Sequence Analysis

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Sequence Analysis • Some algorithms analyze biological sequences for patterns – RNA splice sites – Open reading frames (ORFs): stretch of codons – Amino acid propensities in a protein – Conserved regions in • AA sequences [possible active site] • DNA/RNA [possible protein binding site] • Others make predictions based on sequence – Protein/RNA secondary structure folding 1 Bioinformatics Sequence Driven Problems • Genomics – Fragment assembly of the DNA sequence. • Not possible to read entire sequence. • Cut up into small fragments using restriction enzymes. • Then need to do fragment assembly. Overlapping similarities to matching fragments. • N-P complete problem. – Finding Genes • Identify open reading frames – Exons are spliced out. – Junk in between genes • Proteomics – Identification of functional domains in protein’s sequence • Determining functional pieces in proteins. – Protein Folding • 1D Sequence → 3D Structure 2 • What drives this process? Genome is Sequenced, What’s Next? • Tracing Phylogeny – Finding family relationships between species by tracking similarities between species. • Gene Annotation (cooperative genomics) – Comparison of similar species. • Determining Regulatory Networks – The variables that determine how the body reacts to certain stimuli. • Proteomics – From DNA sequence to a folded protein. 3 Modeling • Modeling biological processes tells us if we understand a given process • Because of the large number of variables that exist in biological problems, powerful computers are needed to analyze certain questions • Protein modeling: – Quantum chemistry imaging algorithms of active sites allow us to view possible bonding and reaction mechanisms – Homologous protein modeling is a comparative proteomic approach to determining an unknown protein’s tertiary structure • Regulatory Network Modeling: – Micro array experiments allow us to compare differences in expression for two different states – Algorithms for clustering groups of gene expression help point out possible regulatory networks (e.g. WGCNA) – Other algorithms perform statistical analysis to improve signal to noise contrast • Systems Biology Modeling: – Predictions of whole cell interactions (Organelle processes, expression modeling) – Currently feasible for specific processes (eg. Flux Balance Analysis) 4 Back to the sequence alignment problem 5 Pairwise Sequence Alignment Methods • Visual • Brute Force • Dynamic Programming • Word-Based (k tuple) 6 Visual Alignments (Dot Plots) • Matrix – Rows: Characters in one sequence – Columns: Characters in second sequence • Filling – Loop through each row; if character in row, col match, fill in the cell – Continue until all cells have been examined 7 The Dot Matrix • established in 1970 by A.J. Gibbs and G.A.McIntyre • method for comparing two amino acid or nucleotide sequences A G C T A G G A G • each sequence builds one axis of A the grid C • one puts a dot, at the intersection of same letters appearing in both T sequences • scan the graph for a series of dots A • reveals similarity G • or a string of same characters • longer sequences can also be G compared on a single page, by C using smaller dots 8 Example Dot Plot 9 An entire software module of a telecommunications switch; about two million lines of C Darker areas indicate regions with a lot of matches (a high degree of similarity). Lighter areas indicate regions with few matches (a low degree of similarity). Dark areas along the main diagonal indicate sub- modules. Dark areas off the main diagonal indicate a degree of similarity between sub- modules The largest dark squares are formed by redundancies in initializations of signal- tables and finite-state machines. 10 The Dot Matrix The very stringent, self-dotplot: The non-stringent self-dotplot: 11 Noise in Dot Plots • Nucleic Acids (DNA, RNA) – 1 out of 4 bases matches at random • Stringency (The condition under which a DNA sequence can bind to related or non- specific sequences. For example, high temperature and lower salt increases stringency such that non-specific binding or binding with low melting temperature will dissolve) – Window size is considered – Percentage of bases matching in the window is set as threshold • To filter out random matches, one uses sliding windows • A dot is printed only if a minimal number of matches occur • rule of thumb: – larger windows for DNAs (only 4 bases, more random matches) – typical window size is 15 and stringency of 10 12 Reduction of Dot Plot Noise Self alignment of ACCTGAGCTCACCTGAGTTA 13 The Dot Matrix Two similar, but not identical, sequences An indel (insertion or deletion): 14 The Dot Matrix Self-dotplot of a tandem duplication: A tandem duplication: 15 An inversion: The Dot Matrix Joining sequences: 16 The Dot Matrix Self dotplot with repeats: 17 The Dot Matrix • the dot matrix method reveals the presence of insertions or deletions • comparing a single sequence to itself can reveal the presence of a repeat of a subsequence – Inverted repeats = reverse complement • Used to determine folding of RNA molecules • self comparison can reveal several features: – similarity between chromosomes – tandem genes – repeated domains in a protein sequence – regions of low sequence complexity (same characters are often repeated) 18 Insertions/Deletions 19 Repeats/Inverted Repeats 20 Comparing Genome Assemblies 21 Chromosome Y self comparison 22 Available Dot Plot Programs • Vector NTI software package (under AlignX) 23 Available Dot Plot Programs • Vector NTI software package (under AlignX) GCG software package: • Compare http://www.hku.hk/bruhk/gcgdoc/compare.html • DotPlot+ http://www.hku.hk/bruhk/gcgdoc/dotplot.html • http://www.isrec.isb-sib.ch/java/dotlet/Dotlet.html • http://bioweb.pasteur.fr/cgi-bin/seqanal/dottup.pl • Dotter (http://www.cgr.ki.se/cgr/groups/sonnhammer/Dotter.html) 24 Available Dot Plot Programs Dotlet (Java Applet) http://www.isrec.isb- sib.ch/java/dotlet/Dotlet.html 25 Available Dot Plot Programs Dotter (http://www.cgr.ki.se/cgr/groups/sonnhammer/Dotter.html) 26 Available Dot Plot Programs EMBOSS DotMatcher, DotPath,DotUp 27 The Dot Matrix • When to use the Dot Matrix method? – unless the sequences are known to be very much alike • limits of the Dot Matrix – doesn’t readily resolve similarity that is interrupted by insertion or deletions – Difficult to find the best possible alignment (optimal alignment) – most computer programs don’t show an actual alignment 28 Dot Plot References Gibbs, A. J. & McIntyre, G. A. (1970). The diagram method for comparing sequences. its use with amino acid and nucleotide sequences. Eur. J. Biochem. 16, 1-11. Staden, R. (1982). An interactive graphics program for comparing and aligning nucleic-acid and amino-acid sequences. Nucl. Acid. Res. 10 (9), 2951-2961. 29 Next step We must define quantitative measures of sequence similarity and difference! • Hamming distance: – # of positions with mismatching characters AGTC Hamming distance = 2 CGTA • Levenshtein (or edit) distance: – # of operations required to change one string into the other (deletion, insertion, substitution) AG-TCC Levenshtein distance = 3 CGCTCA 30 Scoring • +1 for a match -1 for a mismatch? • should gaps be allowed? – if yes how should they be scored? • what is the best algorithm for finding the optimal alignment of two sequences? • is the produced alignment significant? 31 Scoring Matrices • match/mismatch score – Not bad for similar sequences – Does not show distantly related sequences • Likelihood matrix – Scores residues dependent upon likelihood substitution is found in nature – More applicable for amino acid sequences 32 Parameters of Sequence Alignment Scoring Systems: • Each symbol pairing is assigned a numerical value, based on a symbol comparison table. Gap Penalties: • Opening: The cost to introduce a gap • Extension: The cost to elongate a gap 33 DNA Scoring Systems -very simple Sequence 1 actaccagttcatttgatacttctcaaa Sequence 2 taccattaccgtgttaactgaaaggacttaaagact A G C T A 1 0 0 0 Match: 1 G 0 1 0 0 Mismatch: 0 C 0 0 1 0 Score = 5 T 0 0 0 1 34 Protein Scoring Systems T:G = -2 Sequence 1 PTHPLASKTQILPEDLASEDLTI T:T = 5 Sequence 2 PTHPLAGERAIGLARLAEEDFGM Score = 48 Scoring C S T P A G N D . matrix C 9 S -1 4 A scoring matrix is a table T -1 1 5 of values that describe the P -3 -1 -1 7 probability of a residue pair A 0 1 0 -1 4 occurring in alignment. G -3 0 -2 -2 0 6 N -3 1 0 -2 -2 0 5 D -3 0 -1 -1 -2 -1 1 6 . 35 . Amino acid exchange matrices Amino acids are not equal: 1. Some are easily substituted because they have similar: • physico-chemical properties • structure 2. Some mutations between amino acids occur more often due to similar codons The two above observations give us ways to define substitution matrices 36 Properties of Amino Acids • Substitutions with similar chemical properties • Amino acids have different biochemical and physical properties that influence their relative replaceability in evolution. 37 Scoring Matrices • table of values that describe the probability of a residue pair occurring in an alignment • the values are logarithms of ratios of two probabilities 1. probability of random occurrence of an amino acid (diagonal) 2. probability of meaningful occurrence of a pair of residues 38 Protein Scoring Systems • Scoring matrices reflect: – # of mutations to convert one to another – chemical similarity – observed mutation frequencies • Log odds matrices: – the values are logarithms of probability ratios of the probability of an aligned pair to the probability of a random alignment. • Widely used scoring matrices:
Recommended publications
  • Traveling Salesman Problem

    Traveling Salesman Problem

    TRAVELING SALESMAN PROBLEM, THEORY AND APPLICATIONS Edited by Donald Davendra Traveling Salesman Problem, Theory and Applications Edited by Donald Davendra Published by InTech Janeza Trdine 9, 51000 Rijeka, Croatia Copyright © 2010 InTech All chapters are Open Access articles distributed under the Creative Commons Non Commercial Share Alike Attribution 3.0 license, which permits to copy, distribute, transmit, and adapt the work in any medium, so long as the original work is properly cited. After this work has been published by InTech, authors have the right to republish it, in whole or part, in any publication of which they are the author, and to make other personal use of the work. Any republication, referencing or personal use of the work must explicitly identify the original source. Statements and opinions expressed in the chapters are these of the individual contributors and not necessarily those of the editors or publisher. No responsibility is accepted for the accuracy of information contained in the published articles. The publisher assumes no responsibility for any damage or injury to persons or property arising out of the use of any materials, instructions, methods or ideas contained in the book. Publishing Process Manager Ana Nikolic Technical Editor Teodora Smiljanic Cover Designer Martina Sirotic Image Copyright Alex Staroseltsev, 2010. Used under license from Shutterstock.com First published December, 2010 Printed in India A free online edition of this book is available at www.intechopen.com Additional hard copies can be obtained
  • Early Fixation of an Optimal Genetic Code

    Early Fixation of an Optimal Genetic Code

    Early Fixation of an Optimal Genetic Code Stephen J. Freeland,* Robin D. Knight,* Laura F. Landweber,* and Laurence D. Hurst² *Department of Ecology and Evolution, Princeton University; and ²Department of Biology and Biochemistry, University of Bath, Bath, England The evolutionary forces that produced the canonical genetic code before the last universal ancestor remain obscure. One hypothesis is that the arrangement of amino acid/codon assignments results from selection to minimize the effects of errors (e.g., mistranslation and mutation) on resulting proteins. If amino acid similarity is measured as polarity, the canonical code does indeed outperform most theoretical alternatives. However, this ®nding does not hold for other amino acid properties, ignores plausible restrictions on possible code structure, and does not address the naturally occurring nonstandard genetic codes. Finally, other analyses have shown that signi®cantly better code structures are possible. Here, we show that if theoretically possible code structures are limited to re¯ect plausible biological constraints, and amino acid similarity is quanti®ed using empirical data of substitution frequencies, the canonical code is at or very close to a global optimum for error minimization across plausible parameter space. This result is robust to variation in the methods and assumptions of the analysis. Although signi®cantly better codes do exist under some assumptions, they are extremely rare and thus consistent with reports of an adaptive code: previous analyses which suggest otherwise derive from a misleading metric. However, all extant, naturally occurring, secondarily derived, nonstandard genetic codes do appear less adaptive. The arrangement of amino acid assignments to the codons of the standard genetic code appears to be a direct product of natural selection for a system that minimizes the phenotypic impact of genetic error.
  • Using Local Alignments for Relation Recognition

    Using Local Alignments for Relation Recognition

    Journal of Artificial Intelligence Research 38 (2010) 1-48 Submitted 11/09; published 05/10 Using Local Alignments for Relation Recognition Sophia Katrenko [email protected] Pieter Adriaans [email protected] Maarten van Someren [email protected] Informatics Institute, University of Amsterdam Science Park 107, 1098XG Amsterdam, the Netherlands Abstract This paper discusses the problem of marrying structural similarity with semantic relat- edness for Information Extraction from text. Aiming at accurate recognition of relations, we introduce local alignment kernels and explore various possibilities of using them for this task. We give a definition of a local alignment (LA) kernel based on the Smith-Waterman score as a sequence similarity measure and proceed with a range of possibilities for com- puting similarity between elements of sequences. We show how distributional similarity measures obtained from unlabeled data can be incorporated into the learning task as se- mantic knowledge. Our experiments suggest that the LA kernel yields promising results on various biomedical corpora outperforming two baselines by a large margin. Additional series of experiments have been conducted on the data sets of seven general relation types, where the performance of the LA kernel is comparable to the current state-of-the-art results. 1. Introduction Despite the fact that much work has been done on automatic relation extraction (or recog- nition) in the past few decades, it remains a popular research topic. The main reason for the keen interest in relation recognition lies in its utility. Once concepts and semantic relations are identified, they can be used for a variety of applications such as question answering (QA), ontology construction, hypothesis generation and others.
  • 1 Introduction

    1 Introduction

    Biological sequence analysis by vector-valued functions: revisiting alignment-free methodologies for DNA and protein classification Susana Vinga Instituto de Engenharia de Sistemas e Computadores: Investigação e Desenvolvimento (INESC-ID) R. Alves Redol 9, 1000-029 Lisboa, Portugal Tel. (+351) 213 100 300 Fax: (+351) 213 145 843 E-mail: [email protected] Departamento de Bioestatística e Informática, Faculdade de Ciências Médicas – Universidade Nova de Lisboa (FCM/UNL) Campo dos Mártires da Pátria 130, 1169-056 Lisboa, Portugal Tel. (+351) 218 803 052 Fax: (+351) 218 851 920 Abstract Biological sequence analysis is at the core of bioinformatics, bringing together several fields, from computer science to probability and statistics. Its purpose is to computationally process and decode the information stored in biological macromolecules involved in all cell mechanisms of living organisms – such as DNA, RNA and proteins – and provide prediction tools to reveal their structure, function and complex relationship networks. Within this context several methods have arisen that analyze sequences based on alignment algorithms, ubiquitously used in most bioinformatics applications. Alternatively, although less explored in the literature, the use of vector maps for the analysis of biological sequences, both DNA and proteins, represents a very elegant proposal to extract information from those types of sequences using an alignment-free approach. This work presents an overview of alignment-free methods used for sequence analysis and comparison and the new trends of these techniques, applied to DNA and proteins. The recent endeavors found in the literature along with new proposals and widening of applications fully justifies a revisit to these methodologies, partially reviewed before (Vinga and Almeida, 2003).
  • Efficient Alignment-Free Sequence Similarity Measurement Based on Kendall Statistics

    Efficient Alignment-Free Sequence Similarity Measurement Based on Kendall Statistics

    Clinical and Translational Science Institute Centers 5-15-2018 K2 and K2*: efficient alignment-free sequence similarity measurement based on Kendall statistics Jie Lin Fujian Normal University Donald A. Adjeroh West Virginia University Bing-Hua Jiang University of Iowa Yue Jiang Fujian Normal University Follow this and additional works at: https://researchrepository.wvu.edu/ctsi Part of the Medicine and Health Sciences Commons Digital Commons Citation Lin, Jie; Adjeroh, Donald A.; Jiang, Bing-Hua; and Jiang, Yue, "K2 and K2*: efficient alignment-free sequence similarity measurement based on Kendall statistics" (2018). Clinical and Translational Science Institute. 957. https://researchrepository.wvu.edu/ctsi/957 This Article is brought to you for free and open access by the Centers at The Research Repository @ WVU. It has been accepted for inclusion in Clinical and Translational Science Institute by an authorized administrator of The Research Repository @ WVU. For more information, please contact [email protected]. Bioinformatics, 34(10), 2018, 1682–1689 doi: 10.1093/bioinformatics/btx809 Advance Access Publication Date: 15 December 2017 Original Paper Sequence analysis * K2 and K2 : efficient alignment-free sequence similarity measurement based on Kendall statistics Jie Lin1, Donald A. Adjeroh2, Bing-Hua Jiang3 and Yue Jiang1,* 1Department of Software engineering, College of Mathematics and Informatics, Fujian Normal University, Fuzhou 350108, China, 2Department of Computer Science & Electrical Engineering, West Virginia University, Morgantown, WV 26506, USA and 3Department of Pathology, Carver College of Medicine, The University of Iowa, Iowa City, IA 52242, USA *To whom correspondence should be addressed. Associate Editor: John Hancock Received on September 8, 2017; revised on December 11, 2017; editorial decision on December 12, 2017; accepted on December 14, 2017 Abstract Motivation: Alignment-free sequence comparison methods can compute the pairwise similarity between a huge number of sequences much faster than sequence-alignment based methods.
  • Amino Acid Substitution Matrices from an Information Theoretic Perspective

    Amino Acid Substitution Matrices from an Information Theoretic Perspective

    p J. Mol. Bd-(1991) 219, 555-565 Amino Acid Substitution Matrices from an , Information Theoretic Perspective Stephen F. Altschul National Center for Biotechnology Information National Library of Medicine National Institutes of Health Bethesda, MD 20894, U.S.S. (Received 1 October 1990; accepted 12 February 1991) Protein sequence alignments have become an important tool for molecular biologists. Local alignments are frequently constructed with the aid of a “substitution score matrix” that specifies a scorefor aligning each pair of amino acid residues. Over the years, manydifferent substitution matrices have been proposed, based on a wide variety of rationales. Statistical results, however, demonstrate that any such matrix is i.mplicitly a “log-odds” matrix, with a specific targetdistribution for aligned pairs of amino acid residues. Inthe light of information theory, itis possible to express the scores of a substitution matrix in bits and to see that different matrices are better adapted to different purposes. The most widely used matrix for protein sequence comparison has been the PAM-250 matrix. It is argued that for database searches the PAM-,I20 matrix generally is more appropriate, while for comparing two specific proteins with.suspecte4 homology the PAM-200 matrix is indicated. Examples discussed include the lipocalins, human a,B-glycoprotein, the cysticfibrosis transmembrane conductance regulator and the globins. Keywords: homology; sequence comparison; statistical significance; alignment algorithms; pattern recognition 2. Introduction . similarity measure (Smith & Waterman, 1981; Goad & Kanehisa, 1982; Sellers, 1984). This has the General methods for protein sequence comparison advantage of placing no a priori restrictions on the were introduced to molecular biology 20 years ago length of the local alignments sought.
  • Similarity in Design: a Framework for Evaluation

    Similarity in Design: a Framework for Evaluation

    MASTER’S THESIS Similarity in Design: A Framework for Evaluation Master’s Educational Program __Space and Engineering Systems__ Student: Alsalehi, Suhail Hasan Hael Signature, Name Research Advisor: Crawley, Edward F. Signature, Name, Title Moscow 2019 Copyright 2019 Author. All rights reserved. The author hereby grants to Skoltech permission to reproduce and to distribute publicly paper and electronic copies of this thesis document in whole and in part in any medium now known or hereafter created. МАГИСТЕРСКАЯ ДИССЕРТАЦИЯ Сходство в дизайне: Структура для оценки Магистерская образовательная программа__ Космические и Инженерные Системы_ Студент: Аль Салехи Сухаиль Хасан Хаил подпись, ФИО Научный руководитель: Кроули, Эдвард Ф. подпись, ФИО, должность Москва, 2019 Авторское право 2019. Все права защищены. Автор настоящим дает Сколковскому институту науки и технологий разрешение на воспроизводство и свободное распространение бумажных и электронных копий настоящей диссертации в целом или частично на любом ныне существующем или созданном в будущем носителе. "Aim for the moon. If you miss, you may hit a star" W. Clement Stone i ABSTRACT Engineered systems are rapidly increasing in complexity. Complexity, if not managed properly, can lead to inefficient design, higher risk of failures, and/or unexpected costs and schedule delays. This is specifically true during early design. The early phase of design, conceptual design, is characterized by high levels of uncertainty and fuzziness. In this phase, designers rely mostly on expertise to evaluate solution variants. Although researchers have developed many tools for solution variants evaluation during conceptual design, these tools have some drawbacks. A major drawback is that existing tools do not account for the system architecture during evaluation.
  • A Web Tool for Protein Semantic Similarity

    A Web Tool for Protein Semantic Similarity

    ProteInOn: A Web Tool for Protein Semantic Similarity Daniel Faria Catia Pesquita Francisco M. Couto Andr´eO. Falc˜ao DI–FCUL TR–07–6 March 2007 Departamento de Inform´atica Faculdade de Ciˆenciasda Universidade de Lisboa Campo Grande, 1749–016 Lisboa Portugal Technical reports are available at http://www.di.fc.ul.pt/tech-reports. The files are stored in PDF, with the report number as filename. Alternatively, reports are available by post from the above address. ProteInOn: A Web Tool for Protein Semantic Similarity Daniel Faria Catia Pesquita [email protected] [email protected] Francisco M. Couto André O. Falcão [email protected] [email protected] Departamento de Informática, Faculdade de Ciências da Universidade de Lisboa Campo Grande, 1749-016 Lisboa, Portugal ABSTRACT proaches [22]. Bioinformatics arose from the need to manage and extract Protein comparison is also essential to integrate the knowl- knowledge from the vast amount of sequence data generated edge from the sequence level to the system level. Sequence by automated Molecular Biology techniques. One impor- similarity, pattern discovery and structural comparisons are tant step for this was the development of the Gene Ontol- among the most common approaches for this purpose, but ogy (GO), which provided a unified and structured vocabu- it is also possible to compare proteins based on their an- lary to describe proteins, and also a background to compare notations within a BioOntology [14]. This type of compar- them, contributing to the integration of knowledge from the ison, called semantic similarity, is based on the structure sequence level to the system level.
  • Similarity Measures for Clustering SNP and Epidemiological Data

    Similarity Measures for Clustering SNP and Epidemiological Data

    A Service of Leibniz-Informationszentrum econstor Wirtschaft Leibniz Information Centre Make Your Publications Visible. zbw for Economics Selinski, Silvia Working Paper Similarity Measures for Clustering SNP and Epidemiological Data Technical Report, No. 2006,25 Provided in Cooperation with: Collaborative Research Center 'Reduction of Complexity in Multivariate Data Structures' (SFB 475), University of Dortmund Suggested Citation: Selinski, Silvia (2006) : Similarity Measures for Clustering SNP and Epidemiological Data, Technical Report, No. 2006,25, Universität Dortmund, Sonderforschungsbereich 475 - Komplexitätsreduktion in Multivariaten Datenstrukturen, Dortmund This Version is available at: http://hdl.handle.net/10419/22668 Standard-Nutzungsbedingungen: Terms of use: Die Dokumente auf EconStor dürfen zu eigenen wissenschaftlichen Documents in EconStor may be saved and copied for your Zwecken und zum Privatgebrauch gespeichert und kopiert werden. personal and scholarly purposes. Sie dürfen die Dokumente nicht für öffentliche oder kommerzielle You are not to copy documents for public or commercial Zwecke vervielfältigen, öffentlich ausstellen, öffentlich zugänglich purposes, to exhibit the documents publicly, to make them machen, vertreiben oder anderweitig nutzen. publicly available on the internet, or to distribute or otherwise use the documents in public. Sofern die Verfasser die Dokumente unter Open-Content-Lizenzen (insbesondere CC-Lizenzen) zur Verfügung gestellt haben sollten, If the documents have been made available under an Open gelten abweichend von diesen Nutzungsbedingungen die in der dort Content Licence (especially Creative Commons Licences), you genannten Lizenz gewährten Nutzungsrechte. may exercise further usage rights as specified in the indicated licence. www.econstor.eu Similarity Measures for Clustering SNP and Epidemiological Data Silvia Selinski SFB 475, Fachbereich Statistik, Universität Dortmund and the GENICA Network Interdisciplinary Study Group on Gene Environment Interaction and Breast Cancer in Germany, represented by C.
  • Research Article a Topology-Based Metric for Measuring Term Similarity in the Gene Ontology

    Research Article a Topology-Based Metric for Measuring Term Similarity in the Gene Ontology

    CORE Metadata, citation and similar papers at core.ac.uk Provided by PubMed Central Hindawi Publishing Corporation Advances in Bioinformatics Volume 2012, Article ID 975783, 17 pages doi:10.1155/2012/975783 Research Article A Topology-Based Metric for Measuring Term Similarity in the Gene Ontology Gaston K. Mazandu and Nicola J. Mulder Computational Biology Group, Department of Clinical Laboratory Sciences, Institute of Infectious Disease and Molecular Medicine, University of Cape Town, Cape Town 7925, South Africa Correspondence should be addressed to Nicola J. Mulder, [email protected] Received 13 December 2011; Revised 29 February 2012; Accepted 13 March 2012 Academic Editor: Satoru Miyano Copyright © 2012 G. K. Mazandu and N. J. Mulder. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. The wide coverage and biological relevance of the Gene Ontology (GO), confirmed through its successful use in protein function prediction, have led to the growth in its popularity. In order to exploit the extent of biological knowledge that GO offers in describing genes or groups of genes, there is a need for an efficient, scalable similarity measure for GO terms and GO-annotated proteins. While several GO similarity measures exist, none adequately addresses all issues surrounding the design and usage of the ontology. We introduce a new metric for measuring the distance between two GO terms using the intrinsic topology of the GO-DAG, thus enabling the measurement of functional similarities between proteins based on their GO annotations.
  • Significance and Functional Similarity for Identification of Disease Genes 3

    Significance and Functional Similarity for Identification of Disease Genes 3

    IEEE/ACM TRANSACTIONS ON COMPUTATIONAL BIOLOGY AND BIOINFORMATICS, VOL. XX, NO. YY, 2016 1 Significance and Functional Similarity for Identification of Disease Genes Pradipta Maji and Ekta Shah Abstract—One of the most significant research issues in functional genomics is insilico identification of disease related genes. In this regard, the paper presents a new gene selection algorithm, termed as SiFS, for identification of disease genes. It integrates the information obtained from interaction network of proteins and gene expression profiles. The proposed SiFS algorithm culls out a subset of genes from microarray data as disease genes by maximizing both significance and functional similarity of the selected gene subset. Based on the gene expression profiles, the significance of a gene with respect to another gene is computed using mutual information. On the other hand, a new measure of similarity is introduced to compute the functional similarity between two genes. Information derived from the protein-protein interaction network forms the basis of the proposed SiFS algorithm. The performance of the proposed gene selection algorithm and new similarity measure, is compared with that of other related methods and similarity measures, using several cancer microarray data sets. Index Terms—Disease gene identification, microarray data analysis, feature selection, protein-protein interaction network. ✦ 1 INTRODUCTION (mRMR) criterion based gene selection algorithms [3], [9], [10]. The mRMR criterion, introduced in [3], selects ENETIC diseases are mainly caused due to muta- a set of genes from microarray data by maximizing tions in genes. New mutations or changes in the G the relevance of the selected genes and minimizing the DNA, inherited genetic conditions, or some non-genetic redundancy among them.
  • A New Measure for Similarity Searching in DNA Sequences 1

    A New Measure for Similarity Searching in DNA Sequences 1

    MATCH MATCH Commun. Math. Comput. Chem. 65 (2011) 477-488 Communications in Mathematical and in Computer Chemistry ISSN 0340 - 6253 A New Measure for Similarity Searching in DNA Sequences Yusen Zhang∗ and Wei Chen School of Mathematics and Statistics, Shandong University at Weihai Weihai 264209, China (Received June 14, 2010) Abstract. The purpose of the present study was designed to develop a new mathematical model for comparison of DNA sequences. Instead of the classical distances, a new distance based on dinucleotide absolute frequency in large DNA sequences is in- troduced. The proposed distance that requires neither homologous sequences nor prior sequence alignments is used to search for similar sequences from a database. This method was tested using a set of 39 DNA sequences and a set of 63 DNA sequences. The sensitivity and the selectivity are computed to evaluate and com- pare the performance of the proposed distance measure. Real data analysis shows that it is a very efficient, high-selective and high-sensitive comparison algorithm that can determine the relative dissimilarity in a large dataset of DNA sequences very rapidly. 1 Introduction Sequence comparison is a fundamental task in Computational Biology that aims to discover similarity relationships between molecular sequences. Searching database with a DNA sequence rely heavily on sequence comparison techniques. Because of the importance of research into similarity measure, a number of efficient algorithms have been developed for searching genetic databases for biologically significant similarities in DNA sequences. The traditional algorithms for comparing biological sequences are based mostly on the technique of sequence alignment [9,28]. Such approaches have been hitherto widely used.