 μL of 3M sodium acetate and 510 μL of 100% isopropanol were added. The solution was then mixed by hand and allowed to chill 1-12 hours in a -20°C freezer for maximum precipitation of DNA.

After chilling, the solution was centrifuged for 20 minutes at 13,000 rpm to

obtain a pellet of DNA. The supernatant was then decanted. A solution of 70%

ethanol was then added to wash the pellet and the tube surfaces; this was

repeated twice. Any remaining ethanol in the tube was then removed via pipette.

The DNA was then resuspended with 50-150 μL of Tris-EDTA

(ethylenediaminetetraacetic acid) buffer (TE, pH 8.0) by incubating at 50°C for 15

minutes and vortexing occasionally. DNA from herbarium material and any

discolored DNA were then cleaned with Qiagen QIAquick PCR purification

columns to remove any inhibitory secondary compounds and resuspended in 60

μL of TE. All DNA solutions were stored at -20°C.

Amplification

For DNA extracted from fresh or silica gel-dried specimens, the ITS region

was amplified using primers of Sun et al. (1994) (Fig. 2-1; Table 2-2).

Polymerase chain reactions were carried out using either Sigma or Eppendorf

brand reagents on either a Biometra Tgradient or an Eppendorf Mastercycler EP

Gradient S thermocycler. After adding all reagents (Table 2-3) except Taq

polymerase to each reaction tube, an initial denaturation of the DNA was held at

99°C for 10 minutes. The samples were then held at 94°C and 0.2 μL of Taq

polymerase were added to each tube. After adding Taq polymerase, 33 cycles of

25 denaturation, annealing, and elongation were completed (Table 2-4). For degraded DNA extracted from herbarium specimens, ITS was amplified in two pieces that have partial overlap using primers of Blattner (1999) designed for general angiosperms (ITS-A + ITS-C and ITS-D + ITS-B, Table 2-2). Plastid regions (matK and trnL-F) were amplified similarly (Tables 2-2, 2-3, and 2-4).

Strongly polymorphic PCR product was cloned for ITS of D. schlechteri.

ITS (~800 bps) 18S ITS1 5.8S ITS2 26S

17SE ADC 26SEB matK (~1800 bps) trnK matK trnK

-19F 56F 308F 1520R trnK2R trnL-F (~1200 bps) trnL trnL trnF

CDEF

Figure 2-1. Diagrams of selected gene regions (ITS, matK, and trnL-F) used in this study. Solid black lines indicate noncoding regions, boxes indicate exons, and black triangles indicate primers and their respective annealing sites. The length of each region (in base pair number) is given in parentheses and is based on the aligned matrix length.

Table 2-2. Primer sequences for polymerase chain reaction. Primer Primer sequence ITS (ITS 1 + 5.8S + ITS 2) 17SE, forward ACGAATTCATGGTCCGGTGAAGTGTTCG 26SE, reverse TAGAATTCCCCGGTTCGCTCGCCGTTAC ITS-A, forward GGAAGGAGAAGTCGTAACAAGG ITS-B, reverse CTTTTCCTCCGCTTATTGATATG ITS-C, reverse GCAATTCACACCAAGTATCGC ITS-D, forward CGGCAACGGATATCTCGGCTC matK -19F, forward CGTTCTGACCATATTGCACTATG 56F, forward ACTTCCTCTATCCGCTACTCCTT 308F, forward TATCAGAAGGTTTTG(CG)A 1520R, reverse CGGATAATGTCCAAATACCAAATA TrnK2R, reverse ACCTAGTCGGATGGAGTAG trnL-F TabC, forward CGAAATCGGTAGACGCTACG TabD, reverse GGGGATAGAGGGACTTGAAC TabE, forward GGTTCAAGTCCCTCTATCCC TabF, reverse ATTTGAACTGGTGACACGAG

Table 2-3. Components of polymerase chain reactions. Amplification of ITS from fresh or silica-dried tissue was performed using either Eppendorf (E) or Sigma (S) brand reagents. Amplification of ITS using herbarium (H) extracted tissue and used Sigma brand reagents. MatK and trnL-F were amplified using Sigma brand reagents. ITS ITS ITS PCR components (μL) matK trnL-F (E) (S) (H) Water (H2O) 12.5 22.0 28.0 16.5 16.5 Betaine (5M) 0 13.4 0 0 0 10X Sigma Buffer 0 4.5 5.0 2.5 2.5 MgCl2 (Sigma) 0 6.2 6.0 4.0 4.0 10X Eppendorf buffer 15 mM Mg(Oac)2 2.5 0 0 0 0 25 mM Mg(Oac)2 (Eppendorf) 2.5 0 0 0 0 5X Taq Master (Eppendorf) 5.0 0 0 0 0 Forward primer (10 pmol/μL) 0.5 1.0 2.0 0.5 0.5 Reverse primer (10 pmol/μL) 0.5 1.0 2.0 0.5 0.5 dNTPs (10mM) 0.5 1.0 1.0 0.5 0.5 Taq polymerase 0.2 0.4 0.4 0.2 0.2 DNA template 1.0 1.0 5.0 1.0 1.0 Total 25.2 50.5 49.4 25.7 25.7

Table 2-4. Thermocycler programs for polymerase chain reaction. Step # Temperature (C°) Time Notes ITS 1 99 10 minutes 2 94 pause Add Taq polymerase 3 94 45 seconds 4 65 1 minute 5 72 1 minute Cycle to step 3, 33 times 6 72 3 minutes ITS (for herbarium samples) 1 94 3 minutes 2 94 40 seconds 3 55 1 minute 4 72 1 minute 5 72 3 minutes Cycle to step 2, 40 times matK 1 99 10 minutes 2 94 pause Add Taq polymerase 3 94 45 seconds 4 60 45 seconds 5 72 2 minutes Cycle to step 3, 33 times 6 72 3 minutes trnL-F 1 94 3 minutes 2 94 1 minutes 3 58 1 minutes 4 72 1 minute, 20 seconds Cycle to step 2, 33 times 5 72 6 minutes

Sequencing

PCR products were cleaned with either Qiagen QIAquick PCR purification columns or with Microclean™ following the manufacturers protocols, eluted with

50 μL of 10 mM Tris-Cl (pH 8.5) and stored at 4°C. Purified PCR products were then cycle sequenced (Table 2-5) using a mix of water, fluorescent Big Dye dideoxy terminator, Better Buffer™, and a single primer (Table 2-6). For ITS and trnL-F, the products were sequenced using both primers to ensure reliability of sequence quality. The matK region was substantially larger, and required the primers used in PCR and two or three additional internal primers (Table 2-2 and

Fig. 2-1). Resulting cycle sequencing products were placed into a clean 1.5 mL

Eppendorf tube along with 19.2 μL of 95% ethyl alcohol and 0.8 μL of 3.0 M sodium acetate. This solution was mixed briefly and centrifuged at 13,200 rpm for 20 minutes. The supernatant was poured off and the resulting DNA pellet was cleaned thrice with approximately 500 μL of 70% ethyl alcohol. The pellets were then dried in a heated vacuum centrifuge at 60°C for approximately 15 minutes.

Table 2-5. Thermocycler program for cycle sequencing. Step # Temperature (C°) Time Notes 1 96 10 seconds 2 96 10 seconds 3 50 5 seconds 4 60 4 minutes Cycle to step 2, 25 times

Table 2-6. Cycle sequencing reagents. Reagents Volume (μL) Water 3.0 Better Buffer 2.0 Big Dye 1.0 Template 1.0 Primer 0.5

Cleaned cycle sequence products were directly sequenced on

polyacrylamide gel in a Perkin Elmer Applied Biosystems, Inc. (ABI) 377, 3100,

or 3130 automated sequencer at the Interdisciplinary Center for Biotechnology

Research facility at the University of Florida. Sequence data were edited and

assembled using Sequencher™. A consensus file of data from all primers from

each region was used as the alignable sequence for phylogenetic analyses.

Data Analysis

Sequence data from assembled sequence fragments were incorporated

into a matrix. Data were first manually aligned using Se-Al v2.0a11 (Rambaut,

1996). All characters were weighted equally. Missing data were coded as “?,”

gaps were coded as “-,” and nucleotides of indeterminable identity were coded as

“N.” No sequence data were excluded from analyses.

Maximum parsimony analyses were performed with PAUP*4.0b10

(Swofford, 1999) using heuristic search strategy of branch swapping by tree

bisection and reconnection (TBR), stepwise addition with 5000 random-addition

replicates holding 10 trees at each step, saving multiple trees. Individual

datasets (ITS, matK, and trnL-F) and combined datasets were all subjected to

this analysis.

Levels of support were measured using jackknife and bootstrap values.

Bootstrap values were estimated with 1000 bootstrap replicates, using TBR

algorithm for branch swapping for five random-addition replicates per bootstrap

replicate. Jackknife values were estimated with 1000 jackknife replicates, using

TBR algorithm for branch swapping for five random-addition replicates per

jackknife replicate, emulating Jac resampling and with character deletion set to

37%, in part following Freudenstein et al. (2004). Bootstrap and jackknife trees

were generated and manually compared for congruency.

Data congruency was tested using the partition homogeneity test (HTF) in

PAUP*4.0b10 (Swofford, 1999) as described by Johnson and Soltis (1998).

Heuristic searches for the HTF tests were performed using 100 replicates and a

TBR algorithm comparing all three combinations of the three genes. Ten

random-addition replicates were performed per HTF replicate, holding 5 trees and

saving no more than 10 trees per replicate. Probability values greater than 0.05

30 were used to identify data sets that were not significantly different from one another. Combined datasets used accessions with missing data.

A Bayesian analysis was performed using MrBayes 3.0b3 (Huelsenbeck &

Ronquist, 2001) as an alternative to parsimony. The model of no rate variation across sites (rates equal to “equal”) was selected for the combined three-gene matrix. The analysis was run for 2,000,000 generations with four chains. The burn-in stage was set to 200,000. The trees sampled from within the burn-in stage were excluded, and the remaining trees were assumed to be representative of the posterior probability distribution. The majority rule consensus tree was calculated in PAUP*, and the resulting branch values represent the posterior probabilities.

CHAPTER 3 RESULTS

In all analyses, Dichaea is monophyletic with strong support for the placement of Dichaea within Zygopetalinae. Seven outgroups were used, including one species of Maxillaria (Maxillariinae). Topology within the

Zygopetalinae is similar to that found by Whitten et al. (2005). Statistical comparisons of analyses for each gene region and combined gene regions are given in Table 3-1.

Table 3-1. Comparison of tree statistics for each gene region and combinations of these gene regions for parsimony analyses. Tree statistics ITS matK trnL-F matK + ITS + trnL-F matK + trnL-F Tree length (L) 896 323 272 599 1513 Informative characters 279 129 108 237 516 Total characters 790 1837 1331 3168 3958 Trees saved 503 5991 20000+ 20000+ 20000+ CI (with uninformative characters) 0.578 0.830 0.783 0.803 0.660 CI (without uninformative characters) 0.536 0.718 0.676 0.690 0.576 RI 0.881 0.935 0.915 0.924 0.891 RC 0.509 0.776 0.716 0.742 0.588

ITS Analyses of Dichaea

The ITS matrix includes 83 accessions. The monophyly of Dichaea is supported by a jackknife (JK) of 98% and a bootstrap (BS) of 94% (Figs. 3-1 and

3-2). There is no support for the relationships among the sections of Dichaea.

The monophyly of section Dichaea is strongly supported (100% JK, 100%

BS) with the addition of section Dichaeastrum. The two species representing section Dichaeastrum are not sister and do not form a monophyletic group.

31 32

Maxillaria sophronitis Zygopetalum maxillare Chaubardia heteroclita Outgroups Huntleya wallisii Dichaea poicillantha 3 D. poicillantha 4 D. poicillantha 5 D. poicillantha 1 D. poicillantha 2 D. eligulata D. cryptarrhena 1 D. muricatoides D. cryptarrhena 2 D. longa 1 D. longa 2 D. oxyglossa D. sarapiquinsis D. obovatipetala 1 D. obovatipetala 2 Dichaea D. cf. violacea D. sp. 9 D. sp. 2 D. sp. 3 D. sp. 5 D. sp. 7 D. muyuyacensis 1 D. muyuyacensis 2 D. cf. lagotis 1 D. cf. lagotis 2 D. cf. lagotis 3 D. sp. 6 D. sp. 4 D. pendula D. dammeriana D. viridula Dichaeastrum D. trichocarpa 1 D. trichocarpa 2 D. squarrosa D. hystricina 2 D. hystricina 1 Dichaea D. hystricina 3 D. cf. ciliolata D. neglecta D. tuerckheimii Dichaeastrum D. lankesteri 1 D. lankesteri 2 D. amparoana D. sp. 8 D. sp. 1 D. cf. kegelii D. cf. acroblephara 2 Pseudodichaea 1 D. cf. acroblephara 3 D. acroblephara 1 D. rubroviolacea D. ecuadorensis 1 D. ecuadorensis 2 D. elliptica 1 D. elliptica 2 D. fragrantissima ssp. eburnea 1 D. fragrantissima ssp. eburnea 2 D. morrisii 1 D. morrisii 3 D. cf. morrisii 2 Pseudodichaea 2 D. globosa 2 D. globosa 3 D. globosa 4 D. globosa 1 D. glauca Dichaeopsis 1 D. panamensis 1 D. panamensis 2 D. panamensis 3 D. panamensis 4 Dichaeopsis 3 D. ancoraelabia 1 D. ancoraelabia 2 D. ancoraelabia 3 D. trulla 1 D. trulla 2 D. trulla 3 Dichaeopsis 2 D. caveroi Warrea warreana Cryptarrhena guatemalensis Outgroups C. lunata 5 changes

Figure 3-1. One of 503 equally parsimonious ITS trees (DELTRAN optimization).

Maxillaria sophronitis Zygopetalum maxillare Warrea warreana Outgroups 84 Chaubardia heteroclita 78 Huntleya wallisii 52 Dichaea poicillantha 3 * D. poicillantha 4 100 D. poicillantha 5 100 D. poicillantha 1 D. poicillantha 2 D. eligulata 98 74 D. cryptarrhena 1 D. muricatoides 98 67 100 D. cryptarrhena 2 79 D. longa 1 99 78 D. longa 2 D. oxyglossa 74 D. sarapiquinsis 60 100 D. obovatipetala 1 100 D. obovatipetala 2 D. cf. violacea Dichaea 60 62 D. sp. 2 62 62 D. sp. 9 63 D. sp. 3 63 59 D. sp. 5 88 65 D. sp. 7 80 96 62 D. muyuyacensis 1 91 65 D. muyuyacensis 2 D. cf. lagotis 1 96 64 77 76 D. cf. lagotis 2 95 62 71 D. cf. lagotis 3 64 D. sp. 6 D. sp. 4 D. pendula D. dammeriana D. viridula Dichaeastrum 63 D. trichocarpa 1 100 100 62 D. trichocarpa 2 100 100 81 D. squarrosa D. hystricina 1 70 100 Dichaea 64 100 100 D. hystricina 2 52 100 D. hystricina 3 D. cf. ciliolata D. neglecta D. tuerckheimii Dichaeastrum 63 D. lankesteri 1 100 63 D. lankesteri 2 100 D. amparoana 100 D. sp. 8 100 100 D. sp. 1 100 100 D. cf. kegelii 62 D. cf. acroblephara 2 99 87 63 D. cf. acroblephara 3 Pseudodichaea 1 76 100 85 73 D. acroblephara 1 100 D. rubroviolacea 100 100 D. ecuadorensis 1 100 100 D. ecuadorensis 2 98 100 D. elliptica 1 94 100 D. elliptica 2 100 99 D. fragrantissima ssp. eburnea 1 100 71 100 D. fragrantissima ssp. eburnea 2 88 68 D. morrisii 1 86 D. morrisii 3 100 D. cf. morrisii 2 Pseudodichaea 2 99 D. globosa 2 100 85 D. globosa 3 100 86 D. globosa 4 D. globosa 1 D. glauca Dichaeopsis 1 D. panamensis 1 59 64 D. panamensis 2 56 100 63 100 D. panamensis 3 100 D. panamensis 4 Dichaeopsis 3 100 100 D. ancoraelabia 1 100 D. ancoraelabia 2 D. ancoraelabia 3 100 D. trulla 1 99 100 D. trulla 2 Dichaeopsis 2 97 D. trulla 3 D. caveroi 100 Cryptarrhena guatemalensis Outgroups 100 C. lunata

Figure 3-2. Jackknife consensus tree from analysis of ITS data set. Jackknife percentages are listed above branches and bootstrap percentages are listed below brnches. Percentages >50% are listed; values ≤50% are represented by an asterisk if the other analysis yielded a value >50%.

Section Pseudodichaea is strongly supported (100% JK and BS). There

are two strongly supported subclades: one group, the Pseudodichaea 2 clade,

contains D. globosa, D. morrisii, and D. fragrantissima (100% JK, 99% BS) and the other group, the Pseudodichaea 1 clade, contains all remaining species

(100% JK and BS).

Section Dichaeopsis is not supported as monophyletic. It consists of two

clades. One clade contains D. trulla and related taxa, the Dichaeopsis 2 clade,

(96% JK and BS) and the other contains D. glauca (the Dichaeopsis 1 clade), D.

panamensis, and D. ancoraelabia (together the Dichaeopsis 3 clade). Dichaea

panamensis and D. ancoraelabia are strongly supported (100% JK and BS) sister taxa, but D. glauca is poorly supported (59% JK, 56% BS) as sister to these two. The affinity of D. glauca to these taxa is incongruent with the plastid data. Also, the clade containing D. trulla is sister to the rest of the genus in many of the trees (Fig. 3-1), but does not have this relationship in the plastid data.

matK Analyses of Dichaea

The matK matrix includes 72 accessions. The monophyly of Dichaea is

strongly supported (96% JK, 92% BS) (Figs. 3-3 and 3-4). The relationships

among the sections of Dichaea are better supported in these analyses.

Section Dichaea is a strongly supported clade (99% JK, 97% BS).

However, the relationships within the section are considerably less resolved than

with ITS. The two species of section Dichaeastrum are not sister and are

embedded within section Dichaea.

Maxillaria sophronitis Zygopetalum maxillare Warrea warreana Outgroups Huntleya wallisii Chaubardia heteroclita Cryptarrhena guatemalensis C. lunata Dichaea poicillantha 1 D. poicillantha 2 D. poicillantha 3 D. poicillantha 4 D. poicillantha 5 D. sarapiquinsis D. obovatipetala 2 D. obovatipetala 1 D. sp. 9 D. muyuyacensis 1 D. muyuyacensis 2 D. sp. 2 D. cf. violacea D. cf. lagotis 1 D. sp. 3 Dichaea D. sp. 4 D. sp. 5 D. cf. lagotis 2 D. cf. lagotis 3 D. sp. 6 D. sp. 7 D. eligulata D. cryptarrhena 1 D. cryptarrhena 2 D. oxyglossa D. longa 1 D. longa 2 D. pendula D. tuerckheimii Dichaeastrum D. trichocarpa 1 D. squarrosa D. viridula Dichaeastrum D. hystricina 1 D. hystricina 2 D. hystricina 3 D. cf. ciliolata Dichaea D. neglecta D. dammeriana D. glauca Dichaeopsis 1 D. trulla 1 D. trulla 2 D. trulla 3 Dichaeopsis 2 D. caveroi D. lankesteri 2 D. amparoana D. sp. 8 D. cf. kegelii D. elliptica 1 Pseudodichaea 1 D. acroblephara 1 D. rubroviolacea D. ecuadorensis 1 D. ecuadorensis 2 D. fragrantissima ssp. eburnea 1 D. fragrantissima ssp. eburnea 2 D. morrisii 3 D. globosa 2 Pseudodichaea 2 D. globosa 3 D. globosa 4 D. panamensis 1 D. panamensis 2 D. panamensis 3 D. panamensis 4 Dichaeopsis 3 D. ancoraelabia 1 D. ancoraelabia 3 D. ancoraelabia 2 1 change

Figure 3-3. One of 5991 equally parsimonious matK trees (DELTRAN optimization).

Maxillaria sophronitis 76 Zygopetalum maxillare 71 Warrea warreana 79 Huntleya wallisii Outgroups 74 Chaubardia heteroclita 99 Cryptarrhena guatemalensis 98 C. lunata Dichaea poicillantha 1 98 D. poicillantha 2 D. poicillantha 3 99 D. poicillantha 4 D. poicillantha 5 62 D. sarapiquinsis D. obovatipetala 1 62 D. obovatipetala 2 D. sp. 9 64 D. muyuyacensis 1 87 62 D. muyuyacensis 2 D. sp. 2 82 D. cf. violacea D. cf. lagotis 1 D. sp. 3 Dichaea D. sp. 4 D. sp. 5 D. cf. lagotis 2 D. cf. lagotis 3 D. sp. 6 D. sp. 7 D. eligulata 63 D. cryptarrhena 1 66 63 99 62 D. cryptarrhena 2 57 60 D. oxyglossa 97 73 D. longa 1 75 D. longa 2 100 D. trichocarpa 1 100 D. squarrosa D. viridula Dichaeastrum D. hystricina 1 91 62 96 100 D. hystricina 2 87 60 96 D. hystricina 3 100 D. cf. ciliolata Dichaea D. neglecta 54 D. pendula D. dammeriana * D. tuerckheimii Dichaeastrum D. glauca Dichaeopsis 1 95 D. trulla 1 98 95 62 D. trulla 2 63 D. trulla 3 Dichaeopsis 2 96 D. caveroi D. lankesteri 2 99 D. amparoana 99 D. cf. kegelii D. sp. 8 98 65 D. elliptica 1 Pseudodichaea 1 96 99 63 94 D. acroblephara 1 92 96 D. rubroviolacea 99 D. ecuadorensis 1 100 99 D. ecuadorensis 2 100 62 D. fragrantissima ssp. eburnea 1 64 D. fragrantissima ssp. eburnea 2 D. morrisii 3 Pseudodichaea 2 98 D. globosa 2 D. globosa 3 99 D. globosa 4 D. panamensis 1 100 62 D. panamensis 2 D. panamensis 3 100 100 63 D. panamensis 4 Dichaeopsis 3 99 100 D. ancoraelabia 1 D. ancoraelabia 2 100 D. ancoraelabia 3

Figure 3-4. Jackknife consensus tree from analysis of matK data set. Jackknife percentages are listed above branches and bootstrap percentages are listed below branches. Percentages >50% are listed; values ≤50% are represented by an asterisk if the other analysis yielded a value >50%.

Section Pseudodichaea is monophyletic (100% JK and BS). However, the

Pseudodichaea 2 clade (D. globosa, D. morrisii, and D. fragrantissima) is not

supported. The remaining species are a strongly supported clade (98% JK, 99%

BS).

Section Dichaeopsis is not monophyletic. The three clades found using ITS

dataset are not closely related in any matK tree. The Dichaeopsis 3 clade is strongly supported (100% JK, 99% BS), but is not supported as sister to the rest of the genus (although it is sister in many of the trees) (Fig. 3-3). Dichaea glauca is strongly supported as sister to section Dichaea (91% JK, 87% BS), rather than sister to the Dichaeopsis 3 clade, as was found with ITS. The Dichaeopsis 2 clade is strongly supported as monophyletic (98% JK, 96% BS), but is a poorly supported (54% JK, <50% BS) sister to the clade containing section Dichaea and

D. glauca.

trnL-F Analyses of Dichaea

The trnL-F matrix includes 64 accessions. The monophyly of Dichaea is

moderately supported (82% JK, 77% BS) (Figs. 3-5 and 3-6). This dataset

shows the greatest resolution among the sections of Dichaea.

Section Dichaea is strongly supported (97% JK, 94% BS) as monophyletic

with the inclusion of section Dichaeastrum. Section Dichaeastrum is

polyphyletic: D. viridula is sister to the remainder of section Dichaea with

moderate support (74% JK, 66% BS) and D. tuerckheimii is part of a basal

polytomy within section Dichaea. The resolution within section Dichaea is very

similar to that obtained from the matK analysis.

Maxillaria sophronitis Zygopetalum maxillare Cryptarrhena guatemalensis Outgroup C. lunata Huntleya wallisii Chaubardia heteroclita Dichaea poicillantha 1 D. poicillantha 2 D. poicillantha 3 D. poicillantha 4 D. poicillantha 5 D. eligulata D. longa 2 D. cryptarrhena 1 D. cryptarrhena 2 D. sarapiquinsis D. obovatipetala 2 D. obovatipetala 1 D. pendula Dichaea D. oxyglossa D. sp. 9 D. muyuyacensis 2 D. cf. violacea D. cf. lagotis 1 D. cf. lagotis 2 D. cf. lagotis 3 D. sp. 6 D. sp. 3 D. sp. 5 D. sp. 7 D. sp. 4 D. hystricina 1 D. hystricina 2 D. hystricina 3 D. cf. ciliolata D. trichocarpa 1 D. squarrosa D. dammeriana D. neglecta D. tuerckheimii D. viridula Dichaeastrum D. glauca Dichaeopsis 1 D. lankesteri 2 D. amparoana D. sp. 8 D. cf. kegelii Pseudodichaea 1 D. elliptica 1 D. acroblephara 1 D. rubroviolacea D. ecuadorensis 2 D. fragrantissima ssp. eburnea 2 D. morrisii 3 D. globosa 2 Pseudodichaea 2 D. globosa 3 D. globosa 1 D. trulla 1 D. trulla 2 D. trulla 3 Dichaeopsis 2 D. caveroi D. panamensis 1 D. panamensis 3 D. ancoraelabia 3 Dichaeopsis 3 D. ancoraelabia 2 Warrea warreana Outgroup 1 change

Figure 3-5. One of >20,000 equally parsimonious trnL-F trees (DELTRAN optimization).

Maxillaria sophronitis Zygopetalum maxillare 100 Cryptarrhena guatemalensis 100 C. lunata Outgroups Warrea warreana 84 Huntleya wallisii 82 Chaubardia heteroclita Dichaea poicillantha 1 62 D. poicillantha 2 D. poicillantha 3 63 D. poicillantha 4 D. poicillantha 5 55 D. eligulata * D. longa 2 86 D. cryptarrhena 1 86 D. cryptarrhena 2 61 D. sarapiquinsis D. obovatipetala 1 65 D. obovatipetala 2 60 D. pendula Dichaea D. oxyglossa 53 63 D. sp. 9 66 D. muyuyacensis 2 D. cf. violacea D. cf. lagotis 1 86 D. cf. lagotis 2 89 D. cf. lagotis 3 62 D. sp. 3 62 D. sp. 5 74 D. sp. 6 87 D. sp. 7 66 D. sp. 4 81 84 D. trichocarpa 1 84 D. squarrosa 90 D. hystricina 1 97 94 D. hystricina 2 94 91 D. hystricina 3 90 D. cf. ciliolata 99 D. dammeriana 98 D. neglecta D. tuerckheimii D. viridula Dichaeastrum D. glauca Dichaeopsis 1 D. lankesteri 2 77 66 D. amparoana 72 60 D. cf. kegelii 89 D. sp. 8 86 D. elliptica 1 Pseudodichaea 1 59 96 D. acroblephara 1 100 52 96 D. rubroviolacea 98 D. ecuadorensis 2 97 D. fragrantissima ssp. eburnea 2 95 100 D. morrisii 3 D. globosa 1 99 D. globosa 2 Pseudodichaea 2 D. globosa 3 82 87 D. trulla 1 77 96 D. trulla 2 Dichaeopsis 2 88 D. trulla 3 96 D. caveroi 100 D. panamensis 1 100 D. panamensis 3 100 Dichaeopsis 3 100 94 D. ancoraelabia 2 95 D. ancoraelabia 3

Figure 3-6. Jackknife consensus tree from analysis of trnL-F data set. Jackknife percentages are listed above branches and bootstrap percentages are listed below branches. Percentages >50% are listed; values ≤50% are represented by an asterisk if the other analysis yielded a value >50%.

Section Pseudodichaea is strongly supported (100% JK, 98% BS) as

monophyletic. The topology is very similar to that of ITS with two strongly

supported clades (i.e., Pseudodichaea 1 clade and Pseudodichaea 2 clade).

Section Dichaeopsis is polyphyletic. There are 3 distinct clades as in matK.

The Dichaeopsis 3 clade is strongly supported as monophyletic (100% JK and

BS) and moderately supported as sister to the rest of the genus (82% JK, 77%

BS). The Dichaeopsis 2 clade is strongly supported as sister to section

Pseudodichaea + D. glauca + sections Dichaea and Dichaeastrum (97% JK,

95% BS). Dichaea glauca is strongly supported as sister to section Dichaea

(99% JK, 98% BS) as in matK.

Combined Plastid Analyses of Dichaea

The combined plastid (matK and trnL-F) matrix includes 72 accessions.

There were no conflicting, well-supported clades between the matK and trnL-F regions. In addition, the partition homogeneity test supported the congruence between these two datasets (p-value = 0.30). The monophyly of Dichaea is strongly supported (99% JK, 98% BS) (Figs. 3-7 and 3-8).

Section Dichaea is strongly supported (100% JK and BS) as monophyletic,

including D. viridula. Section Dichaeastrum is not supported as monophyletic: D.

viridula is sister to section Dichaea and D. tuerckheimii is part of a basal

polytomy in section Dichaea.

Section Pseudodichaea is strongly supported (100% JK and BS) as

monophyletic. The Pseudodichaea 2 clade constitutes a moderately supported

(78% JK, 79% BS) polytomy that is sister to the Pseudodichaea 1 clade.

Maxillaria sophronitis Zygopetalum maxillare Warrea warreana Outgroups Huntleya wallisii Chaubardia heteroclita Dichaea poicillantha 1 D. poicillantha 2 D. poicillantha 3 D. poicillantha 4 D. poicillantha 5 D. sarapiquinsis D. obovatipetala 2 D. obovatipetala 1 D. sp. 9 D. muyuyacensis 1 D. muyuyacensis 2 D. sp. 2 D. cf. violacea D. cf. lagotis 1 D. cf. lagotis 2 Dichaea D. cf. lagotis 3 D. sp. 6 D. sp. 3 D. sp. 5 D. sp. 7 D. sp. 4 D. eligulata D. longa 1 D. longa 2 D. cryptarrhena 1 D. cryptarrhena 2 D. oxyglossa D. pendula D. tuerckheimii Dichaeastrum D. trichocarpa 1 D. squarrosa D. dammeriana D. hystricina 1 Dichaea D. hystricina 2 D. hystricina 3 D. cf. ciliolata D. neglecta D. viridula Dichaeastrum D. glauca Dichaeopsis 1 D. lankesteri 2 D. amparoana D. sp. 8 D. cf. kegelii D. elliptica 1 Pseudodichaea 1 D. acroblephara 1 D. rubroviolacea D. ecuadorensis 1 D. ecuadorensis 2 D. fragrantissima ssp. eburnea 1 D. fragrantissima ssp. eburnea 2 D. globosa 2 D. globosa 1 Pseudodichaea 2 D. globosa 3 D. globosa 4 D. morrisii 3 D. trulla 1 D. trulla 2 Dichaeopsis 2 D. trulla 3 D. caveroi D. panamensis 1 D. panamensis 2 D. panamensis 3 D. panamensis 4 Dichaeopsis 3 D. ancoraelabia 1 D. ancoraelabia 3 D. ancoraelabia 2 Cryptarrhena guatemalensis Outgroups C. lunata 5 changes

Figure 3-7. One of >20,000 equally parsimonious plastid (matK and trnL-F) combined trees (DELTRAN optimization).

Maxillaria sophronitis 61 Zygopetalum maxillare 58 Warrea warreana Outgroups 96 Chaubardia heteroclita 92 Huntleya wallisii Dichaea poicillantha 1 99 D. poicillantha 2 99 D. poicillantha 3 D. poicillantha 4 D. poicillantha 5 85 D. sarapiquinsis D. obovatipetala 1 86 D. obovatipetala 2 D. sp. 9 63 D. muyuyacensis 1 84 63 D. muyuyacensis 2 80 D. sp. 2 D. cf. violacea D. cf. lagotis 1 83 D. cf. lagotis 2 85 D. cf. lagotis 3 59 D. sp. 6 58 D. sp. 3 Dichaea 83 D. sp. 5 74 D. sp. 7 D. sp. 4 D. eligulata 95 D. cryptarrhena 1 79 95 D. cryptarrhena 2 75 D. oxyglossa 70 82 D. longa 1 64 84 D. longa 2 66 D. pendula 59 100 D. trichocarpa 1 100 D. squarrosa 100 D. hystricina 1 100 D. hystricina 2 100 100 D. hystricina 3 100 100 D. cf. ciliolata 100 D. dammeriana D. neglecta 99 D. tuerckheimii Dichaeastrum 52 D. viridula * D. glauca Dichaeopsis 1 99 D. trulla 1 62 D. trulla 2 100 100 Dichaeopsis 2 99 62 D. trulla 3 D. caveroi D. lankesteri 2 94 100 D. amparoana 87 99 D. cf. kegelii 99 D. sp. 8 61 D. elliptica 1 Pseudodichaea 1 100 100 61 63 D. acroblephara 1 100 D. rubroviolacea 64 98 100 D. ecuadorensis 1 98 D. ecuadorensis 2 100 62 D. fragrantissima ssp. eburnea 1 99 60 D. fragrantissima ssp. eburnea 2 98 78 51 D. globosa 2 D. globosa 1 Pseudodichaea 2 79 * 62 63 D. globosa 3 D. globosa 4 D. morrisii 3 D. panamensis 1 100 62 D. panamensis 2 100 63 D. panamensis 3 100 D. panamensis 4 Dichaeopsis 3 100 100 D. ancoraelabia 1 100 D. ancoraelabia 2 D. ancoraelabia 3 100 Cryptarrhena guatemalensis Outgroups 100 C. lunata

Figure 3-8. Jackknife consensus tree from analysis of plastid (matK and trnL-F) data set. Jackknife percentages are listed above branches and bootstrap percentages are listed below branches. Percentages >50% are listed; values ≤50% are represented by an asterisk if the other analysis yielded a value >50%.

Section Dichaeopsis is not supported as monophyletic. Dichaea glauca

(Dichaeopsis 1 clade) is strongly supported as sister to section Dichaea + section

Dichaeastrum (100% JK, 99% BS). The Dichaeopsis 2 clade is poorly supported

as sister to D. glauca + sections Dichaea and Dichaeastrum (52% JK, <50% BS).

The Dichaeopsis 3 clade is strongly supported as monophyletic (100% JK and

BS) and as sister to the rest of the genus (99% JK, 98% BS).

Combined ITS and Plastid Analyses of Dichaea

The combined ITS, matK, and trnL-F matrix includes 83 accessions. There

were no conflicting, well-supported clades between these regions; all

incongruences were poorly supported (Figs. 3-9 and 3-10). In addition, the

partition homogeneity tests supported the congruence between these three

datasets: for ITS and trnL-F (p-value = 0.07), for ITS and matK (p-value = 0.16), and for matK and trnL-F (p-value = 0.30).

Section Dichaea is strongly supported as monophyletic with the inclusion of

section Dichaeastrum (100% JK, BS). The two species of section Dichaeastrum

do not form a monophyletic group.

Section Pseudodichaea is strongly supported as monophyletic (100% JK

and BS). Pseudodichaea 1 clade and Pseudodichaea 2 clade are both strongly

supported (100% JK and BS).

Section Dichaeopsis is not monophyletic. The Dichaeopsis 3 clade is sister

to the rest of the genus. However, the rest of the genus is on a branch with very

poor support using parsimony (52% JK, 51% BS). The Dichaeopsis 2 clade is

strongly supported as monophyletic (100% JK and BS). However, the position of

Maxillaria sophronitis Zygopetalum maxillare Warrea warreana Outgroups Chaubardia heteroclita Huntleya wallisii Dichaea poicillantha 3 D. poicillantha 4 D. poicillantha 5 D. poicillantha 2 D. poicillantha 1 D. sarapiquinsis D. obovatipetala 2 D. obovatipetala 1 D. cf. violacea D. sp. 9 D. sp. 2 D. muyuyacensis 2 D. muyuyacensis 1 D. sp. 3 D. sp. 5 D. sp. 7 D. cf. lagotis 1 D. cf. lagotis 2 D. cf. lagotis 3 D. sp. 6 Dichaea D. sp. 4 D. eligulata D. cryptarrhena 1 D. muricatoides D. cryptarrhena 2 D. longa 1 D. longa 2 D. oxyglossa D. pendula D. dammeriana D. trichocarpa 1 D. trichocarpa 2 D. squarrosa D. hystricina 2 D. hystricina 1 D. hystricina 3 D. cf. ciliolata D. neglecta D. tuerckheimii D. viridula Dichaeastrum D. glauca Dichaeopsis 1 D. trulla 1 D. trulla 2 D. trulla 3 Dichaeopsis 2 D. caveroi D. lankesteri 1 D. lankesteri 2 D. amparoana D. sp. 8 D. sp. 1 D. cf. kegelii D. cf. acroblephara 2 D. cf. acroblephara 3 Pseudodichaea 1 D. acroblephara 1 D. rubroviolacea D. ecuadorensis 1 D. ecuadorensis 2 D. elliptica 1 D. elliptica 2 D. fragrantissima ssp. eburnea 1 D. fragrantissima ssp. eburnea 2 D. morrisii 3 D. morrisii 1 D. cf. morrisii 2 Pseudodichaea 2 D. globosa 2 D. globosa 3 D. globosa 4 D. globosa 1 D. panamensis 1 D. panamensis 2 D. panamensis 3 D. panamensis 4 Dichaeopsis 3 D. ancoraelabia 1 D. ancoraelabia 3 D. ancoraelabia 2 Cryptarrhena guatemalensis C. lunata Outgroups 5 changes

Figure 3-9. One of >20,000 equally parsimonious three-gene (ITS, matK, and trnL-F) combined trees (DELTRAN optimization).

Maxillaria sophronitis Zygopetalum maxillare Warrea warreana Outgroups 93 Chaubardia heteroclita 92 Huntleya wallisii Dichaea poicillantha 1 100 D. poicillantha 2 100 D. poicillantha 3 D. poicillantha 4 D. poicillantha 5 D. eligulata 50 96 67 D. cryptarrhena 1 53 D. cryptarrhena 2 99 72 99 D. muricatoides 84 D. longa 1 100 92 D. longa 2 69 D. oxyglossa 69 76 D. sarapiquinsis 100 88 D. obovatipetala 1 100 D. obovatipetala 2 D. cf. violacea 60 D. sp. 2 67 D. sp. 9 58 D. muyuyacensis 1 53 71 71 D. muyuyacensis 2 Dichaea 71 90 62 D. sp. 3 91 D. sp. 5 D. sp. 7 86 D. cf. lagotis 1 98 D. cf. lagotis 2 86 99 D. cf. lagotis 3 D. sp. 6 D. sp. 4 D. pendula 78 D. dammeriana 78 58 51 100 D. trichocarpa 1 70 D. trichocarpa 2 * 100 66 D. squarrosa D. hystricina 1 63 100 100 100 100 D. hystricina 2 100 100 D. hystricina 3 D. cf. ciliolata 93 D. neglecta 93 D. tuerckheimii D. viridula Dichaeastrum D. glauca Dichaeopsis 1 59 D. lankesteri 1 100 72 D. lankesteri 2 D. amparoana 100 100 D. sp. 8 100 100 D. sp. 1 95 100 D. cf. kegelii 96 D. acroblephara 1 82 Pseudodichaea 1 63 100 93 D. cf. acroblephara 2 72 100 D. cf. acroblephara 3 100 D. rubroviolacea 52 100 D. ecuadorensis 1 100 51 100 D. ecuadorensis 2 100 D. elliptica 1 100 D. elliptica 2 100 99 D. fragrantissima ssp. eburnea 1 100 61 100 D. fragrantissima ssp. eburnea 2 83 71 D. morrisii 1 86 D. morrisii 3 100 D. cf. morrisii 2 Pseudodichaea 2 100 D. globosa 2 100 100 74 D. globosa 3 100 100 85 D. globosa 4 D. globosa 1 100 D. trulla 1 100 100 D. trulla 2 Dichaeopsis 2 100 D. trulla 3 D. caveroi 65 D. panamensis 1 100 76 D. panamensis 2 100 D. panamensis 3 100 D. panamensis 4 Dichaeopsis 3 100 100 D. ancoraelabia 1 100 D. ancoraelabia 2 D. ancoraelabia 3 100 Cryptarrhena guatemalensis Outgroups 100 C. lunata

Figure 3-10. Jackknife consensus tree from analysis of three-gene (ITS, matK, and trnL-F) data set. Jackknife percentages are listed above branches and bootstrap percentages are listed below branches. Percentages >50% are listed; values ≤50% are represented by an asterisk if the other analysis yielded a value >50%.

this clade within the genus is unresolved. Dichaea glauca (the Dichaeopsis 1

clade) is strongly supported as sister to section Dichaea (93% JK and BS).

A Bayesian inference analysis was also performed for this combined

dataset. The resulting trees were made into a consensus tree using a 50%

majority rule, with the posterior probability values (PP) listed (Fig. 3-11). The

monophyly of Dichaea is strongly supported (100% PP).

Bayesian inference gives similar results for section Dichaea and

Dichaeastrum. Section Dichaeastrum is not monophyletic.

Section Pseudodichaea is strongly supported as monophyletic (100% PP).

Pseudodichaea 1 clade and Pseudodichaea 2 clade are both strongly supported

(100% PP). However, section Pseudodichaea is poorly supported (60% PP) as

sister to Dichaeopsis 1 + sections Dichaea and Dichaeastrum.

The Bayesian tree shows section Dichaeopsis to be polyphyletic. It places

the Dichaeopsis 2 clade as one step into the genus past the Dichaeopsis 3 clade.

The Dichaeopsis 3 clade is sister to the rest of the genus. Unlike the MP trees, there is very high support using Bayesian Inference for the rest of the genus

(100% PP). Support for the Dichaeopsis 2 clade is similar to MP (100% PP).

Dichaeopsis 1 is sister to section Dichaea (100% PP).

Analysis of a Hybrid Accession of Dichaea schlechteri

One accession of Dichaea schlechteri was used in this study. The ITS PCR

product of this accession gave polymorphic signal when sequenced. Four clones

of this PCR product yielded two different copies when sequenced. Two parental

types would be expected in nuclear DNA from an interspecific hybrid. Neither

matK nor trnL-F gave polymorphic signal. Of the four clones of ITS for D.

Maxillaria sophronitis Zygopetalum maxillare Warrea warreana Outgroups 100 Chaubardia heteroclita Huntleya wallisii 99 Dichaea poicillantha 3 D. poicillantha 4 100 D. poicillantha 5 D. poicillantha 1 D. poicillantha 2 100 D. sarapiquinsis 100 D. obovatipetala 1 D. obovatipetala 2 71 D. cf. violacea 98 100 D. sp. 2 90 D. sp. 9 100 D. muyuyacensis 1 99 D. muyuyacensis 2 79 D. sp. 3 100 D. sp. 5 D. sp. 7 Dichaea 100 D. cf. lagotis 1 100 99 D. cf. lagotis 2 D. cf. lagotis 3 D. sp. 6 D. sp. 4 D. eligulata 100 100 D. cryptarrhena 1 100 D. muricatoides 98 100 D. cryptarrhena 2 100 100 D. longa 1 D. longa 2 66 D. oxyglossa D. pendula D. dammeriana 100 D. tuerckheimii Dichaeastrum 99 D. trichocarpa 1 98 100 D. trichocarpa 2 99 D. squarrosa D. hystricina 1 100 100 Dichaea 97 100 D. hystricina 2 D. hystricina 3 100 D. cf. ciliolata D. neglecta D. viridula Dichaeastrum D. glauca Dichaeopsis 1 94 D. lankesteri 1 100 D. lankesteri 2 100 D. amparoana D. sp. 8 100 D. sp. 1 60 100 D. cf. kegelii 100 D. cf. acroblephara 2 100 Pseudodichaea 1 80 100 D. cf. acroblephara 3 D. acroblephara 1 D. rubroviolacea 100 100 D. ecuadorensis 1 95 D. ecuadorensis 2 100 D. elliptica 1 D. elliptica 2 100 100 D. fragrantissima ssp. eburnea 1 100 52 D. fragrantissima ssp. eburnea 2 100 54 D. morrisii 1 D. morrisii 3 100 D. cf. morrisii 2 Pseudodichaea 2 D. globosa 2 100 100 D. globosa 3 D. globosa 4 100 D. globosa 1 100 D. trulla 1 100 97 D. trulla 2 D. trulla 3 Dichaeopsis 2 D. caveroi 94 D. panamensis 1 100 99 D. panamensis 2 D. panamensis 3 100 D. panamensis 4 Dichaeopsis 3 60 D. ancoraelabia 1 100 D. ancoraelabia 2 D. ancoraelabia 3 100 Cryptarrhena guatemalensis C. lunata Outgroups

Figure 3-11. 50% majority-rule consensus tree of a Bayesian analysis of three- gene (ITS, matK, and trnL-F) data set. Numbers above branches represent posterior probability values.

schlechteri, three form a monophyletic group (A, B, and C) that is most closely

related to D. cryptarrhena (Fig. 3-12). The fourth clone (D) is more closely related to D. oxyglossa. The matK and trnL-F combined plastid analysis places

D. schlechteri sister to D. cryptarrhena.

D. eligulata a D. cryptarrhena 1 D. cryptarrhena 2

D. longa 1 D. longa 2 D. oxyglossa

D. poicillantha 1 D. pendula D. dammeriana D. neglecta D. glauca D. globosa 3 D. trulla 2

D. eligulata b D. longa 1 D. longa 2

D. cryptarrhena 1

D. cryptarrhena 2

D. oxyglossa

D. poicillantha 1

D. pendula

D. dammeriana

D. neglecta

D. glauca

D. globosa 3 D. trulla 2

Figure 3-12. Branch and bound searches with branch lengths above each branch and jackknife and bootstrap percentages listed below. a) The various clones of D. schlechteri (D. Bogarín 329) and closely related Dichaea. b) The combined plastid data for D. schlechteri and closely related Dichaea.

CHAPTER 4 DISCUSSION

The monophyly of Dichaea is supported by molecular data and morphology.

Synapomorphies of Dichaea include elongate (monopodial) stems, reduced flower size, and infrastigmatic ligules. The placement of Dichaea within the

Zygopetalinae is also supported by molecular data and morphology. Dichaea does not share the distinctive multi-ridged callus and short sympodial growth typical of the Zygopetalinae, but it does share a distinct pollinarium structure of four pollinia attached to a stipe by four caudicles terminating in a viscidium.

The placement of Dichaea within the Zygopetalinae also agrees with

Whitten et al. (2005). Dichaea is somewhat aberrant in the Zygopetalinae because the callus on the labellum is generally absent or reduced to an inconspicuous ridge. The habit of the plant appears monopodial, instead of sympodial, as in the rest of the Zygopetalinae. Dichaea shares the synapomorphy of a single-flowered inflorescence with the rest of the Huntleyinae clade (Fig. 1-7). Single-flowered inflorescences are probably derived within the

Zygopetalinae but are common in the closely related Maxillariinae.

Cryptarrhena is possibly sister to the clade containing Dichaea and the

Huntleyinae group. The anchor-shaped labellum of Cryptarrhena is similar to that of Dichaea. Cryptarrhena also lacks the distinctive ridged callus at the base of the labellum. Instead, the claw of the labellum is thickened and raised into a single ridge, the most common type of callus found in Dichaea.

49 50

In Dichaea, the loss of articulating leaves evolved once and unites sections

Dichaea and Dichaeastrum (Fig. 4-1). Muricate ovaries appear to have evolved independently in sections Dichaea and Pseudodichaea (Fig. 4-2).

Indels (insertions and deletions) were not coded in any analysis. Some indels were homoplaseous, as in trnL-F. Many indels were a single nucleotide in length and were therefore dubious characters to code. Because a large portion of the data in this study consisted of introns, especially in trnL-F, the indels were often extensive and coding these for phylogenetic inference would have been very complicated. Indels were most informative at the species level and were largely autapomorphic. Wherever indels were evident and phylogenetically informative they are discussed in the following text.

Section Dichaeopsis

This section is not a monophyletic group in either the two-section system, sensu Kuntze (1904), or in the four-section system, sensu Cogniaux(1906).

Cogniaux’s more concise circumscription, including only those taxa with glabrous ovaries and an abscission layer in the leaves, consists of at least three distinct lineages.

One such lineage (Dichaeopsis 1 clade) consists of only a single species:

D. glauca. This species is found in Central America and in the Caribbean and is the tallest species in the genus. It has very glaucous leaves and the thickest roots in the genus. ITS placed this species sister to another group of section

Dichaeopsis, containing D. panamensis and D. ancoraelabia, but with poor support. Dichaea glauca and D. panamensis both have glaucous leaves, an unusual feature among Dichaea. However, plastid data strongly support the

Figure 4-1. Leaf abscission layer character mapped on one of >20,000 most parsimonious trees based on three-gene (ITS, matK, and trnL-F) dataset (DELTRAN optimization).

Figure 4-2. Muricate ovary character mapped on one of >20,000 most parsimonious trees based on three-gene (ITS, matK, and trnL-F) dataset (DELTRAN optimization).

placement of D. glauca sister to sections Dichaea and Dichaeastrum, even

though there is no apparent morphological basis for this placement.

The Dichaeopsis 2 clade consists of a number of species and is well

supported. The plants in this clade typically have erect or semi-erect stems,

leaves that are up to 10 cm long, and well-developed ligules. The placement of

this clade within the genus is uncertain. The ITS dataset usually places this

clade sister to the rest of the genus. The matK dataset usually places this clade

sister to the clade containing D. glauca and sections Dichaea and Dichaeastrum.

The trnL-F dataset more definitively places this clade sister to a clade including section Pseudodichaea, D. glauca and sections Dichaea and Dichaeastrum. The combined effect is the ambiguous placement of this clade.

The most common and widespread species in the Dichaeopsis 2 clade is D.

trulla. Dichaea caveroi was originally described from Peru; the specimen

sampled was grown in Ecuador by Ecuagenera and may represent a range

extension of the species otherwise unnoted. Other species not sampled in this

group include: D. calyculata Poepp. & Endl., D. powellii Schltr., and D. benzingii

Dodson.

Dichaea panamensis and D. ancoraelabia form the Dichaeopsis 3 clade.

This group has small leaves (1.0-3.0 x 0.1-0.7 cm), delicate stems, dark maroon

anther cap, spotted perianth, and a reduced and bluntly triangular infrastigmatic

ligule. These characters are shared by most species within the Dichaeopsis 3

clade and represent putative synapomorphies. The placement of this clade sister

to the rest of the genus is most strongly supported by plastid data, but even ITS

indicates that this is a relatively basal group in the genus. Remarkably, each

gene region shows that this clade is on a relatively long branch. This is a

potential reason for the moderate incongruence between nuclear and plastid

data. Long-branch attraction is probably not occurring in this instance because

all three gene regions show D. panamensis and D. ancoraelabia to be sister.

Also, taxon-sampling density is appropriate and the branch length of the

Dichaeopsis 3 clade is not abnormally long for the genus (Doyle & Davis, 1998).

There are, however, many more described species that are closely related

to these two species. The number of species in the Dichaeopsis 3 clade may be

exaggerated. The D. ancoraelabia species complex in this clade has a primarily

South American distribution. Some described species in the D. ancoraelabia

complex include D. campanulata C.Schweinf., D. hutchisonii D.E.Benn. &

Christenson, D. longipedunculata D.E.Benn. & Christenson, D. peruviensis

D.E.Benn. & Christenson, and D. picta Rchb.f. The other complex centers around D. panamensis. The monophyly of this species is supported by a unique six base pair insertion in the coding region of matK. Dichaea panamensis is a

widespread species found throughout Central and South America, but not in the

Caribbean. There are other species that are closely related to D. panamensis

(e.g., D. dressleri Folsom (ined.)). Dichaea tenuis C.Schweinf. and D. trinitensis

Gleason are undoubtedly part of this Dichaeopsis 3 clade, but it is uncertain here as to which complex they belong based on morphology.

Section Pseudodichaea

Two characters define section Pseudodichaea: leaves with an abscission

layer (which is plesiomorphic) and muricate ovaries (which is apomorphic).

Muricate ovaries are also found in section Dichaea; they seem to have evolved

twice and are therefore homoplaseous in the genus (Fig. 4-2). Despite the

circumscription of section Pseudodichaea being based on plesiomorphic and

homoplaseous characters, it is clearly a monophyletic section. Section

Pseudodichaea is not as closely related to section Dichaea as might be

supposed based on the muricate ovaries. These sections are separated by D.

glauca and, in some trees, also by the Dichaeopsis 2 clade (D. trulla and

relatives).

The data support two main groups within this section. One group is referred to as the Pseudodichaea 2 clade and consists of at least 3 recognized species: D. morrisii, D. fragrantissima, and D. globosa. These species are all

large for the genus, with relatively broad and long leaves. Dichaea globosa is a

morphologically distinct species with large, reddish-brown spots on the perianth

rather than stripes, as in the other two species. Dichaea morrisii is found through most of the range of genus, but D. fragrantissima and D. globosa are restricted to

Costa Rica and Panama. One accession of D. cf. morrisii from Ecuador

potentially makes the species paraphyletic to D. fragrantissima ssp. eburnea, and

a reassessment of species circumscription is probably necessary.

The other group, referred to as Pseudodichaea 1 clade in the phylogenetic

trees, is a much more speciose group. This clade is particularly diverse in South

America and many of these species were not sampled in this study: D.

alcantarae D.E.Benn. & Christenson, D. angustisegmenta Dodson, D. chasei

Dodson, D. cleistogama Dodson, D. delcastilloi D.E.Benn. & Christenson, D.

56 galeata Dodson, D. luerorum Dodson, D. moronensis Dodson, D. richii Dodson,

D. riopalenquensis Dodson, D. sodiroi Schltr., D. suarezii Dodson, D. tamboensis

Dodson, and D. venezuelensis Carnevali & I.Ramírez. There is a high degree of endemism for this Pseudodichaea 1 clade in Ecuador, with about ten endemic species. There is an unusually high degree of molecular divergence (and subsequently strong support) throughout the Pseudodichaea 1 clade, which may be because of the relatively poor taxon sampling in this clade.

Dichaea elliptica, D. acroblephara, D. lankesteri, and D. amparoana are all distributed in Costa Rica and Panama. The close relationship between D. amparoana and D. lankesteri has been hypothesized because of similar morphology (Dressler, 1993a), and the molecular data support their close relationship. Dichaea elliptica and D. acroblephara are very similar morphologically, but are not closely related. Dichaea ecuadorensis has a nine base pair deletion in the trnK-matK intron that supports the monophyly of this species.

The phylogenetic analysis of section Pseudodichaea probably has the most potential to be biogeographically informative. This section shows high levels of sequence divergence and phylogenetic resolution. With more adequate taxon sampling, any biogeographic patterns could easily be determined. This is especially true because of the high degree of endemism, lending discreet geographical limits, in places like Ecuador.

Section Dichaea (Including Section Dichaeastrum)

The most coherent group within Dichaea based on morphology consists of sections Dichaea and Dichaeastrum. This group has leaves lacking an

abscission layer (Fig. 4-1), a generally pendulous or creeping habit, and (usually)

muricate or (sometimes) glabrous ovaries. Sections Dichaea and Dichaeastrum

also form a strongly supported monophyletic group with all sampled gene

regions. Pfitzer (1889) and Kuntze (1904) recognized this entire group as

section Dichaea. Cogniaux (1906) and Schlechter (1914) segregated the group

into sections Dichaea and Dichaeastrum. This study does not support the

monophyly of section Dichaeastrum. The two taxa that would be placed in

section Dichaeastrum (D. tuerckheimii and D. viridula) have glabrous ovaries and

are relatively diminutive plants. As these two species are not sister and are part

of a basal polytomy within section Dichaea, section Dichaeastrum should be

treated as a part of section Dichaea. There are more species belonging to this

glabrous ovary group known as section Dichaeastrum (e.g., D. escobariana

Dodson, D. pumila Barb.Rodr., D. retroflexa Kraenzl., and D. tenuifolia Schltr.).

Species in section Dichaeastrum usually have small, thin-textured,

nonarticulating leaves and glabrous ovaries. Therefore, with greater taxon

sampling, a larger monophyletic group of what would be recognized as section

Dichaeastrum may appear. The type of section Dichaeastrum was not sampled;

morphological affinity of the type species to either D. tuerckheimii or D. viridula cannot be assessed at this time.

Section Dichaea s.s. was monographed in 1987 by Folsom. In addition, he

attempted to diagram the evolutionary patterns within the section, with emphasis

on clusters of species complexes (Fig. 1-8), some of which agrees with my

results. Dichaea poicillantha is a distinct species on a long branch in all

58 datasets. Folsom placed it near D. schlechteri, D. cryptarrhena, and D. muricatoides. The placement of D. muricatoides as sister to D. cryptarrhena in this phylogeny is based on ITS data from a herbarium specimen. Although this specimen fits into the morphological circumscription of D. muricatoides (i.e., leaves with numerous lateral veins), I suspect that it may be a variant of D. cryptarrhena. Also, Franco Pupulin (pers. comm.) suspects that D. muricatoides may simply be a synonym of D. poicillantha.

Dichaea oxyglossa, D. eligulata, D. longa, D. muricatoides, and D. cryptarrhena formed a strongly supported complex of species in my analyses.

This group does not entirely agree with Folsom’s diagram. He placed D. oxyglossa and D. eligulata near D. obovatipetala, D. sarapiquinsis, and D. retroflexiligula. Dichaea retroflexiligula was not sampled in this study. Dichaea obovatipetala and D. sarapiquinsis are not closely related to this group.

Dichaea schlechteri was also a part of this group according to plastid data

(matK and trnL-F), but ITS gave a strongly polymorphic signal. The ITS PCR was cloned giving two parental types, presumably from a hybrid origin: one of which was closely related to D. cryptarrhena and the other sister to D. oxyglossa.

The plastid data showed D. schlechteri sister to D. cryptarrhena; Folsom (1987) also indicated the close relationship between these two species. Because this is the only accession of D. schlechteri that could be obtained, there are no additional data to refute or confirm the hybrid status of this species. However, D. schlechteri may indeed be a legitimate species because the plastid data give a unique phylogenetic position and because one of the parental types of the ITS

data was congruent with the plastid data. This accession is probably a recent

interspecific hybrid between the true D. schlechteri and D. oxyglossa.

Dichaea obovatipetala and D. sarapiquinsis are moderately supported as a

monophyletic group. They are part of a strongly supported clade including most

South American taxa of section Dichaea. Folsom (1987) showed that D.

obovatipetala and D. sarapiquinsis are Central American constituents that have

close evolutionary ties to South American taxa. Although many of the

accessions sampled from this clade are unidentified, they do represent the South

American group of section Dichaea with strong cross venation demonstrated by

Folsom. Within this clade, D. muyuyacensis contained a unique insertion in the

matK-trnK intron region, which lends strong support for the monophyly of this

species, where there was poor to moderate support (58% JK, 71% BS)

otherwise. Several species have been described that are considered here to be

synonyms of D. muyuyacensis: D. tuberculilabris Folsom (from Colombia,

Ecuador, and Panama) and D. filiarum Pupulin (from Costa Rica).

Folsom ignored some of the taxa that should properly be placed within

section Dichaea. He referred to one such group as the “Dichaea hystricina complex,” including D. hystricina, D. ciliolata and other unspecified species. This complex has formed a monophyletic group united by ciliate leaf margins. The exclusion of this complex from section Dichaea would make it paraphyletic.

Pupulin (2005a) addressed this D. hystricina complex and showed that the variation in vegetative morphology in Costa Rica corresponded to a single species. The type of D. ciliolata is from Costa Rica and Pupulin suggested that it

is a synonym of D. hystricina, so the usage of this species name may be

inappropriate. The name has been used in this study for an Ecuadorian

specimen because it is used in that country as the only species other than D.

hystricina that has ciliate leaf margins.

Another distinct clade included D. trichocarpa, D. squarrosa and D.

intermedia Ames & Correll. Of these species, only D. squarrosa and D. trichocarpa were sampled. Dichaea intermedia is sometimes considered to be a hybrid between D. trichocarpa and D. squarrosa (Ames & Correll, 1985; Folsom,

1987). Taxon sampling was insufficient to determine the monophyly of these three species individually, but they are clearly closely related and form a monophyletic group as was depicted by Folsom (1987).

Dichaea neglecta was part of an unresolved polytomy at the base of section

Dichaea. Dichaea costaricensis Schltr. was not sampled in this study (material

could not be obtained), so its hypothesized close relationship to D. neglecta

(Folsom, 1987) could not be confirmed.

Folsom also indicated a few aberrant species that were not closely related

to any other species. Species such as D. pendula and D. dammeriana were sampled in this study and were demonstrated to be part of a paraphyletic grade at the base of the core group of section Dichaea. In addition, D. camaridioides

Schltr. has a very distinct morphology and was not sampled in this study, but

would probably also be isolated phylogenetically.

It is unclear how many species were not sampled in this section, especially

because of the number of specimens that were unidentified from the primarily

South American clade. Two specimens, D. sp 2 (Whitten 1724) and D. sp 9

(Neubig 4-2004) probably represent one species of uncertain affinity. The specimens identified as D. cf. lagotis are not identified with any certainty. The flowers of D. lagotis are supposed to be immaculate. My accessions match the vegetation of D. lagotis very well. Dichaea sp. 4 (Whitten 2435) is a separate entity, but of uncertain specific affinity. Dichaea sp. 3 (Whitten 2434), D. sp. 5

(Whitten 2476), and D. sp. 7 (Whitten 2709) also probably represent a single, different species of uncertain affinity.

Summary

All my data support the monophyly of Dichaea and its placement within the

Zygopetalinae, but most of the traditionally recognized sections are not shown to

be monophyletic. Section Dichaeopsis consists of at least three distinct lineages: one clade containing D. trulla and relatives, another clade containing D.

panamensis and relatives, and the last clade containing only D. glauca. A revision of the taxonomy of this group would create two new sections in addition to section Dichaeopsis s.s. Section Pseudodichaea is monophyletic and contains two clades: one of a few robust species like D. morrisii and the other of numerous delicate species like D. rubroviolacea. These two clades are marked by distinct morphology and may merit the separation into two different sections.

Sections Dichaea and Dichaeastrum are not distinct phylogenetically. Each of these two sections has been demonstrated to be nonmonophyletic with the exclusion of the other. The simplest taxonomic revision of sections Dichaea and

Dichaeastrum would make it a single group, section Dichaea s.l., united by the lack of an abscission layer in the leaves (Fig. 4-1). The muricate ovary character

62 has apparently evolved at least twice: once in section Pseudodichaea and once

(or more) within section Dichaea s.l. (Fig. 4-2). This may be further supported by the more definitive placement of the Dichaeopsis 2 clade, which is lacking in these data. The apparent homoplasy created by the loss of muricate ovaries or the multiple origins of muricate ovaries has led to recognition of an unsound group: section Dichaeastrum.

LIST OF REFERENCES

Ames O, Correll DS. 1985. Orchids of Guatemala and Belize. New York: Dover Publications.

Aublet JBCF. 1775. Histoire des Plantes de la Guiane Francoise, volume 2. Paris: Didot.

Balick MJ, Nee MH, Atha DE. 2000. Checklist of the vascular plants of Belize, with common names and uses. New York: The New York Botanical Garden Press.

Blattner FR. 1999. Direct amplification of the entire ITS region from poorly preserved plant material using recombinant PCR. BioTechniques 27: 1180-1186.

Boggan J, Funk V, Kelloff C, Hoff M, Cremers G, Feuillet C. 1992. Checklist of the plants of the Guianas (Guyana, Surinam, French Guiana). Washington, D.C.: Smithsonian Institution.

Brako L, Zarucchi J. 1995. Catalogue of the flowering plants and Gymnosperms of Peru. St. Louis: Missouri Botanical Garden Press.

Cameron KM. 2001. An expanded phylogenetic analysis of Orchidaceae using three plastid genes: rbcL, atpB, and psaB. American Journal of Botany 88: 104.

Cameron KM. 2004. Utility of plastid psaB gene sequences for investigating intrafamilial relationships within Orchidaceae. Molecular Phylogenetics and Evolution 31: 1157-1180.

Cameron KM, Chase MW, Whitten WM, Kores PJ, Jarrell DC, Albert VA, Yukawa T, Hills HG, Goldman DH. 1999. A phylogenetic analysis of the Orchidaceae: evidence from rbcL nucleotide sequences. American Journal of Botany 86: 208-224.

Carnevali G, Ramirez- Morillo IM. 2003. Dichaea. In: Berry PE, Yatskievych K and Holst BK, eds. Flora of the Venezuelan Guyana. St. Louis: Missouri Botanical Garden Press, 299-305.

63 64

Chase M, Freudenstein JV, Cameron KM, Barrett RL. 2003. DNA data and Orchidaceae systematics: a new phylogenetic classification. In: Dixon KW, Kell SP, Barrett RL and Cribb PJ, eds. Orchid Conservation. Kota Kinabalu, Malaysia: Natural History Publications, 69-89.

Cogniaux A. 1906. Orchidaceae III. In: de Martius CFP, ed. Flora Brasiliensis. Koenigstein: Otto Koeltz Science Publishers, 484-504.

Dodson CH, Escobar R. 1994. Native Ecuadorian Orchids, volume I. Medellin, Colombia: Compania Litografica Nacional.

Doyle JJ, Davis JI. 1998. Homology in molecular phylogenetics: a parsimony perspective. In: Soltis DE, Soltis PS and Doyle JJ, eds. Molecular systematics of plants II: DNA sequencing. Boston: Kluwer Academic Publishers, 101-131.

Doyle JJ, Doyle JL. 1987. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochemical Bulletin 19: 11-15.

Dressler RL. 1968. Pollination by euglossine bees. Evolution 22: 202-210.

Dressler RL. 1993a. Field guide to the orchids of Costa Rica and Panama. Ithaca: Comstock Publishing Associates.

Dressler RL. 1993b. Phylogeny and classification of the orchid family. Portland: Dioscorides Press.

Dressler RL. 2003. Dichaea. In: Hammel BE, Grayum MH, Herrera C and Zamora N, eds. Manual de plantas de Costa Rica. Volumen III: Monocotiledoneas (Orchidaceae-Zingiberaceae). St. Louis: Missouri Botanical Garden Press, 70-80.

Felix LP, Guerra M. 2000. Cytogenetics and cytotaxonomy of some Brazilian species of Cymbidioid orchids. Genetics and Molecular Biology 23: 957- 978.

Folsom JP. 1987. A systematic monograph of Dichaea section Dichaea (Orchidaceae) Department of Botany. Austin: University of Texas.

Freudenstein JV, van den Berg C, Goldman DH, Kores PJ, Molvray M, Chase M. 2004. An expanded plastid DNA phylogeny of Orchidaceae and analysis of jackknife branch support strategy. American Journal of Botany 91: 149-157.

Hamer F. 2001. Dichaea. In: Stevens WD, Ulloa CU, Pool A and Montiel O, eds. Flora de Nicaragua, Angiospermas (Fabaceae-Oxalidaceae). St. Louis: Missouri Botanical Garden Press, 1655-1659.

Hering L. 1900. Zur anatomie der monopodialen Orchideen. Botanisches Centralblatt 84: 1-11, 35-45, 73-113, 113-122, 145-150, 177-184.

Hooker WJ. 1827. Exotic Flora. William Blackwood, Edinburgh.

Huelsenbeck JP, Ronquist F. 2001. MRBAYES: Bayesian inference of phylogenetic trees. Bioinformatics 17: 754-755.

Johnson LA, Soltis DE. 1998. Assessing congruence: empirical examples from molecular data. In: Soltis DE, Soltis PS and Doyle JJ, eds. Molecular systematics of plants II: DNA sequencing. Boston: Kluwer Academic Publishers, 297-348.

Jorgensen PM, Leon-Yanez S. 1999. Catalogue of the vascular plants of Ecuador. St. Louis: Missouri Botanical Garden Press.

Judd WS, Campbell CS, Kellogg EA, Stevens PF, Donoghue MJ. 2002. Plant Systematics: A Phylogenetic Approach. Sunderland: Sinauer Associates, Inc.

Knowles G, Westcott F. 1839. Dichaea. Floral Cabinet 2: 167.

Kraenzlin F. 1923. Orchidaceae-Monandrae-Pseudomonopodiales. In: Engler A, ed. Das Pflanzenreich. Leipzig, Germany: Engelmann, 33-59.

Kuntze CEO. 1904. Revision of Dichaea. In: von Post TE, ed. Lexicon Generum Phanerogamarum. Stuttgart: Deutsche Verlags-Anstalt, 171.

Lindley J. 1833. The genera and species of orchidaceous plants. London: Ridgways.

McVaugh R. 1985. Dichaea. In: Anderson WR, ed. Flora Novo-Galiciana, volume 16 Orchidaceae. Ann Arbor: The University of Michigan Press, 77- 78.

Möbius M. 1887. Über den anatomischen Bau der Orchideenblätter und dessen Bedeutung für das System dieser Familie. Jahrbücher für Wissenschaftliche Botanik 18: 530-607.

Nir MA. 2000. Orchidaceae Antillanae. New York: DAG Media Publishing, Inc.

Pabst GFJ, Dungs F. 1977. Orchidaceae Brasilienses. Hildesheim, Germany: Brücke-Verlag Schmersow.

Peter CI, Johnson SD. 2005. Doing the twist: a test of Darwin's cross-pollination hypothesis for pollinarium reconfiguration Biology Letters. 1-4.

Pfitzer EH. 1889. Orchidaceae. In: Engler A and Prantl K, eds. Die Naturlichen Pflanzenfamilien. 6 ed. Leipzig, Germany: Verlag von Wilhelm Engelmann, 206-207.

Pupulin F. 2005a. Dichaea hystricina and Dichaea ciliolata: two species in one and an interesting variation. Orchids 74: 678-683.

Pupulin F. 2005b. Vanishing beauty: native Costa Rican orchids. San Jose, Costa Rica: Editorial de la Universidad de Costa Rica.

Rambaut A. 1996. Se-Al: Sequence Alignment editor, v2.0a11. Oxford, UK: University of Oxford. Available at website, http://evolve.zoo.ox.ac.uk/, last accessed 8 August 2002.

Ruiz H, Pavon J. 1794. Flora Peruvianae, et Chilensis Prodromus. Madrid, Spain: Imprenta de Sancha.

Schlechter R. 1914. Die Orchideen-Gruppe Dichaeinae Pfitzers. Orchis 8: 1-8.

Schneckenburger S. 1994. Orchid inflorescences - descriptive and typological aspects. In: Pridgeon AM, ed. Proceedings of the 14th World Orchid Conference. Edinburgh, UK: HMSO Publications, 353-360.

Senghas K. 1996. Dichaeinae. In: Schlechter R, ed. Die Orchideen. Berlin, Germany: Blackwell Wissenschafts-Verlag, 1853-1861.

Sosa V, Gomez-Pompa A. 1994. Flora de Veracruz. Xalapa, Mexico: Instituto de Ecologia.

Stern WL, Judd WS, Carlsward BS. 2004. Systematic and comparative anatomy of Maxillarieae (Orchidaceae), sans Oncidiinae. Botanical Journal of the Linnean Society 144: 251-274.

Sun Y, Skinner DZ, Liang GH, Hulbert SH. 1994. Phylogenetic analysis of Sorghum and related taxa using internal transcribed spacers of nuclear ribosomal DNA. Theoretical and Applied Genetics 89: 26-32.

Swartz O. 1788. Nova Genera & Species Plantarum seu Prodromus descriptionum Vegetabilium, maximam partem incognitorum quae sub itinere in Indiam Occidentalem annis 1783-87. Stockholm, Sweden: In Bibliopoliis Acad. M. Swederi.

Swartz O. 1799. Nova Acta Regiae Societatis Scientiarum Upsaliensis 6: 71.

Swofford DL. 1999. PAUP*: phylogenetic analysis using parsimony (*and other methods), version 4.0b10. Sunderland: Sinauer Associates, Inc.

Szlachetko DL. 1995. Systema Orchidalium. Fragmenta Floristica et Geobotanica Supplementum 3: 1-152.

Vasquez R, Ibisch PL, Gerkmann B. 2003. Diversity of Bolivian Orchidaceae - a challenge for taxonomic, floristic and conservation research. Organisms, Diversity & Evolution 3: 93-102.

Whitten MW, Williams NH, Chase MW. 2000. Subtribal and generic relationships of Maxillarieae (Orchidaceae) with emphasis on Stanhopeinae: combined molecular evidence. American Journal of Botany 87: 1842-1856.

Whitten WM, Williams NH, Dressler RL, Gerlach G, Pupulin F. 2005. Generic relationships of Zygopetalinae (Orchidaceae: Cymbidieae): combined molecular evidence. Lankesteriana 5: 87-107.

Williams NH. 1982. The biology of orchids and euglossine bees. In: Arditti J, ed. Orchid Biology, Reviews and Perspectives II. Ithaca: Cornell University Press, 119-171.

Williams NH, Chase MW, Fulcher T, Whitten WM. 2001. Molecular systematics of the Oncidiinae based on evidence from four DNA sequence regions: expanded circumscriptions of Cyrtochilum, Erycina, Otoglossum, and Trichocentrum and a new genus (Orchidaceae). Lindleyana 16: 113-139.

BIOGRAPHICAL SKETCH

Kurt Maximillian Neubig was born in Baton Rouge, Louisiana, to Henry

Conrad Neubig of Plaquemine and Linda Hutchins Neubig of Shreveport on

February 1, 1981. He graduated from Scotlandville Magnet High School in 1999

and started his undergraduate career with great haste at Louisiana State

University in Baton Rouge. While at LSU, Kurt met Lowell Urbatsch, a plant

systematist, who helped guide him into the field of taxonomy and systematics. In

2003, he earned a Bachelor of Science degree in biological sciences with a

minor in French. That same year, he enrolled as a graduate student at the

University of Florida under the tutelage of the great and powerful Dr. Norris H.

Williams. In July of 2004, Kurt finally married his lifelong sweetheart, the funny

and beautiful Julie Kay Eggert. Through Norris’s masterful guidance and wit,

Kurt graduated with a Master of Science in December of 2005. Kurt hopes that

he may continue his graduate career to become a rich and famous scientist.