The Roles of Hmsh4-Hmsh5 and Hmlh1-Hmlh3 in Meiotic Double Strand Break Repair DISSERTATION Presented in Partial Fulfillment Of

The roles of hMSH4-hMSH5 and hMLH1-hMLH3 in meiotic double strand break repair

DISSERTATION

Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate School of The Ohio State University

Randal James Soukup

Graduate Program in Molecular, Cellular and Developmental Biology

The Ohio State University

2016

Dissertation Committee:

Richard Fishel, PhD, Advisor

Mark Parthun, PhD

Charles Bell, PhD

Mamuka Kvaratskhelia, PhD

Copyrighted by

Randal James Soukup

2016

Abstract

The DNA double strand break is a highly cytotoxic DNA lesion. Mouse and human mitotically dividing cells experience ~10 double strand breaks (DSBs) per day that are often repaired through non-homologous end joining and result in the accumulation of short insertions and deletions. However, in prophase I of meiosis, ~400 double strand breaks are introduced into primary mouse spermatocytes by the endonuclease SPO11. The cell undergoes a cell-wide DSB repair response which functions to repair each break, and in doing so, pair homologous chromosomes for segregation at the outset of meiosis I. This process generates genetic crossovers between the homologous chromosomes, which are required for accurate chromosome segregation and are also the basis for the reshuffling of genes between maternal and paternal chromosomes. At the center of this DNA repair process is the Holliday Junction, which physically links homologous chromosomes and whose resolution defines the outcome to a genetic crossover or gene conversion event. A number of proteins involved in mitotic

DSB repair are also involved with the meiotic process. However, MSH4-MSH5 and

MLH1-MLH3 proteins appear to have unique roles in establishing homologous chromosome pairing and segregation during meiotic DSB repair, but do not play any role in mitotic DSB repair.

Here we used purified hMSH4-hMSH5 to conduct a series of binding experiments with numerous Holliday Junction constructs. We demonstrate binding of mobile, as well as immobile, Holliday Junctions by hMSH4-hMSH5, and the ability to retain ATP bound hydrolysis-independent sliding clamps on a blocked-end mobile Holliday Junction. In addition, we show that the binding of hMSH4-hMSH5 does not appear to distinguish between the stacked-X or planar conformations of the Holliday Junction. The rate of bulk branch migration by an assembled Holliday Junction did not appear to be affected by the addition of hMSH4-hMSH5. The development of a single molecule approach is reported that will ultimately be used to determine whether the protein transiently or kinetically influences branch migration of individual Holliday Junctions.

With no protein currently identified that functions to maintain homologous chromosome pairing through segregation or perform the required Holliday Junction resolution prior to segregation, we partially purified and examined the hMLH1-hMLH3 heterodimer that has been shown to be associated with the development of homologous chromosome linkages. Our preparation of hMLH1-hMLH3 does not appear to display any endonuclease activity or stable complex formation with hMSH4-hMSH5. As has been previously reported we do observe an aggregate that appears to form between hMLH1-hMLH3 and Holliday Junctions at very low ionic strengths. Further hMLH1- hMLH3 purification is required for more complex studies to be performed.

iii

To my wife, Jenna Karras, you are my biggest champion and best friend; I couldn’t have done this without you.

To my Dad, for unwavering love, support, guidance, and friendship.

To my Mom, for your constant love and encouragement, I will always love and miss you.

Acknowledgments

I would like to thank my advisor, Rick Fishel, for his guidance, support, and mentorship. I thank him for introducing me to the wonders and frustrations of scientific research and for guiding me through the world of Biophysics.

I thank the members of my dissertation committee: Dr. Mark Parthun, Dr.

Charles Bell and Dr. Mamuka Kvaratskhelia for generously offering their time, support and guidance throughout my graduate career. Your discussion and ideas have been incredibly helpful.

I wish to thank Dr. Kristine Yoder for her support, encouragement and kindness.

Thank you for keeping your office door open and encouraging my progression to the end.

Finally, I want to express my sincere gratitude to past and present members of Dr.

Fishel’s and Dr. Yoder’s labs. I thank Nathan Jones, Brooke Britton, Miguel Lopez and

Dr. Juana Martin Lopez for their support and friendship. I especially thank Dr. Gayan

Senavirathne for his support and scientific discussions, and Dr. Jeungphill Hanne for his commitment to helping and guiding me through single molecule experiments. It has been a pleasure to work with and learn from everyone.

Vita

April 15, 1987 ...... Born – Highland Heights, Ohio

May 2005 ...... Gilmour Academy

May 2009…………………………………….B.S. Biochemistry, Miami University Oxford, Ohio

September 2010 to present ...... Graduate Research Associate, The Ohio State University, Columbus, Ohio

Publications

1. Xu B, Soukup RJ, Jones CJ, Fishel R, Wozniak DJ. Pseudomonas aeruginosa AmrZ binds to four sites in the algD promoter, inducing DNA-AmrZ complex formation and transcriptional activation. J Bacteriol. 2016 May 16.

2. Xu B, Ju Y, Soukup RJ, Ramsey DM, Fishel R, Wysocki VH, Wozniak DJ. The Pseudomonas aeruginosa AmrZ C-terminal domain mediates tetramerization and is required for its activator and repressor functions. Environ Microbiol Rep. 2016 Feb;8(1):85-90. doi: 10.1111/1758-2229.12354. Epub 2015 Dec 21.

3. Honda M, Okuno Y, Hengel SR, Martín-López JV, Cook CP, Amunugama R, Soukup RJ, Subramanyam S, Fishel R, Spies M. Mismatch repair protein hMSH2- hMSH6 recognizes mismatches and forms sliding clamps within a D-loop recombination intermediate. Proc Natl Acad Sci U S A. 2014 Jan 21;111(3):E316-25. doi: 10.1073/pnas.1312988111. PMID:24395779

Fields of Study

Major Field: Molecular, Cellular and Developmental Biology

Table of Contents

Abstract ...... ii

Acknowledgments ...... v

Vita ...... vi

List of Tables ...... x

List of Figures ...... xi

Chapter 1: Introduction ...... 1

1.1 Double strand break repair………………………………………………...1

1.2 Double strand break repair in meiotic cells……………………………….6

1.3 Holliday Junction dynamics and structure…………………………….…..9

1.4 MSH4-MSH5: A MutS homolog involved in meiotic homologous recombination…….………………………………………...12

1.5 hMLH1-hMLH3: A MutL homolog with a role in meiotic recombination………………………………………………...14

Chapter 2: Investigating the mechanism of hMSH4-hMSH5 search for the Holliday Junction branch point and its impact on branch migration.....17

2.1 Introduction……………………………………………………………..17

2.2 Materials and methods…………………………………………………..19

vii

2.3 Results………………………………………………………………...…27

2.3.1 hMSH4-hMSH5 can be purified to near homogeneity…………..27

2.3.2 hMSH4-hMSH5 recognizes immobile Holliday Junctions and form a sliding clamp upon ATP binding……….……………29

2.3.3 hMSH4-hMSH5 also recognizes mobile Holliday Junctions and forms a sliding clamp upon ATP binding………….………..31

2.3.4 hMSH4-hMSH5 shows stronger binding affinity to a mobile Holliday Junction containing a dsDNA tail……………………...33

2.3.5 The Holliday Junction conformation does not appear to impact hMSH4-hMSH5 binding …………………………………….…..35

2.3.6 An hMSH4-hMSH5 sliding clamp can be retained on mobile Holliday Junctions when DNA ends are blocked………….…….36

2.3.7 hMSH4-hMSH5 sliding clamp is retained on tailed mobile Holliday Junctions ……………………………………..………..38

2.3.8 Development of FRET based assembled Holliday Junction branch migration assay………………………………………...... 40

2.3.9 Validating the migration rates of our assembled Holliday Junction……………………………………………………….….44

2.3.10 The addition of hMSH4-hMSH5 to assembled Holliday Junctions does not appear to alter the rate of branch migration……..……..45

2.3.11 Pitfalls of assembled Holliday Junction branch migration……….48

2.3.12 Developing a model single molecule branch migratable Holliday Junction………………………………………………...48

2.4 Discussion………………………………………………………………..53

Chapter 3: Determining the in vitro activity of purified hMLH1-hMLH3………….56

3.1 Introduction………………………………………………………………56

3.2 Materials and methods…………………………………………………...58

viii

3.3 Results……………………………………………………………………62

3.3.1 Purification of hMLH1-hMLH3…………………………………62

3.3.2 Testing purified hMLH1-hMLH3 for Endonuclease Activity…………………………………………………………..65

3.3.3 Determination of the DNA substrates which associate with hMLH1-hMLH3…………………………………………………66

3.3.4 hMLH1-hMLH3 recruitment to HJ by hMSH4-hMSH5………...69

3.4 Discussion………………………………………………………………..71

Chapter 4: Discussion………………………………………………………………….73

4.1 Introduction……………………………………………………………...73

4.2 Interaction between hMSH4-hMSH5 and the Holliday Junction………..75

4.3 How do HJ dynamics fit with the DSBR mechanisms?...... 77

4.4 The difficult elucidation of a mechanism for MLH1-hMLH3 in homologous recombination………………..…………………………..78

4.5 Conclusions………………………………………………………………80

References………………………………………………………………………………82

List of Tables

Table 1. PCR primers used to fuse HIS6 tag onto the C-terminus of MSH5………..…19

Table 2. Oligonucleotides used in the construction of four-stranded Holliday Junctions…………………………………………………….…...………..…...23

Table 3. Comparison of our measured rates of branch migration to previous reports…………………………………………………...……………………..45

Table 4. Primers used to fuse MBP onto MLH3………………………………………...59

List of Figures

Figure 1. Pathways of Double Strand Break Repair…...... 2

Figure 2. Resolution of double Holliday Junctions……………………………………….5

Figure 3. Movement of Holliday Junctions……………………..……………………….10

Figure 4. Purification of hMSH4-hMSH5…………………………………………….....28

Figure 5. hMSH4-hMSH5 binding and Clamp Formation on Immobile Holliday Junctions……………………………………………………………………….30

Figure 6. hMSH4-hMSH5 binding and clamp formation on mobile Holliday Junctions…………………………………………………………………….…32

Figure 7. Stronger binding of Holliday Junction with dsDNA tail…………………..….34

Figure 8. hMSH4-hMSH5 recognizes a Holliday Junction in the planar T configuration…………………………………………………………………………….36

Figure 9. Double blocked end Holliday Junction results in strong binding by hMSH4-hMSH5 and retention of sliding clamps………………………………………..37

Figure 10. hMSH4-hMSH5 sliding clamp is retained on a tailed Holliday Junction……………………………………………………………..……………………39

Figure 11. Cartoon of the assembled Holliday Junction for branch migration assays…41

Figure 12. Sample traces of assembled Holliday Junction branch migration………..….43

Figure 13. Rate validation of assembled Holiday Junction branch migration………...…44

Figure 14. The addition of hMSH4-hMSH5 to assembled Holliday Junctions does not appear to alter the rate of branch migration…………………………………………….47

Figure 15. Single molecule Holliday Junction with fluorophores in non-migratable region ……………………………………………………………………………………49 . Figure 16. Single molecule migration trajectories of branch migratable Holliday Junction……………………………………………………………………………….….50

Figure 17. Single molecule migration trajectories in magnesium demonstrate a slower rate of branch migration…..……………………………………………………………51

Figure 18. Average change in FRET of single molecule migration trajectories in the absence and presence of magnesium...... ………………...…….....53

Figure 19. Purification of hMLH1-hMLH3……………………………………………..64

Figure 20. Studying the endonuclease activity of hMLH1-hMLH3…………………….66

Figure 21… hMLH1-hMLH3 interacts with different DNA substrates………………...68

Figure 22. Determining if hMLH1-hMLH3 can form a stable complex with hMSH4- hMSH5…………………………………………………………….…………………….70

xii

Chapter 1: Introduction

1.1 Double strand break repair

DNA is fragile. Breaks, nicks, loops, and spontaneous mutations all occur constantly in cells. In order for life to continue these issues must be resolved.

Fortunately, there are numerous pathways of DNA repair for each type of DNA lesion.

However, these repair pathways are not perfect and defects can lead to a multitude of diseases (Miki, Swensen et al. 1994, Ellis, Groden et al. 1995, Savitsky, Bar-Shira et al.

1995, Tavtigian, Simard et al. 1996, D'Andrea and Grompe 2003). On the other hand, without errors and aberrant DNA repair there would be no accumulation of mutations, deletions, and recombination necessary for evolution to occur. Therefore, a delicate balance point is required for life to both exist and thrive, but also for life to change, adapt, and evolve to its surroundings.

Double strand breaks (DSBs) are caused by both external (radiation and chemical damage) and internal (enzymatic activities and stalled replication forks) stimuli. In any of these cases, the sugar phosphate backbone is severed on both sides of the DNA duplex, resulting in discontinuity of the chromosome. Because of the drastic nature of this type of damage an unrepaired DSB may be lethal, or in the very least, may lead to genome instability. Even upon successful repair, mutations are very commonly introduced at the break site.

There exist four pathways for double strand break repair (DSBR) (Ciccia and

Elledge 2010). The non-homologous end joining (NHEJ) pathway is unique from the others in that the ends of the broken DNA are simply ligated back together (Figure 1A)

(Difilippantonio, Zhu et al. 2000, Lieber 2010). A cohort of proteins including

Ku70/Ku80, DNA-PKcs, and DNA ligase IV are required in this DSBR pathway that prevents chromosomal translocations but results in short insertions and deletions at the breakpoint in the course of repair (Mahaney, Meek et al. 2009).

Figure 1. Pathways of Double Strand Break Repair. (A) Non-Homologous End Joining directly ligates broken ends onto one another. If end resection occurs, then cells can undergo base pairing between single stranded ends to initiate (B) Micro-Homology Mediated End-Joining/Alternate End Joining if the homology is short or (C) Single Strand Annealing if the homology is long. (D) Homologous Recombination is another pathway that begins with end resection and occurs when the single stranded end invades a template chromosome. (Image from Ceccaldi et al., 2016; copyright license number 3983920428171).

The remaining DSBR pathways require the action of a 5’ exonuclease to expose a

3’ ssDNA end on either side of the DSB (Symington 2014). If the two 3’ ssDNA ends interact with one another and form a duplex, the break is repaired through the micro- homology mediated end-joining (MMEJ) pathway. MMEJ utilizes 5-20 base stretches of homology on either end of the broken chromosome to form DNA duplex resulting in a series of events to fill gaps, remove flaps, and ligate nicks to repair the break (Figure 1B)

(Deriano and Roth 2013). This avenue of repair commonly results in deletions due to flap resection and use of short sequences for annealing. Chromosomal translocations are also possible if these micro-homology tracts interact with the 3’ ssDNA ends from different broken chromosomes (Simsek and Jasin 2010, Zhang and Jasin 2011). The single strand annealing (SSA) pathway of DSBR, functions similarly to MMEJ, where the key difference is the homologous region used in duplex formation are repeating elements greater than 30 nucleotides (nt) (Figure 1C) (Heyer, Ehmsen et al. 2010). While chromosomal translocations are rare, larger deletions are inevitable in this pathway, causing it to be moderately mutagenic as well.

The final DSBR pathway is homologous recombination (HR), in which the 3’ ssDNA forms a nucleoprotein filament with a RecA homolog (RAD51/DMC1) that can perform strand invasion on the sister chromatid or a homologous chromosome (Figure

1D) (Masson, Davies et al. 1999, Masson and West 2001). The repair template selection depends on the phase of the cell cycle and if the cells are undergoing meiotic or mitotic division. The act of strand invasion forms a displacement loop (D-loop) and a Holliday

Junction (HJ) (Figure 1D). The extension of the 3’ end of the invading strand by a DNA

3 polymerase results in the expansion of the D-loop. Dissociation of the extended invading strand from the template chromosome allows it to bind the other broken 3’ ssDNA end to engage in the synthesis dependent stand annealing (SDSA) pathway (Nassif, Penney et al.

1994, Ferguson and Holloman 1996). This process is similar to SSA, but does not require annealing of the DNA repeats because of the 3’ extension. Alternatively the 3’ ssDNA on the other side of the broken chromosome can anneal with the displaced strand of the expanding D-loop, an event referred to as second end capture, resulting in the formation of a second HJ (Orr-Weaver and Szostak 1983, Bzymek, Thayer et al. 2010). Further polymerization and ligation results in concatenated chromatids or chromosomes by this double HJ (dHJ), which must be dissolved or resolved for the completion of HR (Bizard and Hickson 2014, Wyatt and West 2014).

For separation of the chromosomes to occur the dHJ linkage must be removed, which occurs via two methods. In HJ dissolution the two HJs converge, driven by a

RecQ–like helicase, which in humans is Bloom’s syndrome protein (BLM) (Bernstein,

Gangloff et al. 2010). BLM interacts strongly with TOP3α, RMI1, and RMI2 and as

BLM drives the HJs together TOP3α unlinks the chromosomes through a decatenation event (Figure 2A) (Johnson, Lombard et al. 2000, Yin, Sobeck et al. 2005, Bernstein,

Gangloff et al. 2010).

Another pathway for HJ resolution involves endonuclease activity, performed by a HJ resolvase, which cleaves DNA at each HJ. The orientation of the cleavage at the junctions determines whether dHJ resolution results in a gene conversion/non-crossover

Figure 2. Resolution of double Holliday Junctions. (A) Dissolution of dHJ occurs by convergent migration and decatenation of linked chromosomes. (B) Endonuclease based resolution involves the cutting of two strands at each junction, with the orientation of the paired cuts at either junction resulting in non-crossover or crossover products. (Image from Bizard and Hickson, Copyright (2014) Cold Spring Harbor Laboratory Press).

(NCO) event or a crossover (CO) event (Figure 2B). The most well studied HJ resolvase is the bacterial RuvC protein, part of the RuvABC resolvosome complex. Previous

5 studies have demonstrated RuvA locks the HJ in the open planar structure while RuvB performs ATP driven branch migration that allows RuvC to locate a preferred sequence to perform symmetric incisions across the HJ (Iwasaki, Takahagi et al. 1991, Sharples and Lloyd 1991, West 1997). Three HJ resolvases; GEN1, MUS81-EME1, and SLX1-

SLX4 have been identified in humans (Chen, Melchionna et al. 2001, Ip, Rass et al. 2008,

Fekairi, Scaglione et al. 2009). GEN1 has been shown to cleave HJs in a symmetrical fashion, similar to RuvC (Ip, Rass et al. 2008). Whereas MUS81-EME1 HJ resolution results in 1 to 2 nt overhangs or gaps in the cut HJ and shows inefficient activity on intact

HJs (Boddy, Gaillard et al. 2001, Ciccia, Constantinou et al. 2003). SLX1-SLX4 has been shown to make only single cuts on synthetic HJs (Wyatt, Sarbajna et al. 2013).

Knockout (KO) of any of these proteins alongside BLM KO will result in the accumulation of unresolved HJs that in turn lead to aneuploidy (Andersen, Bergstralh et al. 2009, Mankouri, Ashton et al. 2011, Wechsler, Newman et al. 2011, Agostinho, Meier et al. 2013, Castor, Nair et al. 2013). Importantly none of these HJ resolvases have been shown to have significant impact on crossover rates or chromosomal segregation in meiosis (Mullen, Kaliraman et al. 2001, Abraham, Lemmers et al. 2003, Dendouga, Gao et al. 2005).

1.2 Double strand break repair in meiotic cells

Meiosis is a required process for all sexually reproducing organisms. It consists of two rounds of division reducing a diploid cell to haploid gametes. The second round, meiosis II, functions to segregate sister chromatids. The first round of division, meiosis I,

6 is much more complex and interesting. Specifically, in prophase I of meiosis an important and dramatic process is observed: the introduction of hundreds of DSBs is followed by the initiation of DSBR response that is required not only to repair the chromosomes but also to pair homologous chromosomes for accurate segregation at the end of meiosis I. The process of meiotic DSBR is very similar to the mitotic variety, with a few key distinctions. In meiotic cells, DSBs are not only sporadic, but also cellularly induced by the endonuclease Spo11 during the onset of prophase I (Klapholz,

Waddell et al. 1985, Keeney, Giroux et al. 1997). DSBs are also much more abundant as

Spo11 induces ~400 DSBs in mouse spermatocytes during prophase I in each cell while mouse and human cells undergoing mitosis incur ~10 DSBs a day (Lieber 2010).

Furthermore, while homologous recombination based pathways are rather rare in mitosis they are dominant in meiotic cells (Rothkamm, Kruger et al. 2003, Kass and Jasin 2010,

Symington and Gautier 2011). The use of homologous recombination pathways functions to not only repair DSBs in a less error-prone manner it also performs a required function in prophase I, which is the pairing of homologous chromosomes. Homologous chromosome pairing is required as it is this pairing that allows for proper homolog segregation in anaphase I of meiosis. A number of proteins have been identified as assisting in the process of homologous chromosome pairing, namely RPA, RAD51, and

DMC1, these proteins stabilize ssDNA intermediates and assist in strand invasion

(Klapholz, Waddell et al. 1985, Keeney, Giroux et al. 1997). After pairing, homologous chromosomes form a close association that is maintained through the disassembly of dHJ complexes into crossovers (Lam and Keeney 2014, Subramanian and Hochwagen 2014,

Zickler and Kleckner 2015). The dHJ resolution into crossovers results in the development of chiasmata, a linkage between homologous chromosomes that becomes visible late in prophase I (Kurdzo and Dawson 2015, Rankin 2015). Upon formation of crossovers and development of chiasmata the pairing of homologous chromosomes must be maintained I until segregation in anaphase I. It is this homologous chromosome pairing up to anaphase which presents a unique problem. In both mitosis and meiosis a protein complex called cohesin functions to hold sister chromatids together while spindle assembly progresses and the metaphase plate develops (Subramanian and Hochwagen

2014, Zickler and Kleckner 2015). Cohesin will continue maintaining this sister chromatid pairing until the activation of the protein Separase, which cleaves RAD21 causing the disassembly of the cohesin complex and the segregation of the chromatids

(Rankin and Dawson 2016). However, cohesin is not involved in linking of homologous chromosomes and yet unidentified protein(s) are likely required to maintain the pairing between homologs prior to their segregation.

Another distinction between mitotic and meiotic DSBR is the way in which the

HJ is disassembled. Mitotic division favors HJ disassembly which does not result in crossover events, namely SDSA or dHJ dissolution (Wu and Hickson 2006, Heyer,

Ehmsen et al. 2010). Whereas in meiotic cells dHJ resolvase activity resulting in, at minimum, one crossover event per homologous chromosome pair is required, this requirement is referred to as the obligate crossover (Jones 1984). Without the obligate crossover chiasmata are unable to develop and non-disjunction of the homologous

8 chromosomes is observed (Bishop and Zickler 2004, Hillers 2004, Kleckner, Zickler et al. 2004).

The requirement for homologous repair, dHJ resolution into crossover products, chiasmata development, and maintained pairing of the homologs for accurate segregation in Anaphase I demonstrates a clear difference to the process of mitotic DSBR. These additional requirements suggest the presence of protein factors not present in the mechanisms repairing mitotic DSBs. The search for meiosis specific repair factors has led many to suggest that a pair of proteins from the mismatch repair family are specifically involved with meiotic recombination.

1.3 Holliday Junction dynamics and structure

Holliday Junctions were hypothesized in 1964 by Robin Holliday and identified as a recombination intermediate and the site of genetic exchange (Holliday 2007). The

HJ is a four-way DNA junction that links two chromosomes via base pairing from one chromosome to the other. One HJ is formed early in recombination through strand invasion, and a second HJ is formed upon second end capture. Each HJ is a highly dynamic structure with two types of movement. One type of movement is the rearrangement of the four duplex arms around the DNA exchange point, or branch point

(McKinney, Declais et al. 2003, Joo, McKinney et al. 2004). The duplex arms alternate between three configurations, one of which is highly transient. The transient structure is referred to as the open planar structure in which the four arms extend outward from the branch point in the same plane at roughly 90o angles to each other (Figure 3) (Joo,

McKinney et al. 2004). The four arms will undergo conformational rearrangements about the branch point and adopt one of two distinct right hand anti-parallel stacked-X structures (Figure 3). These stacked-X structures were first observed by crystallography and have been confirmed through FRET (Fӧrster Resonance Energy Transfer) experiments (Ortiz-Lombardia, Gonzalez et al. 1999, McKinney, Declais et al. 2003). smFRET also confirmed the anti-parallel nature of these structures (McKinney, Freeman et al. 2005). Stacked-X structures are likely stabilized by the presence of divalent cations, most notably magnesium (Joo, McKinney et al. 2004).

Figure 3. Movement of Holliday Junctions. The Holliday Junction displays two interconnected types of movement. Arm rotation about branch point results in changing conformation of the junction to the planar T or one of two distinct stacked-X conformations. A junction temporarily in the planar T conformation can also exchange base pairing effectively moving the exchange point, a process called branch migration. (Image adapted from McKinney et al., Copyright (2005) National Academy of Sciences).

Along with rearrangements at the branch point, the HJ also exhibits spontaneous movement of the branch point along homologous lengths of DNA between the two chromosomes, a process known as branch migration (Lee, Davis et al. 1970, Doniger,

Warner et al. 1973, Thompson, Escarmis et al. 1975). Spontaneous branch migration has been measured in a variety of conditions showing that the rate of migration increases with temperature or decreasing concentrations of divalent cations (Panyutin and Hsieh 1994,

Panyutin, Biswas et al. 1995, Mulrooney, Fishel et al. 1996). This slower rate of migration with divalent cations is likely due to the increased stability of the stacked-X structures, preventing adoption of the open planar structure, through which branch migration is thought to occur (Figure 3) (Lushnikov, Bogdanov et al. 2003, Karymov,

Daniel et al. 2005). Modeling of branch migration as a random walk process was in agreement with observed rates of branch migration and suggested that it is simply one- dimensional diffusion of the branch point along the homologous region of DNA

(Panyutin and Hsieh 1994, Mulrooney, Fishel et al. 1996, Biswas, Yamamoto et al.

1998). More recently, single molecule studies have shown branch migration to be a highly heterogeneous process, punctuated by significant time spent at single branch point positions, followed by rapid movement (McKinney, Freeman et al. 2005). Interestingly, branch migration does not only occur in single base steps but appears to favors steps of multiple bases, even in a short (6 base) migratable region (Karymov, Chinnaraj et al.

2008).

1.4 MSH4-MSH5: A MutS homolog involved in meiotic homologous recombination

Bacterial MutS and the MutS homologs (MSHs) are a group of proteins highly conserved throughout biology and function primarily in the initiation of the mismatch repair process (Fishel 2015). MSHs initiate mismatch repair through the binding of a mismatched nucleotide resulting in a short lived (3 s) pause of the protein at the mismatch (Su and Modrich 1986, Jeong, Cho et al. 2011). This allows for an exchange of ADP for ATP in the conserved Walker A/B nucleotide-binding motif (Walker, Saraste et al. 1982, Gradia, Acharya et al. 1997). ATP binding results in both the formation of a hydrolysis-independent sliding clamp which diffuses one-dimensionally along duplex

DNA and a dramatic increase in the lifetime of the MSH-DNA association (~10 min)

(Gradia, Acharya et al. 1997, Gradia, Subramanian et al. 1999, Acharya, Foster et al.

2003, Jeong, Cho et al. 2011). This stable MSH sliding clamp appears to recruit downstream machinery of the mismatch repair process for further processing of the misincorporated nucleotide (Liu, Hanne et al. 2016).

Unlike all other MutS homologs, it is clear that the MSH4-MSH5 heterodimer does not recognize mismatches and furthermore does not play any role in mismatch repair (MMR) as deletion of MSH4 shows no defects in MMR (Ross-Macdonald and

Roeder 1994). Evidence of a distinct role for MSH4 and MSH5 was initially observed where deletion of MSH4 shows no defects in MMR but display reduced levels of crossover as well as an increase of non-disjunction between homologous chromosomes in meiosis I (Ross-Macdonald and Roeder 1994, Argueso, Wanat et al. 2004, Nishant, Chen et al. 2010, Zakharyevich, Tang et al. 2012). hMSH4 and hMSH5 mRNA is

12 predominately expressed in germ line tissue, suggesting a likely role in meiosis

(Charbonneau, Amunugama et al. 2009). Additionally, MSH4 and MSH5 localization to areas of recombination was observed by immunofluorescence. Studies in mouse spermatogenesis and oogenesis observed MSH4 and MSH5 foci localization to sites of homologous chromosome pairing shortly after DSB formation, but by late prophase I

MSH4 and MSH5 foci are mostly observed at sites of crossover (Ross-Macdonald and

Roeder 1994, Hollingsworth, Ponte et al. 1995, Novak, Ross-Macdonald et al. 2001,

Moens, Kolas et al. 2002, Lenzi, Smith et al. 2005). This presence of MSH4-MSH5 at recombination sites suggests an early role for MSH4-MSH5 in the DSBR pathway, but also suggests a unique role in crossovers. Using purified hMSH4-hMSH5, the protein was observed to bind the HJ recombination intermediate (Snowden, Acharya et al. 2004).

Although lacking the mismatch recognition domain, both MSH4 and MSH5 retain the conserved Walker A/B ATPase domain (Walker, Saraste et al. 1982). The purified hMSH4-hMSH5 was observed to bind ATP upon recognition of the HJ, resulting in the formation of a hydrolysis-independent sliding clamp on the DNA, as seen with the other human MSH heterodimers hMSH2-hMSH6 and hMSH2-hMSH3 (Gradia, Subramanian et al. 1999). Upon ATP binding, MSH hydrolysis-independent sliding clamps will diffuse rapidly along duplex DNA (Gradia, Subramanian et al. 1999, Acharya, Foster et al. 2003). Intriguingly, unlike the other MutS homologs, the hMSH4-hMSH5 sliding clamp appears to encircle not one, but two strands of dsDNA (Snowden, Acharya et al.

2004). Collectively, these findings suggest that MSH4-MSH5 acts to stabilize the recombination intermediate, the HJ. It is unknown what effect MSH4-MSH5 binding has

13 on the highly dynamic nature of the HJ. It is possible that MSH4-MSH5 may play further roles in DSBR, such as recruitment of downstream proteins involved with HJ resolution.

1.5 hMLH1-hMLH3: A MutL homolog with a role in meiotic recombination

MutL homologs (MLHs) are another component of the mismatch repair system, which also includes the post-meiotic segregation (PMS) proteins, which together form

MLH/PMS complexes. The formation of a stable MSH sliding clamp allows for the recruitment of a MLH/PMS dimer to the DNA. Upon recruitment to the DNA by bacterial MutS, MutL will bind ATP forming a hydrolysis-independent sliding clamp

(Liu, Hanne et al. 2016). This sliding clamp is likely the result of the binding of ATP and dimerization of the N-terminal domains of the protein subunits (Ban, Junop et al. 1999).

This MutL sliding clamp exhibits an extraordinarily long lifetime (14 min) on the DNA

(Liu, Hanne et al. 2016). In bacteria, MutL then recruits the endonuclease containing

MutH, which recognizes the newly replicated daughter strand based on the hemi- methylation at GATC sites and performs incision of the daughter strand (Welsh, Lu et al.

1987). A eukaryotic MutH homolog does not exist; however, some eukaryotic

MLH/PMS have been shown to perform strand specific incision through an ATP dependent endonuclease activity (Kadyrov, Dzantiev et al. 2006, Kadyrov, Holmes et al.

2007, Guarne 2012). This endonuclease activity is dependent on a conserved metal binding motif DQHA(X)2E(E)4E and is found in the human MLH proteins hPMS2 and hMLH3, both of which form heterodimers with MLH1 (Kadyrov, Holmes et al. 2007,

Ranjha, Anand et al. 2014, Rogacheva, Manhart et al. 2014). MLH1-PMS2 is known to 14 interact with MSH complexes as well as display metal binding dependent endonuclease activity (Kadyrov, Dzantiev et al. 2006, Kosinski, Plotz et al. 2008, van Oers, Roa et al.

2010). In humans hMLH1-hPMS2 has been identified as the primary MLH/PMS heterodimer involved in single base mismatch repair.

MLH1-MLH3 has been shown to play a very minor role in mitotic mismatch repair, in which it likely interacts with MSH2-MSH3 for repair of large loops, although its deletion only modestly increases mutation rates (Flores-Rozas and Kolodner 1998,

Korhonen, Raevaara et al. 2007). While the role of MLH1-MLH3 in loop repair appears limited or overlapping, it is required for wild-type levels of homolog segregation in meiotic cells, suggesting a unique role in meiotic DSBR (Wang, Kleckner et al. 1999,

Argueso, Smith et al. 2002, Hoffmann, Shcherbakova et al. 2003). The exact role that

MLH1-MLH3 may play in meiotic recombination remains unclear, although, it does appear that MLH1-MLH3 acts in the same pathway and functions of MSH4-MSH5. For example, studies in S. cerevisiae have shown similar decreases in viable spore production between single mlh1 deletions and double knockouts of mlh1 and either msh4 or msh5

(Hunter and Borts 1997, de los Santos, Hunter et al. 2003, Argueso, Wanat et al. 2004).

Further evidence supporting involvement in a common pathway for these meiotic MSH and MLH proteins comes from foci localization studies in mouse spermatogenesis and oogenesis. It was observed that MLH1 and MLH3 foci appeared at locations of DSBR, where MSH4 and MSH5 foci localization occurs prior to the appearance of MLH1 or

MLH3 foci. Additionally, MLH1 and MLH3 foci are observed at sites of crossover, and correlate with chiasmata development (Santucci-Darmanin, Walpita et al. 2000, Lipkin,

Moens et al. 2002, Moens, Kolas et al. 2002, Kolas, Svetlanov et al. 2005, Lenzi, Smith et al. 2005). While it does appear MLH1-MLH3 plays a role in meiotic recombination to maintain required levels of chiasmata development, a more defined role and mechanism for MLH1-MLH3 involvement remains unclear. As much of the information gathered about the mechanism of MSH and MLH/PMS proteins in mismatch repair has been obtained from in vitro biochemical studies a similar approach has been sought for the study of MLH1-MLH3; however, only recently have reports been published that use purified MLH1-MLH3. While yMLH1-yMLH3 was observed to display an intrinsic endonuclease activity on supercoiled plasmid in low ionic strength, which was stimulated by yMsh2-yMsh3 in physiological ionic strength; no endonuclease activity was observed with synthetic HJs (Rogacheva, Manhart et al. 2014).

Chapter 2: Investigating the mechanism of hMSH4-hMSH5 search for the Holliday Junction branch point and its impact on branch migration

2.1 Introduction

The formation and resolution of the Holliday Junction (HJ) are the defining moments of homologous recombination (HR) and as such, have profound implications in repairing DNA double strand breaks (DSBs), the most deleterious lesions a cell can encounter (Jasin and Haber 2016). The formation of the first HJ after strand invasion is the first step in HR. Interestingly, the mechanism employed to remove the HJ defines which specific pathway of HR is carried out; be it the synthesis dependent strand annealing after invading strand dissociation, gene conversion after dHJ dissolution following de-catenation, or dHJ resolution resulting in both non-crossover or crossover formation by a HJ resolvase. Because of their pivotal role in DSBR and HR, HJ formation, dynamics, and resolution are all areas of great interest.

The dynamics and movement of the HJ has been an area of ongoing research for decades. It has been shown that the branch point of the HJ can spontaneously move along regions of homology between two linked chromosomes and this movement follows a random walk model (Panyutin and Hsieh 1994, Mulrooney, Fishel et al. 1996, Biswas,

Yamamoto et al. 1998). Observed rates of spontaneous branch migration vary wildly from less than 1 base pair per second (bp/s) to thousands of bp/s depending on the temperature and the concentration of divalent cations like Mg2+ (Panyutin and Hsieh 17

1994, Panyutin, Biswas et al. 1995, Mulrooney, Fishel et al. 1996). Migration has been shown to slow in the presence of Mg2+ likely due to the increased stability of the HJ stacked-X structure. (Lushnikov, Bogdanov et al. 2003, Karymov, Daniel et al. 2005).

This stabilization minimizes the rearrangement to the planar T conformation that is thought to be an intermediate for branch migration. An interesting paradox is that this incredibly important DNA structure, which sits at the center of the HR process, exhibits so much random movement. The spontaneous branch migration can result in either a dramatic increase of the chromosomal linkage and displacement loop (D-loop) expansion or the removal of the invading strand and loss of the chromosomal linkage depending on the net direction migration occurs. Therefore it is reasonable to hypothesize that the HJ must be regulated or stabilized in some way by the cell in order to have full control over the pathways of HR.

Few proteins have been observed to specifically interact with HJs, which often fall into one of two groups, namely helicases or HJ resolvases. However, hMSH4- hMSH5 is a heterodimeric protein which does not fit into either of these groups, but has been observed to bind the HJ (Snowden, Acharya et al. 2004). Binding of the HJ by hMSH4-hMSH5 appears to be centered at the branch point with a footprint of roughly 25 bp (Snowden, Acharya et al. 2004). While it is clear hMSH4-hMSH5 specifically binds the branch point of the HJ, it is not clear how the enzyme would locate the branch point.

However, we do know that other MSHs perform a 1-D search on duplex DNA to locate a mismatch (Gorman, Chowdhury et al. 2007, Jeong, Cho et al. 2011, Cho, Jeong et al.

2012). Once bound to the branch point hMSH4-hMSH5 has been shown to exchange

ADP for ATP and form a hydrolysis-independent sliding clamp on the DNA in congruence with other MSH proteins (Gradia, Subramanian et al. 1999, Snowden,

Acharya et al. 2004, Jeong, Cho et al. 2011, Cho, Jeong et al. 2012). A series of experiments carried out using ATP and 1 to 4 end-blocks on the arms of the HJ led to the conclusion that the ATP-bound sliding clamp, likely encircles two DNA duplexes

(Snowden, Acharya et al. 2004). Given that conformational rearrangements of the HJ arms are likely required for spontaneous branch migration, it is possible that a protein that embraces two duplex arms of a HJ may inhibit the conformational dynamics about the branch point, and possibly impact the rate of spontaneous migration. We sought to answer these mechanistic questions in the current study by characterizing the hMSH4- hMSH5 interactions with the HJ and the impact binding and sliding clamp formation have on the rate of branch migration.

2.2 Materials and Methods

Cloning

Human MSH5 was PCR amplified and a His6 was added to the C-terminus and placed in pFastbac1 (Snowden, Acharya et al. 2004). Primers used are found in Table 1.

Table 1. PCR primers used to fuse HIS6 tag onto the C-terminus of MSH5. 19

Insect cell transfection

All pFastBac1 plasmids were transformed in the DH10 Bac (Invitrogen) cell line as suggested by the manufacturer. This transfection resulted in the transposition of the genes of interest into a bacmid contained in the DH10 cells. The bacmid harboring the gene of interest was purified as suggested by manufacturer. Bacmid was then transfected into Sf9 insect cells (Thermo-Fisher) as suggested by the manufacturer. Transfections resulted in a baculovirus which when added to insect cells will express the protein of interest. hMSH4-hMSH5 Expression

Baculoviruses individually expressing hMSH4 and hMSH5-HIS6 were mixed in a

2:1 ratio and added to 200 mL of Sf9 cells at a concentration of 2x106/mL and incubated at 27 °C for 60 hours. Cells were centrifuged at 500x RFC for 10 minutes at 4 °C. Cell pellets were resuspended in 25 mM HEPES (pH 8.1), 150 mM NaCl, and 10% Glycerol.

Cells were again centrifuged at 500x RFC for 10 minutes at 4 °C and resuspended in

HEPES (pH 8.1), 500 mM NaCl, 20 mM Imidazole, 10% Glycerol, 500 uM PMSF, 1 ug/mL Pepstatin, and 1 ug/mL Leupeptin and then snap-frozen in liquid nitrogen and stored at -80 °C. hMSH4-hMSH5 purification

Eight pellets representing 1.6 L of Sf9 cells were removed from -80 °C freezer and thawed on ice. Cells were lysed by passage through 25 G needle three times. Lysate was spun for 1 hour at 4 °C and 41k RPM using a Ti-60 rotor in an Optima L-1000 XP

Ultra-centrifuge (Beckman-Coulter). Supernatant was loaded onto a Ni-NTA Superflow

(Qiagen) column pre-equilibrated with Buffer W (25 mM HEPES [pH 8.1], 500 mM

NaCl, 20 mM Imidazole, and 10% glycerol). All purification buffers contained 500 uM

PMSF, 1 ug/mL Pepstatin, and 1 ug/mL Leupeptin. After protein injection the column was first washed with 5 column volumes (CV) of Buffer W and then with 5 CVs of

Buffer A (25 mM HEPES [pH 8.1], 300 mM NaCl, 20 mM Imidazole, and 10% glycerol). Protein was eluted from the column with a linear gradient of Imidazole using

Buffer B (25 mM HEPES [pH 8.1], 300 mM NaCl, 200 mM Imidazole, and 10% glycerol). Fractions containing hMSH4-hMSH5 were pooled and flowed through PBE-

94 (Sigma) and a Heparin Sepharose (GE Healthcare) columns in series which were pre- equilibrated with Buffer C (25 mM HEPES [pH 8.1], 300 mM NaCl, 1 mM DTT, 0.1 mM EDTA, and 10% glycerol). The flow through was dialyzed overnight against Buffer

D (25 mM HEPES [pH 8.1], 100 mM NaCl, 1 mM DTT, 0.1 mM EDTA, and 10% glycerol). Protein was then loaded onto a Heparin-Sepharose column pre-equilibrated with Buffer D and eluted with a linear gradient of NaCl using Buffer E (25 mM HEPES

[pH 8.1], 1 M NaCl, 1 mM DTT, 0.1mM EDTA, and 10% glycerol). Peak fractions containing hMSH4-hMSH5 were pooled and dialyzed against Buffer F (25 mM HEPES

[pH 7.8], 100 mM NaCl, 1 mM DTT, 0.1mM EDTA, and 20% glycerol). Protein samples were quantified using 280nm absorption measured on a Nano-Drop 2000c

Spectrophotometer (Thermo) and stored at -80 °C after snap-freezing in liquid nitrogen.

Oligonucleotide labeling with fluorophores

Oligonucleotides for Holliday Junctions were ordered from Midland or IDT and are listed in Table 2. Oligonucleotides containing an Amino-C6-dT modified bases were labeled with Cy3 or Cy5 fluorophore (GE Healthcare). Labeling was performed overnight at 35 °C in 100 mM Sodium Borate Buffer (ph 8.5). Purification of the labeled oligonucleotides was performed on a 1260 Infinity HPLC (Agilent). Unpurified oligonucleotide was injected onto a Poroshell 120 C-18 column (Agilent) pre-equilibrated in Buffer A (100 mM TEAA Buffer [pH 7.0] and 3% Acetonitrile). Separation was performed by linear gradient of Acetonitrile (1% Acetonitrile/mL) using Buffer B (100 mM TEAA Buffer [pH 7.0] and 30% Acetonitrile). Fractions containing the labeled ssDNA were placed in a speed-vac for 4 hours to remove Acetonitrile. Oligonucleotides were then concentrated and buffer exchanged to TEN Buffer (10 mM Tris, 0.1 mM

EDTA, and 100 mM NaCl) using Ultracel 10K membrane filter (Amicon).

Concentration of the oligonucleotides was determined by 260 nm absorption on a Nano-

Drop 2000c Spectrophotometer (Thermo).

Holliday Junction assembly and annealing

Holliday Junction Assembly was performed by mixing the four component oligonucleotides required at an equimolar ratio in TEN Buffer and heating to 95 °C in a

GeneAmp PCR system 9700 thermocycler (Applied Biosystems) and then reducing the temperature in 5 °C decrements until reaching 25 °C over the course of eleven hours.

Component strands for all HJs can be found in Table 2. Purification of four strand

Holliday Junctions was performed on a 5% native acrylamide gel. Gel bands containing 22 all four strands were excised from gel and were extracted by overnight diffusion into

TEN Buffer. DNA was concentrated by 10 K membrane filter (Amicon) and quantified by Nano-Drop 2000c Spectrophotometer by using the absorption at 260 nm. Branch migration substrates used in assembled HJ FRET studies were assembled in halves using only two strands, purified, and concentrated in the same manor. Mobile Holliday

Junctions were purified as a four stranded core to which a biotin linker was ligated. The junction core was mixed in an equimolar ratio with a short or long biotin linker and ligated by T4 DNA Ligase (NEB) at 25 °C for 18 hours. Ligation was confirmed by native and denatured PAGE gels.

Holliday Primer Sequence 5’-3’ Vendor Junction GTGCATCGATGGCGGAATTCGATTAGGCCTATTCGAATC CAGACGCGAGTAGATCTTCACGGTACCCGCGGTTACCCG Midland Immobile TG GCG(Amino-C6-dT) GGTTCGCTCGGGATCCGAGTAGTACT ATTCGGCAGAGGATTCGAATAGGCCTAATCGAATTCCGC Midland Immobile CATCGATGCAC CTAGTATAGAGCCGGCGCGCCATGTCTAGATAGCGTTAG GTCTGCCGAATAGTACTACTCGGATCCCGAGCGAACCAC Midland Immobile GC CACGGGTAACCGCGGGTACCGTGAAGATCTACTCGCGTC TCCTAACGCTATCTAGACATGGCGCGCCGGCTCTATACT Midland Immobile AG GCGTGACTGAGCTAGCGTCAGATCGGATCGCACCTGTTC Single GTATCGTATCGGTAAAGATCCGCGATCGATCCGAGTCGC IDT Molecule 2 GATCTAGCGTAGC Core CTCGGAAGTCGTAGCAAAGGATCTTTACCGATACGATAC Single GAACAGG(Amino-C6-dT)GCGATCCGATCTGACGCTAG C IDT Molecule 2 TCAGTCACGC Core …………………………………………………………………………………...Continued

Table 2. Oligonucleotides used in the construction of four-stranded Holliday Junctions.

Table 2 continued

Holliday Primer Sequence 5’-3’ Vendor Junction (Dig)GCTACGCTAGATCGCGACTCGATCGATCGCGGATCT Single TTACCGATACGATACGAACAGGTGGCACCTTTCCCACGT IDT Molecule 2 GAACCCAGCGTCATC Core CTCGGAAGTCGTAGCAAAGGATCTTTACCGATACGATAC Single GAACAGGTGCGA(Amino-C6-dT)CCGATCTGACG IDT Molecule 3 CTAGCTCAGTCACGC Core GATGACGCTGGGTTCACGTGGGAAAGG(Amino-C6- Single dT)GCCACCTGTTCGTATCGTATCGGTAAAGATCCTTTGCT IDT Molecule 3 ACGACTTCCGAGAGGTCGCCGCCC Core Short Mobile (Biotin)TCTTTGGGCGGCGACCT IDT Linker (Biotin)TCTTTTCGAGGCCGTTCGTTAATTCCTGTTGCATTC Long Mobile GTACCGCCTATATTTGTCTCTTTGCCGGCTTATATGGACG IDT Linker GGCGGCGACCT GTCCATATAAGCCGGCAAAGAGACAAATATAGGCGGTA Long Mobile IDT CGAATGCAACAGGAATTAACGAACGGCCTCGA Linker (Biotin)ACCATGCTCGAGATTACGAGATATCGATGCATGC GAATTGCTAATTGCCAATGTCTCTAGAAGCTATCGATCG Midland Assembled TCATG(AminoC6dT)G (Biotin)CACA(AmC6dT)GACGATCGATAGCTTCTAGAGACA TTGGCAATTAGCAATTCGCATGCATCGATATAATACGTG Midland Assembled AGGCCTAGGATC (Biotin)CACATGACGATCGATAGCTTCTAGAGACATTGGC AATTAGCAATTCGCATGCATCGATATCTCGTAATCTCGA Midland Assembled GCATGGT (Biotin)GATCCTAGGCCTCACGTATTATATCGATGCATGCG AATTGCTAATTGCCAATGTCTCTAGAAGCTATCGATCGT Midland Assembled CATGTG (Biotin)GCGTGACTGAGCTAGCGTCAGATCGGATCGCACC Single TGTTCGTATCGTATCGGTAAAGA(Amino-C6- Midland Molecule dT)CCGCGATCGATCGAGTCGCGATCTAGCGTAGC GCACACGTAGGACTCGGAAGTCGTAGCAAAGGATCTTTA Single CCGATACGATACGAACAGG(Amino-C6- Midland Molecule dT)GCGATCCGATCTGACGCTAGCTCAGTCACGC GCTACGCTAGATCGCGACTCGATCGATCGCGGATCTTTA Single CCGATACGATACGAACAGGTGGCACCTTTCCCACGTGAA Midland Molecule CCCAGCGTCATC (Dig)GATGACGCTGGGTTCACGTGGGAAAGGTGCCACCT Single GTTCGTATCGTATCGGTAAAGATCCTTTGCTACGACTTCC Midland Molecule GAGTCCTACGTGTGC

Electrophoretic mobility shift assays (EMSA)

Holliday Junction binding assays were performed in 20 μL reactions. Reaction mixtures were composed of 25 mM HEPES (pH 7.8), 100 mM NaCl, 1 mM DTT, 5 mM

MgCl2, 5% glycerol, 50 ng 400 bp dsDNA competitor, 50 ng poly dI-dC competitor, 100

μg/mL Acetylated BSA, and 20 fmol Cy5 labeled Holliday Junction. Reactions were mixed and incubated at 37 °C for 15 min. In ATP and ATPγS binding studies a10 minute

37 °C incubation followed the nucleotide addition. A 20-fold molar excess of anti- digoxigenin and streptavidin were included for double blocked end Holliday Junction studies. The analysis was performed at 4 °C in TAE buffered 5% native polyacrylamide gels (37.5:1 Acrylamide to Bis-Acrylamide) at 105 V for 5 hours. Similarly single and double blocked end Holliday Junctions were resolved on 4% polyacrylamide gels at 105

V for 8 hours. Gels were imaged with Typhoon 9410 (GE Healthcare) and quantified with ImageQuant TL (GE Healthcare). Data from at least three independent experiments were used construct binding curves for exponential fitting and KD calculation.

Bulk Branch Migration Assays

Migration assays were performed in 20 μL reactions. Reaction components included 25 mM HEPES (pH 7.8), 100 mM NaCl, 5 mM Mg, 1 mM DTT, 100 ug/mL

Acetylated BSA, 5% glycerol, 100 nM hMSH4-hMSH5 (where indicated), 1mM ATP

(where indicated) and 2 pmol unlabeled D2 half HJ. In rapid succession 200 fmol of labeled D1 half HJ was added to the reaction, and was loaded into a pre-incubated quartz cuvette (Starna), placed in Spectrophotometer (Horiba Jobin-Yvon) followed by data acquisition. Measurements were taken every 5 sec with 200 ms integration times for 30 25 min. The excitation wavelength was set to 554 nm with emission wavelengths of 568 nm and 664 nm. The fluorescence resonance energy transfer (FRET) efficiency was calculated as E = 1-(ID+A/ ID). Where ID and ID+A are the emissions of the donor in the absence and presence of the acceptor respectively. The rate constants were extracted by fitting the decay in FRET efficiency with a single exponential decay function of the form y = Ae-kt.

An Eyring plot was generated by plotting 1/T against ln(k/T). Where k was the rate constant and T was the absolute temperature in Kelvin at which the k was measured.

Because the Eyring equation follows the form of equation 2.1,

ŧ ŧ 푘 −∆퐻 1 푘퐵 ∆푆 (2.1) 푙푛 = ∗ + 푙푛 + 푇 푅 푇 ℎ 푅 the activation enthalpy and entropy of the reaction could be extracted from a linear fit to

ŧ ŧ the data. Such that –ΔH = R*m and ΔS = R[b-ln(kb/h)]. Where R is the universal gas constant, m is the slope, b is the intercept, kB is the Boltzmann constant, and h is Planck’s constant. 1028 S Cleveland St, Philadelphia, PA 19146

Random walks were simulated with 60 base pairs of DNA and one reflecting barrier. For each walk, the number of steps to reach the opposite end was counted. A normalized plot was constructed with the fraction of molecules which have not completed migration on the y-axis and number of steps to completion on the x-axis. This models the number of steps required for a bulk sample of molecules to branch migrate to completion.

10,000 iterations of the random walk were performed. The number of steps required for completion was multiplied by various time constants to determine a rate of branch

26 migration. Least squares regression was used to assign a theoretical rate of branch migration to the raw data.

Single molecule total internal reflection fluorescence microscopy (smTIRF)

Biotin conjugated Holliday Junctions were injected into the flow cell and bound to the PEG-passivated quartz surface through Neutravidin (Invitrogen) interaction.

Observation of single molecules was performed on a custom prism TIRF set-up with an

IX71 microscope (Olympus). Fluorophores were excited by a 532 nm DPSS laser. An

EMCCD (Princeton Instruments) camera was used for image capture after emissions were split by Dual View optical arrangement (Photometrics). Images were captured at a rate of 200 ms.

2.3 Results

2.3.1 hMSH4-hMSH5 can be purified to near homogeneity

hMSH4-hMSH5 was found to have optimal expression and solubility when expressed in Sf9 insect cells which were incubated at 27 °C for 60 hours after the addition of baculovirus. A schematic depicting the hMSH4-hMSH5 gene products are represented in Figure 4A. Crude cell extracts were applied to a Nickel column and the protein was

Figure 4. Purification of hMSH4-hMSH5 (A) Depiction of hMSH4 and hMSH5 gene products. (B) SDS-PAGE gel showing protein fractions eluted during the imidazole gradient molecular weights (MW) in kilodaltons (kDa) noted on left. (C) Protein fraction analysis after passage through PBE-94 and Heparin columns as visualized by SDS-PAGE. (D) SDS-PAGE gel showing protein after NaCl gradient elution off of a Heparin column. (E and F) Western blots of purified hMSH4 (105 kDa) hMSH5 (92 kDa) with antibodies specific to hMSH4 and hMSH5 respectively.

28 eluted with imidazole (Figure 4B). This moderately pure protein was then flown through

PBE-94 and Heparin columns in series at 300 mM NaCl, removing many contaminants that are retained in the columns (Figure 4C). Dilution of NaCl to 100 mM allowed hMSH4-hMSH5 to bind to a Heparin column efficiently, and then could be eluted at higher NaCl concentration. At this point greater than 95% pure and moderately concentrated hMSH4-hMSH5 was obtained (Figure 4D). The identities of the proteins were confirmed by western blotting with antibodies specific for each protein. Western blots clearly show a single band for each hMSH4 and hMSH5 in the predicted locations

(Figure 4E and 4F).

2.3.2 hMSH4-hMSH5 recognizes immobile Holliday Junctions and form a sliding clamp upon ATP binding

The activity of the purified protein was confirmed by EMSA gels shifts that were designed to detect binding of the enzyme to immobile Holliday Junction (Figure 5A).

The depicted HJ shows the labeling with a Cy5 fluorophore and the dashed region indicates immobility of the junction. The addition of hMSH4-hMSH5 to this immobile

HJ resulted in the formation of a gel shift complex as previously reported (Figure 5B)

(Snowden, Acharya et al. 2004). Gel shift quantification and analysis from three independent experiments were used to calculate the dissociation constant (KD, immobile HJ =

32 nM) using an exponential binding isotherm (Figure 5C). Notably this dissociation constant was in agreement with the previously published binding activity of hMSH4- hMSH5(Snowden, Acharya et al. 2004). To test the ability of purified protein to form

29 sliding clamps ATP was titrated into reactions with constant concentration of hMSH4- hMSH5.

Figure 5. hMSH4-hMSH5 binding and Clamp Formation on Immobile Holliday Junctions. (A) Cartoon drawing of the immobile HJ used in this study. (B) Increasing concentration of hMSH4-hMSH5 results in the formation of increased amounts of a gel shift complex (GS) with 10 fmol of Cy5-labeled immobile Holliday Junction, unbound HJ marked UB. (C) Quantification of gel shift complex was done by plotting the percent DNA bound and used to determine a KD for protein-DNA. Data represents average ± S.D. from at least three independent experiments. (D and E) Addition of ATP or ATPγS to a constant hMS4-hMSH5 concentration (100 nM) and 10 fmol of HJ results in the loss of shift complex, first lane is included as control without hMSH4-hMSH5. (F) Plot of percent DNA bound with the addition of indicated nucleotide with quantitation as in (B), with single exponential decay function fits. 30

The loss of a gel shift complex with the addition of ATP demonstrates the ability of hMSH4-hMSH5 to form sliding clamps (Figure 5D). Increases in unbound (UB) HJ after the addition of a poorly hydrolyzable analog of ATP, ATPγS, to these binding reactions shows the ability of hMSH4-hMSH5 to dissociate from DNA through sliding clamp formation without hydrolyzing ATP, demonstrating the stable sliding clamp formed by hMSH4-hMSH5 is hydrolysis-independent (Figure 5E). Quantification and plotting of the dissociation data demonstrates an exponential relationship between the amount of nucleotide added and the percent of bound DNA (Figure 5F).

2.3.3 hMSH4-hMSH5 also recognizes mobile Holliday Junctions and forms a sliding clamp upon ATP binding

After confirming the binding and sliding clamp formation activity of hMSH4- hMSH5 with immobile Holliday Junctions, we next sought to determine hMSH4-hMSH5 activity on a mobile HJ, which was designed for single molecule analysis, using the same experimental approach (Figure 6A). In this depiction of the HJ the dashed lines indicate immobility only at the ends of the four arms, allowing migration through the intermittent region, dual Cy3 and Cy5 fluorophore labeling was done for use in single molecule assays. hMSH4-hMSH5 binds to mobile HJ with nearly the same affinity as the immobile HJ (KD, mobile HJ =32 nM) (Figure 6B and 6C). Binding studies done in the presence of ATP or ATPγS showed the release of hMSH4-hMSH5 from the mobile HJ in the same way as observed for the immobile substrate confirming the formation of a hydrolysis-independent sliding clamp (Figure 6D, 6E, 6F).

Figure 6. hMSH4-hMSH5 binding and clamp formation on mobile Holliday Junctions. (A) Diagram of the mobile HJ used in this study. (B) EMSA showing the increasing amount of shift complex (GS) as hMSH4-hMSH5 concentration is increased with 10 fmol of Cy5 labeled HJ, unbound HJ marked UB. (C) Plot of the average percent DNA bound ± S.D. from three independent experiments and exponential fit of the data used to calculate the KD. (D and E) Gel shift assays showing the loss of shift complex as the nucleotides ATP or ATPγS are added to the reactions a control lane without hMSH4-hMSH5 is included. (F) Plot of the concentration of indicated nucleotide versus percent DNA bound with analysis identical to (B). 32

2.3.4 hMSH4-hMSH5 shows stronger binding affinity to a mobile Holliday Junction containing a dsDNA tail

A second mobile HJ was designed for single molecule analysis and is identical to the previously described mobile junctions except for a 70 bp extension present on one of the arms (Figure 7A). As with the short mobile junction both Cy3 and Cy5 were included for use in single molecule assays and dashed lines indicate the immobility of the ends of the junction arms. Surprisingly, in tailed HJ binding experiments we observed stronger binding of hMSH4-hMSH5 to this HJ compared to the HJ with a short linker region (Figure 7B). This was confirmed through quantitation and KD calculation (KD, mobile HJ long = 18 nM), which was lower than previously seen with the other HJs (Figure

7C). Addition of ATP or ATPγS showed similar results as those observed with the short mobile HJ, and demonstrate formation of the hMSH4-hMSH5 hydrolysis-independent sliding clamp (Figure 7D, 7E, and 7F).

Figure 7. Stronger binding of Holliday Junction with dsDNA tail. (A) Cartoon of the tailed mobile HJ. (B) Gel shift (GS) formation with increasing hMSH4-hMSH5 concentration with a constant 10 fmol of Cy5 labeled HJ, unbound HJ marked as UB. (C) Average percent DNA bound ± S.D. from three independent experiments is plotted against the concentration of hMSH4-hMSH5. (D and E) Loss of gel shift complex as ATP or ATPγS is added to 10 fmol of HJ and 100nM hMSH4-hMSH5 with the first lane being the control without hMSH4-hMSH5. (F) Plot of data from (D and E) and analysis as in (B).

2.3.5 The Holliday Junction conformation does not appear to impact hMSH4- hMSH5 binding

We then attempted to influence the conformation of the HJ by controlling the concentration of Mg2+. Divalent cations such as Mg2+ are shown to stabilize the stacked-

X structure of the HJ, therefore reducing the concentration of Mg2+ or chelating through

EDTA, may increase the amount of time the HJ spends in the planar T configuration

(Duckett, Murchie et al. 1988, Lushnikov, Bogdanov et al. 2003, Karymov, Daniel et al.

2005). Based on this notion, we performed gel shift assays with varying concentrations of EDTA and Mg2+ to determine if the HJ conformation may influence binding by hMSH4-hMSH5. A maximal HJ binding was observed by hMSH4-hMSH5 in EDTA and low concentrations of Mg2+ with significant loss of the shift complex at higher Mg2+ concentrations (Figure 8A and 8B). This shows that hMSH4-hMSH5 does not appear to distinguish between the stacked-X or planar conformations in binding the HJ.

Figure 8. hMSH4-hMSH5 recognizes a Holliday Junction in the planar T configuration. (A) EMSA gel shifts with 10 fmol cy5 labeled HJ, 50 nM hMSH4- hMSH5, and varying EDTA and Mg2+ concentration as indicated, bands noted as gel shift complex (GS) and unbound HJ (UB), control lane included on left with 0 nM hMSH4- hMSH5. (B) Gel shift with identical conditions to (A) but using the tailed HJ.

2.3.6 An hMSH4-hMSH5 sliding clamp can be retained on mobile Holliday

Junctions when DNA ends are blocked

It has been observed that a HJ with two, three, or four blocked duplex arms can retain the ATP-bound hMSH4-hMSH5 sliding clamp (Snowden, Acharya et al. 2004).

Our mobile junctions were designed with two blocked ends such that in either anti- parallel confirmation a block would be at either end of the junction (Figure 9A). For blocking, a biotin-streptavidin (SA) conjugation and Digoxigenin (Dig)-α-Dig interaction on the opposite arms of the HJ were used. We set out to determine if this doubly end blocked mobile HJ would retain sliding clamps as observed with an immobile HJ 36

(Snowden, Acharya et al. 2004). Introduction of hMSH4-hMSH5 displayed binding of the double blocked mobile HJ (Figure 9B). The binding of the blocked end substrate

Figure 9. Double blocked end Holliday Junction results in strong binding by hMSH4-hMSH5 and retention of sliding clamps. (A) Cartoon of the mobile HJ with streptavidin and anti-digoxigenin blocked ends. (B) EMSA gel shift complex (GS) formation with 10 fmol of end blocked mobile HJ and increasing hMSH4-hMSH5, unbound HJ marked UB. (C) Plot of gel shift data as percent DNA bound with error bars resulting from three independent experiments and an included single exponential growth fit. (D and E) EMSA showing the retention sliding clamps on 10 fmol of HJ with 50nM of hMSH4-hMSH5 and the indicated amount of nucleotide, No hMSh4- hMSH5 added control lane is included to the left. (F) Plot of data from (D and E) using analysis as in (B) demonstrating a constant percent of bound HJ.

37 appeared to be a stronger than with the unblocked variant, and this was confirmed (KD

=9.8 nM) (Figure 9C). After confirming the binding by hMSH4-hMSH5, ATP or ATPγS was introduced to determine if nucleotide binding would induce the loss of shift due to sliding clamp formation. We observed no loss of the shift complex when ATP or ATPγS was added confirming that the hMSH4-hMSH5 sliding clamp is retained on a blocked end mobile HJ as previously observed with immobile junctions (Figure 9D, 9E, 9F)

(Snowden, Acharya et al. 2004).

2.3.7 hMSH4-hMSH5 sliding clamp is retained on tailed mobile Holliday Junction

Previous studies on sliding clamp retention after ATP addition involved a HJ with four equivalent duplex arms, thus a sliding clamp could only ever encircle two duplex arms as it moved along the HJ. However, our tailed HJ substrate has one arm with a 70 bp addition that has a SA block on the end. An hMSH4-hMSH5 sliding clamp can therefore form at the branch point, slide along two DNA duplexes but at some point slide to a location where the shorter duplex arm terminates and the long arm does not (Figure

10A). We performed double blocked-end hMSH4-hMSH5 binding experiments with the tailed HJ that show very similar binding characteristics to the short mobile blocked-end

HJ (KD =10 nM) (Figure 10B and 10C). We then added ATP and ATPγS to the reactions and observed no loss of the gel shift complex (Figure 10D, 10E, 10F). The retention of the hMSH4-hMSH5 shows that either the sliding clamp will not slide off the two duplex arms of the HJ onto a single duplex or that the sliding clamp can be retained on a single

DNA duplex.

Figure 10. hMSH4-hMSH5 sliding clamp is retained on a tailed Holliday Junction. (A) Depiction of the tailed mobile HJ showing the streptavidin and anti-digoxigenin end blocks. (B) Gel shift assay using 10 fmol of tailed mobile HJ and increasing concentration of hMSH4-hMSH5 demonstrating formation of gel shift complex (GS), unbound HJ marked UB. (C) Plot of percent DNA bound versus the hMSH4-hMSH5 concentration with error bars from three independent experiments and a single exponential growth fit of the data. (D and E) Gel shifts showing the retention of sliding clamps on the HJ using 10 fmol of DNA and 50 nM hMSH4-hMSH5 and the indicated concentration of given nucleotide. (F) Plot of the percent bound DNA with nucleotide addition using analysis as in (B) which shows the constant gel shift formation with nucleotide addition. 39

2.3.8 Development of FRET based assembled Holliday Junction branch migration assay

Our study of rates of branch migration utilizes a fluorophore based technology called Förster resonance energy transfer (FRET). In this phenomenon a donor fluorophore is excited by radiation of a wavelength specific for that fluorophore (λEX, D).

Typically, the electrons excited from a ground state to an excited state would release that energy in the form of fluorescence (λEM, D). The presence of an acceptor fluorophore instead causes the excited donor to transfer this energy in a non-radiative manner to the acceptor (λEx, A), which is promoted to an excited state and will release the energy through fluorescence (λEM, A). FRET is defined as this non-radiative transfer of energy and was first described by Theodor Förster who theorized the efficiency of this energy transfer is dependent on the inter-dye distance (R). The relationship between FRET efficiency and the inter-dye distance is defined in equation 2.2.

6 푅0 (2.2) 퐸퐹푅퐸푇 = 6 6 푅0 + 푅

The value R0 in this equation is the Förster radius and is specific for each donor- acceptor pair. For our chosen FRET pair Cy3-Cy5 the R0 is estimated to be ~5.5 nm.

From equation 2.2 and the R0 the EFRET is extremely sensitive to inter-dye distances between 2.5 nm to 10 nm and can be used to approximate the inter-dye distance. We utilize this phenomenon by conjugating Cy3 and Cy5 fluorophores to nucleotides on opposing strands of DNA and in the course of branch migration the fluorophores will be

40 moved toward or apart from one another resulting in quantifiable changes in EFRET which we can use to determine the rates of migration.

Figure 11. Cartoon of the assembled Holliday Junction for branch migration assays. Drawing of the assembled HJ FRET branch migration assay in which a labeled half Holliday Junction (D1) with high FRET signal is annealed to an unlabeled half Holliday Junction (D2) to form a full four dsDNA armed HJ. Upon annealing the HJ can spontaneously migrate which eventually results in the resolution of the four strands into two duplex DNA fragments and the concomitant loss of FRET signal.

To study the rates of spontaneous branch migration with assembled HJ assays, a

DNA construct was designed such that HJ formation and branch migration would begin once two HJ halves were combined (Figure 11). Once formed, the branch point could migrate randomly until eventually reaching the distal end, resulting in the resolution into two duplexes. A pair of FRET fluorophores (Cy3 and Cy5) was attached on one half of the HJ such that they become separated during the branch migration process. This allows us to monitor branch migration in real time in terms of FRET decay. To validate that our synthetic HJ was both annealing and migrating properly, we began by measuring the

FRET decays and comparing those measurements to a random walk model to determine the rate of branch migration in bp/s. As a control without the unlabeled half of the junction we observed constant Cy3 and FRET signals (Figure 12A and 12B). However, when the unlabeled half was introduced we observed an increase in Cy3 signal associated with an anti-correlated decay in FRET signal. The fluorescence traces can be fit very well by single exponential functions. In order to deconvolute an actual branch migration rate from these FRET decay rates a computer simulation that included the characteristics of a random walk model was performed. This simulation involved a 60 bp random walk with a reflecting barrier on one end. Performing 10,000 iterations of this simulation we generated a distribution of the number of steps required for migration to complete (Figure

12C). By applying a range of step times to this distribution, performing exponential fitting of these models, and then fitting the theoretical rate constant to measured rate constants we were able to assign a step time to our observed branch migration reactions

(Figure 12D).

Figure 12. Sample Traces of assembled Holliday Junction branch migration. (A) Plot of Cy3 signal over time at 35°C with 5 nM D1 alone or with 50 nM D2 which demonstrates Cy3 increase only when both halves of the HJ are included. (B) FRET values over time using data from (A) again showing constant FRET with D1 alone and FRET loss when D2 is included due to branch migration and HJ resolution. (C) Plot of computer simulation of a spontaneously migrating HJ junction showing the number of base pair steps required before resolution to duplex DNA can occur. (D) Plot showing the percent difference between theoretical and observed k value as step time assigned to the theoretical model is varied, where the difference is lowest is the assigned step rate to the observed data.

2.3.9 Validating the migration rates of our assembled Holliday Junction

Next, we measured the rate of migration over a range of temperatures to determine if the rates observed were in line with the average rate of branch migration as previously measured. As expected, the rate of branch migration increased with

Figure 13. Rate validation of assembled Holliday Junction branch migration (A) Graph of the calculated rate of branch migration in base pairs per second over a range of temperatures, error bars represent measurements from five different reactions. (B) Eyring plot of the data from (A) which demonstrates an exponential increase in the rate of branch migration as temperature is increased, a linear fit of the data is applied.

temperature (Figure 13A). These rates of migration were used to generate an Eyring plot to which a linear fit was applied to estimate the enthalpy (훥S) and entropy (훥H) (Figure

13B). Our measured rates of branch migration, change in enthalpy, and the activation energy (Ea) are in agreement with known rates of spontaneous branch migration, demonstrating an appropriate method to model and calculate branch migration (Table 3).

Migration Rate Step Rate ΔH Ea at 37°C at 45°C k(bp/sec) (msec) (kcal/molK) (kcal/mol) Mulrooney et al. 35 ± 7 28 34.4 35 Panyutin et al. 15 66 36 Our Data 28 ± 3 36 33 32 Table 3. Comparison of our measured rates of branch migration to previous reports.

2.3.10 The addition of hMSH4-hMSH5 to assembled Holliday Junctions does not appear to alter the rate of branch migration

Next, we assessed if hMSH4-hMSH5 binding to the HJ influences the rate of migration. To address this question, we first confirmed that hMSH4-hMSH5 would bind this migratable and resolvable HJ. The addition of hMSH4-hMSH5 does cause the formation of a gel shift complex, a shift that is lost upon addition of ATP demonstrating the formation of a sliding clamp (Figure 14A). Two other bands are observed on this gel shift that are the un-annealed labeled half HJ (D1) and the product duplex DNA from the branch migration reaction (dsDNA). The accumulation of dsDNA demonstrates the full migration and resolution of the assembled HJ that may not have interacted with hMSH4- hMSH5. After confirming the binding and sliding clamp formation of hMSH4-hMSH5 on this HJ construct we aimed to determine if transient binding or the stable sliding clamp would alter the rate of branch migration. We began by testing the effect transient binding of hMSH4-hMSH5 would have on branch migration. At 2 mM Mg2+ the rate of branch migration (16 ± 1 bp/s) did not change with addition of hMSH4-hMSH5 up to 200 nM (17 ± 1 bp/s) (Figure 14B). This suggested that the transient binding of hMSH4- hMSH5 does not influence the rate of spontaneous branch migration. As transient MSH

45 binding is thought to last 3-4 s, we sought to determine if the more stably bound and physiologically relevant hMSH4-hMSH5 sliding clamp would result in a change in the rate of branch migration (Jeong, Cho et al. 2011). With the addition of ATP and streptavidin (SA) we sought to form sliding clamps which would be retained by the SA blocked-ends. The presence of the SA-blocked ends (14 ± 2 bp/s) do not appear to influence the rate of branch migration in a reaction buffer with 4 mM Mg2+ and 1 mM

ATP (13 ± 2 bp/s) (Figure 14C). We then added the SA end-blocks along with ATP and hMSH4-hMSH5 but once again no change in the rate of migration was observed (Figure

14D).

Figure 14. The addition of hMSH4-hMSH5 to assembled Holliday Junctions does not appear to alter the rate of branch migration (A) EMSA gel shift with 50 fmol of D1 and 500 fmol of D2 showing HJ binding as hMSH4-hMSH5 is added and then the loss of shift complex as ATP is introduced with 150nM hMSH4-hMSH5, along with labeled half HJ (D1) and duplex product (dsDNA). (B) Comparison of rates of branch migration in 2 mM MgCl2 with and without indicated nM hMSH4-hMSH5 shows no difference, error bars are the result of five independent experiments. (C) Graph comparing migration rates in 4 mM MgCl2 and 1 mM ATP with and without Streptavidin (SA). (D) Graph comparing rates of branch migration in 5 mM MgCl2, 1 mM ATP, Streptavidin and indicated hMSH4-hMSH5 shows no change in the rate of migration. Error bars from five independent experiments.

2.3.11 Pitfalls of assembled Holliday Junction branch migration assay

While the addition of hMSH4-hMSH5 did not appear to alter the rate of branch migration, it is important to acknowledge some of the issues with this experiment and how these issues might impact the ability to observe a change in branch migration. The use of the assembled HJ in itself presented two primary issues. The first being that we monitored the loss of FRET signal as a reporter for the completion of branch migration that was used to calculate a rate of branch migration (bp/s). Using this approach we were only monitoring the end point of the branch migration reaction and could not monitor any migration dynamics that occur after annealing but prior to resolution. Furthermore, once the half HJs were annealed, branch migration could immediately proceed, while hMSH4- hMSH5 binding likely occurs only after the annealing of the HJ it is uncertain whether hMSH4-hMSH5 can bind the HJ before a significant amount of branch migration has taken place. Finally, we were unable to confirm the retention of hMSH4-hMSH5 sliding clamps on the SA blocked-end assembled junction due to complications with the addition of the end blocks in combination with the transient nature of this assembled HJ.

2.3.12 Developing a model single molecule branch migratable Holliday Junction

Single molecule observation of branch migrating HJs have been previously reported (Lushnikov, Bogdanov et al. 2003, McKinney, Declais et al. 2003, Karymov,

Daniel et al. 2005, McKinney, Freeman et al. 2005, Karymov, Chinnaraj et al. 2008,

Hyeon, Lee et al. 2012). However, the short migratable regions (1-6bp) were not conducive to our study as the footprint of hMSH4-hMSH5 is ~25 bp (Snowden, Acharya

48 et al. 2004). We designed a HJ with a branch point trapped in a migratable region flanked by non-migratable regions and included a FRET pair positioned as reporters to roughly signal the position of the branch point within the migratable region (Figure 15A).

This HJ is comprised of a 30 bp migratable region with 30 bp non-migratable arms to trap the branch point as well as to hold the complex together; a 70 bp linker region between the HJ core and the slide surface was also included. This trapped branch point allows us to monitor migration kinetics without resolution to duplex products for prolonged observation of migration kinetics, in contrast to the assembled HJ FRET studies presented above. In order to interpret the FRET values in single molecule time

A B

Figure 15. Single molecule Holliday Junction with fluorophores in non-migratable region (A) Cartoon depiction of the modified and fluorophore adjusted Holliday Junction used for observation of migration dynamics. (B) Calculated FRET efficiency at each branch position along this single molecule junction.

49 trajectories we constructed a theoretical FRET curve using the crystal structure of the HJ and Fӧrster equation. This curve correlates the base pair position the branch point is located at to the FRET value expected from the inter-fluorophore distance (Figure 15B).

To test the migration of our HJ we began by observing migration in the presence of 0

2+ mM MgCl2. The previously reported average rate of migration in the absence of Mg at

25 °C is 300 bp/s, and with a frame rate of 200 ms we could expect the branch point to move ~60 steps within each frame of recording (Panyutin and Hsieh 1994, Panyutin,

Biswas et al. 1995, Mulrooney, Fishel et al. 1996). Because of the random walk nature of

Figure 16. Single molecule migration trajectories of branch migratable Holliday Junction (A) Trajectories of Cy3 and Cy5 from a single Holliday Junction taken at 200 ms frame rate for 180 s in 0 mM MgCl2. (B) Inset of data from (A) to demonstrate the anti-correlation between Cy3 and Cy5 emissions. (C) Apparent FRET efficiency calculated from data in (A). (D) Apparent FRET efficiency calculated from data in (B). 50

Figure 17. Single molecule migration trajectories in magnesium demonstrate a slower rate of branch migration (A) Trajectories of Cy3 and Cy5 from a single Holliday Junction taken at 200 ms frame rate for 180 s in 5 mM MgCl2. (B) FRET trajectory calculated from trajectories in (A).

spontaneous branch migration and the large number of steps per frame we might expect a random distribution of the branch point over the 30 possible positions, which in turn would result in an average FRET value for each frame (Eavg = 0.33). Cy3 and Cy5 fluorescence trajectories of individual molecules in the absence of Mg2+ exhibit highly dynamic fluctuations suggesting a HJ which is branch migrating rapidly (Figure 16A). 51

An inset of Figure 16A is shown which demonstrates that the emission from Cy3 and

Cy5 are anti-correlated confirming that signal changes are due to the changing inter- fluorophore distance (Figure 16B). FRET efficiency trajectories in the absence of magnesium also show rapid signal fluctuations (Figure 16C and 16D). As mentioned previously, the rate at which branch migration occurs in the absence of magnesium suggests the observed FRET efficiencies at each frame are not indicative of the branch point at individual locations, but rather an average of the many locations the branch point migrates through during the 200 ms time frame. We observed FRET efficiency fluctuations from roughly E = 0.1 to E = 0.5, and appear centered at E = 0.3, which is in agreement with the calculated average FRET (Eavg = 0.33). The addition of 5 mM MgCl2 resulted in Cy3 and Cy5 trajectories, which were once again anti-correlated (Figure 17A).

A FRET efficiency trajectory shows fluctuating signal between E = 0.1 and E = 0.6, though the changes are much less rapid than those observed in the absence of magnesium

(Figure 17B). This less dynamic trajectory confirms that magnesium is able to slow the rate of branch migration through stabilization of the stacked-X conformation of the HJ.

The average change in FRET per 200 ms time frame was calculated for 150 individual molecules in the presence and absence or magnesium and a histogram of those averages was plotted (Figure 18A). This histogram shows the ability to quantify the effect magnesium has on the rate of branch migration. Random walk modeling allowed us to calculate a rate of branch migration (bp/s) from the average change in FRET (Figure

18B). We report a calculated rate of branch migration of 425 bp/s and 75 bp/s in the absence and presence of magnesium, respectively.

Figure 18. Average change in FRET of single molecule migration trajectories in the absence and presence of magnesium (A) Histogram of calculated average change in FRET per frame of single Holliday Junctions in 0 and 5 mM MgCl2. (B) Reported rate of branch migration calculated from the average change in FRET through modeling of a random walk process.

2.4 Discussion

After overcoming protein expression and solubility challenges, we were able to purify hMSH4-hMSH5 using a protocol previously developed in this lab. Utilizing a HJ substrate identical to the one employed previously, we showed comparable hMSH4- hMSH5 binding to immobile HJs (Snowden, Acharya et al. 2004). We also show the loss of gel shift complex after addition of ATP or ATPγS addition, demonstrating the proteins ability to not only bind the HJ but also form hydrolysis-independent sliding clamps on the

DNA. Confident in the purity and activity of our protein we tested if this interaction with immobile junctions could be replicated with a mobile HJ. hMSH4-hMSH5 demonstrated

53 the ability to bind the mobile HJs with a similar calculated dissociation constant for both the mobile and immobile HJs. This demonstrates the movement of the branch point does not alter hMSH4-hMSH5 binding to the HJ. Interestingly, we also observed that hMSH4-hMSH5 bound more strongly to a tailed mobile HJ as compared to a short mobile HJ. The sole difference between these HJs was the addition of the 70 bp linker region to one of the duplex arms, so we considered how this modification could bring about the observed increase in binding. As the dissociation constant (KD) is equal to the ratio of the dissociation and association rates (koff/kon) and the association rate (kon) has a linear relationship with protein concentration, it appears the observed change in KD can be attributed to the dissociation rate (koff). Therefore, it appears that this tail region in some way impacts dissociation of hMSH4-hMSH5 from the HJ resulting in a lowered

KD. Another interesting observation was that hMSH4-hMSH5 binding of the HJ appeared similar in the presence of EDTA or physiological concentrations of magnesium.

Further studies and dissociation constant calculation for hMSH4-hMSH5 binding of the

HJ in different concentrations of MgCl2 is required for broader statements on the effect magnesium and HJ structure have on binding by hMSH4-hMSH5. However, this observation provides a range of MgCl2 concentrations in which HJ migration assays can be performed with little change in hMSH4-hMSH5 binding to the HJ.

As retention of hMSH4-hMSH5 sliding clamps had previously been observed only on immobile HJs with two, three, or four blocked ends, we aimed to confirm this sliding clamp retention for a double end-blocked end mobile junction. We observed the binding of hMSH4-hMSH5 to the blocked-end short mobile HJ and the retention of the

54 sliding clamp on the DNA as visualized by maintained shift complex upon ATP addition.

Interestingly, sliding clamp retention also occurred on the tailed blocked end mobile HJ.

Pitfalls in the design of our assembled branch migratable HJ studies prevent the formation of any conclusions regarding the effect hMSH4-hMSH5 may have on the rate of branch migration. These studies did allow us to conclude that a different approach was necessary to study this interaction. We therefore developed a single molecule platform by which to observe branch migration of individual Holliday Junctions and allow for continuous observation of migration dynamics. Single molecule trajectories in the absence of magnesium are consistent with rapid migration along the migratable region and the calculation of branch migration rates yielded a rate (425 bp/s) roughly consistent with that previously reported at 25 0C in the absence of magnesium (300 bp/s) (Panyutin and Hsieh 1994). Magnesium slowed the rate of branch migration, which was observed visually through inspection of single molecule trajectories as well as quantitatively in the reduction in the average change in FRET per frame. However, our reported rate of branch migration (75 bp/s) in magnesium is significantly greater than that previously reported at 5 mM Mg2+ and 25 0C (1 bp/s) (Panyutin and Hsieh 1994). Further optimization of the code used to model migration may lead to the calculation of migration rates more in line with those previously reported. Following the full validation of this system the addition of hMSH4-hMSH5 will allow us to determine if binding or sliding clamp formation impact the rate of branch migration.

Chapter 3: Determining the in vitro activity of purified hMLH1-hMLH3

3.1 Introduction

Correct completion of meiotic division requires the asymmetric resolution of the dHJ that results in crossover events, development of the chiasmata, and proper chromosomal segregation (Jones 1984, Bishop and Zickler 2004, Hillers 2004, Kleckner,

Zickler et al. 2004). The HJ resolvases identified to date do not appear to significantly impact the levels of crossover products and do not show a propensity for specifically performing asymmetrical dHJ cleavage (Mullen, Kaliraman et al. 2001, Abraham,

Lemmers et al. 2003, Dendouga, Gao et al. 2005). Furthermore, unidentified proteins are likely required to function as a homolog specific cohesion, holding homologous chromosomes together during the development of the metaphase I plate. A substantial amount of genetic and cellular studies suggest that the MLH/PMS homolog MLH1-

MLH3 plays a role in meiotic chromosome segregation (Wang, Kleckner et al. 1999,

Argueso, Smith et al. 2002, Moens, Kolas et al. 2002, Hoffmann, Shcherbakova et al.

2003, Kolas, Svetlanov et al. 2005). Studies in S. cerevisiae suggest that mlh1 acts in the same pathway of spore development as msh4 and msh5 (Hunter and Borts 1997, de los

Santos, Hunter et al. 2003, Argueso, Wanat et al. 2004). Furthermore, in mouse spermatogenesis and oocyte development MLH1 and MLH3 foci form late in prophase

56 mostly at sites of DSBR, which are also marked by MSH4 and MSH5 foci formation earlier in prophase I (Moens, Kolas et al. 2002, Kolas, Svetlanov et al. 2005, Lenzi,

Smith et al. 2005). Also, MLH1 and MLH3 foci correlate with the frequency and distribution of chiasmata formation (Baker, Plug et al. 1996, Lipkin, Moens et al. 2002).

Collectively, these results suggest that MLH1-MLH3 plays a role in chromosome segregation that is downstream of MSH4-MSH5 and functions at sites of crossover formation and chiasmata development.

Some MLH/PMS proteins have been shown to possess a latent endonuclease activity that is dependent on a conserved DQHA(X)2E(X)4E metal binding motif

(Kadyrov, Dzantiev et al. 2006, Kadyrov, Holmes et al. 2007, Pluciennik, Dzantiev et al.

2010). An intrinsic endonuclease activity has been demonstrated by MLH/PMS proteins in low ionic strengths, an activity that is additionally dependent upon Mn2+ and ATP

(Kadyrov, Holmes et al. 2007). In physiological ionic strengths MLH/PMS exhibits stimulation by MSHs, RFC, and PCNA, with a requirement for ATP and Mn2+ to perform endonuclease activity (Kadyrov, Dzantiev et al. 2006, Kadyrov, Holmes et al. 2007,

Pluciennik, Dzantiev et al. 2010). Furthermore, hMLH1-hPMS2 endonuclease activity was shown to be stimulated by PCNA alone, although dependant on Mn2+ and ATP, this activity was inhibited through addition of p21, which contains a PCNA interaction motif

(Pluciennik, Dzantiev et al. 2010). yMLH3 and hMLH3 contain this conserved metal binding motif and both form a heterodimer with MLH1 (Kadyrov, Dzantiev et al. 2006,

Kadyrov, Holmes et al. 2007, Guarne 2012). Point mutations in the yMLH3 metal binding motif demonstrate similar levels of aberrant crossover and chromosome

57 segregation in comparison to complete knockout of the MLH3 gene (Nishant, Plys et al.

2008).

Recently, yeast and human MLH1-MLH3 heterodimer were purified to assay for biochemical activity in vitro. These studies showed that yMlh1-yMlh3 possesses the inherent ability to nick supercoiled plasmid DNA (low ionic strength), which required

Mn2+ and was stimulated by yMsh2-Msh3 (physiological ionic strength) but was not stimulated by PCNA and RFC (Ranjha, Anand et al. 2014, Rogacheva, Manhart et al.

2014). yMLH1-yMLH3 endonuclease appeared to be independent of ATP binding

(Ranjha, Anand et al. 2014, Rogacheva, Manhart et al. 2014). The purified human variant of MLH1-MLH3 did not demonstrate native nicking ability, and does not show nicking activity when stimulated by yPCNA, yRFC, yMsh2-Msh3, ATP, or Mn2+.

However, hMLH1-hMLH3 was shown to aggregate with the HJ, an effect more evident in EDTA than Mg2+ (Ranjha, Anand et al. 2014, Rogacheva, Manhart et al. 2014).

Based on this experimental evidence which suggests an unknown role for MLH1-

MLH3 in meiotic recombination and segregation we sought to purify hMLH1-hMLH3 to assay the proteins endonuclease activity, interaction with DNA, and interaction with the meiosis associated MSH, hMSH4-hMSH5.

3.2 Materials and methods

Cloning

The wild type MLH3 was PCR amplified and in the process a HRV-3C protease site was added onto the 5’ end of the MLH3 gene, while a Formylglycine Generating

Enzyme (FGE) and His6 tag were cloned onto the 3’ end of the MLH3 gene. This augmented MLH3 was then ligated into a pFastBac1 plasmid. A Maltose Binding

Protein (MBP) expressing plasmid pMALc5X (NEB) was used for PCR template to place

5’ of the HRV-3C site in the MLH3 plasmid, resulting in a MBP-HRV-3C-hMLH3-FGE-

6HIS expressing pFastBac1 plasmid.

Table 4. Primers used to fuse MBP onto MLH3.

Insect cell transfection

All pFastBac1 plasmids were transformed in the DH10 Bac (Invitrogen) cell line as suggested by the manufacturer. This transfection resulted in the transposition of genes of interest into a bacmid contained in the DH10 cells. The bacmid containing the gene of interest was purified as suggested by manufacturer. Bacmid was then transfected into Sf9 insect cells (Thermo-Fisher) as suggested by the manufacturer. Transfections resulted in a baculovirus which when added to insect cells will express the protein of interest.

59 hMLH1-hMLH3 Expression

Baculoviruses individually expressing hMLH1 and MBP-hMLH3-FGE-HIS were mixed in a 1:1 ratio to Hi5 cells (thermo Fisher) at a concentration of 2x106 and incubated at 27°C for 24 hours. Cells pellet was obtained by centrifuge at 500x RFC for

10 minutes at 4°C. Cell pellet was resuspended in Buffer W (25 mM HEPES [pH 8.1],

150 mM NaCl, and 10% Glycerol). Cells were pelleted again by centrifuge and resuspended in Buffer F (HEPES [pH 8.1], 500 mM NaCl, 1 mM DTT, 1 mM EDTA,

10% Glycerol, 500 uM PMSF, 1 ug/mL Pepstatin, and 1 ug/mL Leupeptin) and then snap-frozen in liquid nitrogen and stored at -80°C for later protein purification. hMLH1-hMLH3 Purification

Eight pellets containing 1.6 L worth of Hi5 cells stored at -80°C freezer were thawed on ice. Cells were lysed by passage through 25G needle three times. Lysate was centrifuged for 1 hour at 4C and 41000 RPM using a Ti-60 rotor in an Optima L-1000 XP

Ultra-centrifuge (Beckman-Coulter) to separate the supernatant from insoluble material.

Supernatant was loaded onto a Amylose High Flow column pre-equilibrated in Buffer A

(HEPES [pH 8.1], 300 mM NaCl, 1 mM DTT, 1 mM EDTA, 10% Glycerol). All buffers contained 500 uM PMSF, 1 ug/mL Pepstatin, and 1 ug/mL Leupeptin. Column was then washed with 5 column volumes (CV) of Buffer A and then the bound proteins were eluted with Buffer B (HEPES [pH 8.1], 300 mM NaCl, 60 mM Maltose, 1 mM DTT, 1 mM EDTA, and 10% Glycerol).

Peak fractions were collected and incubated on ice overnight with HRV-3C protease added at a 0.25 X molar ratio for removal of MBP tag from MLH3. Digested 60 protein was subsequently applied to a Superdex 200Hi-Load 16/60 (GE Healthcare) pre- equilibrated with Buffer A. Fractions containing hMLH1-hMLH3 were pooled and loaded onto a Heparin-Sepharose column pre-equilibrated with Buffer A, washed with

5CV Buffer A and eluted with Buffer C (HEPES [pH 8.1], 1 M NaCl, 1 mM DTT, 1 mM

EDTA, 10% Glycerol). Fractions containing hMLH1-hMLH3 were dialyzed against

Buffer D (HEPES [pH 7.8], 300 mM NaCl, 1 mM DTT, 1 mM EDTA, 20% Glycerol), quantified by UV absorption at 280 nm using a Nano-Drop (Thermo Fisher), snap frozen, and stored at -80°C until further use.

Super-coiled plasmid nuclease assays

Non-physiological endonuclease assays were performed in 10uL reactions in 25 mM HEPES (pH 7.8), 25 mM NaCl, 1 mM DTT, 5 mM MgCl2, 1 mM MnSO4, 500 ug/mL acetylated BSA, 2% glycerol, and 0.5 mM ATP when indicated. PCNA induced endonuclease assays were performed in 10uL reactions with 25mM Hepes Buffer

(pH=7.8), 130mM NaCl, 1mM DTT, 5mM MgCl2, 1mM MnSO4, 200nM yRFC, 50nM hPCNA, 500ug/mL acetylated BSA, 2% glycerol, and 0.5mM ATP when indicated. All reactions were incubated at 37°C for 40min and resolved on 1% TAE agarose gel at 70V for 40min. Gels were imaged on a Gel Doc 1000 (BioRad).

Electrophoretic mobility shift assays (EMSA)

Holliday Junction binding super shift assays were performed in 20uL reactions.

Reaction mixtures were composed of 25 mM HEPES (pH 7.8), 100 mM NaCl, 1 mM

DTT, 5 mM MgCl2, 5% glycerol, 50 ng 400 bp dsDNA competitor, 50 ng poly dI-dC

61 competitor, 100 ug/mL Acetylated BSA, 20 fmol Cy5 labeled Holliday Junction, 50 nM hMSH4-hMSH5, 20-fold molar excess Anti-Digoxigenin, 20-fold molar excess

Streptavidin and 0.5mM ATP or ATPγS when indicated. Reactions were mixed and incubated at 37°C for 5min. When indicated ATP or ATPγS was added and reaction was incubated an additional 5min at 37°C, finally hMLH1-hMLH3 was added followed by a final 5min incubation at 37°C. Gel separation was performed at 4C in TAE buffered 4% native polyacrylamide gels (37.5:1) at 105V for 8 hours. Gels were imaged with

Typhoon 9410 (GE Healthcare) and quantified with ImageQuant TL (GE Healthcare).

DNA binding assays with ssDNA, duplex DNA, or HJ were performed in 25 mM

HEPES (pH 7.8), 25 mM NaCl, 1 mM DTT, 5% glycerol, 100 ug/mL acetylated BSA, and either 2 mM EDTA or 2 mM MgCl2 as indicated. 20 μL reactions were incubated on ice for 15min and resolved on 5% native polyacrylamide gels (37.5:1) at 105V for 4 hours. Gels were imaged with Typhoon 9410 (GE Healthcare) and quantified with

ImageQuant TL (GE Healthcare).

3.3 Results

3.3.1 Purification of hMLH1-hMLH3

Expression and solubility of hMLH1-hMLH3 was optimized by use of an N- terminal Maltose Binding Protein (MBP) tag and expression in Hi5 cells at 27°C for 24 hours (Routzahn and Waugh 2002, Young, Britton et al. 2012). A schematic of hMLH1- hMLH3 that is expressed is shown in Figure 19A. Soluble cell extracts were bound to an

Amylose column and eluted with maltose that produced a relatively pure and concentrated protein (Figure 19B). Removal of the MBP tag from hMLH3 was performed by digestion with HRV-3C protease and subsequently the hMLH1-hMLH3 complex was purified from the MBP tag, HRV-3C protease, and other small contaminants by a Superdex gel filtration (Figure 19C). Because the gel filtration column diluted the protein, a concentration step was performed using Heparin binding and step elution. This resulted in concentrated and roughly 50% pure hMLH1-hMLH3 protein samples (Figure 19D).

The identities of protein bands in the coomassie gel were confirmed by western blot analysis, which showed a single band for hMLH1 protein (Figure 19E). The western blot for hMLH3 however showed a number of bands, that we identified as undigested

MBP-hMLH3, full length hMLH3, and two other bands assumed to be degradation products of hMLH3 (Figure 19F).

Figure 19. Purification of hMLH1-hMLH3. (A) Cartoon depiction of the gene products expressed in Hi5 cells. (B) SDS-PAGE gel showing the protein that was loaded onto, flowed through, and eluted from an Amylose resin column, molecular weights (MW) in kilodaltons (kDa) noted on left. (C) Coomassie stained gel showing the proteins from Amylose column, cut by HRV-3C protease, and separated by a size exclusion chromatography column. (D) SDS-Page gel showing samples of protein loaded onto, flown through, and eluted from a Heparin resin column. (E and F) Western blots of purified protein with anti-bodies specific to hMLH1 and hMLH3 showing a single band for hMLH1 and multiple bands for hMLH3.

3.3.2 Testing purified hMLH1-hMLH3 for Endonuclease Activity

We first sought to characterize the activity of purified hMLH1-hMLH3 using

DNA binding and nicking activity assays as observed with MLH/PMS proteins (Kadyrov,

Dzantiev et al. 2006, Kadyrov, Holmes et al. 2007, Pluciennik, Dzantiev et al. 2010,

Ranjha, Anand et al. 2014, Rogacheva, Manhart et al. 2014). The nuclease activity was assessed based on the protein ability to nick supercoiled plasmid DNA. Nicking assays were performed at 25 mM NaCl as MLH/PMS do not demonstrate endonuclease activity at physiological ionic strength. hMLH1-hPMS2 demonstrated endonuclease activity through nicking and relaxation of the supercoiled DNA plasmid, an activity that was ATP dependant. However, hMLH1-hMLH3 did not show any intrinsic nuclease activity at 25 mM NaCl (Figure 20A). We then sought to determine if hPCNA would stimulate the endonuclease activity of hMLH1-hMLH3 in physiological NaCl, as observed with other

MLH/PMS proteins. We observed a relaxed plasmid DNA band with the addition of hMLH1-hPMS2, this endonuclease activity is shown to be dependent on hPCNA, yRFC, and ATP. hMLH1-hMLH3 does not show similar activity to nick supercoiled DNA in the presence of hPCNA, yRFC, and ATP (Figure 20B).

Figure 20. Studying the endonuclease activity of hMLH1-hMLH3. (A) Supercoiled DNA plasmid nicking assay performed at 25 mM NaCl with 100 ng of PMP2 plasmid, 1 mM ATP as indicated and increasing amounts of either hMLH1-hPMS2 or hMLH1- hMLH3. Assay shows the ability of hMLH1-hPMS2 to nick the plasmid, an activity which is ATP dependent and which is not observed with hMLH1-hMLH3. (B) Plasmid nicking assay performed at 130mM NaCl which shows hMLH1-hPMS2 plasmid nicking which is dependent on 1 mM ATP, 50 nM hPCNA, and 200nM yRFC. The ATP, hPCNA, and yRFC dependent nicking activity is not observed when hMLH1-hMLH3 is added.

3.3.3 Determination of the DNA substrates which associate with hMLH1-hMLH3

Unable to observe any nuclease activity with hMLH1-hMLH3, a set of binding experiments were performed to evaluate the ability of hMLH1-hMLH3 to associate with different DNA substrates. hMLH1-hMLH3 DNA association studies were performed at

25 mM NaCl as MLH/PMS proteins do not show interaction with DNA in the presence of physiological ionic strengths. dsDNA with increasing concentrations of hMLH1-

66 hMLH3 showed only a marginal association, all of which remained in the well of the acrylamide gel (Figure 21A). Additionally, the presence of Mg2+ showed no apparent effect on protein-DNA association (Figure 21A). These same experimental conditions were used to evaluate the interaction with a HJ by hMLH1-hMLH. Interestingly, the amount of DNA trapped in the well was greater than compared to dsDNA and previously published data of hMLH1-hMLH3 interaction with the HJ (Figure 21B) (Ranjha, Anand et al. 2014). Furthermore, Mg2+ presence showed only a marginal effect on HJ association. Similarly, the use of a ssDNA substrate also showed a significant amount of

DNA-protein association all of which was trapped in the wells and no change was observed with the addition of Mg2+ (Figure 21C).

Figure 21. hMLH1-hMLH3 interacts with different DNA substrates. (A) EMSA with 10 fmol of Cy5 labeled dsDNA and increasing amount of hMLH1-hMLH3 performed in both 2 mM MgCl2 and 2 mM EDTA which shows minimal binding, all of which is trapped in the well. (B) Identical gel shift as in (A) but using 10 fmol of Cy5 labeled immobile HJ, showing substantial DNA-protein interaction all of which is trapped in the well. (C) EMSA assay identical to (A) with 10 fmol of ssDNA, which again shows an interaction which is trapped in the well.

3.3.4 No observation of a stable complex formation between hMLH1-hMLH3 and hMSH4-hMSH5

The localization of MLH1 and MLH3 foci to DSBR sites appears follow MSH4 and MSH5 foci formation. It is possible that hMSH4-hMSH5 may recruit hMLH1- hMLH3 to these sites, an interaction observed with other MSH and MLHs. To test this hypothesis we used a double blocked-end HJ, which had been already shown to allow the formation and retention of DNA bound hMSH4-hMSH5 sliding clamps (Figure 6), and examined whether hMSH4-hMSH5 could form a stable complex with hMLH1-hMLH3.

Our data shows that the addition of hMLH1-hMLH3 had no effect on transient hMSH4- hMSH5 HJ binding (Figure 22A). This is consistent with the notion that MSH proteins typically recruit MLH proteins following sliding clamp formation. Therefore, we next performed a similar binding experiment in the presence of ATP in order to form hMSH4- hMSH5 sliding clamps. However, no stable complex was formed as shown by the lack of super shift or other changes in the binding pattern (Figure 22B). One caveat of this experiment is that an ATP bound hMLH1-hMLH3 sliding clamp could potentially be large enough to slide off these blocked DNA ends. Therefore, we substituted ATP with

ATPγS as other MLH proteins have shown inefficient binding of ATPγS, permitting the recruitment of hMLH1-HMLH3 to the HJ by hMSH4-hMSH5 without forming an independent sliding clamp. While a slightly deformed gel shift is observed in the presence of 200 nM hMLH1-hMLH3, no stable complex was observed (Figure 22C).

Figure 22 Determining if hMLH1-hMLH3 can form a stable complex with hMSH4-hMSH5. (A) Gel shift experiment where 10 fmol of Cy5 labeled blocked end HJ is incubated with 50 nM hMSH4-hMSH5 before hMLH1-hMLH3 is added which shows transient hMSH4-hMSH5 does not induce recruitment of the MLH protein. (B) EMSA gel shift in which 50 nM hMSH4-hMSH5 is added to 10 fmol of blocked end HJ to form sliding clamps prior to hMLH1-hMLH3 addition, no recruitment of hMLH1- hMLH3 is observed by the hMSH4-hMSH5 sliding clamp. (C) Gel shift identical to (B) but with the use of ATPγS rather than ATP which also shows no recruitment of hMLH1- hMLH3 to the HJ.

3.4 Discussion

Using the MBP tag as a solubility enhancer we were able to achieve sufficient expression and solubility of the hMLH1-hMLH3 protein to attempt purification

(Cordingley, Register et al. 1989). We developed a novel chromatographic purification protocol that resulted in ~50% pure protein, with at least some of contaminants being degradation products of the hMLH3 protein. Gel shift experiments were then performed to assess the activity of the newly purified protein. In agreement with previous investigations, hMLH1-hMLH3 aggregated with the HJ at non-physiological ionic strength, however, no gel shift complex was observed with the complex being observed exclusively in the well (Ranjha, Anand et al. 2014). In contrast to observations where

MLH1-MLH3 association with HJs was more pronounced in EDTA, we report HJ association with hMLH1-hMLH3 was similar in 2 mM EDTA and the physiologically relevant 2 mM Mg2+. Furthermore, we observe that hMLH1-hMLH3 associates with ssDNA at non-physiological ionic strengths, consistent with the binding activity observed for other MLH/PMS proteins. The inability to form a specific gel shift complex is possibly due to solubility issues of hMLH1-hMLH3, resulting in protein aggregates precipitating and the entirety of the protein-DNA association becoming trapped in the well of the gel.

The absence of independent hMLH1-hMLH3 nicking activity in non- physiological ionic strengths on supercoiled plasmid may also be explained by protein solubility in 25 mM NaCl and formation of protein aggregates. The addition of RFC and

PCNA do not stimulate the any endonuclease activity of hMLH3. As yMLH1-yMLH3

71 does show endonuclease activity, but was not stimulated by PCNA, it is possible MLH1-

MLH3 may not interact with PCNA (Kadyrov, Dzantiev et al. 2006, Pluciennik, Dzantiev et al. 2010).

No stable complex was observed between hMLH1-hMLH3 and hMSH4-hMSH5 in the presence or absence of end-blocks, ATP, or ATPγS. There are many possibilities as to why a stable gel complex was unable to be observed. One problem lies in the protein itself as the presence of contaminants make it impossible to know the true nature of the protein samples we have purified. It is also possibly that limitations of the gel shift assay performed. Another possibility is that after an hMSH4-hMSH5 sliding clamp is formed interaction with hMLH1-hMLH3 allows hMLH1-hMLH3 to bind ATP forming a hydrolysis-independent sliding clamp as observed with MutL (Liu, Hanne et al. 2016).

The large disordered internal region of MLHs could allows for the formation of large sliding clamps. The increased size of the hMLH3 suggests the ability to form a sliding clamp of similar or greater size than other MLH/PMS proteins. This sliding clamp may not be constrained by the streptavidin and α–digoxigenin blocks in place and could diffuse off the HJ. While we attempted to avoid this through the use of ATPγS, which is poorly bound by other MLHs, it is entirely possible hMLH1-hMLH3 can form sliding clamps through ATPγS binding.

Chapter 4: Discussion

4.1 Introduction

The events in meiosis I constitute one of the most amazing organizational processes in biology. The double strand break (DSB) is possibly the most mutagenic and cytotoxic DNA lesion, yet hundreds of DSBs are self-inflicted upon the cell during the onset of meiosis I. What follows is a highly choreographed repair process which functions to repair each DSB, pair homologous chromosomes, regulate and form genetic crossovers, and segregate chromosomes. The importance of accurate meiotic DSBR is demonstrated in the fact that chromosomal non-disjunction is responsible for 50% of spontaneous miscarriages (Hassold, Hall et al. 2007). Furthermore, errors in maternal meiosis are responsible for roughly 90% of Down syndrome cases (Hassold, Sherman et al. 1995). This repair process begins with the genomic destruction carried out by the protein SPO11. Repair of these breaks is partially performed by non-homologous end joining, while a majority are repaired by homologous recombination (HR), which begins with nucleoprotein filament formation by RAD51 and DMC1 followed by strand invasion and formation of the first Holliday Junction (HJ) (Klapholz, Waddell et al. 1985,

Keeney, Giroux et al. 1997). It is also clear that a second HJ is formed as the other half of the broken chromosome anneals to the displaced loop using the same mechanism.

What is unclear is what happens to the HJs after the formation of this dHJ structure linking two homologous chromosomes. Therefore, the center of this discussion about the mechanism of homologous recombination (HR) is the HJ, the physical linkage between chromosomes through which homologous recombination begins and ends, and the resolution of which defines the type of genetic exchange between chromosomes. One interesting question is what happens to HJs after they have been formed? Are these junctions static or dynamic? Are they constantly associated with or controlled by protein mechanisms? By more fully understanding the dynamics of the HJs and the proteins shown to interact with them we can add clarity to their characteristics during HR.

Another question has to do with the resolution of the HJs. Intriguingly, although multiple DSBs are likely introduced per chromosome, only one or two chiasmata are usually observed between each homologous chromosome pair (Jones 1984). This demonstrates how tightly controlled this repair process is, both mandating a crossover yet preventing extraneous recombination. This prevalence and requirement for dHJs to be resolved into crossovers during meiosis is in contrast to the lowered rates observed in mitotic cells. While both can perform all types of double strand break repair, the use of a homologous template in recombination with higher rates of crossover formation is unique in meiotic cells (Rothkamm, Kruger et al. 2003, Kass and Jasin 2010, Symington and

Gautier 2011). The mechanism by which COs are formed is unclear, however, a number of proteins have been implicated as having roles in CO formation and chiasmata development. It has been observed that the knockout of MSH4, MSH5, MLH1, or MLH3 results in increased levels of non-disjunction between homologous chromosomes as well

74 as lowered levels of crossover (Ross-Macdonald and Roeder 1994, Wang, Kleckner et al.

1999, Argueso, Smith et al. 2002, Hoffmann, Shcherbakova et al. 2003, Argueso, Wanat et al. 2004, Nishant, Chen et al. 2010, Zakharyevich, Tang et al. 2012). Also, foci localization data shows that MSH4 and MSH5 foci form at the sites of DSB, which is followed by the formation of MLH1 and MLH3 foci which correlate with sites of future crossover and chiasmata formation (Santucci-Darmanin, Walpita et al. 2000, Lipkin,

Moens et al. 2002, Moens, Kolas et al. 2002, Kolas, Svetlanov et al. 2005, Lenzi, Smith et al. 2005).

The specific binding of the HJ by hMSH4-hMSH5 has been observed through in vitro experiments. Finally, double knockout studies of these proteins suggest they act in the same pathway of CO generation (Hunter and Borts 1997, de los Santos, Hunter et al.

2003, Argueso, Wanat et al. 2004). While it is clear these proteins have roles in meiotic

DSBR, the exact function remains unknown and with the elucidation of their mechanisms a deeper understanding of HR may follow.

4.2 Interaction between hMSH4-hMSH5 and the Holliday Junction

The study of the biophysical properties of MutS, MutL, and their homologs has allowed for direct observation of some mechanisms in mismatch repair. Furthermore, basic biophysical observations allow for the development of broader ideas about the roles for these proteins and their function in relation to one another. We therefore seek to further understand the way in which the meiotic MSH, hMSH4-hMSH5, interacts with

75 the Holliday Junction in the hope that an in-depth understanding of its interaction on

DNA will allow for a better understanding of its role in meiosis I.

From our gel shift studies we have been able to make a number of interesting observations concerning the interaction between hMSH4-hMSH5 and the Holliday

Junction. Importantly, we report that it appears the ability of the HJ to branch migrate does not affect binding by hMSH4-hMSH5. We were also able to show that our mobile

HJs could retain an hMSH4-hMSH5 sliding clamp with two blocked-ends of the HJ.

These observations lay the foundation for the study of hMSH4-hMSH5 binding and how it may impact branch migration. Other observations we have made require further study and the use of different approaches for broader conclusions to be drawn. We report similar binding of the HJ by hMSH4-hMSH5 in EDTA and physiological MgCl2 concentrations. As magnesium stabilizes the stacked-X structure of the HJ it appears that hMSH4-hMSH5 interaction with the HJ is unaffected by the conformation, but further studies will be required to determine if the HJ conformation impacts binding by hMSH4- hMSH5. Also we observe that the inclusion of a 70 bp tail on one arm of the HJ as well as the addition of end-blocks to HJ arms result in a decrease in the dissociation constant of hMSH4-hMSH5 to the HJ. As mentioned previously it would appear that this observed decrease in KD is caused by changes in the koff of the interaction. The question then becomes what is the mechanism of hMSH4-hMSH5 dissociation from the HJ, which leads to these changes in the dissociation constant. The use of bulk approaches cannot begin to answer these questions, however, the use of single molecule imaging may allow for a greater understanding of the way that hMSH4-hMSH5 interacts with the HJ, which

76 may lead to the elucidation of the role hMSH4-hMSH5 plays in homologous chromosome pairing and repair.

4.3 How do HJ dynamics fit with the DSBR mechanisms?

As the formation and resolution of the HJ defines the process and pathway of HR an understanding of the behavior of and influences on the HJ is of utmost importance.

By elucidating the dynamics of the HJ we will gain more insight into the process of homology based DSBR. While studies have elucidated the mechanisms of HJ formation, little is known about the nature of the chromosomal HJ after formation and prior to its dissolution or resolution. While little may be known about the HJs in the cell, much is understood about the dynamics and kinetics of the branch point and branch migration with synthetic HJs. The conformational rearrangements at the branch point allow adoption of the planar structure through which migration likely proceeds (McKinney,

Declais et al. 2003, Joo, McKinney et al. 2004). The planar structure is much less stable in magnesium as divalent cations interact with the HJ and stabilize the stacked-X structure slowing the conformational rearrangements and branch migration (Panyutin and

Hsieh 1994, Panyutin, Biswas et al. 1995, Mulrooney, Fishel et al. 1996, Joo, McKinney et al. 2004). During HR an unchecked and spontaneously migrating HJ would have the ability to migrate toward the 3’ end of the invading strand and cause the chromosomal pairing to come apart or conversely move away from the invading strand further opening the displacement loop. It is therefore sensible that a mechanism is in place to stabilize the HJ and prevent it from unchecked migration.

The direct binding of the HJ by hMSH4-hMSH5 and its proposed sliding clamp structure formed after ATP binding suggests the ability to stabilize the HJ and that it might interfere with the conformational rearrangements required for branch migration

(Snowden, Acharya et al. 2004). Our work thus far does not appear to show hMSH4- hMSH5 binding or sliding clamp formation influencing branch migration. However, due a number of issues with our assembled HJ assay and the monitoring of a large population of HJs we may be missing a more subtle change hMSH4-hMSH5 is exerting on branch migration. Our development and validation of a single molecule HJ which exhibits rapid branch migration in the absence of magnesium, which is slowed upon the addition of magnesium will act as a framework on which to build. Prolonged observation of migrating junctions as they undergo dynamic rearrangement and migration will provide a direct answer concerning the effect hMSH4-hMSH5 binding and clamp formation has on branch migration.

4.4 The difficult elucidation of a mechanism for MLH1-hMLH3 in homologous recombination

The formation of crossover events at the dHJ is important to begin separation of the homologous chromosomes, but also to maintain the homolog linkage through chiasmata development, as well as to shuffle genetic information between parental chromosomes. Crossover formation is dependent upon the endonucleolytic cleavage of two strands at each branch point of the dHJ (Wyatt and West 2014). Coordination between the sites is required as symmetric cleavage results in non-crossover products. Of

78 the known human HJ resolvases (SLX1-SLX4, GEN1, and MUS81-EME1) none have been shown to specifically generate crossover products and the deletion of all three has minimal impact on the levels of crossover formation (Mullen, Kaliraman et al. 2001,

Abraham, Lemmers et al. 2003, Dendouga, Gao et al. 2005). It appears hMLH1-hMLH3 may be present as crossovers are formed and some evidence suggests that hMLH1- hMLH3 itself could act as the HJ resolvase (Wang, Kleckner et al. 1999, Argueso, Smith et al. 2002, Hoffmann, Shcherbakova et al. 2003). The most convincing evidence has come from studies that showed dramatic reduction in viable yeast spore generation due to the deletion of MLH3 or mutation of a conserved metal-binding domain in MLH3, a domain which is required for endonuclease activity in other MLH proteins (Nishant, Plys et al. 2008). However, the presence of hMLH1-hMLH3 during the development of chiasmata and ability of MLH/PMS protein to form extremely stable clamps on the DNA suggests an entirely different role for hMLH1-hMLH3 to stabilize homologous pairing through crossover formation.

While a substantial amount of genetic and cellular localization data has suggested a role of hMLH1-hMLH3 late in meiotic recombination, little progress has been made to elucidate the mechanism of hMLH1-hMLH3. Previously, in vitro studies were impossible due to the insolubility and degradation of hMLH1-hMLH3 with substantial purity. While progress has been made, the continued inability to obtain greater than 95% pure hMLH1-hMLH3 is a factor that must be considered when analyzing data, and continued refinement of the purification is of utmost importance. With that in mind we do notice that the observed activity of our hMLH1-hMLH3 is in agreement with, but also

79 expands on the previous findings with purified hMLH1-hMLH3 (Ranjha, Anand et al.

2014). Specifically, studies showed hMLH1-hMLH3 association with the HJ at low ionic strength in the absence of Mg2+. Our results show hMLHL1-hMLH3 association with the

HJ both the absence and presence of Mg2+, however, this association is entirely observed through aggregate formation. Even at low ionic strengths other MLH/PMS proteins show little to no binding to mismatched (MM) nucleotides on DNA and this association with the HJ is worth further consideration (Hall, Wang et al. 2001, Hall, Shcherbakova et al.

2003). The lack of any observed endonuclease activity could be due to the purity of the sample used, protein solubility, or unfavorable assay conditions. The inability to form a stable complex with hMSH4-hMSH5 is possibly due to the limitations imposed by use of gel shift assays in combination with short end-blocked HJs. The interactions of

MLH/PMS proteins with MSH proteins and the DNA has only just been more deeply understood, and this was only possible through single molecule imaging, and it is likely that further understanding of the role hMLH1-hMLH3 plays in chromosome segregation will also require the use of more advanced approaches.

4.5 Conclusions

Our results summarized in this chapter show a complex interaction between the

HJ and hMSH4-hMSH5, and one that is not impacted by branch point migration.

Interesting binding patterns with tailed junctions and blocked-end junctions demand further study at the single molecule level to understand how hMSH4-hMSH5 interacts with the HJ. We also show that the effect this sliding clamp has upon branch migration

80 may be more complex than previously envisioned and will require further study before this relationship is understood. We report limited results with hMLH1-hMLH3 and can only conclude that refinement in the purification and possible use of single molecule imaging are needed to better understand the role hMLH1-hMLH3 may play in meiosis.

References

1. Abraham, J., B. Lemmers, M. P. Hande, M. E. Moynahan, C. Chahwan, A. Ciccia, J. Essers, K. Hanada, R. Chahwan, A. K. Khaw, P. McPherson, A. Shehabeldin, R. Laister, C. Arrowsmith, R. Kanaar, S. C. West, M. Jasin and R. Hakem (2003). "Eme1 is involved in DNA damage processing and maintenance of genomic stability in mammalian cells." Embo j 22(22): 6137-6147.

2. Acharya, S., P. L. Foster, P. Brooks and R. Fishel (2003). "The coordinated functions of the E. coli MutS and MutL proteins in mismatch repair." Mol Cell 12(1): 233-246.

3. Agostinho, A., B. Meier, R. Sonneville, M. Jagut, A. Woglar, J. Blow, V. Jantsch and A. Gartner (2013). "Combinatorial regulation of meiotic holliday junction resolution in C. elegans by HIM-6 (BLM) helicase, SLX-4, and the SLX-1, MUS- 81 and XPF-1 nucleases." PLoS Genet 9(7): e1003591.

4. Andersen, S. L., D. T. Bergstralh, K. P. Kohl, J. R. LaRocque, C. B. Moore and J. Sekelsky (2009). "Drosophila MUS312 and the vertebrate ortholog BTBD12 interact with DNA structure-specific endonucleases in DNA repair and recombination." Mol Cell 35(1): 128-135.

5. Argueso, J. L., D. Smith, J. Yi, M. Waase, S. Sarin and E. Alani (2002). "Analysis of conditional mutations in the Saccharomyces cerevisiae MLH1 gene in mismatch repair and in meiotic crossing over." Genetics 160(3): 909-921.

6. Argueso, J. L., J. Wanat, Z. Gemici and E. Alani (2004). "Competing crossover pathways act during meiosis in Saccharomyces cerevisiae." Genetics 168(4): 1805-1816.

7. Baker, S. M., A. W. Plug, T. A. Prolla, C. E. Bronner, A. C. Harris, X. Yao, D. M. Christie, C. Monell, N. Arnheim, A. Bradley, T. Ashley and R. M. Liskay (1996). "Involvement of mouse Mlh1 in DNA mismatch repair and meiotic crossing over." Nat Genet 13(3): 336-342.

8. Ban, C., M. Junop and W. Yang (1999). "Transformation of MutL by ATP binding and hydrolysis: a switch in DNA mismatch repair." Cell 97(1): 85-97.

9. Bernstein, K. A., S. Gangloff and R. Rothstein (2010). "The RecQ DNA helicases in DNA repair." Annu Rev Genet 44: 393-417.

10. Bishop, D. K. and D. Zickler (2004). "Early decision; meiotic crossover interference prior to stable strand exchange and synapsis." Cell 117(1): 9-15.

11. Biswas, I., A. Yamamoto and P. Hsieh (1998). "Branch migration through DNA sequence heterology." J Mol Biol 279(4): 795-806.

12. Bizard, A. H. and I. D. Hickson (2014). "The dissolution of double Holliday junctions." Cold Spring Harb Perspect Biol 6(7): a016477.

13. Boddy, M. N., P. H. Gaillard, W. H. McDonald, P. Shanahan, J. R. Yates, 3rd and P. Russell (2001). "Mus81-Eme1 are essential components of a Holliday junction resolvase." Cell 107(4): 537-548.

14. Bzymek, M., N. H. Thayer, S. D. Oh, N. Kleckner and N. Hunter (2010). "Double Holliday junctions are intermediates of DNA break repair." Nature 464(7290): 937-941.

15. Castor, D., N. Nair, A. C. Declais, C. Lachaud, R. Toth, T. J. Macartney, D. M. Lilley, J. S. Arthur and J. Rouse (2013). "Cooperative control of holliday junction resolution and DNA repair by the SLX1 and MUS81-EME1 nucleases." Mol Cell 52(2): 221-233.

16. Charbonneau, N., R. Amunugama, C. Schmutte, K. Yoder and R. Fishel (2009). "Evidence that hMLH3 functions primarily in meiosis and in hMSH2-hMSH3 mismatch repair." Cancer Biol Ther 8(14): 1411-1420.

17. Chen, X. B., R. Melchionna, C. M. Denis, P. H. Gaillard, A. Blasina, I. Van de Weyer, M. N. Boddy, P. Russell, J. Vialard and C. H. McGowan (2001). "Human Mus81-associated endonuclease cleaves Holliday junctions in vitro." Mol Cell 8(5): 1117-1127.

18. Cho, W. K., C. Jeong, D. Kim, M. Chang, K. M. Song, J. Hanne, C. Ban, R. Fishel and J. B. Lee (2012). "ATP alters the diffusion mechanics of MutS on mismatched DNA." Structure 20(7): 1264-1274.

19. Ciccia, A., A. Constantinou and S. C. West (2003). "Identification and characterization of the human mus81-eme1 endonuclease." J Biol Chem 278(27): 25172-25178.

20. Ciccia, A. and S. J. Elledge (2010). "The DNA damage response: making it safe to play with knives." Mol Cell 40(2): 179-204.

21. Cordingley, M. G., R. B. Register, P. L. Callahan, V. M. Garsky and R. J. Colonno (1989). "Cleavage of small peptides in vitro by human rhinovirus 14 3C protease expressed in Escherichia coli." J Virol 63(12): 5037-5045.

22. D'Andrea, A. D. and M. Grompe (2003). "The Fanconi anaemia/BRCA pathway." Nat Rev Cancer 3(1): 23-34.

23. de los Santos, T., N. Hunter, C. Lee, B. Larkin, J. Loidl and N. M. Hollingsworth (2003). "The Mus81/Mms4 endonuclease acts independently of double-Holliday junction resolution to promote a distinct subset of crossovers during meiosis in budding yeast." Genetics 164(1): 81-94.

24. Dendouga, N., H. Gao, D. Moechars, M. Janicot, J. Vialard and C. H. McGowan (2005). "Disruption of murine Mus81 increases genomic instability and DNA damage sensitivity but does not promote tumorigenesis." Mol Cell Biol 25(17): 7569-7579.

25. Deriano, L. and D. B. Roth (2013). "Modernizing the nonhomologous end-joining repertoire: alternative and classical NHEJ share the stage." Annu Rev Genet 47: 433-455.

26. Difilippantonio, M. J., J. Zhu, H. T. Chen, E. Meffre, M. C. Nussenzweig, E. E. Max, T. Ried and A. Nussenzweig (2000). "DNA repair protein Ku80 suppresses chromosomal aberrations and malignant transformation." Nature 404(6777): 510- 514.

27. Doniger, J., R. C. Warner and I. Tessma (1973). "Role of circular dimer DNA in the primary recombination mechanism of bacteriophage S13." Nat New Biol 242(114): 9-12.

28. Duckett, D. R., A. I. Murchie, S. Diekmann, E. von Kitzing, B. Kemper and D. M. Lilley (1988). "The structure of the Holliday junction, and its resolution." Cell 55(1): 79-89.

29. Ellis, N. A., J. Groden, T. Z. Ye, J. Straughen, D. J. Lennon, S. Ciocci, M. Proytcheva and J. German (1995). "The Bloom's syndrome gene product is homologous to RecQ helicases." Cell 83(4): 655-666.

30. Fekairi, S., S. Scaglione, C. Chahwan, E. R. Taylor, A. Tissier, S. Coulon, M. Q. Dong, C. Ruse, J. R. Yates, 3rd, P. Russell, R. P. Fuchs, C. H. McGowan and P. H. Gaillard (2009). "Human SLX4 is a Holliday junction resolvase subunit that binds multiple DNA repair/recombination endonucleases." Cell 138(1): 78-89.

31. Ferguson, D. O. and W. K. Holloman (1996). "Recombinational repair of gaps in DNA is asymmetric in Ustilago maydis and can be explained by a migrating D- loop model." Proc Natl Acad Sci U S A 93(11): 5419-5424. 84

32. Fishel, R. (2015). "Mismatch repair." J Biol Chem 290(44): 26395-26403.

33. Flores-Rozas, H. and R. D. Kolodner (1998). "The Saccharomyces cerevisiae MLH3 gene functions in MSH3-dependent suppression of frameshift mutations." Proc Natl Acad Sci U S A 95(21): 12404-12409.

34. Gorman, J., A. Chowdhury, J. A. Surtees, J. Shimada, D. R. Reichman, E. Alani and E. C. Greene (2007). "Dynamic basis for one-dimensional DNA scanning by the mismatch repair complex Msh2-Msh6." Mol Cell 28(3): 359-370.

35. Gradia, S., S. Acharya and R. Fishel (1997). "The human mismatch recognition complex hMSH2-hMSH6 functions as a novel molecular switch." Cell 91(7): 995-1005.

36. Gradia, S., D. Subramanian, T. Wilson, S. Acharya, A. Makhov, J. Griffith and R. Fishel (1999). "hMSH2-hMSH6 forms a hydrolysis-independent sliding clamp on mismatched DNA." Mol Cell 3(2): 255-261.

37. Guarne, A. (2012). "The functions of MutL in mismatch repair: the power of multitasking." Prog Mol Biol Transl Sci 110: 41-70.

38. Hall, M. C., P. V. Shcherbakova, J. M. Fortune, C. H. Borchers, J. M. Dial, K. B. Tomer and T. A. Kunkel (2003). "DNA binding by yeast Mlh1 and Pms1: implications for DNA mismatch repair." Nucleic Acids Res 31(8): 2025-2034.

39. Hall, M. C., H. Wang, D. A. Erie and T. A. Kunkel (2001). "High affinity cooperative DNA binding by the yeast Mlh1-Pms1 heterodimer." J Mol Biol 312(4): 637-647.

40. Hassold, T., H. Hall and P. Hunt (2007). "The origin of human aneuploidy: where we have been, where we are going." Hum Mol Genet 16 Spec No. 2: R203-208.

41. Hassold, T., S. Sherman and P. A. Hunt (1995). "The origin of trisomy in humans." Prog Clin Biol Res 393: 1-12.

42. Heyer, W. D., K. T. Ehmsen and J. Liu (2010). "Regulation of homologous recombination in eukaryotes." Annu Rev Genet 44: 113-139.

43. Hillers, K. J. (2004). "Crossover interference." Curr Biol 14(24): R1036-1037.

44. Hoffmann, E. R., P. V. Shcherbakova, T. A. Kunkel and R. H. Borts (2003). "MLH1 mutations differentially affect meiotic functions in Saccharomyces cerevisiae." Genetics 163(2): 515-526.

45. Holliday, R. (2007). "A mechanism for gene conversion in fungi." Genet Res 89(5-6): 285-307. 85

46. Hollingsworth, N. M., L. Ponte and C. Halsey (1995). "MSH5, a novel MutS homolog, facilitates meiotic reciprocal recombination between homologs in Saccharomyces cerevisiae but not mismatch repair." Genes Dev 9(14): 1728- 1739.

47. Hunter, N. and R. H. Borts (1997). "Mlh1 is unique among mismatch repair proteins in its ability to promote crossing-over during meiosis." Genes Dev 11(12): 1573-1582.

48. Hyeon, C., J. Lee, J. Yoon, S. Hohng and D. Thirumalai (2012). "Hidden complexity in the isomerization dynamics of Holliday junctions." Nat Chem 4(11): 907-914.

49. Ip, S. C., U. Rass, M. G. Blanco, H. R. Flynn, J. M. Skehel and S. C. West (2008). "Identification of Holliday junction resolvases from humans and yeast." Nature 456(7220): 357-361.

50. Iwasaki, H., M. Takahagi, T. Shiba, A. Nakata and H. Shinagawa (1991). "Escherichia coli RuvC protein is an endonuclease that resolves the Holliday structure." Embo j 10(13): 4381-4389.

51. Jasin, M. and J. E. Haber (2016). "The democratization of gene editing: Insights from site-specific cleavage and double-strand break repair." DNA Repair (Amst) 44: 6-16.

52. Jeong, C., W. K. Cho, K. M. Song, C. Cook, T. Y. Yoon, C. Ban, R. Fishel and J. B. Lee (2011). "MutS switches between two fundamentally distinct clamps during mismatch repair." Nat Struct Mol Biol 18(3): 379-385.

53. Johnson, F. B., D. B. Lombard, N. F. Neff, M. A. Mastrangelo, W. Dewolf, N. A. Ellis, R. A. Marciniak, Y. Yin, R. Jaenisch and L. Guarente (2000). "Association of the Bloom syndrome protein with topoisomerase IIIalpha in somatic and meiotic cells." Cancer Res 60(5): 1162-1167.

54. Jones, G. H. (1984). "The control of chiasma distribution." Symp Soc Exp Biol 38: 293-320.

55. Joo, C., S. A. McKinney, D. M. Lilley and T. Ha (2004). "Exploring rare conformational species and ionic effects in DNA Holliday junctions using single- molecule spectroscopy." J Mol Biol 341(3): 739-751.

56. Kadyrov, F. A., L. Dzantiev, N. Constantin and P. Modrich (2006). "Endonucleolytic function of MutLalpha in human mismatch repair." Cell 126(2): 297-308.

57. Kadyrov, F. A., S. F. Holmes, M. E. Arana, O. A. Lukianova, M. O'Donnell, T. A. Kunkel and P. Modrich (2007). "Saccharomyces cerevisiae MutLalpha is a mismatch repair endonuclease." J Biol Chem 282(51): 37181-37190.

58. Karymov, M., D. Daniel, O. F. Sankey and Y. L. Lyubchenko (2005). "Holliday junction dynamics and branch migration: single-molecule analysis." Proc Natl Acad Sci U S A 102(23): 8186-8191.

59. Karymov, M. A., M. Chinnaraj, A. Bogdanov, A. R. Srinivasan, G. Zheng, W. K. Olson and Y. L. Lyubchenko (2008). "Structure, dynamics, and branch migration of a DNA Holliday junction: a single-molecule fluorescence and modeling study." Biophys J 95(9): 4372-4383.

60. Kass, E. M. and M. Jasin (2010). "Collaboration and competition between DNA double-strand break repair pathways." FEBS Lett 584(17): 3703-3708.

61. Keeney, S., C. N. Giroux and N. Kleckner (1997). "Meiosis-specific DNA double-strand breaks are catalyzed by Spo11, a member of a widely conserved protein family." Cell 88(3): 375-384.

62. Klapholz, S., C. S. Waddell and R. E. Esposito (1985). "The role of the SPO11 gene in meiotic recombination in yeast." Genetics 110(2): 187-216.

63. Kleckner, N., D. Zickler, G. H. Jones, J. Dekker, R. Padmore, J. Henle and J. Hutchinson (2004). "A mechanical basis for chromosome function." Proc Natl Acad Sci U S A 101(34): 12592-12597.

64. Kolas, N. K., A. Svetlanov, M. L. Lenzi, F. P. Macaluso, S. M. Lipkin, R. M. Liskay, J. Greally, W. Edelmann and P. E. Cohen (2005). "Localization of MMR proteins on meiotic chromosomes in mice indicates distinct functions during prophase I." J Cell Biol 171(3): 447-458.

65. Korhonen, M. K., T. E. Raevaara, H. Lohi and M. Nystrom (2007). "Conditional nuclear localization of hMLH3 suggests a minor activity in mismatch repair and supports its role as a low-risk gene in HNPCC." Oncol Rep 17(2): 351-354.

66. Kosinski, J., G. Plotz, A. Guarne, J. M. Bujnicki and P. Friedhoff (2008). "The PMS2 subunit of human MutLalpha contains a metal ion binding domain of the iron-dependent repressor protein family." J Mol Biol 382(3): 610-627.

67. Kurdzo, E. L. and D. S. Dawson (2015). "Centromere pairing--tethering partner chromosomes in meiosis I." Febs j 282(13): 2458-2470.

68. Lam, I. and S. Keeney (2014). "Mechanism and regulation of meiotic recombination initiation." Cold Spring Harb Perspect Biol 7(1): a016634.

69. Lee, C. S., R. W. Davis and N. Davidson (1970). "A physical study by electron microscopy of the terminally repetitious, circularly permuted DNA from the coliphage particles of Escherichia coli 15." Journal of Molecular Biology 48(1): 1-22.

70. Lenzi, M. L., J. Smith, T. Snowden, M. Kim, R. Fishel, B. K. Poulos and P. E. Cohen (2005). "Extreme heterogeneity in the molecular events leading to the establishment of chiasmata during meiosis i in human oocytes." Am J Hum Genet 76(1): 112-127.

71. Lieber, M. R. (2010). "The mechanism of double-strand DNA break repair by the nonhomologous DNA end-joining pathway." Annu Rev Biochem 79: 181-211.

72. Lipkin, S. M., P. B. Moens, V. Wang, M. Lenzi, D. Shanmugarajah, A. Gilgeous, J. Thomas, J. Cheng, J. W. Touchman, E. D. Green, P. Schwartzberg, F. S. Collins and P. E. Cohen (2002). "Meiotic arrest and aneuploidy in MLH3- deficient mice." Nat Genet 31(4): 385-390.

73. Liu, J., J. Hanne, B. M. Britton, J. Bennett, D. Kim, J. B. Lee and R. Fishel (2016). "Cascading MutS and MutL sliding clamps control DNA diffusion to activate mismatch repair." Nature 539(7630): 583-587.

74. Lushnikov, A. Y., A. Bogdanov and Y. L. Lyubchenko (2003). "DNA Recombination: HOLLIDAY JUNCTIONS DYNAMICS AND BRANCH MIGRATION." Journal of Biological Chemistry 278(44): 43130-43134.

75. Mahaney, B. L., K. Meek and S. P. Lees-Miller (2009). "Repair of ionizing radiation-induced DNA double-strand breaks by non-homologous end-joining." Biochem J 417(3): 639-650.

76. Mankouri, H. W., T. M. Ashton and I. D. Hickson (2011). "Holliday junction- containing DNA structures persist in cells lacking Sgs1 or Top3 following exposure to DNA damage." Proc Natl Acad Sci U S A 108(12): 4944-4949.

77. Masson, J. Y., A. A. Davies, N. Hajibagheri, E. Van Dyck, F. E. Benson, A. Z. Stasiak, A. Stasiak and S. C. West (1999). "The meiosis-specific recombinase hDmc1 forms ring structures and interacts with hRad51." Embo j 18(22): 6552- 6560.

78. Masson, J. Y. and S. C. West (2001). "The Rad51 and Dmc1 recombinases: a non-identical twin relationship." Trends Biochem Sci 26(2): 131-136.

79. McKinney, S. A., A. C. Declais, D. M. Lilley and T. Ha (2003). "Structural dynamics of individual Holliday junctions." Nat Struct Biol 10(2): 93-97.

80. McKinney, S. A., A. D. Freeman, D. M. Lilley and T. Ha (2005). "Observing spontaneous branch migration of Holliday junctions one step at a time." Proc Natl Acad Sci U S A 102(16): 5715-5720.

81. Miki, Y., J. Swensen, D. Shattuck-Eidens, P. A. Futreal, K. Harshman, S. Tavtigian, Q. Liu, C. Cochran, L. M. Bennett, W. Ding and et al. (1994). "A strong candidate for the breast and ovarian cancer susceptibility gene BRCA1." Science 266(5182): 66-71.

82. Moens, P. B., N. K. Kolas, M. Tarsounas, E. Marcon, P. E. Cohen and B. Spyropoulos (2002). "The time course and chromosomal localization of recombination-related proteins at meiosis in the mouse are compatible with models that can resolve the early DNA-DNA interactions without reciprocal recombination." J Cell Sci 115(Pt 8): 1611-1622.

83. Mullen, J. R., V. Kaliraman, S. S. Ibrahim and S. J. Brill (2001). "Requirement for three novel protein complexes in the absence of the Sgs1 DNA helicase in Saccharomyces cerevisiae." Genetics 157(1): 103-118.

84. Mulrooney, S. B., R. A. Fishel, J. A. Hejna and R. C. Warner (1996). "Preparation of figure 8 and cruciform DNAs and their use in studies of the kinetics of branch migration." J Biol Chem 271(16): 9648-9659.

85. Nassif, N., J. Penney, S. Pal, W. R. Engels and G. B. Gloor (1994). "Efficient copying of nonhomologous sequences from ectopic sites via P-element-induced gap repair." Mol Cell Biol 14(3): 1613-1625.

86. Nishant, K. T., C. Chen, M. Shinohara, A. Shinohara and E. Alani (2010). "Genetic analysis of baker's yeast Msh4-Msh5 reveals a threshold crossover level for meiotic viability." PLoS Genet 6(8).

87. Nishant, K. T., A. J. Plys and E. Alani (2008). "A mutation in the putative MLH3 endonuclease domain confers a defect in both mismatch repair and meiosis in Saccharomyces cerevisiae." Genetics 179(2): 747-755.

88. Novak, J. E., P. B. Ross-Macdonald and G. S. Roeder (2001). "The budding yeast Msh4 protein functions in chromosome synapsis and the regulation of crossover distribution." Genetics 158(3): 1013-1025.

89. Orr-Weaver, T. L. and J. W. Szostak (1983). "Yeast recombination: the association between double-strand gap repair and crossing-over." Proc Natl Acad Sci U S A 80(14): 4417-4421.

90. Ortiz-Lombardia, M., A. Gonzalez, R. Eritja, J. Aymami, F. Azorin and M. Coll (1999). "Crystal structure of a DNA Holliday junction." Nat Struct Biol 6(10): 913-917. 89

91. Panyutin, I. G., I. Biswas and P. Hsieh (1995). "A pivotal role for the structure of the Holliday junction in DNA branch migration." Embo j 14(8): 1819-1826.

92. Panyutin, I. G. and P. Hsieh (1994). "The kinetics of spontaneous DNA branch migration." Proc Natl Acad Sci U S A 91(6): 2021-2025.

93. Pluciennik, A., L. Dzantiev, R. R. Iyer, N. Constantin, F. A. Kadyrov and P. Modrich (2010). "PCNA function in the activation and strand direction of MutLalpha endonuclease in mismatch repair." Proc Natl Acad Sci U S A 107(37): 16066-16071.

94. Ranjha, L., R. Anand and P. Cejka (2014). "The Saccharomyces cerevisiae Mlh1- Mlh3 heterodimer is an endonuclease that preferentially binds to Holliday junctions." J Biol Chem 289(9): 5674-5686.

95. Rankin, S. (2015). "Complex elaboration: making sense of meiotic cohesin dynamics." Febs j 282(13): 2426-2443.

96. Rankin, S. and D. S. Dawson (2016). "Recent advances in cohesin biology." F1000Res 5.

97. Rogacheva, M. V., C. M. Manhart, C. Chen, A. Guarne, J. Surtees and E. Alani (2014). "Mlh1-Mlh3, a meiotic crossover and DNA mismatch repair factor, is a Msh2-Msh3-stimulated endonuclease." J Biol Chem 289(9): 5664-5673.

98. Ross-Macdonald, P. and G. S. Roeder (1994). "Mutation of a meiosis-specific MutS homolog decreases crossing over but not mismatch correction." Cell 79(6): 1069-1080.

99. Rothkamm, K., I. Kruger, L. H. Thompson and M. Lobrich (2003). "Pathways of DNA double-strand break repair during the mammalian cell cycle." Mol Cell Biol 23(16): 5706-5715.

100. Routzahn, K. M. and D. S. Waugh (2002). "Differential effects of supplementary affinity tags on the solubility of MBP fusion proteins." J Struct Funct Genomics 2(2): 83-92.

101. Santucci-Darmanin, S., D. Walpita, F. Lespinasse, C. Desnuelle, T. Ashley and V. Paquis-Flucklinger (2000). "MSH4 acts in conjunction with MLH1 during mammalian meiosis." Faseb j 14(11): 1539-1547.

102. Savitsky, K., A. Bar-Shira, S. Gilad, G. Rotman, Y. Ziv, L. Vanagaite, D. A. Tagle, S. Smith, T. Uziel, S. Sfez, M. Ashkenazi, I. Pecker, M. Frydman, R. Harnik, S. R. Patanjali, A. Simmons, G. A. Clines, A. Sartiel, R. A. Gatti, L. Chessa, O. Sanal, M. F. Lavin, N. G. Jaspers, A. M. Taylor, C. F. Arlett, T. Miki, S. M. Weissman, M. Lovett, F. S. Collins and Y. Shiloh (1995). "A single ataxia 90

telangiectasia gene with a product similar to PI-3 kinase." Science 268(5218): 1749-1753.

103. Sharples, G. J. and R. G. Lloyd (1991). "Resolution of Holliday junctions in Escherichia coli: identification of the ruvC gene product as a 19-kilodalton protein." J Bacteriol 173(23): 7711-7715.

104. Simsek, D. and M. Jasin (2010). "Alternative end-joining is suppressed by the canonical NHEJ component Xrcc4-ligase IV during chromosomal translocation formation." Nat Struct Mol Biol 17(4): 410-416.

105. Snowden, T., S. Acharya, C. Butz, M. Berardini and R. Fishel (2004). "hMSH4-hMSH5 recognizes Holliday Junctions and forms a meiosis-specific sliding clamp that embraces homologous chromosomes." Mol Cell 15(3): 437- 451.

106. Su, S. S. and P. Modrich (1986). "Escherichia coli mutS-encoded protein binds to mismatched DNA base pairs." Proc Natl Acad Sci U S A 83(14): 5057- 5061.

107. Subramanian, V. V. and A. Hochwagen (2014). "The meiotic checkpoint network: step-by-step through meiotic prophase." Cold Spring Harb Perspect Biol 6(10): a016675.

108. Symington, L. S. (2014). "End resection at double-strand breaks: mechanism and regulation." Cold Spring Harb Perspect Biol 6(8).

109. Symington, L. S. and J. Gautier (2011). "Double-strand break end resection and repair pathway choice." Annu Rev Genet 45: 247-271.

110. Tavtigian, S. V., J. Simard, J. Rommens, F. Couch, D. Shattuck-Eidens, S. Neuhausen, S. Merajver, S. Thorlacius, K. Offit, D. Stoppa-Lyonnet, C. Belanger, R. Bell, S. Berry, R. Bogden, Q. Chen, T. Davis, M. Dumont, C. Frye, T. Hattier, S. Jammulapati, T. Janecki, P. Jiang, R. Kehrer, J. F. Leblanc, J. T. Mitchell, J. McArthur-Morrison, K. Nguyen, Y. Peng, C. Samson, M. Schroeder, S. C. Snyder, L. Steele, M. Stringfellow, C. Stroup, B. Swedlund, J. Swense, D. Teng, A. Thomas, T. Tran, M. Tranchant, J. Weaver-Feldhaus, A. K. Wong, H. Shizuya, J. E. Eyfjord, L. Cannon-Albright, M. Tranchant, F. Labrie, M. H. Skolnick, B. Weber, A. Kamb and D. E. Goldgar (1996). "The complete BRCA2 gene and mutations in chromosome 13q-linked kindreds." Nat Genet 12(3): 333-337.

111. Thompson, B. J., C. Escarmis, B. Parker, W. C. Slater, J. Doniger, I. Tessman and R. C. Warner (1975). "Figure-8 configuration of dimers of S13 and phiX174 replicative form DNA." J Mol Biol 91(4): 409-419.

112. van Oers, J. M., S. Roa, U. Werling, Y. Liu, J. Genschel, H. Hou, Jr., R. S. Sellers, P. Modrich, M. D. Scharff and W. Edelmann (2010). "PMS2 endonuclease activity has distinct biological functions and is essential for genome maintenance." Proc Natl Acad Sci U S A 107(30): 13384-13389.

113. Walker, J. E., M. Saraste, M. J. Runswick and N. J. Gay (1982). "Distantly related sequences in the alpha- and beta-subunits of ATP synthase, myosin, kinases and other ATP-requiring enzymes and a common nucleotide binding fold." The EMBO Journal 1(8): 945-951.

114. Wang, T. F., N. Kleckner and N. Hunter (1999). "Functional specificity of MutL homologs in yeast: evidence for three Mlh1-based heterocomplexes with distinct roles during meiosis in recombination and mismatch correction." Proc Natl Acad Sci U S A 96(24): 13914-13919.

115. Wechsler, T., S. Newman and S. C. West (2011). "Aberrant chromosome morphology in human cells defective for Holliday junction resolution." Nature 471(7340): 642-646.

116. Welsh, K. M., A. L. Lu, S. Clark and P. Modrich (1987). "Isolation and characterization of the Escherichia coli mutH gene product." J Biol Chem 262(32): 15624-15629.

117. West, S. C. (1997). "Processing of recombination intermediates by the RuvABC proteins." Annu Rev Genet 31: 213-244.

118. Wu, L. and I. D. Hickson (2006). "DNA helicases required for homologous recombination and repair of damaged replication forks." Annu Rev Genet 40: 279-306.

119. Wyatt, H. D., S. Sarbajna, J. Matos and S. C. West (2013). "Coordinated actions of SLX1-SLX4 and MUS81-EME1 for Holliday junction resolution in human cells." Mol Cell 52(2): 234-247.

120. Wyatt, H. D. and S. C. West (2014). "Holliday junction resolvases." Cold Spring Harb Perspect Biol 6(9): a023192.

121. Wyatt, H. D. M. and S. C. West (2014). "Holliday Junction Resolvases." Cold Spring Harbor Perspectives in Biology 6(9): a023192.

122. Yin, J., A. Sobeck, C. Xu, A. R. Meetei, M. Hoatlin, L. Li and W. Wang (2005). "BLAP75, an essential component of Bloom's syndrome protein complexes that maintain genome integrity." Embo j 24(7): 1465-1476.

123. Young, C. L., Z. T. Britton and A. S. Robinson (2012). "Recombinant protein expression and purification: a comprehensive review of affinity tags and microbial applications." Biotechnol J 7(5): 620-634.

124. Zakharyevich, K., S. Tang, Y. Ma and N. Hunter (2012). "Delineation of joint molecule resolution pathways in meiosis identifies a crossover-specific resolvase." Cell 149(2): 334-347.

125. Zhang, Y. and M. Jasin (2011). "An essential role for CtIP in chromosomal translocation formation through an alternative end-joining pathway." Nat Struct Mol Biol 18(1): 80-84.

126. Zickler, D. and N. Kleckner (2015). "Recombination, Pairing, and Synapsis of Homologs during Meiosis." Cold Spring Harb Perspect Biol 7(6).