Colorful seashells: Identification of haem pathway genes Title associated with the synthesis of porphyrin shell color in marine snails

Williams, Suzanne T.; Lockyer, Anne E.; Dyal, Patricia; Author(s) Nakano, Tomoyuki; Churchill, Celia K. C.; Speiser, Daniel I.

Citation Ecology and Evolution (2017), 7(23): 10379-10397

Issue Date 2017-12

URL http://hdl.handle.net/2433/259324

© 2017 The Authors. Ecology and Evolution published by John Wiley & Sons Ltd. This is an open access article under the Right terms of the Creative Commons Attribution License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited.

Type Journal Article

Textversion publisher

Kyoto University

Received: 4 August 2017 | Revised: 19 September 2017 | Accepted: 20 September 2017 DOI: 10.1002/ece3.3552

ORIGINAL RESEARCH

Colorful seashells: Identification of haem pathway genes associated with the synthesis of porphyrin shell color in marine snails

Suzanne T. Williams1 | Anne E. Lockyer2 | Patricia Dyal3 | Tomoyuki Nakano4 | Celia K. C. Churchill5 | Daniel I. Speiser6

1Department of Life Sciences, Natural History Museum, London, UK Abstract 2Institute of Environment, Health and Very little is known about the evolution of molluskan shell pigments, although Societies, Brunel University London, Uxbridge, Mollusca is a highly diverse, species rich, and ecologically important group of animals UK comprised of many brightly colored taxa. The marine snail genus Clanculus was cho- 3Core Research Laboratories, Natural History Museum, London, UK sen as an exceptional model for studying the evolution of shell color, first, because in 4Seto Marine Biological Laboratory, Kyoto Clanculus margaritarius and Clanculus pharaonius both shell and foot share similar University, Nishimuro, Wakayama Prefecture, Japan colors and patterns; and second, because recent studies have identified the pigments, 5Marine Science Institute, University of trochopuniceus (pink-­red), and trochoxouthos (yellow-­brown), both comprised of California, Santa Barbara, CA, USA uroporphyrin I and uroporphyrin III, in both shell and colored foot tissue of these spe- 6 Department of Biological Sciences, University cies. These unusual characteristics provide a rare opportunity to identify the genes of South Carolina, Columbia, SC, USA involved in color production because, as the same pigments occur in the shell and Correspondence colored foot tissue, the same color-­related genes may be simultaneously expressed in Suzanne T. Williams, Department of Life Sciences, Natural History Museum, London, both mantle (which produces the shell) and foot tissue. In this study, the transcrip- UK. tomes of these two Clanculus species along with a third species, Calliostoma zizyphi- Email: [email protected] num, were sequenced to identify genes associated with the synthesis of porphyrins. Funding information Calliostoma zizyphinum was selected as a negative control as trochopuniceus and tro- National Science Foundation, Grant/Award Number: CNS-0960316, DEB-1355230, choxouthos were not found to occur in this species. As expected, genes necessary for EAGER-10457 and MRSEC DMR-1121053; the production of uroporphyrin I and III were found in all three species, but gene King Abdullah University of Science and Technology, Grant/Award Number: 59130357 ­expression levels were consistent with synthesis of uroporphyrins in mantle and and CRG-1-2012-BER-002; Life Sciences colored foot tissue only in Clanculus. These results are relevant not only to under- Department at the Natural History Museum, London; Todd Oakley and the Oakley standing the evolution of shell pigmentation in Clanculus but also to understanding Laboratory at the University of California the evolution of color in other species with uroporphyrin pigmentation, including Santa Barbara; UCSB’s Center for Scientific Computing at the CNSI and MRL (mainly marine) mollusks soft tissues and shells, annelid and platyhelminth worms, and some bird feathers.

KEYWORDS color, heme, mollusk, pigment, porphyrin, shell, uroporphyrin

This is an open access article under the terms of the Creative Commons Attribution License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited. © 2017 The Authors. Ecology and Evolution published by John Wiley & Sons Ltd.

 www.ecolevol.org | 10379 Ecology and Evolution. 2017;7:10379–10397. 10380 | WILLIAMS et al.

1 | BACKGROUND The molecular processes involved in the synthesis of shell color have been studied in some detail in only a few mollusks. Generally, a Color and pattern are important features of morphological adaptive suite of potential genes have been identified that may have some con- variation and are often associated with crypsis, aposematism, and trol over shell pigmentation, although in most studies it is not possible mating displays (Ruxton, Sherratt, & Speed, 2004). Significant ad- to rule out that some of these genes may rather be involved in bio- vances have been made toward the characterization of pigments and mineralization (e.g., Bai, Zheng, Lin, Wang, & Li, 2013; Guan, Huang, & their biosynthetic pathways for plants, vertebrates, and certain inver- He, 2011; Lemer, Saulnier, Gueguen, & Planes, 2015; Qin, Liu, Zhang, tebrate groups (e.g., Braasch, Schartl, & Volff, 2007; Grotewold, 2006; Zhang, & Guo, 2007; Richards et al., 2013; Yuan, He, & Huang, 2012; Hodges & Derieg, 2009; Joron et al., 2006; Nijhout, 2010; Wittkopp Zou et al., 2014). A study on Haliotis asinina (abalone) showed that more & Beldade, 2009; Wittkopp, Williams, Selegue, & Carroll, 2003); how- than one-­quarter of the genes expressed in the mantle encode secreted ever, the molecular pathways leading to shell pigmentation have not proteins, indicating that hundreds of proteins may be contributing been completely elucidated for any mollusk (Mann & Jackson, 2014). to shell construction (Jackson et al., 2006). Only one of these genes The phylum Mollusca is highly diverse, species rich, ecologically im- was found to map precisely to gastropod shell pigmentation patterns portant, and abounding in colorful exemplars, so our lack of under- (Jackson, Worheide, & Degnan, 2007; Jackson et al., 2006), although standing about pigment evolution in this clade is a serious gap in our the pigment is unknown. Despite in-­depth molecular investigations knowledge of how color has evolved in the natural world (Williams, trying to determine the genes involved in color production, to date, 2017). no study has been able to completely elucidate the molecular pathway Most molluskan groups are immediately recognizable by their cal- used in shell pigmentation for mollusks (Mann & Jackson, 2014). careous shells, many of which are strongly pigmented. Mollusk shells The vetigastropod genus, Clanculus, and in particular the species are secreted by the outer fold of the mantle, and both pigmentation and C. margaritarius and C. pharaonius (Trochidae, Trochoidea), are suitable shell growth are under neurosecretory control (Boettiger, Ermentrout, models for studying the synthesis and evolution of molluskan shell color & Oster, 2009; Budd, McDougall, Green, & Degnan, 2014). Although (Figure 1) because their shell pigments are known. A recent study used shell color can be affected by food intake, and in some species may de- a combination of biochemical and multimodal spectroscopic methods pend entirely on diet (e.g., Ino, 1949, 1958; Leighton, 1961), breeding to identify pigments responsible for three predominant shell colors in studies in both bivalves and gastropods have shown that color varia- these species (Williams et al., 2016). Two pigments, trochopuniceus tion in many species is a heritable trait, and in some cases, inheritance and trochoxouthos, are responsible for the dominant colors of pink-­ patterns can be explained by variation at a single locus (e.g., Kobayashi, red and yellow-­brown, respectively, and traces of eumelanin are likely Kawahara, Hasakura, & Kijima, 2004; Liu, Wu, Zhao, Zhang, & Guo, responsible for black spots on the shells. Trochopuniceus and trochox- 2009). outhos are both comprised of uroporphyrin I and uroporphyrin III, but

FIGURE 1 Photographs of species used in this study. (a–c) Clanculus margaritarius C. (a, b) Two views of a shell of Clanculus margaritarius C (specimen #2). Note that this specimen is subadult. (c) Colored foot of a live animal. Note that the color and pattern are the same as found on the shell. (d, e) Two views of a Clanculus pharaonius shell (specimen #4). (f–h) Calliostoma zizyphinum. (f, g) Two views of a shell of Calliostoma zizyphinum (specimen #2). (h) Living animal showing foot color (not the same specimen). Note that the foot color and pattern in this species do not match the shell. Scale bars for Clanculus spp are in mm. Scale bar for Calliostoma is 1 cm WILLIAMS et al. | 10381 likely differ in the substituents on the porphyrin ring, which can affect biochemical pathways involved in pigment production are known. In color. The substituents are not known. The same porphyrin pigments particular, uroporphyrin I and uroporphyrin III are produced in several were also found in colored foot tissue from these species. Conversely, forms of porphyria, a metabolic disorder affecting humans, and their only traces of uroporphyrin were found in the shell of a third species, synthesis has been well studied (Layer, Reichelt, Jahn, & Heinz, 2010). Calliostoma zizyphinum (Calliostomatidae:Trochoidea), despite the fact They are synthesized as side products of the evolutionarily ancient that it is from the same superfamily and has superficially similar col- heme pathway, which is conserved among metazoans and has been oration, suggesting that shell color in this species is due to different well characterized in humans, Mus and Drosophila (Ajioka, Phillips, & shell pigments (Williams et al., 2016). The congruence of colors arising Kushner, 2006; Heinemann, Jahn, & Jahn, 2008; Figure 2). Normally in from different pigments suggests that there may be selective pressures the eight-­step haem pathway (Figure 2), the third enzyme porphobilino- leading to convergent evolution in these taxa (Williams et al., 2016). gen deaminase (PBGD) condenses two molecules of porphobilinogen Apart from Clanculus, uroporphyrin pigments are also responsible for to form hydroxymethylbilane (HMB), which is highly unstable. The coloration of soft tissues and shells of other (mostly marine) mollusks fourth enzyme in the pathway, uroporphyrinogen-­III synthase (UROS) (reviewed in Williams, 2017), the integument of some annelids (Fox, then converts HMB to uroporphyrinogen III by closing the linear tetra- 1979), and turaco bird feathers (Nicholas & Rimington, 1951). pyrrole molecule to form a ring (Ajioka et al., 2006). Uroporphyrin I is The identification of shell pigments offers an enormous advan- produced when activity of UROS is diminished (Warner, Yoo, Roberts, tage when searching for genes involved in color synthesis, as some & Desnick, 1992) or the activity of PBGD is increased (Siersema, de

Uroporphyrinogen decarboxylase 5. (UROD) + O E.C. 4.1.1.37 O OH glycinesuccinyl-CoA HO OH 1. Aminolevulinic acid O synthase OH (ALAS) NH N E.C. 2.3.1.37 O O Coproporphyrinogen III O (Coprogen III) N HN OH HN2 OH HO O O δ-Aminolevulinic acid O (ALA) 2. Delta-aminolevulinic acid dehydratase (ALAD) HO OH E.C. 4.2.1.24 O Coproporphyrinogen oxidase Uroporphyrin I 6. (CPOX) (Uro I) NH NH2 E.C. 1.3.3.3 O

HO O HO Porphobilinogen (PBG) Protoporphyrinogen IX 3. Porphobilinogen deaminase (Protogen IX) (PBGD) EC 2.5.1.61 O O OH HO OH 7. O Protoporphyrinogen oxidase OH (PPOX) NH HN E.C. 1.3.3.4 process O CH2 CH3 O CH2 NH HN OH HO CH3 O O NH HN OH Protoporphyrin IX Uroporphyrinogen I (Proto IX) HO OH NN (Urogen I) O Hydroxymethylbilane CH3 CH3 (HMB) 4. Uroporphyrinogen III synthase (UROS) E.C. 4.2.1.75 O OH O OH OH OH O OH OH O Ferrochelatase O O OH 8. (FECH) HO OH O O E.C. 4.99.1.1 O HO NH N O NH HN O N HN OH OH NH HN HO O O Haem O O HO O OH OH O OH O HO Uroporphyrinogen III Uroporphyrin III (Urogen III) 5. (Uro III)

FIGURE 2 Haem synthetic pathway. The eight enzymatic reactions needed to produce haem and the nonenzymatic side paths resulting in the synthesis of uroporphyrin I and uroporphyrin III pigments (chemical structures marked with a black box). Light blue arrows indicate nonenzymatic processes. Enzyme names are in red font, metabolite names are in black font. Enzyme Commission (EC) numbers provide a numerical classification scheme for enzymes, based on the chemical reactions they catalyze 10382 | WILLIAMS et al.

Rooij, Edixhoven-­Bosdijk, & Wilson, 1990) leading to an accumulation 2 | MATERIALS AND METHODS of HMB. Excess HMB can then be converted into uroporphyrinogen I by the nonenzymatic, spontaneous closure of the ring (Warner et al., 2.1 | Samples 1992). Uroporphyrinogen I can then be oxidised to form uroporphy- rin I (Figure 2; Layer et al., 2010). Uroporphyrin III is produced by ox- Clanculus pharaonius were collected from Saudi Arabia, C. margaritar- idation of uroporphyrinogen III that builds up when there is reduced ius were collected from two localities in Japan, and Calliostoma zizyphi- activity of the fifth enzyme uroporphyrinogen decarboxylase (UROD), num specimens came from the United Kingdom (see Table 1 for list of although in humans iron and certain forms of cytochrome P-­450 may specimens). In Williams et al. (2016), the authors noticed small differ- also enhance the oxidation of uroporphyrinogen III to uroporphyrin ences in shell sculpture and pattern in specimens nominally described III (Ponka, 1997; Figure 2). The overproduction of intermediate me- as C. margaritarius and suggested that there may be two groups of tabolites δ-­aminolevulinic acid, porphobilinogen, and HMB can also uncertain specific status. Given concerns for the possibility of cryp- enhance the formation of uroporphyrin I, uroporphyrin III, and copro- tic species, part of the mitochondrial gene cytochrome oxidase was porphyrin III (Hibino, Petri, Buchs, & Ohtake, 2013; Piao, Kiatpapan, sequenced for C. margaritarius specimens #3, 6, 14, and 15 follow- Yamashita, & Murooka, 2004). In humans, regulation of the haem ing published methods (Williams & Ozawa, 2006) and compared with pathway occurs primarily at the first step catalyzed by aminolevulinic homologous transcripts for specimens #1 and 2 in order to confirm acid synthase (ALAS), the rate-­limiting enzyme, by downregulating its species identity. transcription, upregulating mRNA breakdown, blocking its uptake into mitochondria, and increasing breakdown of the protein (Besur, Hou, 2.2 | Transcriptome sequencing Schmeltzer, & Bonkovsky, 2014). We predict that in porphyrin-­producing tissues in Clanculus, the Total RNA was extracted from mantle edge tissue from specimens first enzyme in the pathway (ALAS) may be upregulated in tissue pro- of two C. margaritarius, one C. pharaonius and one Ca. zizyphinum, ducing uroporphyrin I and uroporphyrin III, but UROS or UROD will be and from colored tissue from the side of the foot of one specimen downregulated. Our prediction is based on information known about of C. margaritarius, which is also colored by porphyrins (Williams the metabolic disorders known generally as porphyrias. These disor- et al., 2016; Table 1). RNA was extracted using the RNeasy Fibrous ders arise from a deficiency in one of the eight enzymes in the haem Tissue Mini Kit (Qiagen) according to the manufacturer’s instructions. pathway and are usually inherited although some forms may be ac- Total RNA was quantified using a Qubit® 2.0 Fluorometer RNA assay quired, and environmental factors may play an important role (Balwani kit and the RNA integrity assessed on an Agilent 2200 Tapestation & Desnick, 2012). Uroporphyrins are produced in porphyrias with using a high sensitivity R6K Screen Tape. Gastropod mRNA was iso- decreased activity of PBGD, UROS, and UROD (Balwani & Desnick, lated using the Dynabeads® mRNA DIRECT™ Micro Kit (Ambion, Life 2012). Upregulation of ALAS has also been associated with increased Technologies) according to the 100 ng–1 μg total RNA samples proto- severity of particular types of porphyria that produce uroporphyrin col from the manufacturer. (To-­Figueras et al., 2011). We do not make a prediction about PBGD Illumina-­compatible indexed libraries were prepared for each tis- as both increased (Siersema et al., 1990) and decreased (Balwani & sue sample using the ScriptSeq™ v2 RNA-­Seq Library Preparation Kit Desnick, 2012) levels have been associated with uroporphyrin pro- from Epicentre (Epicentre Biotechnologies, Madison, WI, USA). The duction. Even though UROS and UROD might be downregulated, we libraries were size checked on an Agilent 2200 Tapestation with a still expect all eight genes in the haem pathway to be expressed in all Tapestation HS D1K kit and quantified using qPCR. The libraries were tissues irrespective of porphyrin production, because haem serves as loaded onto a MiSeq V2 500 cycle sequencing run taking one-­fifth of a precursor to cytochrome prosthetic groups which are necessary for a run according to the manufacturer’s instructions. The libraries for Ca. cell function (Layer et al., 2010). zizyphinum and the two C. margaritarius mantle tissue samples were In order to test this hypothesis, we used transcriptomics in com- then run additionally on a second MiSeq run. All libraries in each run bination with phylogenetically informed annotation (Speiser et al., were equimolar. 2014) to determine whether C. margaritarius, C. pharaonius, and Ca. zizyphinum express the enzymes necessary to produce uroporphyrin I 2.3 | Transcriptome assembly and uroporphyrin III. We then used qPCR to compare expression lev- els within all three species between three tissue types: mantle tissue, Transcriptomes were assembled using tools implemented in Galaxy, which is responsible for shell construction and potentially pigment an open-­source workflow management system (Blankenberg et al., production, colored foot tissue (in Clanculus only), and unpigmented 2010; Giardine et al., 2005; Goecks, Nekrutenko, & Taylor, 2010). columellar muscle tissue. Our expectations were that in Clanculus spe- Reads for the two separate sequencing runs were concatenated cies, UROS and UROD would be expressed at lower levels in tissue (where applicable). Filtering removed reads that were identical or dif- that produces porphyrins (mantle and colored foot), than tissue that fered at <3 bases. Further filtering using Trimmomatic (Lohse et al., does not produce porphyrins (columellar muscle), whereas the reverse 2012) implemented the initial ILLUMINACLIP step (with default op- might be expected for ALAS. We did not expect to necessarily observe tions selected), used a sliding window to trim reads (averaging across the same pattern in Ca. zizyphinum, which has unknown shell pigments. four bases and requiring an average quality score of 24), and then WILLIAMS et al. | 10383

TABLE 1 Sample details for Clanculus margaritarius, C. pharaonius, and Calliostoma zizyphinum

Species # Sampling locality Analyses

C. margaritarius C 1 Kitahama, Shirahama, Nishimuro-­gun, Wakayama Pref., HPLC for melanins in shell; confocal on shell (not Japan (CMAR.SHI.1) shown); transcriptome of mantle and foot tissue; COI GenBank accession number: KY200867 C. margaritarius A 2 Kitahama, Shirahama, Nishimuro-­gun, Wakayama Pref., HPLC for melanins in shell; confocal on shell; Japan (CMAR.SHI.2) transcriptome of mantle tissue. Note that this specimen is subadult. C. margaritarius A 3 Kitahama, Shirahama, Nishimuro-­gun, Wakayama Pref., Confocal on shell (not shown); EDS on shell; HPLC Japan (CMAR.SHI.3) for porphyrins in shell and foot tissue; PCR COI (=AB505297) C. margaritarius A 4 Kitahama, Shirahama, Nishimuro-­gun, Wakayama Pref., Laser ablation; qPCR Japan (CMAR.APR.1) C. margaritarius A 5 Kitahama, Shirahama, Nishimuro-­gun, Wakayama Pref., Laser ablation; UV-­visible spectrometry; qPCR Japan (CMAR.APR.2) C. margaritarius A 6 Fukushima, Saeki-­shi, Oita Pref., Japan (CMAR.FUG.1) HPLC foot (ethanol; not shown); PCR COI (=AB505297) C. margaritarius A 7 Fukushima, Saeki-­shi, Oita Pref., Japan (CMAR.FUG.2) Raman on shell; confocal on shell (not shown); UV and visible light photograph; laser ablation; NHMUK 20150502 C. margaritarius B 8 Not known – unlocalized NHMUK specimen (shell only) Confocal on shell (not shown); HPLC for melanins on shell C. margaritarius B 9 Not known – unlocalized NHMUK specimen (shell only) Confocal on shell (not shown); HPLC for porphyrins in shell C. margaritarius B 10 Not known – unlocalized NHMUK specimen (shell only) Confocal on shell; NHM EDS C. margaritarius B 11 Not known – unlocalized NHMUK specimen (shell only) UoM EDS; ToF-­SIMS; FTIR; Microfocus Synchrotron C. margaritarius B 12 Not known – unlocalized NHMUK specimen (shell only) Pigmented layer removed using EDTA; confocal on nacreous layers of shell (not shown); HPLC for porphyrins on dissolved pigment layer (not shown); control shell HPLC for melanins C. margaritarius B 13 Not known – unlocalized NHMUK specimen (shell only) Confocal on shell (not shown) C. margaritarius A 14 Kitahama, Shirahama, Nishimuro-­gun, Wakayama Pref., PCR COI (=AB505297) Japan (CMAR.SHI.4) C. margaritarius A 15 Kitahama, Shirahama, Nishimuro-­gun, Wakayama Pref., PCR COI (=AB505297) Japan (CMAR.SHI.5) C. pharaonius 1 Rose Reef, Thuwal, Saudi Arabia (CPHA.KAU.2) HPLC for porphyrins in foot; visible/UV photo- graph; transcriptome of mantle tissue. NHMUK 20150503 C. pharaonius 2 Rose Reef, Thuwal, Saudi Arabia (CPHA.KAU.6) HPLC for porphyrins in shell, qPCR C. pharaonius 3 Rose Reef, Thuwal, Saudi Arabia (CPHA.KAU.4) HPLC for melanins in shell, qPCR C. pharaonius 4 Rose Reef, Thuwal, Saudi Arabia (CPHA.KAU.1) Confocal on shell, qPCR C. pharaonius 5 Rose Reef, Thuwal, Saudi Arabia (CPHA.KAU.7) Laser ablation; UV-­visible spectrometry; qPCR C. pharaonius 6 Rose Reef, Thuwal, Saudi Arabia (CPHA.KAU.3) qPCR C. pharaonius 7 Rose Reef, Thuwal, Saudi Arabia (CPHA.KAU.5) qPCR Ca. zizyphinum 1 Shetland Islands, 60°14.9′N, 01°5.1′W, UK (CZIZ.SHT.1) Confocal on shell (data not shown); transcriptome of mantle tissue. NHMUK 20160315 Ca. zizyphinum 2 Shetland Islands, 60°14.9′N, 01°5.1′W, UK (CZIZ.SHT.2) HPLC for porphyrins in shell (not shown) Ca. zizyphinum 3 Shetland Islands, 60°14.9′N, 01°5.1′W, UK (CZIZ.SHT.q1) qPCR Ca. zizyphinum 4 Shetland Islands, 60°14.9′N, 01°5.1′W, UK (CZIZ.SHT.q2) qPCR Ca. zizyphinum 5 Shetland Islands, 60°14.9′N, 01°5.1′W, UK (CZIZ.SHT.q3) qPCR Ca. zizyphinum 6 Shetland Islands, 60°14.9′N, 01°5.1′W, UK (CZIZ.SHT.q4) qPCR

Specimen number, sampling locality, analyses undertaken in this study (red font) and in (Williams et al., 2016; black font). 10384 | WILLIAMS et al. removed all reads with a length of <30 bases. Transcriptomes were as- BLAST searches on to the precalculated gene trees using maximum sembled using Trinity (Grabherr et al., 2011), with default settings and likelihood. Hits from the transcriptomes were scored as potential or- a minimum contig length of 200 bases. Finally, ORFs were identified thologs of genes if they: (1) had an orthologous relationship to genes (for nucleotides and predicted amino acid sequences) using the pro- with well-­characterized functions and (2) fell on short branches that gram TransDecoder (Haas et al., 2013; predicted proteins >30 amino were in positions consistent with established relationships between acids or longer). Assembly statistics for transcriptomes are given in species. Apparent multiple hits were conservatively scored only once Table 2. Raw reads for all transcriptomes have been published online because without a completely sequenced genome it is not possible NCBI-­SRA SRP092238, SRP092881, and SRP092239. to tell whether these sequences represent different loci, different al- leles or isoforms of the same locus, or sequence or assembly errors. For comparison, we also performed BLASTx searches against all se- 2.4 | Identification of genes associated with quences on GenBank, recording the top score with an identified gene. pigment synthesis

We searched for potential orthologs of the eight genes in the haem 2.5 | Quantitative analysis of gene expression pathway using phylogenetically informed annotation (PIA), a tree-­ based approach for annotating transcriptomes and genomes (Speiser Total RNA was extracted from columellar, mantle, and colored foot et al., 2014). Briefly, PIA involves a set of precalculated gene trees tissue samples using the RNeasy Fibrous Tissue Mini Kit (Qiagen) ac- produced using tools for phylogenetic analysis by maximum likelihood cording to the manufacturer’s protocol from C. pharaonius (n = 6 indi- available in the Osiris package for Galaxy (Oakley et al., 2014). These viduals), C. margaritarius A (n = 2 individuals), and Ca. zizyphinum (n = 4 trees incorporated sequences from the predicted protein databases individuals, no colored foot tissue). This kit includes DNAse treatment associated with 29 fully sequenced genomes, including those from 24 to eliminate genomic DNA contamination. cDNA synthesis was car- metazoans, two choanoflagellates, and three fungi (see Speiser et al., ried out using 30 ng total RNA from each individual using QuantiTect 2014 for details). Each analysis also included “landmark” sequences Reverse Transcription Kit, (Qiagen) according to the manufacturer’s from GenBank, which represent genes that have been well character- protocol. This kit also has an integrated genomic DNA removal step ized functionally. The BLASTp algorithm searched translated versions prior to cDNA synthesis. of the transcriptomes using the same queries that were used to iden- Specific primers were designed to amplify the five haem genes tify sequences for the precalculated gene trees described above. For using Primer3Plus (Untergasser et al., 2007). One set of primers searches using BLASTp, the ten hits that had the lowest e-­value scores worked for both Clanculus species and a separate set of primers were were retained, provided that these e-­values were below 1e−4. Next, designed for Calliostoma (Table 3). We used 18S as the reference gene MAFFT-­profile (Katoh & Standley, 2013) was used to align the hits and the same amount of RNA (quantified by nanodrop) was used for from BLAST searches against the sequences that comprised the pre- each cDNA synthesis, with all giving very similar CT results for 18S. calculated gene trees. Finally, the evolutionary placement algorithm Primers were designed for 18S that worked on all species. (Berger, Krompass, & Stamatakis, 2011; Berger et al., 2010; imple- Two divergent sequences of PBGD easily separable by alignment of mented in RAxML; Stamatakis, 2014) was used to place hits from the amino acids were found in transcriptomes of C. pharaonius mantle and

TABLE 2 Assembly statistics for transcriptomes

Clanculus Clanculus margaritarius Clanculus margaritarius Clanculus margaritarius A Calliostoma Assembly statistics pharaonius mantle C #1 mantle C #1 foot #2 mantle zizyphinum mantle

Minimum contig length 201 201 201 201 201 Maximum contig length 12,989 10,772 12,734 10,772 10,772 Mean contig length 485.23 415.35 417 402.05 444.24 Standard deviation of 475.35 344.32 353.33 321.35 371.52 contig length Median contig length 332 307 307 298 323 N50 contig length 541 434 435 415 481 Number of contigs 90,248 113,249 129,021 85,061 118,165 Number of contigs ≥1 kb 6,884 5,090 5,967 3,547 6,761 Number of contigs in N50 20,970 30,436 34,360 23,060 30,427 Number of bases in all 43,791,415 47,038,272 53,801,440 34,198,859 52,494,157 contigs Number of bases in contigs 11,897,645 8,110,215 9,547,572 5,514,410 10,673,841 ≥1 kb GC Content of contigs (%) 40.49 39.74 39.40 39.35 40.99 WILLIAMS et al. | 10385

TABLE 3 Primer pairs used for qPCR, amplicon product size, and PCR annealing temperature

Product Annealing Gene Forward primer Reverse primer size (bp) temperature (°C)

Clanculus (2 species) ALAS CACAGCCCCAGTCACATCAT AGTTGGGGCCACACGAAGTC 156 61 ALAD CGGATCACGCAGTTCTTCAC AAGTGGTTCAATGGCTTCTTGTAG 200 61 PBGD-­1 GGCCCCGAATATGAGAAGAG CTCTCGGCGACGACTCTGAT 170 61 UROS TGAATTTGCAGTGTTCTTCAGTCC TGGTTCTGGTTTGGCTGTAA 172 61 UROD GGTTATCCCCCTTGCCTTG ACCCAGCTCCTTGTGAATATCA 133 61 Calliostoma ALAS GTGCCTAAAATTGTTGCCTTTGA CCCACAACATAGCCTCCCATATT 245 61 ALAD ATGTCACGGACACTGTGGTATTC AGGTCCATAAAAACTGGATGCAAA 241 65 PBGD-­2 AGACCTGCCCACATCACTTC ACCCACAACACTTCCCTCTG 166 61 UROS GGATTGCCCGAGTTTGCAGT GGCTGTGATACCATGGAGTTTGAA 168 64 UROD TTTTGGTTATCCCCCTTGC GGCTTCATACACATAGCCCAGTTC 152 59 All species 18S AAACGGCTACCACATCCAAG CCAGACTTGCCCTCCAATAG 165 57

C. margaritarius A #1 mantle. As PBGD is known to exist as two isoforms referred to as “B” was identified in (Williams et al., 2016). We were in humans (Deybach & Puy, 1995), primers were made specifically for not able to include C. margaritarius B in this study as only dry shells PBGD-­1 for Clanculus (the most highly expressed isoform in this species are available and there are no tissue samples for genetic studies. All where the two isoforms were found) and PBGD-­2 for Calliostoma (the COI sequences corresponding to C. margaritarius A were identical only isoform expressed in this species). Primers for PBGD-­1 and PBGD-­2 to each other and to a published COI sequence on GenBank for were designed to match to regions that varied between the two iso- the same species (AB505297), but differed from the single speci- forms, so that amplification of only the target isoform was possible (see men of C. margaritarius C by 22 synonymous substitutions over Appendix S1 for primer positions in gene alignments). the 658 bp used as a barcode in most molluskan studies (GenBank ® PCRs of 20 μl contained Power SYBR Green Master Mix ac- accession number for C. margaritarius C: KY200867; photographs cording to the manufacturers protocol (Applied Biosystems), 10 showing exemplar shells in Appendix S2). This difference (~3.3% pmol of each primer, and 2 μl of 1/10 dilution of cDNA synthesized uncorrected) was unexpected and may reflect cryptic species or from individual snails. PCR cycling conditions were as follows: 50°C highly divergent populations. Further studies are needed to con- for 2 min, 95°C for 10 min, then 40 cycles of 95°C for 30 s, X°C for firm the status of these groups. Both C. margaritarius A and C were 1 min, using the CFX96 real-­time PCR detection system (Bio-­Rad), included in transcriptomics studies, but only C. margaritarius A was where X is the optimized annealing temperature for each primer pair used in qPCR studies as no further specimens of C. margaritarius C (see Table 3). A dissociation curve was generated in each case to were available. check that only a single band was amplified. The qPCRs were per- formed in triplicate for each individual snail/tissue and normalized 3.2 | Identification of genes associated with to 18S using qGene (Muller, Janovjak, Miserez, & Dobbie, 2002) tak- pigment synthesis ing into account amplification efficiency, which was calculated using a dilution series for each primer pair (Pfaffl, 2001). 18S was chosen We used transcriptomics in combination with phylogenetically in- as a commonly used reference gene, and no consistent variation was formed annotation (Speiser et al., 2014) to determine whether C. found in its expression between tissue types or species. The individ- margaritarius, C. pharaonius, and Ca. zizyphinum express the enzymes ual mean normalized gene expression levels between tissues within necessary to produce uroporphyrin I and uroporphyrin III. Transcripts each species were compared for each gene using paired two-­tail that code for enzymes comprising the haem synthesis pathway Student’s t tests performed in Excel (T.TEST function). (Figure 2) were expressed in all species and tissues, but all eight genes were found only in Ca. zizyphinum mantle (Figure 3; Table 4; Appendix S3). Transcripts corresponding to the first three enzymes (aminole- 3 | RESULTS vulinic acid synthase—ALAS, aminolevulinic acid dehydratase—ALAD, porphobilinogen deaminase—PBGD) were found in all transcrip- 3.1 | Deep divergence in C. margaritarius tomes, for all species (Figure 3; Table 4; Appendix S3). We did not Two divergent genetic lineages were found in C. margaritarius, here limit the number of potential orthologues, and in some cases, more referred to as “A” or “C”. A third morphologically divergent group than one was identified. These orthologues were then included in a 10386 | WILLIAMS et al. phylogenetic analysis including published sequences from mollusks foot tissue was also used because previous studies have shown that and other organisms in order to confirm their evolutionary relation- the two Clanculus species used in this study also produce uroporphy- ships. For comparison, we also performed BLASTx searches against all rin I and III in colored foot tissue (Williams et al., 2016). Our expec- sequences in GenBank, recording the top hit with an identified gene tations were that in Clanculus species, UROS and UROD would be (Table 5). All transcripts were most similar to molluskan or inverte- expressed at lower levels in tissue that produces porphyrins (mantle brate haem genes as expected, with only two exceptions (Table 5); and colored foot) than tissue that does not produce porphyrins (col- two transcripts identified in the PIA analysis of ALAS were more simi- umellar muscle). In humans, an upregulation of the first gene in the lar to serine palmitoyltransferase than ALAS (marked with red font in haem pathway (ALAS) has been associated with increased severity of Figure 3a). particular types of porphyria that produce uroporphyrin (To-­Figueras No transcripts corresponding to uroporphyrinogen-­III synthase et al., 2011), so an increase in ALAS, along with a reduction in UROS (UROS) were identified in transcriptomes from C. margaritarius C #1 and/or UROD would also be consistent with porphyrin production. foot or C. margaritarius A #2 mantle, and uroporphyrinogen decar- We did not expect to necessarily observe the same patterns in Ca. boxylase (UROD) was also missing from the latter (Figure 3). No se- zizyphinum, which has only trace amounts of uroporphyrin I and III in quences corresponding to coproporphyrinogen oxidase (CPOX) were the shell (Williams et al., 2016). recovered from C. margaritarius transcriptomes, protoporphyrinogen Our results are consistent with the idea that Clanculus species are oxidase (PPOX) was missing from all Clanculus transcriptomes, and producing uroporphyrin I and III de novo in colored foot and man- ferrochelatase (FECH) was missing from C. margaritarius C #1 foot tle tissue. Several comparisons of relative levels of gene expression (Figure 3). Predicted translated sequences of the identified haem between tissue types (comparing putatively porphyrin-­producing tis- synthesis genes showed a high degree of amino acid conservation sues versus control, nonporphyrin-­producing tissue) were statistically with human proteins, which have been characterized experimentally significant using two-­tail Student’s t tests (see Table 6 for p values). (Appendix S1; sequences in Appendix S3). Namely, in C. pharaonius, both colored foot and mantle tissue show In all trees, transcripts corresponding to potential orthologues of significantly lower expression levels than columellar muscle for UROS haem synthesis genes form clusters with each other and with pub- (p < .01), as does colored foot for UROD (p < .001). Conversely, ALAS lished genomic sequences for the limpet Lottia gigantea and pearl levels were higher in colored foot than columellar muscle (p < .05). oyster Pinctada fucata, and with landmark sequences from other taxa, Similarly, in C. margaritarius, expression levels were lower in colored which represent genes that have been characterized experimentally foot than columellar muscle for both UROS and UROD, although only (Figure 3). The only exceptions were in the CPOX and ALAS trees. the value for UROS was significant (p < .05). Values of ALAS were In the ALAS tree, all our transcripts, except Clanculus margaritarius 1 also significantly different between columellar muscle and mantle mantle c37020 g and Clanculus margaritarius 1 foot c45104 g1 clus- (p < .05), with ALAS upregulated in mantle. Conversely, in Ca. zizyph- ter together, and BLASTx results suggest that these are not haem inum, only ALAD was significantly upregulated in mantle versus col- genes, confirming PIA results. Primers used in qPCR were designed umellar muscle (p < .05), which is not consistent with the production to avoid amplification of these two sequences. The four transcripts of uroporphyrin. initially identified as CPOX do not come out in a cluster, and only one, Calliostoma zizyphinum mantle c25229 g1 i1, clusters with a published 4 | DISCUSSION molluskan transcript (Lottia gigantea); however, BLASTx results suggest that all are CPOX genes, although they may represent different loci. 4.1 | Biosynthesis of uroporphyrin I and III

Understanding the evolution of shell color first requires identification 3.3 | Quantification of gene expression levels of pigments and then linking those pigments to a biosynthetic path- Quantitative real-­time PCR (qPCR) was used to estimate the expres- way. In this study, we investigated the biosynthesis of two dominant sion levels of transcripts for the first five enzymes in the haem synthe- shell porphyrin pigments that have recently been found to contribute sis pathway (Figure 2) in columellar muscle, colored foot tissue, and to shell color in the marine snails Clanculus pharaonius and C. marga- mantle tissue from C. pharaonius, C. margaritarius A, and Ca. zizyphi- ritarius. The shell pigments uroporphyrin I and uroporphyrin III are num (no foot tissue; Figure 4, Appendix S4). Mantle tissue was tested produced as side products of the haem pathway (Hendry & Jones, because it is responsible for shell construction and potentially pigment 1980). Therefore, we expected to find differences in the expres- production, if pigments are produced de novo by the animal. Colored sion of the haem pathway genes in tissues producing uroporphyrins

FIGURE 3 Maximum likelihood trees for enzymes used in the haem pathway. Sequences in each tree are from predicted protein databases associated with complete genomes. The exceptions are sequences marked “LANDMARK” and highlighted with red squares; these are sequences from GenBank that have been well characterized functionally. Sequences highlighted with yellow circles represent assembled transcripts from our transcriptomes. (a) First four enzymes in the haem biosynthetic pathway. Enzymes are aminolevulinic acid synthase, aminolevulinic acid dehydratase, porphobilinogen deaminase, and uroporphyrinogen-­III synthase. (b) Last four enzymes in the pathway. Enzymes are uroporphyrinogen decarboxylase, coproporphyrinogen oxidase, protoporphyrinogen oxidase, and ferrochelatase. Sequences in red font are likely not haem genes WILLIAMS et al. | 10387

(a) ALAS ALAD Allomyces macrogynus AMAG 03664T0 Acropora digitifera adi v1 08821 Allomyces macrogynus AMAG 04985T0 Saccharomyces cerevisiae jgi Sacce1 1261 Nematostella vectensis jgi Nemve1 171543 Neurospora crassa NCU06189T0 Amphimedon queenslandica Aqu1 228717 Tr ichoplax adhaerens aTriad1 20853 Mnemiopsis leidyi ML062230a Amphimedon queenslandica Aqu1 220596 Capitella teleta jgi Capca1 165396 Helobdella robusta jgi Helro1 189320 Pinctada fucata aug1 0 910 1 07749 t1 Daphnia pulex jgi Dappu1 320395 Daphnia pulex jgi Dappu1 225386 Pinctada fucata aug1 0 4678 1 52335 t1 Drosophila melanogaster FBpp0072060 LANDMARK1 Alas Drosophila melanogaster NP 477281 Clanculus pharaonius mantle c79862 g1 i1 Apis mellifera gnl Amel GB19215 PA Tr ibolium castaneum TC013340 GLEAN 13340 Pinctada fucata aug1 0 53770 1 63442 t1 Lottia gigantea jgi Lotgi1 182709 Clanculus margaritarius 2 mantle c20500 g1 i1 Clanculus pharaonius mantle c18993 g1 i1 Clanculus pharaonius mantle c13026 g1 i1 Clanculus margaritarius 1 mantle c34804 g1 i1 Clanculus margaritarius 2 mantle c20663 g1 i2 Clanculus margaritarius 1 mantle c37760 g2 i1 Clanculus margaritarius 1 foot c38208 g1 i1 Clanculus margaritarius 1 mantle c37760 g1 i2 Clanculus margaritarius 1 mantle c37760 g1 i1 Lottia gigantea jgi Lotgi1 114080 Clanculus margaritarius 1 foot c45732 g2 i1 Clanculus pharaonius mantle c2508 g1 i1 Clanculus margaritarius 1 foot c32922 g1 i1 Calliostoma zizyphinum mantle c45984 g1 i1 Calliostoma zizyphinum mantle c90431 g1 i Saccoglossus kowalevskii XP 002739969 Xenopus tropicalis jgi Xentr4 453502 Calliostoma zizyphinum mantle c8094 g1 i1 Danio rerio ENSDARP00000056419 LANDMARK1 Alas2 Mus musculus P08680 Xenopus tropicalis jgi Xentr4 204888 Mus musculus ENSMUSP00000066040 Mus musculus ENSMUSP00000108335 Gallus gallus ENSGALP00000014392 LANDMARK1 Alas2 Homo sapiens NP 000023 Gallus gallus ENSGALP00000006285 Danio rerio ENSDARP00000069226 LANDMARK1 ALAS1 Homo sapiens NP 000679 LANDMARK1 Alad Mus musculus P10518 Mus musculus ENSMUSP00000117014 Xenopus tropicalis jgi Xentr4 295786 Mus musculus ENSMUSP00000103068 Danio rerio ENSDARP00000005771 Petromyzon marinus ENSPMAP00000004041 LANDMARK1 ALAD Homo sapiens NP 000022 Ciona intestinalis jgi Cioin2 205904 Pinctada fucata aug1 0 6928 1 38431 t1 Saccoglossus kowalevskii XP 002741486 Hydra magnipapillata XP 002154275 Strongylocentrotus purpuratus XP 782371 Nematostella vectensis jgi Nemve1 90289 Tr ichoplax adhaerens jgi Tr iad1 55298 Allomyces macrogynus AMAG 14712T0 Ixodes scapularis ISCW020754 PA Salpingoeca rosetta PTSG 06335T0 Allomyces macrogynus AMAG 12743T0 Monosiga brevicollis jgi Monbr1 38536 Clanculus margaritarius 1 mantle c37020 g1 i1 Capitella teleta jgi Capca1 18667 Clanculus margaritarius 1 foot c45104 g1 i1 Mnemiopsis leidyi ML10895a Helobdella robusta jgi Helro1 185301 Tr ichoplax adhaerens jgi Tr iad1 19375 Ixodes scapularis ISCW015295 PA Tr ibolium castaneum TC009997 GLEAN 09997 Daphnia pulex jgi Dappu1 302058 Apis mellifera gnl Amel GB17093 PA Capitella teleta jgi Capca1 164338 Helobdella robusta jgi Helro1 185935 LANDMARK1 Pbgs Drosophila melanogaster NP 648564 Hydra magnipapillata XP 002164180 Lottia gigantea jgi Lotgi1 207612 Drosophila melanogaster FBpp0075743 Mus musculus ENSMUSP00000006544 LANDMARK2 GCAT Homo sapiens NP 001165161 Daphnia pulex jgi Dappu1 108708 Gallus gallus ENSGALP00000020093 Salpingoeca rosetta PTSG 03984T0 Xenopus tropicalis jgi Xentr4 327659 Danio rerio ENSDARP00000020361 Monosiga brevicollis jgi Monbr1 26688 Ciona intestinalis jgi Cioin2 297144 Nematostella vectensis jgi Nemve1 113623 Hydra magnipapillata XP 002162848 Monosiga brevicollis jgi Monbr1 10030 Salpingoeca rosetta PTSG 07624T0 Ciona intestinalis jgi Cioin2 299304 Drosophila melanogaster FBpp0075815 LANDMARK2 CG10361 Drosophila melanogaster NP 64850 Ciona intestinalis jgi Cioin2 235550 Caenorhabditis elegans T25B9 1 Neurospora crassa NCU01013T0 Capitella teleta jgi Capca1 60780 Nematostella vectensis jgi Nemve1 231555 Saccharomyces cerevisiae jgi Sacce1 2529 PBGD UROS Acropora digitifera adi v1 23501 Acropora digitifera adi v1 24355 Acropora digitifera adi v1 03132 Salpingoeca rosetta ` Acropora digitifera adi v1 08669 Monosiga brevicollis jgi Monbr1 34088 Allomyces macrogynus AMAG 03377T0 Nematostella vectensis jgi Nemve1 204353 Allomyces macrogynus AMAG 04686T0 Strongylocentrotus purpuratus XP 791243 Amphimedon queenslandica Aqu1 227737 Tr ichoplax adhaerens jgi Tr iad1 56012 Danio rerio ENSDARP00000107770 Hydra magnipapillata XP 002156062 Strongylocentrotus purpuratus XP 781025 Xenopus tropicalis jgi Xentr4 449796 Neurospora crassa NCU10292T1 Gallus gallus ENSGALP00000022218 Saccharomyces cerevisiae jgi Sacce1 802 LANDMARK1 Hem3p Saccharomyces cerevisiae S288c NP LANDMARK1 Uros Mus musculus P51163 Mnemiopsis leidyi ML293114a Pinctada fucata aug1 0 4638 1 44993 t1 Mus musculus ENSMUSP00000101752 Pinctada fucata aug1 0 7813 1 31464 t1 LANDMARK1 UROS Homo sapiens NP 000366 Pinctada fucata aug1 0 11560 1 24917 t1 Pinctada fucata aug1 0 5569 1 23819 t1 Ciona intestinalis jgi Cioin2 384347 Pinctada fucata aug1 0 16624 1 39838 t1 Lottia gigantea jgi Lotgi1 218866 Amphimedon queenslandica Aqu1 220465 Clanculus pharaonius mantle c18584 g1 i8 Amphimedon queenslandica Aqu1 202632 Clanculus pharaonius mantle c18584 g1 i4 Clanculus pharaonius mantle c18584 g1 i1 Apis mellifera gnl Amel GB12489 PA Clanculus pharaonius mantle c16373 g1 i1 Clanculus margaritarius 2 mantle c68931 g1 i1 Lottia gigantea jgi Lotgi1 231769 Clanculus margaritarius 2 mantle c20351 g1 i2 Clanculus pharaonius mantle c36956 g1 i1 Clanculus margaritarius 2 mantle c20351 g1 i1 Clanculus margaritarius 1 mantle c68853 g1 i1 Clanculus margaritarius 1 mantle c68027 g1 i1 Clanculus margaritarius 1 mantle c37610 g2 i1 Clanculus margaritarius 1 foot c46228 g1 i1 Calliostoma zizyphinum mantle c75662 g1 i1 Calliostoma zizyphinum mantle c2993 g1 i1 Capitella teleta jgi Capca1 142723 Capitella teleta jgi Capca1 148840 Capitella teleta jgi Capca1 178034 Saccoglossus kowalevskii XP 002734005 Helobdella robusta jgi Helro1 156805 Tr ibolium castaneum TC013007 GLEAN 13007 Drosophila melanogaster FBpp0071211 LANDMARK1 l302640 Drosophila melanogaster NP 61210 Drosophila melanogaster FBpp0072572 LANDMARK1 CG1885 Drosophila melanogaster NP 572507 Apis mellifera gnl Amel GB15699 PA Drosophila melanogaster FBpp0082627 Ciona intestinalis jgi Cioin2 247224 Ciona intestinalis jgi Cioin2 225225 Tr ibolium castaneum TC012334 GLEAN 12334 Danio rerio ENSDARP00000112737 Daphnia pulex jgi Dappu1 44826 Danio rerio ENSDARP00000023322 Danio rerio ENSDARP00000072858 Saccharomyces cerevisiae jgi Sacce1 5936 Danio rerio ENSDARP00000120095 Xenopus tropicalis jgi Xentr4 148906 Neurospora crassa NCU02395T0 Xenopus tropicalis jgi Xentr4 436157 Gallus gallus ENSGALP00000000379 Helobdella robusta jgi Helro1 164780 Mus musculus ENSMUSP00000076575 Mnemiopsis leidyi ML31986a LANDMARK1 Hmbs Mus musculus P22907 Mus musculus ENSMUSP00000095166 Mnemiopsis leidyi ML029512a LANDMARK1 HMBS Homo sapiens NP 000181 Petromyzon marinus ENSPMAP00000007357 Pinctada fucata aug1 0 12383 1 17850 t1 Nematostella vectensis jgi Nemve1 11360 Salpingoeca rosetta PTSG 00828T0 10388 | WILLIAMS et al.

(b) UROD CPOX Nematostella vectensis jgi Nemve1 190553 Nematostella vectensis jgi Nemve1 229388 Nematostella vectensis jgi Nemve1 5010 Acropora digitifera adi v1 05153 Acropora digitifera adi v1 15571 Lottia gigantea jgi Lotgi1 229358 Acropora digitifera adi v1 06375 Calliostoma zizyphinum mantle c25229 g1 i1 Ciona intestinalis jgi Cioin2 284317 Saccoglossus kowalevskii XP 002730678 Tr ichoplax adhaerens jgi Tr iad1 27704 Capitella teleta jgi Capca1 91255 Tr ichoplax adhaerens jgi Tr iad1 27497 Amphimedon queenslandica Aqu1 215384 Calliostoma zizyphinum mantle c29010 g1 i1 Daphnia pulex jgi Dappu1 299574 Capitella teleta jgi Capca1 160634 LANDMARK1 Updo Drosophila melanogaster NP 00113762 Hydra magnipapillata XP 002155548 Drosophila melanogaster FBpp0113059 Strongylocentrotus purpuratus XP 794430 Drosophila melanogaster FBpp0087607 Strongylocentrotus purpuratus XP 785975 Tr ibolium castaneum TC030590 GLEAN 05183 OG11963 Drosophila melanogaster FBpp0078980 Mnemiopsis leidyi ML073217a LANDMARK1 Coprox Drosophila melanogaster NP 524777 Saccoglossus kowalevskii XP 002737366 Daphnia pulex jgi Dappu1 111417 Strongylocentrotus purpuratus XP 784308 Amphimedon queenslandica Aqu1 217385 Hydra magnipapillata XP 002154197 Amphimedon queenslandica Aqu1 211586 Capitella teleta jgi Capca1 169863 Tr ibolium castaneum TC000466 GLEAN 00466 Capitella teleta jgi Capca1 151369 Nematostella vectensis jgi Nemve1 149268 Helobdella robusta jgi Helro1 191893 Amphimedon queenslandica Aqu1 206282 Capitella teleta jgi Capca1 180157 Xenopus tropicalis jgi Xentr4 442995 Gallus gallus ENSGALP00000016593 LANDMARK1 UROD Homo sapiens NP 000365 Salpingoeca rosetta PTSG 04467T0 Mus musculus ENSMUSP00000030446 Monosiga brevicollis jgi Monbr1 28565 LANDMARK1 Urod Mus musculus P70697 Saccharomyces cerevisiae jgi Sacce1 1066 Petromyzon marinus ENSPMAP00000002967 Neurospora crassa NCU01546T0 Petromyzon marinus ENSPMAP00000002963 Allomyces macrogynus AMAG 12388T0 Danio rerio ENSDARP00000023867 Allomyces macrogynus AMAG 14040T0 Xenopus tropicalis jgi Xentr4 438400 Calliostoma zizyphinum mantle c70732 g1 i1 Xenopus tropicalis jgi Xentr4 154239 Capitella teleta jgi Capca1 178054 Lottia gigantea jgi Lotgi1 205092 Mnemiopsis leidyi ML31984a Clanculus pharaonius mantle c81961 g1 i1 Clanculus pharaonius mantle c57098 g1 i1 Clanculus pharaonius mantle c6567 g1 i1 Ciona intestinalis jgi Cioin2 371653 Clanculus margaritarius 1 mantle c45374 g1 i1 Gallus gallus ENSGALP00000024546 Clanculus margaritarius 1 foot c98280 g1 i1 Calliostoma zizyphinum mantle c26554 g1 i1 Mus musculus ENSMUSP00000055455 Calliostoma zizyphinum mantle c79246 g1 i1 LANDMARK1 CPOX Mus musculus P36552 Salpingoeca rosetta PTSG 12432T0 LANDMARK1 CPOX Homo sapiens NP 000088 Monosiga brevicollis jgi Monbr1 34088 Xenopus tropicalis jgi Xentr4 159352 Neurospora crassa NCU02771T0 Danio rerio ENSDARP00000083605 Saccharomyces cerevisiae jgi Sacce1 1069 Helobdella robusta jgi Helro1 86324 Allomyces macrogynus AMAG 04999T0 Tr ichoplax adhaerens jgi Tr iad1 50218 Allomyces macrogynus AMAG 18169T0 Tr ichoplax adhaerens jgi Tr iad1 25736 Allomyces macrogynus AMAG 03377T0 Allomyces macrogynus AMAG 03377T0 Allomyces macrogynus AMAG 04686T0 Allomyces macrogynus AMAG 04686T0 PPOX FECH Monosiga brevicollis jgi Monbr1 11214 Salpingoeca rosetta PTSG 06334T0 Neurospora crassa NCU16396T0 Mnemiopsis leidyi ML305537a Neurospora crassa NCU16396T1 Amphimedon queenslandica Aqu1 223574 Saccharomyces cerevisiae jgi Sacce1 1941 Mus musculus ENSMUSP00000032065 Tr ichoplax adhaerens jgi Tr iad1 50124 Xenopus tropicalis jgi Xentr4 453218 Petromyzon marinus ENSPMAP00000000039 Petromyzon marinus ENSPMAP00000003284 Apis mellifera gnl Amel GB30068 PA Salpingoeca rosetta PTSG 01374T0 Acropora digitifera adi v1 11632 Amphimedon queenslandica Aqu1 218481 Strongylocentrotus purpuratus XP 787759 Saccoglossus kowalevskii XP 002741713 Xenopus tropicalis jgi Xentr4 314412 Saccoglossus kowalevskii XP 002734283 Mus musculus ENSMUSP00000040550 LANDMARK2 MAOB Homo sapiens NP 000889 Hydra magnipapillata XP 002159643 Mus musculus ENSMUSP00000026013 LANDMARK2 MAOA Homo sapiens NP 000231 Hydra magnipapillata XP 002161921 Xenopus tropicalis jgi Xentr4 158317 Ciona intestinalis jgi Cioin2 283668 Danio rerio ENSDARP00000032834 Pinctada fucata aug1 0 505 1 29301 t1 Allomyces macrogynus AMAG 03323T0 Saccoglossus kowalevskii XP 002734905 Lottia gigantea jgi Lotgi1 156653 Allomyces macrogynus AMAG 04666T0 Strongylocentrotus purpuratus XP 794903 Strongylocentrotus purpuratus XP 783768 Neurospora crassa NCU08291T0 Nematostella vectensis jgi Nemve1 196827 Saccharomyces cerevisiae jgi Sacce1 5832 Ciona intestinalis jgi Cioin2 228952 Strongylocentrotus purpuratus XP 788484 Pinctada fucata aug1 0 3739 1 37681 t1 Gallus gallus ENSGALP00000000108 Tr ichoplax adhaerens ATriad1 54930 Capitella teleta jgi Capca1 181169 Amphimedon queenslandica Aqu1 223846 Tr ibolium castaneum TC009642 GLEAN 09642 Helobdella robusta jgi Helro1 69010 Tr ibolium castaneum TC009643 GLEAN 09643 Xenopus tropicalis jgi Xentr4 199456 Daphnia pulex jgi Dappu1 53901 Helobdella robusta jgi Helro1 191961 LANDMARK1 Fech Mus musculus P22315 Daphnia pulex jgi Dappu1 311731 Pinctada fucata aug1 0 62904 1 12978 t1 Mus musculus ENSMUSP00000025484 Lottia gigantea jgi Lotgi1 64197 Caenorhabditis elegans C24G6 6 4 Mus musculus ENSMUSP00000088581 Tr ichoplax adhaerens jgi Tr iad1 51683 LANDMARK1 FECH Homo sapiens NP 000131 Amphimedon queenslandica Aqu1 222026 Strongylocentrotus purpuratus XP 797923 Gallus gallus ENSGALP00000028757 Xenopus tropicalis jgi Xentr4 276510 Gallus gallus ENSGALP00000025700 Gallus gallus ENSGALP00000004832 Xenopus tropicalis jgi Xentr4 151825 Helobdella robusta jgi Helro1 175520 Danio rerio ENSDARP00000125028 Capitella teleta jgi Capca1 93397 Lottia gigantea jgi Lotgi1 174413 LANDMARK2 CG8032 Drosophila melanogaster NP 649811 Drosophila melanogaster FBpp0081369 Clanculus pharaonius mantle c70866 g1 i1 Capitella teleta jgi Capca1 19454 Capitella teleta jgi Capca1 114517 Clanculus margaritarius 2 mantle c1654 g1 i1 Drosophila melanogaster FBpp0080699 LANDMARK2 A37C Drosophila melanogaster O96566 Clanculus margaritarius 1 mantle c87276 g1 i1 Neurospora crassa NCU09120T0 Calliostoma zizyphinum mantle c10706 g1 2 Petromyzon marinus ENSPMAP00000001288 Saccharomyces cerevisiae jgi Sacce1 4695 Calliostoma zizyphinum mantle c10706 g1 i Allomyces macrogynus AMAG 01200T0 Allomyces macrogynus AMAG 05386T0 Ixodes scapularis ISCW016187 PA Apis mellifera gnl Amel GB10177 PA LANDMARK1 Ppox Drosophila melanogaster NP 651278 Caenorhabditis elegans K07G5 6 1 Drosophila melanogaster FBpp0084044 Daphnia pulex jgi Dappu1 128379 Tr ibolium castaneum TC000508 GLEAN 00508 Daphnia pulex jgi Dappu1 50949 Apis mellifera gnl Amel GB15952 PA Ixodes scapularis ISCW023395 PA Tr ichoplax adhaerens jgi Tr iad1 31028 Tr ibolium castaneum TC014202 GLEAN 14202 Mnemiopsis leidyi ML05177a Hydra magnipapillata XP 002166439 LANDMARK1 ferr Drosophila melanogaster NP 524613 Ciona intestinalis jgi Cioin2 290341 Drosophila melanogaster FBpp0085208 Amphimedon queenslandica Aqu1 215294 Saccoglossus kowalevskii XP 002733039 Drosophila melanogaster FBpp0085210 Strongylocentrotus purpuratus XP 797442 Pinctada fucata aug1 0 1582 1 29773 t1 Xenopus tropicalis jgi Xentr4 474318 Lottia gigantea jgi Lotgi1 180405 Calliostoma zizyphinum mantle c25737 g1 i1 Salpingoeca rosetta PTSG 06315T0 Calliostoma zizyphinum mantle c22534 g1 i1 Acropora digitifera adi v1 20820 Helobdella robusta jgi Helro1 110634 Capitella teleta jgi Capca1 228548 Nematostella vectensis jgi Nemve1 186132 Danio rerio ENSDARP00000105337 LANDMARK1 Ppox Mus musculus P51175 Nematostella vectensis jgi Nemve1 150838 Mus musculus ENSMUSP00000072863 LANDMARK1 PPOX Homo sapiens NP 000300 Mus musculus ENSMUSP00000031729 Xenopus tropicalis jgi Xentr4 460937 Acropora digitifera adi v1 12613 Mus musculus ENSMUSP00000106638 Nematostella vectensis jgi Nemve1 207217

FIGURE 3 (Continued) WILLIAMS et al. | 10389

TABLE 4 Summary showing the Clanculus Clanculus Clanculus Clanculus Calliostoma presence or absence of transcripts Gene/ pharaonius margaritarius margaritarius margaritarius zizyphinum corresponding to the eight haem genes transcriptome mantle 1 mantle 1 foot 2 mantle mantle

ALAS + + + + + ALAD + + + + + PBGD + + + + + UROS + + − − + UROD + + + − + CPOX o − − − + PPOX − − − − + FECH + + − + +

+, sequence identified and clusters with other molluskan sequences; −, no sequences found in tran- scriptome; o, transcript found but does not cluster with other molluskan sequences. when compared to nonporphyrin-­producing tissues in Clanculus spe- to see whether this result is typical. Even with the caveat that num- cies. We identified the first four genes of the haem pathway, which bers of individuals examined were small, the results for the colored are necessary for the production of uroporphyrin I and III, in at least foot are consistent with our expectations for porphyrin-­producing one transcriptome from each of the three study species, although tissues. the fourth enzyme, UROS, was not recovered in all tissues. All four Contrary to observations for Clanculus, expression levels of haem remaining genes in the haem pathway were also identified in Ca. genes did not differ significantly between mantle and columellar zizyphinum but were not recovered from all Clanculus transcriptomes. muscle from Ca. zizyphinum, with the exception of ALAD, which was In two transcriptomes (C. margaritarius C #1 foot and C. margaritarius expressed more highly in mantle tissue. Increased activity of ALAD A #2 mantle), transcripts for UROS were not recovered, and UROD is not associated with production of uroporphyrins, although re- was not recovered from C. margaritarius A #2 mantle. The absence of duced activity is associated with some forms of porphyria (Balwani transcripts corresponding to some haem genes does not mean these & Desnick, 2012). We did not expect to observe the same patterns genes are completely absent, as the synthesis of haem is essential for of haem gene expression in Ca. zizyphinum, a species that does not life, because haem serves as a precursor to cytochrome prosthetic produce shell porphyrins. The shell pigments of Ca. zizyphinum are un- groups which are necessary for cell function (Layer et al., 2010). Our known, although based on the observation that some pigments appear inability to find some transcripts corresponding to some genes may to be phylogenetically distributed (Williams, 2017), they may include suggest either low levels of expression, or that the depth of sequenc- bilins, which are found in other trochoidean families (Tixier, 1952). ing was insufficient, or that sequences were too divergent to be rec- Bilins may be taken up in the diet (Fox, 1979; MacColl et al., 1990) or ognized using BLAST-­based searches. produced by the organism through the breakdown of hemoproteins Comparison of relative expression levels between tissue types (Bandaranayake, 2006; Hudson & Smith, 1975), and the pathways for demonstrated differences in gene expression levels between pig- production of trochoidean bilins are unknown. mented and nonpigmented tissues consistent with our hypothe- Taken together, the genetic data presented here along with sis. This was most pronounced in C. pharaonius colored foot tissue previously published chemical data that identified shell pigments where the first enzyme in the haem pathway (ALAS) was signifi- as uroporphyrin I and III (Williams et al., 2016) support the sug- cantly upregulated, and UROS and UROD were significantly down- gestion that shell porphyrins are produced de novo by two spe- regulated. Based on human clinical trials, increased levels of ALAS, cies of Clanculus. An interesting side effect of the incorporation of along with decreased levels of UROS and UROD would likely result trochopuniceus and trochoxouthos into the shell and colored foot in increased production of uroporphyrin (To-­Figueras et al., 2011). tissue of the two Clanculus species is that the production of haem UROS was also significantly downregulated in mantle tissue versus may be reduced in mantle and foot tissues as neither uroporphyrin columellar muscle. ALAS levels were also higher in mantle than col- I nor uroporphyrin III can be converted into heme. Earlier authors umellar muscle, although the values were marginally nonsignificant (Comfort, 1949; Hendry & Jones, 1980; Kennedy, 1975) noted that (p = .05125; Table 6). molluskan taxa that have uroporphyrin I in shell and integument The second species, C. margaritarius, showed similar differences, generally do not use hemoglobin as their respiratory pigment. Many but, perhaps due to only being able to obtain a few samples of this mollusks, including many vetigastropods, use hemocyanin, which, rare species, only the upregulation of ALAS in mantle and downregu- despite the name, is not synthesized via the haem biosynthetic lation of UROS in colored foot (both compared to collumellar tissue) pathway (Hanzlik, 1976). It has been suggested that the haem bio- were statistically significant. The effect on uroporphyrin production synthetic pathway is likely of lesser importance in such organisms of an increase in activity of ALAS, without a concomitant decrease and therefore that haem production can be reduced without harm in UROS or UROD, is not known, and further samples are needed to the animal (Hendry & Jones, 1980). 10390 | WILLIAMS et al. binding binding (Continues) binding pocket phosphate- ­ phosphate- ­ phosphate- ­ 5′- ­ site, catalytic residue site, catalytic residue – – Catalytic residue Catalytic residue, pyridoxal Catalytic residue – Other conserved regions – Catalytic residue – Pyridoxal 5′- ­ – Active site, Schiff base residues Schiff base residues – Pyridoxal 5′- ­ Active site, Schiff base residues Active site, Schiff base residues PBGS superfamily PBGS superfamily PBGS superfamily PBGS superfamily PBGS superfamily PBGS superfamily superfamily superfamily Preseq_ALAS superfamily superfamily AAT_I superfamily AAT_I superfamily AAT_I superfamily AAT_I superfamily AAT_I superfamily ALAD- ­ Conserved domains AAT_I superfamily AAT_I superfamily ALAD- ­ PLN02483, AAT_I Preseq_ALAS, AAT_I ALAD- ­ ALAD- ­ AAT_I superfamily PLN02483, AAT_I ALAD- ­ ALAD- ­ XP_005104982 XP_005104982 XP_005104982 XP_021356935 XP_005104982 XP_013070705 GenBank Acc. No. XP_021356935 AEI88095 XP_021366088 XP_012942343 XP_013397246 XP_021366088 XP_013070705 XP_013397246 XP_012942343 XP_021366088 XP_021366088

a a a a a a (gastropod) (bivalve) (decapod) (bivalve) (gastropod) (brachiopod) (bivalve) (gastropod) (brachiopod) (bivalve) (gastropod) (gastropod) (gastropod) (bivalve) (gastropod) (bivalve) (gastropod) Species Aplysia californica Mizuhopecten yessoensis Scylla paramamosain Mizuhopecten yessoensis Aplysia californica Lingula anatina Mizuhopecten yessoensis Lingula anatina Mizuhopecten yessoensis Biomphalaria glabrata Aplysia californica Aplysia californica Aplysia californica Mizuhopecten yessoensis Aplysia californica Mizuhopecten yessoensis Biomphalaria glabrata like like like like like like like like like like isoform X1 like isoform X1 like isoform X1 like isoform X1 like like like aminolevulinic acid dehydratase- ­ aminolevulinic acid dehydratase- ­ aminolevulinic acid dehydratase- ­ aminolevulinic acid dehydratase- ­ aminolevulinic acid dehydratase- ­ aminolevulinic acid dehydratase- ­ aminolevulinate synthase, erythroid- ­ aminolevulinic acid synthase aminolevulinate synthase, erythroid- ­ aminolevulinate synthase, erythroid- ­ aminolevulinate synthase, erythroid- ­ aminolevulinate synthase, erythroid- ­ aminolevulinate synthase, erythroid- ­ aminolevulinate synthase, erythroid- ­ aminolevulinate synthase, erythroid- ­ specific, mitochondrial- ­ specific, mitochondrial- ­ specific, mitochondrial- ­ specific, mitochondrial- ­ specific, mitochondrial- ­ specific, mitochondrial- ­ specific, mitochondrial- ­ specific, mitochondrial- ­ Gene 5- ­ 5- ­ 5- ­ Delta- ­ delta- ­ Serine palmitoyltransferase 2- ­ 5- ­ 5- ­ 5- ­ delta- ­ 5- ­ 5- ­ Delta- ­ Serine palmitoyltransferase 2- ­ 5- ­ delta- ­ delta- ­ for transcripts identified in PIA analyses as putative haem genes ------tle_c37760_g1_i2 tle_c37760_g2_i1 tle_c20663_g1_i2 tle_c34804_g1_i1 c90431_g1_i1 tle_c37020_g1_i1 c13026_g1_i1 c32922_g1_i1 c45984_g1_i1 c2508_g1_i1 tle_c37760_g1_i1 c18993_g1_i1 c38208_g1_i1 c45104_g1_i1 c45732_g2_i1 tle_c20500_g1_i1 c8094_g1_i1 Transcripts Clanculus_margaritarius_1_man Clanculus_margaritarius_1_man Clanculus_margaritarius_2_man ALAD transcripts Clanculus_margaritarius_1_man Calliostoma_zizyphinum_mantle_ ALAS transcripts Clanculus_margaritarius_1_man Clanculus_pharaonius_mantle_ Clanculus_margaritarius_1_foot_ Calliostoma_zizyphinum_mantle_ Clanculus_pharaonius_mantle_ Clanculus_margaritarius_1_man Clanculus_pharaonius_mantle_ Clanculus_margaritarius_1_foot_ Clanculus_margaritarius_1_foot_ Clanculus_margaritarius_1_foot_ Clanculus_margaritarius_2_man Calliostoma_zizyphinum_mantle_ TABLE 5 Details for BLASTx hits WILLIAMS et al. | 10391 (Continues) – – – – – – – – Other conserved regions – – – – – – – – – PBGS superfamily D_CIMS_like protein D_CIMS_like protein fold superfamily fold superfamily fold superfamily fold superfamily superfamily superfamily fold superfamily fold superfamily fold superfamily fold superfamily fold superfamily fold superfamily fold superfamily Type 2 periplasmic binding Type 2 periplasmic binding Type 2 periplasmic binding Type 2 periplasmic binding HemD superfamily HemD superfamily URO- ­ URO- ­ Conserved domains Type 2 periplasmic binding Type 2 periplasmic binding Type 2 periplasmic binding Type 2 periplasmic binding ALAD- ­ Type 2 periplasmic binding Type 2 periplasmic binding Type 2 periplasmic binding HemD superfamily XP_011444315 XP_011444315 XP_011444315 XP_007441554 XP_005098107 XP_005098107 XP_005105887 XP_013083863 GenBank Acc. No. XP_013082888 XP_013082888 XP_013082888 XP_011444315 XP_021366088 XP_011444315 XP_005097343 XP_011444315 XP_005098107

a a a a a a a a (gastropod) (gastropod) (gastropod) (gastropod) (bivalve) (bivalve) (gastropod) (gastropod) (bivalve) (bivalve) (gastropod) (bivalve) (bivalve) (bivalve) (gastropod) (reptile) (gastropod) Species Biomphalaria glabrata Crassostrea gigas Crassostrea gigas Biomphalaria glabrata Aplysia californica Biomphalaria glabrata Aplysia californica Mizuhopecten yessoensis Crassostrea gigas Biomphalaria glabrata Aplysia californica Crassostrea gigas Crassostrea gigas Crassostrea gigas Aplysia californica Python bivittatus Aplysia californica like like like like isoform like isoform like isoform like isoform X2 like isoform X2 like isoform X2 like III synthase- ­ III synthase- ­ III synthase- ­ aminolevulinic acid dehydratase- ­ X2 X2 X2 Gene Porphobilinogen deaminase- ­ Porphobilinogen deaminase Porphobilinogen deaminase Porphobilinogen deaminase- ­ Uroporphyrinogen- ­ Uroporphyrinogen decarboxylase- ­ Uroporphyrinogen decarboxylase- ­ delta- ­ Porphobilinogen deaminase Porphobilinogen deaminase- ­ Porphobilinogen deaminase- ­ Porphobilinogen deaminase Porphobilinogen deaminase Porphobilinogen deaminase Uroporphyrinogen- ­ Porphobilinogen deaminase Uroporphyrinogen- ­ ------tle_c68853_g1_i1 tle_c20351_g1_i2 tle_c68931_g1_i1 c18584_g1_i1 c36956_g1_i1 tle_c45374_g1_i1 c98280_g1_i1 c79862_g1_i1 c46228_g1_i1 c18584_g1_i4 c18584_g1_i8 c2993_g1_i1 tle_c37610_g2_i1 tle_c20351_g1_i1 tle_c68027_g1_i1 c16373_g1_i1 c75662_g1_i1 Transcripts Clanculus_margaritarius_1_man Clanculus_margaritarius_2_man Clanculus_margaritarius_2_man Clanculus_pharaonius_mantle_ Clanculus_pharaonius_mantle_ UROD transcripts Clanculus_margaritarius_1_man Clanculus_margaritarius_1_foot_ Clanculus_pharaonius_mantle_ Clanculus_margaritarius_1_foot_ Clanculus_pharaonius_mantle_ Clanculus_pharaonius_mantle_ Calliostoma_zizyphinum_mantle_ PBGD transcripts Clanculus_margaritarius_1_man Clanculus_margaritarius_2_man UROS transcripts Clanculus_margaritarius_1_man Clanculus_pharaonius_mantle_ Calliostoma_zizyphinum_mantle_ TABLE 5 (Continued) 10392 | WILLIAMS et al. in Transcripts S3. Appendix in are – – – – – – – – Other conserved regions – – – – – – – sequences Nucleotide D_CIMS_like protein D_CIMS_like protein D_CIMS_like protein D_CIMS_like protein superfamily superfamily superfamily superfamily superfamily superfamily superfamily superfamily superfamily superfamily superfamily URO- ­ URO- ­ URO- ­ URO- ­ Coprogen oxidase Ferrochelatase Ferrochelatase Ferrochelatase Conserved domains – – Coprogen oxidase HemY superfamily HemY superfamily Ferrochelatase Ferrochelatase identified. regions conserved other XP_005105887 GAA51972 XP_005105887 XP_005105887 OON21227 XP_005090207 XP_005090207 EKC30122 GenBank Acc. No. XP_014771663 XP_014771663 OWF48267 XP_005096895 XP_005096895 XP_005090207 XP_005090207

any

and

b b a a a a a domains, a (platyhelminth) (gastropod) (gastropod) (gastropod) (bivalve) (gastropod) (octopus) (octopus) (bivalve) (gastropod) (platyhelminth) (gastropod) (gastropod) (gastropod) (gastropod) Species Clonorchis sinensis Aplysia californica Aplysia californica Aplysia californica Crassostrea gigas Aplysia californica Octopus bimaculoides Octopus bimaculoides Mizuhopecten yessoensis Aplysia californica Opisthorchis viverrini Aplysia californica Aplysia californica Aplysia californica Aplysia californica conserved III III number, like like like like like like like like like accession III oxidase III oxidase GenBank like like dependent coproporphyrinogen- ­ dependent coproporphyrinogen- ­ identification, oxidase- ­ oxidase- ­ Gene Uroporphyrinogen decarboxylase Uroporphyrinogen decarboxylase- ­ Uroporphyrinogen decarboxylase- ­ Oxygen- ­ Oxygen- ­ Ferrochelatase, mitochondrial- ­ Ferrochelatase, mitochondrial Uroporphyrinogen decarboxylase- ­ Coproporphyrinogen- ­ Protoporphyrinogen oxidase- ­ Coproporphyrinogen- ­ Protoporphyrinogen oxidase- ­ Ferrochelatase, mitochondrial- ­ Ferrochelatase, mitochondrial- ­ Ferrochelatase, mitochondrial- ­ species

- - (gastropod) hypothetical protein. identification, gene are Opisthorchis viverrini (platyhelminth) hypothetical protein. Lottia gigantea listed c79246_g1_i1 c6567_g1_i1 c81961_g1_i1 c25229_g1_i1 c57098_g1_i1 c10706_g1_i2 c70866_g1_i1 c26554_g1_i1 c29010_g1_i1 c22534_g1_i1 c70732_g1_i1 c25737_g1_i1 tle_c87276_g1_i1 tle_c1654_g1_i1 c10706_g1_i1 Transcripts Calliostoma_zizyphinum_mantle_ Clanculus_pharaonius_mantle_ Clanculus_pharaonius_mantle_ CPOX transcripts Calliostoma_zizyphinum_mantle_ Clanculus_pharaonius_mantle_ Calliostoma_zizyphinum_mantle_ Clanculus_pharaonius_mantle_ Calliostoma_zizyphinum_mantle_ Calliostoma_zizyphinum_mantle_ PPOX transcripts Calliostoma_zizyphinum_mantle_ Calliostoma_zizyphinum_mantle_ Calliostoma_zizyphinum_mantle_ FECH transcripts Clanculus_margaritarius_1_man Clanculus_margaritarius_2_man Calliostoma_zizyphinum_mantle_ Top hit is Top hit is red font did not cluster with other molluskan sequences and are not haem genes. TABLE 5 (Continued) Details a b WILLIAMS et al. | 10393

(a) Clanculus pharaonius (c) Calliostoma zizyphinum 0.00018 0.009 0.00016 coll 0.008 coll 0.00014 0.007 man man 0.00012 0.006 0.00010 colfoot 0.005 0.00008 0.004 0.00006 0.003 0.00004 0.002 0.00002 ** ** 0.001

Mean normalized expression * ** ** 0 Mean normalized expression 0 ALAS ALAD PBGD1 UROS UROD ALAS ALAD PBGD1UROSUROD

(b) Clanculus margaritarius

0.00007 0.00010 1.00E-06 ** 0.00006 coll 0.00008 8.00E-07 0.00005 man 0.00006 6.00E-07 0.00004 colfoot 0.00004 4.00E-07 0.00003 0.00002 0.00002 2.00E-07 * 0.00001 0 0 * Mean normalized expression ALAS ALAD UROS 0 ALAS ALAD PBGD1 UROS UROD

FIGURE 4 Relative expression levels for the first five genes in the heme synthesis pathway compared between tissues predicted to produce porphyrin (Clanculus mantle (man) & coloured foot (colfoot)) versus those that are not (Clanculus columellar muscle (coll)). Calliostoma zizyphinum is included as a negative control as none of its tissues are predicted to produce porphyrins. Normalised expression was calculated relative to expression of 18S and comparisons were made between columellar tissue and mantle and between columellar tissue and coloured foot. The P values from a students t-test demonstrated * < 0.05 or ** < 0.01 significance. (a) Clanclus pharaonius. (b) Clanclus margaritarius. (c) Calliostoma zizyphinum. The smaller boxed graphs for Calliostoma zizyphinum show the same data, but with a changed y-axis to allow the lower normalised gene expression levels to be visualised.

TABLE 6 Probabilities for two-­tailed, paired t tests for differences in gene regulation among tissues in three trochoidean species of gastropod

Species Tissue comparisons ALAS ALAD PBGD UROS UROD

Clanculus Columellar muscle versus mantle 0.03667* 0.28708 0.07258 0.57494 0.79846 margaritarius Columellar muscle versus colored foot 0.09060 0.08156 0.34498 0.07430 0.04432* Clanculus Columellar muscle versus mantle 0.05125 0.07516 0.23290 0.00531** 0.47822 pharaonius Columellar muscle versus colored foot 0.02389* 0.12462 0.90237 0.00050** 0.00003** Calliostoma Columellar muscle versus mantle 0.16621 0.01222* 0.54429 0.07822 0.59242 zizyphinum

Significant values are marked with an asterisk.

porphyrin derivative), and no relationship was observed between pig- 4.2 | Diet versus de novo synthesis—evidence from ment type and molluskan feeding mode. other studies Two more recent studies by Underwood and Creese also sug- Although the evidence obtained in this study suggests that porphy- gested that shell uroporphyrin is derived from the diet. Underwood rin shell pigmentation is produced de novo by the animal, the origin and Creese (1976) showed that the width of black bands on shells of of porphyrin pigments in molluskan shells was considered uncertain the trochid Austrocochlea porcata (as A. constricta) differed between throughout the last century (Fox, 1976). For instance, Comfort (1950) estuary and open coast habitats and was correlated with chlorophyll suggested that the uroporphyrin I found in vetigastropod shells is de- availability at each site. These authors detected and measured uro- rived from the animal’s diet, but tellingly, admitted that there was no porphyrin I in the shells and showed that concentrations were also evidence that uroporphyrins can be synthesized from chlorophyll (a correlated with shell banding pattern (Creese & Underwood, 1976). 10394 | WILLIAMS et al.

On the basis of their results, the authors suggested that shell pig- (Williams et al., 2016). In both species, trochopuniceus is produced in mentation was not under genetic control but rather affected by en- spots in early whorls. The color pattern in later whorls of C. pharaonius vironmental factors (Creese & Underwood, 1976). The authors did shells would suggest that some mantle cells are producing only eu- not, however, show that the distribution of uroporphyrin I was con- melanin and others only trochopuniceus. The production of eumelanin gruent with pigmentation patterns, although they did show that the is switched on and off producing black and white spots that are con- black pigment dissolved in acid, as would be expected for a porphyrin. gruent with small granules in the shell sculpture. The production of However, shells of this species examined under ultraviolet light do not trochopuniceus is almost continuous. On the other hand, in C. marga- demonstrate the strong fluorescence seen in Clanculus. It is possible ritarius, in later whorls, all mantle cells alternate between production that uroporphyrin occurs in the shell without contributing color, and of eumelanin and trochoxouthos. Shell patterns suggest that pigment-­ that instead banding patterns are due to bilins (also known as bile pig- producing cells pause in pigment production when shifting from one ments); both classes of shell pigments have been found to co-­occur pigment to the other, with a greater break in pigment production after in another trochoidean, Cittarium pica (Comfort, 1951). A biliprotein the production of eumelanin, creating unevenly sized patches of white (bilin complexed to a protein) has also been found in foot and shell on either side of the black spots. of Phorcus turbinatus (as Monodonta turbinata; Bannister, Bannister, & Micallef, 1968a,b, 1970), a species from the same subfamily as Austrocochlea. Unlike porphyrins, bilins can be obtained from the diet. 5 | CONCLUSIONS For instance, the bilin portions of three biliproteins in the ink of the sea hare Aplysia californica are derived from bilins occurring as biliproteins Our work advances studies on the evolution of shell color in mollusks in red algae consumed by the animals (MacColl et al., 1990). Another by matching known shell pigments with the identification of the ge- (not mutually exclusive) explanation is that the synthesis of pigmenta- netic pathway responsible for their biosynthesis. We identify genes tion in the banding pattern occurs at some energetic cost to the animal associated with the production of porphyrin pigments in colored foot (Williams, 2017). In favor of this, hypothesis is the fact that synthesis tissue and mantle tissue in two species known to have porphyrin pig- of porphyrins and bile pigments has been shown to be energetically mentation and one that does not. Relative expression data based on costly in other taxa (e.g., in bird egg shell pigments Miksik, Holáň, & qPCR are consistent with the evidence of taxonomic distribution of Deyl, 1994; Morales, Velando, & Torres, 2010; Moreno & Osorno, porphyrin as determined in recent biochemical studies and with the 2003; Soler, Navarro, Contreras, Avilés, & Cuervo, 2008). hypothesis that porphyrin-­based pigments uroporphyrin I and uropor- Further evidence for the de novo synthesis of porphyrin pigments in phyrin III are synthesized de novo by two Clanculus species but not mollusks comes from studies on marine pearl oyster shells. Porphyrins by Ca. zizyphinum. These results are relevant not only to understand- have been found in oyster shells and pearls and are thought to con- ing the evolution of shell pigmentation in Clanculus but also to un- tribute to visible pigmentation in some species (Fischer & Haarer, derstanding the evolution of color in other species with uroporphyrin 1932; Kosaki, 1947; Miyoshi, Matsuda, & Komatsu, 1987; Nicholas & pigmentation, including (mainly marine) mollusks, annelid and platy- Comfort, 1949; Tixier, 1945), and heritability of shell and pearl color helminth worms, and turaco bird feathers. has been confirmed by breeding experiments (Ky et al., 2013, 2015; We recommend the use of species such as C. margaritarius and Lemer et al., 2015). De novo synthesis of shell pigments is confirmed C. pharaonius that share the same pigments in the foot and shell as by aquaculture techniques, where mantle tissue from one animal is an aid to identify the genes involved in pigment production. Although grafted into another to produce pearls that match the color of those a foot that shares the same color and pattern as the shell is unusual, obtained from the donor animal (Ky et al., 2013, 2015). These even in- occurring in only a few molluskan groups, where it does occur, it pro- clude xenografts between species, where black pearls were produced vides an almost unique opportunity to identify the genes involved in by placing mantle tissue of Pinctada margaritifera in gonad tissue of the inheritance and control of color. In such taxa, it becomes possible Pinctada maxima (McGinty, Zenger, Jones, & Jerry, 2012). Black shell to distinguish between genes that are involved in pigmentation, and coloration in P. margaritifera is due to porphyrins, but porphyrins are those involved in biomineralization as the latter will not be expressed not found in P. maxima (Miyoshi et al., 1987), which does not normally in the foot. This may be particularly useful in identification of novel produce black pearls (McGinty et al., 2012). proteins that may be associated with bilins or carotenoids.

4.3 | Color pattern ACKNOWLEDGMENTS

The production of color patterns has been the focus of many compu- We are very grateful to Piotr Kuklinski for collecting and preserving tational and modeling studies that have sought to find a mechanism Calliostoma zizyphinum and for the photograph of the living animal; for the production of shell patterns (e.g., Meinhardt, 1995). Based on Gustav Paulay for collecting Clanculus pharaonius in Saudi Arabia these ideas, we can hypothesize on how color patterns are formed in while at KAUST and Michael Berumen and Joey DiBattista for the in- Clanculus species. Three pigments are responsible for the dominant vitation to STW to visit KAUST. We also thank Lisa Smith and Kevin colors in the two Clanculus species studied: trochopuniceus for the Hopkins for expert help in the laboratory and Harry Taylor for pho- pink-­red, trochoxouthos for yellow-­brown, and eumelanin for black tographs of specimens. We thank Chiho Ikebe for discussions about WILLIAMS et al. | 10395 qPCR and Menno Schilthuizen, Tim Littlewood, Ana Riesgo, Andrew the pearl mussel Hyriopsis cumingii. PLoS One, 8, e53617. https://doi. Parker, David Reid, John Taylor, and Alfried Vogler for comments on org/10.1371/journal.pone.0053617 Balwani, M., & Desnick, R. J. (2012). The porphyrias: Advances in diagno- text that predated this manuscript and three anonymous reviewers sis and treatment. Blood, 120, 4496–4504. https://doi.org/10.1182/ for helpful comments. Finally, we gratefully acknowledge funding blood-2012-05-423186 from the Life Sciences Department at the Natural History Museum, Bandaranayake, W. M. (2006). The nature and role of pigments of ma- London, and support from Todd Oakley and the Oakley Laboratory at rine invertebrates. Natural Product Reports, 23, 223–255. https://doi. org/10.1039/b307612c the University of California Santa Barbara, as well as UCSB’s Center Bannister, W. H., Bannister, J. V., & Micallef, H. (1968a). Bile pig- for Scientific Computing at the CNSI and MRL. UCSB’s Center for ment in the shell of Monodonta turbinata (Mollusca: Gastropoda). Scientific Computing at the CNSI and MRL was a recipient of NSF Comparative Biochemistry and Physiology, 27, 451–454. https://doi. MRSEC DMR-­1121053 and NSF CNS-­0960316. DIS was supported org/10.1016/0010-406X(68)90244-2 by NSF EAGER-­10457 and NSF DEB-­1355230. STW’s visit to KAUST Bannister, W. H., Bannister, J. V., & Micallef, H. (1968b). The green pigment in the foot of Monodonta (Mollusca) species. was funded by KAUST awards CRG-­1-­2012-­BER-­002 and 59130357 Comparative Biochemistry and Physiology, 24, 839–846. https://doi. (to M.L. Berumen). org/10.1016/0010-406X(68)90795-0 Bannister, W. H., Bannister, J. V., & Micallef, H. (1970). A soluble pigment-­ protein complex from the shell of Monodonta turbinata (Mollusca: CONFLICT OF INTEREST Archaeogastropoda). Comparative Biochemistry and Physiology, 35, 237–243. https://doi.org/10.1016/0010-406X(70)90926-6 The authors have declared that no competing interests exist. Berger, S. A., Krompass, D., & Stamatakis, A. (2011). Performance, accuracy, and web server for evolutionary placement of short sequence reads under maximum likelihood. Systematic Biology, 60, 291–302. https:// AUTHOR CONTRIBUTIONS doi.org/10.1093/sysbio/syr010 Besur, S., Hou, W., Schmeltzer, P., & Bonkovsky, H. L. (2014). Clinically im- STW conceived the project, produced the final figures (other than portant features of porphyrin and heme metabolism and the porphyrias. Figure 4, produced by AEL), and wrote the first draft of the manu- Metabolites, 4, 977–1006. https://doi.org/10.3390/metabo4040977 script and STW, DIS, and AEL edited final drafts. AEL undertook Blankenberg, D., Kuster, G. V., Coraor, N., Ananda, G., Lazarus, R., Mangan, M., … Taylor, J. (2010). Galaxy: A web-­based genome analysis tool for qPCR studies and PD and TN contributed to other molecular labora- experimentalists. Current Protocols in Molecular Biology, 19, 10. tory work. AEL, DIS, STW, and CKCC analyzed molecular data and Boettiger, A., Ermentrout, B., & Oster, G. (2009). The neural origins of shell TN provided live-­collected specimens and photographs of living structure and pattern in aquatic mollusks. Proc Natl Acad Sci USA, 106, specimens. 6837–6842. https://doi.org/10.1073/pnas.0810311106 Braasch, I., Schartl, M., & Volff, J. N. (2007). Evolution of pigment synthesis pathways by gene and genome duplication in fish. BMC Evolutionary Biology, 7, 74. https://doi.org/10.1186/1471-2148-7-74 DATA ACCESSIBILITY Budd, A., McDougall, C., Green, K., & Degnan, B. M. (2014). Control of shell Details of specimens are available in Table 1. Voucher specimens pigmentation by secretory tubules in the abalone mantle. Frontiers in Zoology, 11, 62. https://doi.org/10.1186/s12983-014-0062-0 have been deposited in the Natural History Museum, London (reg- Comfort, A. (1949). Acid-­soluble pigments of shells. 1. The distribution of istration numbers in Table 1). Transcriptome assembly statistics are porphyrin fluorescence in molluscan shells. Biochemical Journal, 44, available in Table 2. Alignments of haem sequences are available in 111–117. https://doi.org/10.1042/bj0440111 Appendix S1. Photographs of shells corresponding to divergent lin- Comfort, A. (1950). Biochemistry of molluscan shell pigments. Proceedings of the Malacological Society of London, 28, 79–85. eages within Clanculus margaritarius are available in Appendix S2. Comfort, A. (1951). Observations on the shell pigments of land pulmonates. Open-­reading frames for all haem transcripts are available in Appendix Proceedings of the Malacological Society of London, 29, 35–44. S3. Normalized qPCR results and probabilities for t tests are given Creese, R. G., & Underwood, A. J. (1976). Observations on the biol- in Table 6 and Appendix S4. Raw reads for all transcriptomes have ogy of the trochid gastropod Austrocochlea constricta (Lamarck) (Prosobranchia). I. Factors affecting shell-­banding pattern. Journal been published online in the NCBI Sequence read Archive: NCBI-­SRA of Experimental Marine Biology and Ecology, 23, 211–228. https://doi. SRP092238, SRP092881, and SRP092239. org/10.1016/0022-0981(76)90021-6 Deybach, J. C., & Puy, H. (1995). Porphobilinogen deaminase gene struc- ture and molecular defects. Journal of Bioenergetics and Biomembranes, ORCID 27, 197–205. https://doi.org/10.1007/BF02110034 Fischer, H., & Haarer, E. (1932). Über uroporphyrin aus muschelschalen. Suzanne T. Williams http://orcid.org/0000-0003-2995-5823 Hoppe-­Seyler′s Zeitschrift für physiologische Chemie, 204, 101–104. Fox, D. L. (1976). Animal biochromes and structural colours: Physical, chemi- cal, distributional and physiological features of the coloured bodies in the animal world (2nd ed.). Berkeley, CA, USA: University of California Press. REFERENCES Fox, D. L. (1979). Biochromy, natural coloration of living things. Berkeley, CA, Ajioka, R. S., Phillips, J. D., & Kushner, J. P. (2006). Biosynthesis of heme USA: University of California Press. in mammals. Biochimica et Biophysica Acta, 1763, 723–736. https://doi. Giardine, B., Riemer, C., Hardison, R. C., Burhans, R., Elnitski, L., Shah, P., … org/10.1016/j.bbamcr.2006.05.005 Miller, W. (2005). Galaxy: A platform for interactive large-­scale genome Bai, Z., Zheng, H., Lin, J., Wang, G., & Li, J. (2013). Comparative analysis analysis. Genome Research, 15, 1451–1455. https://doi.org/10.1101/ of the transcriptome in tissues secreting purple and white nacre in gr.4086505 10396 | WILLIAMS et al.

Goecks, J., Nekrutenko, A., & Taylor, J. (2010). Galaxy: A comprehensive Ky, C. L., Blay, C., Sham-Koua, M., Vanaa, V., Lo, C., & Cabral, P. (2013). approach for supporting accessible, reproducible, and transparent Family effect on cultured pearl quality in black-­lipped pearl oyster computational research in the life sciences. Genome Biology, 11, R86. Pinctada margaritifera and insights for genetic improvement. Aquatic https://doi.org/10.1186/gb-2010-11-8-r86 Living Resources, 26, 133–145. https://doi.org/10.1051/alr/2013055 Grabherr, M. G., Haas, B. J., Yassour, M., Levin, J. Z., Thompson, D. A., Amit, Ky, C. L., Le Pabic, L., Koua, M. S., Molinari, N., Nakasai, S., & Devaux, D. I., … Chen, Z. (2011). Full-­length transcriptome assembly from RNA-­ (2015). Is pearl colour produced from Pinctada margaritifera predict- Seq data without a reference genome. Nature Biotechnology, 29, 644– able through shell phenotypes and rearing environments selections? 652. https://doi.org/10.1038/nbt.1883 Aquaculture Research, 48, 1365–2109. Grotewold, E. (2006). The genetics and biochemistry of floral pigments. Layer, G., Reichelt, J., Jahn, D., & Heinz, D. W. (2010). Structure and func- Annual Review of Plant Biology, 57, 761–780. https://doi.org/10.1146/ tion of enzymes in heme biosynthesis. Protein Science, 19, 1137–1161. annurev.arplant.57.032905.105248 https://doi.org/10.1002/pro.405 Guan, Y., Huang, L., & He, M. (2011). Construction of cDNA subtractive Leighton, D. L. (1961). Observations of the effect of diet on shell coloura- library from pearl oyster (Pinctada fucata Gould) with red color shell tion in the red abalone, Haliotis rufescens Swainson. Veliger, 4, 29–32. by SSH. Chinese Journal of Oceanology and Limnology, 29, 616–622. Lemer, S., Saulnier, D., Gueguen, Y., & Planes, S. (2015). Identification https://doi.org/10.1007/s00343-011-0200-x of genes associated with shell color in the black-­lipped pearl oys- Haas, B. J., Papanicolaou, A., Yassour, M., Grabherr, M., Blood, P. D., Bowden, ter, Pinctada margaritifera. BMC Genomics, 16, 568. https://doi. J., … MacManes, M. D. (2013). De novo transcript sequence reconstruc- org/10.1186/s12864-015-1776-x tion from RNA-­Seq: Reference generation and analysis with Trinity. Nature Liu, X., Wu, F., Zhao, H., Zhang, G., & Guo, X. (2009). A novel shell color protocols, 8, 1494–1512. https://doi.org/10.1038/nprot.2013.084 variant of the Pacific abalone Haliotis discus hannai Ino subject to ge- Hanzlik, R. P. (1976). Inorganic aspects of biological and organic chemistry. netic control and dietary influence. Journal of Shellfish Research, 28, London: Academic Press. 419–424. https://doi.org/10.2983/035.028.0226 Heinemann, I. U., Jahn, M., & Jahn, D. (2008). The biochemistry of heme Lohse, M., Bolger, A. M., Nagel, A., Fernie, A. R., Lunn, J. E., Stitt, M., & biosynthesis. Archives of Biochemistry and Biophysics, 474, 238–251. Usadel, B. (2012). R obi NA: A user-­friendly, integrated software solu- https://doi.org/10.1016/j.abb.2008.02.015 tion for RNA-­Seq-­based transcriptomics. Nucleic Acids Research, 40, Hendry, G. A., & Jones, O. T. (1980). Haems and chlorophylls: Comparison W622–W627. https://doi.org/10.1093/nar/gks540 of function and formation. Journal of Medical Genetics, 17, 1–14. https:// MacColl, R., Galivan, J., Berns, D. S., Nimec, Z., Guard-Friar, D., & doi.org/10.1136/jmg.17.1.1 Wagoner, D. (1990). The chromophore and polypeptide composi- Hibino, A., Petri, R., Buchs, J., & Ohtake, H. (2013). Production of uro- tion of Aplysia ink. The Biological Bulletin, 179, 326–331. https://doi. porphyrinogen III, which is the common precursor of all tetrapyrrole org/10.2307/1542324 cofactors, from 5-­aminolevulinic acid by Escherichia coli expressing Mann, K., & Jackson, D. J. (2014). Characterization of the pigmented shell-­ thermostable enzymes. Applied Microbiology and Biotechnology, 97, forming proteome of the common grove snail Cepaea nemoralis. BMC 7337–7344. https://doi.org/10.1007/s00253-013-4904-z Genomics, 15, 249. https://doi.org/10.1186/1471-2164-15-249 Hodges, S. A., & Derieg, N. J. (2009). Adaptive radiations: From field to McGinty, E. L., Zenger, K. R., Jones, D. B., & Jerry, D. R. (2012). Transcriptome genomic studies. Proc Natl Acad Sci USA, 106(Suppl 1), 9947–9954. analysis of biomineralisation-­related genes within the pearl sac: Host https://doi.org/10.1073/pnas.0901594106 and donor oyster contribution. Marine Genomics, 5, 27–33. https://doi. Hudson, M. F., & Smith, K. M. (1975). Bile pigments. Chemical Society org/10.1016/j.margen.2011.08.006 Reviews, 4, 363–399. https://doi.org/10.1039/cs9750400363 Meinhardt, H. (1995). The algorithmic beauty of sea shells. New York, NY, Ino, T. (1949). The effect of food on growth and coloration of the topshell USA: Springer Verlag. https://doi.org/10.1007/978-3-662-13135-0 (Turbo cornutus Solander). Journal of Marine Research, 8, 1–5. Miksik, I., Holáň, V., & Deyl, Z. (1994). Quantification and variability of eggshell Ino, T. (1958). Ecological studies of the topshell, Turbo cornutus (Solander). pigment content. Comparative Biochemistry and Physiology Part A: Physiology, II. Relation between diet and coloration of the shell. Bulletin of Tokai 109, 769–772. https://doi.org/10.1016/0300-9629(94)90220-8 Regional Fisheries Research Laboratory, 22, 33–36. Miyoshi, T., Matsuda, Y., & Komatsu, H. (1987). Fluorescence from pearls Jackson, D. J., McDougall, C., Green, K., Simpson, F., Wörheide, G., & Degnan, and shells of black lip oyster, Pinctada margaritifera, and its contribu- B. M. (2006). A rapidly evolving secretome builds and patterns a sea tion to the distinction of mother oysters used in pearl culture. Japanese shell. BMC Biology, 4, 40. https://doi.org/10.1186/1741-7007-4-40 Journal of Applied Physics, 26, 1069–1072. https://doi.org/10.1143/ Jackson, D. J., Worheide, G., & Degnan, B. M. (2007). Dynamic ex- JJAP.26.1069 pression of ancient and novel molluscan shell genes during eco- Morales, J., Velando, A., & Torres, R. (2010). Biliverdin-­based egg coloration logical transitions. BMC Evolutionary Biology, 7, 160. https://doi. is enhanced by carotenoid supplementation. Behavioral Ecology and org/10.1186/1471-2148-7-160 Sociobiology, 65, 197–203. Joron, M., Papa, R., Beltrán, M., Chamberlain, N., Mavárez, J., Baxter, S., … Moreno, J., & Osorno, J. L. (2003). Avian egg colour and sexual se- Beasley, H. (2006). A conserved supergene locus controls colour pat- lection: Does eggshell pigmentation reflect female condition tern diversity in Heliconius butterflies. PLoS Biology, 4, e303. https:// and genetic quality? Ecology Letters, 6, 803–806. https://doi. doi.org/10.1371/journal.pbio.0040303 org/10.1046/j.1461-0248.2003.00505.x Katoh, K., & Standley, D. M. (2013). MAFFT multiple sequence align- Muller, P. Y., Janovjak, H., Miserez, A. R., & Dobbie, Z. (2002). Processing ment software version 7: Improvements in performance and usability. of gene expression data generated by quantitative real-­time RTPCR. Molecular Biology and Evolution, 30, 772–780. https://doi.org/10.1093/ BioTechniques, 2002, 1372–1379. molbev/mst010 Nicholas, R. E. H., & Comfort, A. (1949). Acid-­soluble pigments of mollus- Kennedy, G. Y. (1975). Porphyrins in invertebrates. Annals of the New can shells. 4. Identification of shell porphyrins with particular reference York Academy of Sciences, 244, 662–673. https://doi.org/10.1111/ to conchoporphyrin. Biochemical Journal, 45, 208–210. https://doi. nyas.1975.244.issue-1 org/10.1042/bj0450208 Kobayashi, T., Kawahara, I., Hasakura, O., & Kijima, A. (2004). Genetic Nicholas, R. E. H., & Rimington, C. (1951). Isolation of unequivocal uropor- ­control of bluish shell color variation in the Pacific abalone, Haliotis phyrin III. A further study of turacin. Biochemical Journal, 50, 194–201. ­discus hannai. Journal of Shellfish Research, 23, 1153–1156. https://doi.org/10.1042/bj0500194 Kosaki, T. (1947). Porphyrin bodies contained in pearls. Seiri Seitai, 1, Nijhout, H. F. (2010). Molecular and physiological basis of colour pat- 247–250. tern formation. In S. J. Simpson, & J. Casas (Eds.), Insect integument WILLIAMS et al. | 10397

and colour (pp. 219–266). London, UK: Academic Press. https://doi. congenital erythropoietic porphyria. Blood, 118, 1443–1451. https:// org/10.1016/S0065-2806(10)38002-7 doi.org/10.1182/blood-2011-03-342873 Oakley, T. H., Alexandrou, M. A., Ngo, R., Pankey, M. S., Churchill, C. K., Underwood, A. J., & Creese, R. G. (1976). Observations on the biology of the Chen, W., & Lopker, K. B. (2014). Osiris: Accessible and reproducible trochid gastropod Austrocochlea constricta (Lamarck) (Prosobranchia). phylogenetic and phylogenomic analyses within the Galaxy work- II. The effects of available food on shell-­banding pattern. Journal of flow management system. BMC Bioinformatics, 15, 230. https://doi. Experimental Marine Biology and Ecology, 23, 229–240. https://doi. org/10.1186/1471-2105-15-230 org/10.1016/0022-0981(76)90022-8 Pfaffl, M. W. (2001). A new mathematical model for relative quantifica- Untergasser, A., Nijveen, H., Rao, X., Bisseling, T., Geurts, R., & Leunissen, J. tion in real-­time RT-­PCR. Nucleic Acids Research, 29, e45. https://doi. A. (2007). Primer3Plus, an enhanced web interface to Primer3. Nucleic org/10.1093/nar/29.9.e45 Acids Research, 35, 71–74. https://doi.org/10.1093/nar/gkm306 Piao, Y., Kiatpapan, P., Yamashita, M., & Murooka, Y. (2004). Effects of Warner, C. A., Yoo, H. W., Roberts, A. G., & Desnick, R. J. (1992). Congenital expression of hemA and hemB genes on production of porphyrin in erythropoietic porphyria: Identification and expression of exonic mu- Propionibacterium freudenreichii. Applied and Environment Microbiology, tations in the uroporphyrinogen III synthase gene. Journal of Clinical 70, 7561–7566. https://doi.org/10.1128/AEM.70.12.7561-7566.2004 Investigation, 89, 693–700. https://doi.org/10.1172/JCI115637 Ponka, P. (1997). Tissue-­specific regulation of iron metabolism and heme Williams, S. T. (2017). Molluscan shell colour. Biological Reviews, 92, 1039– synthesis: Distinct control mechanisms in erythroid cells. Blood, 89, 1058. https://doi.org/10.1111/brv.12268 1–25. Williams, S. T., Ito, S., Wakamatsu, K., Goral, T., Edwards, N. P., Wogelius, R. A., Qin, Y., Liu, X., Zhang, H., Zhang, G., & Guo, X. (2007). Identification and … Marsden, J. T. (2016). Identification of shell colour pigments in marine mapping of amplified fragment length polymorphism markers linked snails Clanculus pharaonius and C. margaritarius (Trochoidea; Gastropoda). to shell color in bay scallop, Argopecten irradians irradians (Lamarck, PLoS One, 11, e0156664. https://doi.org/10.1371/journal.pone.0156664 1819). Mar Biotechnol (NY), 9, 66–73. https://doi.org/10.1007/ Williams, S. T., & Ozawa, T. (2006). Molecular phylogeny suggests poly- s10126-006-6076-7 phyly of both the turban shells (family Turbinidae) and the superfam- Richards, P. M., Liu, M. M., Lowe, N., Davey, J. W., Blaxter, M. L., & Davison, ily Trochoidea (Mollusca: Vetigastropoda). Molecular Phylogenetics and A. (2013). RAD-­Seq derived markers flank the shell colour and banding Evolution, 39, 33–51. https://doi.org/10.1016/j.ympev.2005.12.017 loci of the Cepaea nemoralis supergene. Molecular Ecology, 22, 3077– Wittkopp, P. J., & Beldade, P. (2009). Development and evolution of insect 3089. https://doi.org/10.1111/mec.12262 pigmentation: Genetic mechanisms and the potential consequences of Ruxton, G. D., Sherratt, T. N., & Speed, M. P. (2004). Avoiding attack: pleiotropy. Seminars in Cell & Developmental Biology, 20, 65–71. https:// The evolutionary ecology of crypsis, warning signals and mimicry. doi.org/10.1016/j.semcdb.2008.10.002 Oxford: Oxford University Press. https://doi.org/10.1093/acprof: Wittkopp, P. J., Williams, B. L., Selegue, J. E., & Carroll, S. B. (2003). oso/9780198528609.001.0001 Drosophila pigmentation evolution: Divergent genotypes underlying Siersema, P., de Rooij, F., Edixhoven-Bosdijk, A., & Wilson, J. (1990). convergent phenotypes. Proc Natl Acad Sci USA, 100, 1808–1813. Erythrocyte porphobilinogen deaminase activity in porphyria cutanea https://doi.org/10.1073/pnas.0336368100 tarda. Clinical Chemistry, 36, 1779–1783. Yuan, T., He, M., & Huang, L. (2012). Identification of an AFLP fragment Soler, J. J., Navarro, C., Contreras, T. P., Avilés, J. M., & Cuervo, J. J. (2008). linked to shell color in the noble scallop Chlamys nobilis Reeve. Journal of Sexually selected egg colouration in spotless starlings. American Shellfish Research, 31, 33–37. https://doi.org/10.2983/035.031.0104 Naturalist, 171, 183–194. https://doi.org/10.1086/524958 Zou, K., Zhang, D., Guo, H., Zhu, C., Li, M., & Jiang, S. (2014). A preliminary Speiser, D. I., Pankey, M. S., Zaharoff, A. K., Battelle, B. A., Bracken-Grissom, study for identification of candidate AFLP markers under artificial se- H. D., Breinholt, J. W., … Oakley, T. H. (2014). Using phylogenetically-­ lection for shell color in pearl oyster Pinctada fucata. Gene, 542, 8–15. informed annotation (PIA) to search for light-­interacting genes in https://doi.org/10.1016/j.gene.2014.03.029 transcriptomes from non-­model organisms. BMC Informatics, 15, 350. https://doi.org/10.1186/s12859-014-0350-x Stark, M., Berger, S. A., Stamatakis, A., & von Mering, C. (2010). MLTreeMap SUPPORTING INFORMATION - accurate Maximum Likelihood placement of environmental DNA se- quences into taxonomic and functional reference phylogenies. BMC Additional Supporting Information may be found online in the sup- Genomics, 11, 461. porting information tab for this article. Stamatakis, A. (2014). RAxML version 8: a tool for phylogenetic analysis and post-analysis of large phylogenies. Bioinformatics, 30, 1312–1313. Tixier, R. (1945). Contribution à l’étude de quelques pigments pyrroliques naturels des coquilles de mollusques, de l’oeuf d’emeu, et du squelette How to cite this article: Williams ST, Lockyer AE, Dyal P, du corail bleu (Heliopora caerulea). Annales de l’Institut Océanographique, Nakano T, Churchill CKC, Speiser DI. Colorful seashells: 22, 243–297. Identification of haem pathway genes associated with the Tixier, R. (1952). Sur quelques pigments tetrapyrroliques provenant d’ani- synthesis of porphyrin shell color in marine snails. Ecol Evol. maux marins. Mémoires du Museum National d’Histoire Naturelle Series A, 5, 41–132. 2017;7:10379–10397. https://doi.org/10.1002/ece3.3552 To-Figueras, J., Ducamp, S., Clayton, J., Badenas, C., Delaby, C., Ged, C., … Puy, H. (2011). ALAS2 acts as a modifier gene in patients with