DOCSLIB.ORG

Taxonomy Confirmation of Puntius Cf. Binotatus from Gunung Tujuh Lake, Jambi, Indonesia Based on Cytochrome Oxidase-I (COI) Gene

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Taxonomy Confirmation of Puntius Cf. Binotatus from Gunung Tujuh Lake, Jambi, Indonesia Based on Cytochrome Oxidase-I (COI) Gene BIODIVERSITAS ISSN: 1412-033X Volume 20, Number 1, January 2019 E-ISSN: 2085-4722 Pages: 54-60 DOI: 10.13057/biodiv/d200107 Taxonomy confirmation of Puntius cf. binotatus from Gunung Tujuh Lake, Jambi, Indonesia based on Cytochrome Oxidase-I (COI) gene DEWI IMELDA ROESMA♥, DJONG HON TJONG, WILA KARLINA, DYTA RABBANI AIDIL Department of Biology, Faculty of Mathematics and Natural Sciences, Universitas Andalas. Jl. Universitas Andalas, Limau Manih, Pauh, Padang 25163, West Sumatra, Indonesia. Tel. +62-751- 777427. Fax. +62-751-71343, ♥email: [email protected]. Manuscript received: 21 September 2018. Revision accepted: 2 December 2018. Abstract. Roesma D. I, Tjong D. H, Karlina W, Aidil D. R. 2019. Taxonomy confirmation of Puntius cf. binotatus from Gunung Tujuh Lake based on Cytochrome Oxidase-I (COI) gene. Biodiversitas 20: 54-60. The population of Puntius cf. binotatus Gunung Tujuh Lake in considered as an isolated population which found in the 20-30 meters depth under the water Gunung Tujuh Lake, Sumatra Island. The species often exhibit different phenotypic characters and may genetic characters may also different due to their response to habitat/ecological conditions. Previous study on P. binotatus from several locations in West Sumatra showed the complexity of the genetic and morphological characters. A molecular study using COI gene of P. cf. binotatus from Gunung Tujuh Lake in Sumatera has been conducted to determine the taxonomic status of the fish. The distinct morphological characters of Puntius cf. binotatus is one black spot in the middle of the caudal and the absent of black spot on the base of the anterior dorsal ray. The analysis on COI gene showed that the range of sequence divergences between P. cf. binotatus Gunung Tujuh Lake and other Sumatra P. cf. binotatus is 3.1-7.6% and 4.1% to Barbodes banksi. This value represents the differences at the subspecies level of Barbodes banksi. Therefore Barbodes banksi gunungtujuh is proposed as an appropriate name to P. cf. binotatus Gunung Tujuh Lake. Keywords: Morphology, Cyt b gene, COI gene, Gunung Tujuh Lake, Puntius cf. binotatus INTRODUCTION consisting of five rivers (Salibutan, Batang Kuranji, Sungai Asam, Batang Gumanti and Batang Sinamar) and one lake Gunung Tujuh Lake, Kerinci District, Jambi Province is (Lake Maninjau) in West Sumatra showed significant located in Sumatra Island, Indonesia at an altitude of 1,950 morphological differences among the locations. Recent meters above sea level, surrounded by volcanic mountains study, Karlina et al. (2016) using cyt b gene on P. cf. that have seven peaks. There is no river flow into the lake binotatus from Gunung Tujuh Lake and P. cf. Binotatus as the water source for the lake, except for water catchment recommended that P. cf. binotatus from Gunung Tujuh surrounding that entering the lake through the small rivers. Lake as a candidate of a new species. Water flows out of the lake directly forming a 75 meters According to Kottelat (2013), Puntius and Barbodes are high waterfall. It is believed that the fish live in this lake synonymous. Previously Taki et al. (1978), Mohsin and have been isolated for a long period. It has been proven that Ambak (1983), and Rainboth (1996) used the Barbonymus, the population in perfectly isolated habitats that prevent the Barbus, Barbodes, Systomus, Capoeta, and Hypsibarbus as migration of individuals between populations. If there is the generic names. Roesma et al. (2018) reported those limited gene flow between populations, the frequency of genera are not synonym and P. cf. binotatus is suggested as genes in a population will be different from before, in Barbodes banksi from West Sumatra that consist of at least which the genetic mixing between populations still occur three subspecies based on Cytochrome Oxidase-I (COI) (Roesma et al. 2017). Handika et al. (2014) reported that gene. Based on the previous studies, it is crucial to use there is a type of fish with genus Puntius in Gunung Tujuh CO1 gene to identify and verify the taxonomic status of Lake that live in the 20-30 meters depth under the lake. Silver Barb (P. cf. binotatus) from Gunung Tujuh Lake. A Based on the phenotypic characters identified, the species mtDNA gene has been widely used for taxonomic, is similar to P. binotatus, so it is identified as P. cf. phylogenetic and phylogeography studies in the Silver binotatus. According to Champasri et al. (2007) and Barb (John et al. 2013; Singh et al. 2013; Negi et al. 2017). Collins et al. (2012), Silver Barb or Spotted Barb are the The COI gene is a part of mtDNA used for species common names of Puntius, and they are sold for food and identification (DNA barcode). The DNA barcode is ornamental fish. designed to develop a rapid species identification that also Based on molecular studies using the cytochrome b allows detecting new species (Hebert et al. 2003a; Stoeckle gene (cyt b) mitochondrial DNA, Roesma (2011) and 2003; Hebert and Gregory 2005). COI gene has rapid Roesma et al. (2016) reported that P. binotatus from evolutionary rates than other mtDNA genes. Therefore, is several locations in West Sumatra reflected the complex useful for identification at species level, and has been and variable genetic and morphological characters among applied to identify numerous animal taxa (Hebert et al. the locations and considered them as P. cf. binotatus. Vitri 2003a; Clare et al. 2006; Hajibabaei et al. 2007; Smith et et al. (2012) reported that P. binotatus from six populations al. 2008; Frezal and Leblois 2008). ROESMA et al. – Taxonomy confirmation of Puntius cf. binotatus 55 MATERIAL AND METHODS 30 seconds, elongation at 72ºC for 1 minute and a final extension at 72ºC for 10 minutes. The PCR products were A total of 50 individuals of P. cf. binotatus in Gunung visualized in 2% agarose at 100 Volt, 20 W for 50 min. Tujuh Lake, Kerinci District, Jambi Province, Indonesia Good quality PCR product was used as samples for were collected following Cailiet et al. (1986). A piece of sequencing, performed in MacroGen USA DNA the tissue samples collected from individuals and stored in Sequencing Laboratory. Eppendorf tubes (1.5 mL) containing 96% ethanol PA. A total of 46 sequences of COI gene were analyzed Individual samples were temporarily stored in 10% consisted of four sequences Puntius cf. binotatus in formalin and transferred in 70% ethanol for long-term Gunung Tujuh Lake, 17 sequences P. cf. binotatus of other storage. Morphological measurements were done for 29 populations in Sumatra and 25 sequences taken from morphometric and 17 meristic characters following Genbank NCBI included outgroup species (Rasbora Kottelat et al. (1993) and Haryono and Tjakrawidjaja daniconius, Danio choprai, and Botia rostrata) (Table 1). (2006) with additional three characters: Lenght of upper DNA sequences (forward and reverse) were assembled and caudal (LUCL), Lenght of lower caudal (LLCL) and edited using the DNA STAR program (Burland 2000). Lenght of middle caudal (LMCL). Morphometric and DNA sequence of P. cf. binotatus compared with the meristic characters were measured using digital calipers to sequences contained in NCBI, to check the similarity of all the nearest 0.1 mm. sequences in http: //blast.ncbi.nlm.nih.gov/Blast.cgi. All Total genomic DNA was extracted using Invitrogen sequences were aligned using the Clustal X program PureLinkTM Genomic DNA Mini Kit. The result of DNA (Thompson 1997). The aligned sequences were edited extraction was used for Polymerase chain reaction (PCR) using BIOEDIT program (Hall 1999). The number of amplification using thermal cycler (SensoQuest). PCR was polymorphic sequences was analyzed using the DNA conducted in 25 μl volumes containing 2x MyTaq Hs Red Sequence Polymorphism 5.10 (Rozas 2003). Sequence Mix (Bioline), 0.01 mM forward and reverse primer, 35 divergences of all sequences were analyzed using the ng/μl DNA template and 10 μl nuclear-free water. Primer Kimura-2 parameter model (K2P) in the MEGA 6.0 used were forward (Fish F1: 5'TCAACCAACCACAAA program (Tamura 2013). The phylogenetic tree was GACATTGG CAC3') and reverse (Fish R1: reconstructed based on four methods; Neighbors Joining 5'TAGACTTCTGGGTGGCCAAAGAATCA3') (Ward et (NJ), Maximum Evolution (ME), Maximum Likelihood al. 2005). The optimal PCR condition consisting of initial (ML) and Maximum Parsimony (MP) using MEGA 6.0 denaturation at 95°C for 2 minutes, 35 cycles consisting of (Tamura 2013). denaturation at 94ºC for 30 seconds, annealing at 54ºC for Table 1. List of freshwater fish species barcoded along with GenBank Accession Numbers Family Genus Species Location Accession No. Sources Cyprinidae Puntius Puntius binotatus Lampung JQ665834 Wibowo et al. (2012) Puntius binotatus Malaysia JN646096 Sade and Biun (2012) Puntius banksi Malaysia JF781235 Song et al. (2013) Puntius sophore India JX983465 Khedkar et al. (2014) Puntius denisonii India HQ176003 Lakra et al. (2010) Puntius orphoides JF915642 Collins et al. (2011) Puntius sarana India EU417805 Lakra et al. (2008) Puntius sarana India JQ667570 Khedkar et al. (2014) Puntius sarana subnasutus HE664122 Vincent (2012) Barbodes Barbodes binotatus Malaysia KT001028 Meganathan et al. (2015) Barbodes binotatus Thailand KP263421 Panprommin and Chanto (2014) Systomus Systomus sarana India JX983454 Khedkar et al. (2014) Systomus sarana India KJ476776 Lal et al. (2014) Systomus orphoides Thailand KP263417 Panprommin and Chanto (2014) Barbus Barbus matthesi Afrika KR153301 Sakharova (2015) Barbus camptacanthus Afrika HM418123 iBOL (2010) Barbus callipterus Afrika HM418124 iBOL (2010) Barbus brazzai Afrika KT193523 Decru et al. (2015) Barbonymus Barbonymus schwanenfeldii Malaysia KT001008 Meganathan et al. (2015) Barbonymus schwanenfeldii Laos JQ346171 Pasco-Viel et al. (2012) Barbonymus altus Afrika KU568767 Van Der Walt et al. (2012) Barbonymus gonionotus Philipina HQ682667 Aquino et al. (2011) Rasbora Rasbora daniconius India JX983478 Khedkar et al. (2012) Danio Danio choprai Myanmar KX852477 Kullander and Noren (2016) Botiidae Botia Botia rostrata China KM610433 Chen et al.
Load more

Recommended publications
  • Cypriniformes: Cyprinidae) from Kali River, Karnataka Region of Western Ghats, Peninsular India
    Iran. J. Ichthyol. (December 2016), 3(4): 266–274 Received: August 14, 2016 © 2016 Iranian Society of Ichthyology Accepted: November 28, 2016 P-ISSN: 2383-1561; E-ISSN: 2383-0964 doi: 10.7508/iji.2016. http://www.ijichthyol.org Description of a new species of large barb of the genus Hypselobarbus (Cypriniformes: Cyprinidae) from Kali River, Karnataka region of Western Ghats, peninsular India Muthukumarasamy ARUNACHALAM*1, Sivadoss CHINNARAJA2, Paramasivan SIVAKUMAR2, Richard L. MAYDEN3 1Manonmaniam Sundaranar University, Sri Paramakalyani Centre for Environmental Sciences, Alwarkurichi–627 412, Tamil Nadu, India. 2Research Department of Zoology, Poompuhar College (Autonomous), Melaiyur-609 107, Sirkali, Nagapattinam dist., Tamil Nadu, India. 3Department of Biology, Saint Louis University, Saint Louis, Missouri 63103, USA. * Email: [email protected] Abstract: A new cyprinid fish, Hypselobarbus kushavali, is described from Kali River, Karnataka, India. Hypselobarbus kushavali is diagnosed from its closest congener, H. dobsoni, by having more upper transverse scale rows, more circumferential scale rows and more lateral line to pelvic scale rows, and from H. bicolor and H. jerdoni by having fewer lateral-line and fewer circumpeduncular scale rows. Diagnostic features for H. kushavali are also provided relative to other species of the genus. Keywords: Cyprinidae, Hypselobarbus kushavali, Distribution, Taxonomy. Zoobank: urn:lsid:zoobank.org:pub:680F325A-0131-47D5-AFD0-E83F7C3D74C3 urn:lsid:zoobank.org:act:C06CDB6B-0969-4D7B-9478-A9E1395596CB Citation: Arunachalam, M.; Chinnaraja, S.; Sivakumar P. & Mayden, R.L. 2016. Description of a new species of large barb of the genus Hypselobarbus (Cypriniformes: Cyprinidae) from Kali River, Karnataka region of Western Ghats, peninsular India. Iranian Journal of Ichthyology 3(4): 266-274.
    [Show full text]
  • From India: a Glimpse Through Advanced Morphometric Toolkits
    Morphological plasticity in a wild freshwater sh, Systomus sarana (Cyprinidae) from India: a glimpse through advanced morphometric toolkits Deepmala Gupta University of Lucknow Faculty of Science Arvind Kumar Dwivedi Barkatullah Vishwavidyalaya Faculty of Life Sciences Madhu Tripathi ( [email protected] ) University of Lucknow Faculty of Science https://orcid.org/0000-0003-1618-4994 Research article Keywords: Intraspecies diversity, Morphological variations, Systomus sarana, Landmark based analysis Posted Date: November 5th, 2020 DOI: https://doi.org/10.21203/rs.3.rs-35594/v2 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Page 1/32 Abstract Background: Body morphology supposed to underpin wide differences in animal performance that can be used to understand the diversication of characters. Further, identifying the sh population with unique shape due to variations in their morphometric characters enable better management of these subunits. Advanced statistical toolkits of morphometry called truss network system and geometric morphometrics have been increasingly used for detecting variations in morphological traits between subunits of sh populations. The present study was therefore carried out with the objective of determining phenotypically distinct units of freshwater sh Systomus sarana collected from geographically isolated locations. Methods: In the present study, 154 specimens of olive barb, S. sarana were collected from four distantly located rivers covering the northern (Ganga), southern (Godavari), central (Narmada), and eastern (Mahanadi) regions of India. Truss-network system and geometric morphometrics have been utilized. Fourteen landmarks were digitized uniformly on each specimen. In the present study, the truss network system yielded size-corrected morphometric characters that were subjected to univariate and multivariate statistical assessment.
    [Show full text]
  • Freshwater Fish Survey of Homadola-Nakiyadeniya Estates, Sri Lanka
    FRESHWATER FISH SURVEY OF HOMADOLA-NAKIYADENIYA ESTATES, SRI LANKA. Prepared by Hiranya Sudasinghe BSc. (Hons) Zoology, M.Phil. reading (University of Peradeniya) INTRODUCTION The diversity of freshwater fishes in Sri Lanka is remarkably high, with a total of 93 indigenous fishes being recorded from inland waters, out of which 53 are considered to be endemic (MOE, 2012; Batuwita et al., 2013). Out of these, 21 are listed as Critically Endangered, 19 as Endangered and five as Vulnerable in the National Red List (MOE, 2012). In addition, several new species of freshwater fishes have been discovered in the recent past which have not yet been evaluated for Red Listing (Batuwita et al., 2017; Sudasinghe 2017; Sudasinghe & Meegaskumbura, 2016; Sudasinghe et al., 2016). Out of the 22 families that represent the Sri Lankan freshwater ichthyofauna, the family Cyprinidae dominates, representing about 50% of the species, followed by the families Gobiidae, Channidae and Bagridae, which represent seven, five and four species, respectively. The remainder of the other families are each represented in Sri Lanka by three species or less. Four major ichthyological zones, viz. Southwestern zone, Mahaweli zone, Dry zone and the Transition zone were identified by Senanayake and Moyle (1982) based on the distribution and the endemism of the fish. The Southwestern zone shows the greatest diversity, followed by the Mahaweli zone, with the least diversity observed in the Dry zone. About 60% of the freshwater fishes occur both in the dry and the wet zones of the island while the rest are more or less restricted to the wet zone. Of the endemic fishes, more than 60% are restricted to the wet zone of the island while about 30% occur in both the dry and the wet zones.
    [Show full text]
  • Molecular Investigations of the Diversity of Freshwater Fishes Across Three Continents
    Molecular Investigations of the Diversity of Freshwater Fishes across Three Continents by Malorie M. Hayes A dissertation submitted to the Graduate Faculty of Auburn University in partial fulfillment of the requirements for the Degree of Doctor of Philosophy Auburn, Alabama August 8, 2020 Keywords: Enteromius, Barbus, sub-Saharan Africa, phylogenetics, systematics, Pteronotropis, conservation genetics, Trichomycterus, Guyana Copyright 2020 by Malorie M. Hayes Approved by Jonathan W. Armbruster, Chair, Professor and Director Auburn University Museum of Natural History Department of Biological Sciences Jason E. Bond, Professor and Schlinger Chair in Insect Systematics University of California, Davis Scott R. Santos, Professor and Chair of the Department of Biological Sciences at Auburn University John P. Friel, Director of the Alabama Museum of Natural History Abstract Fishes are the most speciose vertebrates, and incredible diversity can be found within different groups of fish. Due to their physiological limitations, fish are confined to waters, and in freshwater fish, this is restricted to lakes, rivers, and streams. With a constrained habitat like a freshwater system, it can be expected that freshwater fish will show varying levels of diversity depending on a suite of characteristics. Within this dissertation, I examine the diversity of three fish groups: the speciose Enteromius of West Africa, the population genetic diversity of Pteronotropis euryzonus in Alabama and Georgia, and the unexpectedly species rich Trichomycterus from the Guyana highlands. I use molecular methods and geometric morphometrics to determine the systematics of the species and uncover the hidden diversity within their respective groups. When it comes to diversity, the small barbs of Africa are vastly understudied and require a taxonomic revision.
    [Show full text]
  • Marmorata Heckel
    Hematological Characterization of Triplophysa marmorata Heckel DISSERTATION Submitted in partial fulfillment of the requirements for the Award of the Degree of MASTER OF PHILOSOPHY In ZOOLOGY By Maryum Meraj Under the Joint Supervision Prof. (Dr.) A.R Yousuf Dr. Farooz Ahmad Bhat Supervisor Co-Supervisor Professor Centre of Research for Development Asst. Prof. (SS), Faculty of Fisheries, P.G. Department of Environmental Science SKUAST-K. University of Kashmir, Sgr. Centre of Research for Development Faculty of Biological Science The University of Kashmir Srinagar - 190 006, Kashmir (NAAC Accredited Grade 'A' University) 2013 CORD, University of Kashmir 1 Centre of Research for Development University of Kashmir Srinagar – 190 006, Kashmir No: Date: Certificate This is to certify that the dissertation entitled “Hematological characterization of Triplophysa marmorata Heckel” submitted to the University of Kashmir for the award of the Degree Masters of Philosophy in Zoology, is the original research work of Ms. Maryum Meraj, a bonafide M. Phil. Research Scholar of the Centre, carried out under my supervision. The dissertation has not been submitted to this University or to some other University so far and is submitted for the first time. It is further certified that this dissertation is fit for submission for the degree of Masters of Philosophy (M. Phil.) in Zoology and the candidate has fulfilled all the statutory requirements for the completion of the M.Phil. Programme. Prof. (Dr.) A.R Yousuf Dr. Farooz Ahmad Bhat Supervisor Co-Supervisor Professor Centre of Research for Development Asst. Prof. (SS), Faculty of Fisheries, P.G. Department of Environmental Science SKUAST-K.
    [Show full text]
  • Pethia Guganio (Glass Barb) Ecological Risk Screening Summary
    Glass Barb (Pethia guganio) Ecological Risk Screening Summary U.S. Fish and Wildlife Service, August 2013 Revised, July 2018 Web Version, 8/7/2019 Photo: A. Bentley, University of Kansas Biodiversity Institute. Licensed under CC BY 4.0. Available: https://www.gbif.org/occurrence/656971757. (July 2018). 1 Native Range and Status in the United States Native Range From Dahanukar (2015): “Pethia guganio is widely distributed in India (Ganga, Brahmaputra, Yamuna river systems in the Gangetic Provinces, Assam, Bihar, Uttar Pradesh, West Bangal), Bangladesh. Jayaram (1991).” From Eschmeyer et al. (2018): “Ganga-Brahmaputra basin, Nepal, India and Bangladesh.” Status in the United States This species has not been reported as introduced or established in the United States. There is no indication that this species is in trade in the United States. 1 Means of Introductions in the United States This species has not been reported as introduced or established in the United States. Remarks Both the accepted name Pethia guganio and the synonym Puntius guganio were used when researching in preparation of this assessment. 2 Biology and Ecology Taxonomic Hierarchy and Taxonomic Standing From ITIS (2018): “Kingdom Animalia Subkingdom Bilateria Infrakingdom Deuterostomia Phylum Chordata Subphylum Vertebrata Infraphylum Gnathostomata Superclass Actinopterygii Class Teleostei Superorder Ostariophysi Order Cypriniformes Superfamily Cyprinoidea Family Cyprinidae Genus Puntius Species Puntius guganio (Hamilton, 1822) – glass-barb” From Eschmeyer et al. (2018):
    [Show full text]
  • Liste De Faune Et De Flore
    Paysage Lac Tele Lac Tumba BIODIVERSITE DU SITE RAMSAR NGIRI-TUMBA-MAINDOMBE Annexe 1.Liste des espèces de poisson du Site Ngiri-Tumba-Maindombe Liste rouge UICN Famille No Genre Espèce Auteur CITES CMS Statut Année Tendance Ordre des CHARACIFORMES 1 Alestes liebrechtsii Boulenger, 1898 LC 2010 inconnu 2 Alestopetersius bifasciatus Poll, 1967 LC 2010 inconnu 3 Alestopetersius caudalis Boulenger, 1899 LC 2010 inconnu 4 Alestopetersius hilgendorfi Boulenger, 1899 LC 2010 inconnu 5 Alestopetersius leopoldianus Boulenger, 1899 LC 2010 inconnu 6 Bathyaethiops caudomaculatus Pellegrin, 1925 LC 2010 inconnu 7 Brycinus bimaculatus Boulenger, 1899 LC 2010 inconnu 8 Brycinus grandisquamis Boulenger, 1899 LC 2010 inconnu ALESTIDAE 9 Brycinus macrolepidotus Valenciennes, 1850 LC 2010 inconnu 10 Bryconaethiops boulengeri Pellegrin, 1900 LC 2010 inconnu 11 Clupeocharax schoutedeni Pellegrin, 1926 VU 2010 inconnu 12 Hydrocynus goliath Boulenger, 1898 LC 2010 inconnu 13 Hydrocynus vittatus Castelnau, 1861 LC 2010 inconnu 14 Micralestes humilis Boulenger, 1899 LC 2010 inconnu 15 Phenacogrammus altus Boulenger, 1899 LC 2010 inconnu 16 Phenacogrammus deheyni Poll, 1945 LC 2010 inconnu 17 Citharinus gibbosus Boulenger, 1899 LC 2010 inconnu CITHARINIDAE 18 Citharinus macrolepis Boulenger, 1899 LC 2010 inconnu 19 Belonophago hutsebouti Giltay, 1929 LC 2010 inconnu 20 Distichodus antonii Schilthuis, 1891 LC 2010 inconnu DISTICHODONTIDAE 21 Distichodus atroventralis Boulenger, 1898 LC 2010 inconnu 22 Distichodus fasciolatus Boulenger, 1898 LC 2010 inconnu 23
    [Show full text]
  • Scale Morphologies of Freshwater Fishes at Tembat Forest Reserve, Terengganu, Malaysia (Morfologi Sisik Ikan Air Tawar Di Hutan Simpan Tembat, Terengganu, Malaysia)
    Sains Malaysiana 46(9)(2017): 1429–1439 http://dx.doi.org/10.17576/jsm-2017-4609-11 Scale Morphologies of Freshwater Fishes at Tembat Forest Reserve, Terengganu, Malaysia (Morfologi Sisik Ikan Air Tawar di Hutan Simpan Tembat, Terengganu, Malaysia) FARAH AYUNI FARINORDIN*, WAN SERIBANI WAN NILAM, SHAHRIL MOD HUSIN, ABDULLAH SAMAT & SHUKOR MD. NOR ABSTRACT Scales are calcium carbonate and collagen-contained structures embedded within the fish epidermis and useful for species identification. This study aimed to describe morphological characteristics of scales and use the differences to prepare keys to species. Fishes were sampled from selected rivers of Tembat Forest Reserve, Hulu Terengganu. Specimens caught were from 3 families (Cyprinidae, Channidae, Nandidae) and 17 species. Each species was represented by ten individuals (size ranges 2.5 - 50 cm TL). The scales were removed, soaked in H2O2 (0.5%), NH3 (0.3%), DH2O and mounted between a pair of glass slides for digital photographing. The morphological descriptions were based on types of scales, distinctiveness of radii arrangement at the anterior field, radii cover, radii distribution, overall shape, focus position and focus pattern. Keys to species were constructed based on these scale morphological characters described. Measurements of scale total length (L), total width (W), rostral field length (L1) and caudal field length (L2) of the scales were taken using Image J software. The inter-specific variation among scales was indicated by L1/L, L2/L, L1/L2 and W/L indices through multiple comparison tests (ANOVA). It was found that all 17 species showed significant differences with at least one other species in all four indices.
    [Show full text]
  • Jlb Smith Institute of Ichthyology
    ISSN 0075-2088 J.L.B. SMITH INSTITUTE OF ICHTHYOLOGY GRAHAMSTOWN, SOUTH AFRICA SPECIAL PUBLICATION No. 56 SCIENTIFIC AND COMMON NAMES OF SOUTHERN AFRICAN FRESHWATER FISHES by Paul H. Skelton November 1993 SERIAL PUBLICATIONS o f THE J.L.B. SMITH INSTITUTE OF ICHTHYOLOGY The Institute publishes original research on the systematics, zoogeography, ecology, biology and conservation of fishes. Manuscripts on ancillary subjects (aquaculture, fishery biology, historical ichthyology and archaeology pertaining to fishes) will be considered subject to the availability of publication funds. Two series are produced at irregular intervals: the Special Publication series and the Ichthyological Bulletin series. Acceptance of manuscripts for publication is subject to the approval of reviewers from outside the Institute. Priority is given to papers by staff of the Institute, but manuscripts from outside the Institute will be considered if they are pertinent to the work of the Institute. Colour illustrations can be printed at the expense of the author. Publications of the Institute are available by subscription or in exchange for publi­ cations of other institutions. Lists of the Institute’s publications are available from the Publications Secretary at the address below. INSTRUCTIONS TO AUTHORS Manuscripts shorter than 30 pages will generally be published in the Special Publications series; longer papers will be considered for the Ichthyological Bulletin series. Please follow the layout and format of a recent Bulletin or Special Publication. Manuscripts must be submitted in duplicate to the Editor, J.L.B. Smith Institute of Ichthyology, Private Bag 1015, Grahamstown 6140, South Africa. The typescript must be double-spaced throughout with 25 mm margins all round.
    [Show full text]
  • Resource Enhancement and Sustainable Aquaculture Practices in Southeast Asia 2014 (RESA)
    Challenges in Responsible Production of Aquatic Species Proceedings of the International Workshop on Resource Enhancement and Sustainable Aquaculture Practices in Southeast Asia 2014 (RESA) Maria Rowena R. Romana-Eguia Fe D. Parado-Estepa Nerissa D. Salayo Ma. Junemie Hazel Lebata-Ramos Editors Southeast Asian Fisheries Development Center AQUACULTURE DEPARTMENT Tigbauan, Iloilo, Philippines www.seafdec.org.ph Challenges in Responsible Production of Aquatic Species Proceedings of the International Workshop on Resource Enhancement and Sustainable Aquaculture Practices in Southeast Asia 2014 (RESA) August 2015 ISBN: 978-971-9931-04-1 Copyright © 2015 Southeast Asian Fisheries Development Center Aquaculture Department Tigbauan, Iloilo, Philippines ALL RIGHTS RESERVED No part of this publication may be reproduced or transmitted in any form or by any means, electronic or mechanical, including photocopy, recording, or any information storage and retrieval system, without the permission in writing from the publisher. For inquiries SEAFDEC Aquaculture Department Tigbauan 5021, Iloilo, Philippines Tel (63-33) 330 7030; Fax (63-33) 330 7031 E-mail: [email protected] Website: www.seafdec.org.ph On the cover Logo design courtesy of Mr. Demy D. Catedral of SEAFDEC/AQD International Workshop on Resource Enhancement and Sustainable Aquaculture Practices in Southeast Asia (2014: Iloilo City, Philippines). Resource enhancement and sustainable aquaculture practices in Southeast Asia: challenges in responsible production of aquatic species : proceedings of the international workshop on resource enhancement and sustainable aquaculture practices in Southeast Asia 2014 (RESA) / Maria Rowena R. Romana-Eguia, Fe D. Parado-Estepa, Nerissa D. Salayo, Ma. Junemie Hazel L. Ramos, editors. -- Tigbauan, Iloilo, Philippines : Aquaculture Dept., Southeast Asian Fisheries Development Center, 2015, ©2015.
    [Show full text]
  • Biodiversity Status.Qxp
    163 BIODIVERSITY STATUS OF FISHES INHABITING RIVERS OF KERALA (S. INDIA) WITH SPECIAL REFERENCE TO ENDEMISM, THREATS AND CONSERVATION MEASURES Kurup B.M. Radhakrishnan K.V. Manojkumar T.G. School of Industrial Fisheries, Cochin University of Science & Technology, Cochin 682 016, India E-mail: [email protected] ABSTRACT The identification of 175 freshwater fish- es from 41 west flowing and 3 east flowing river systems of Kerala were confirmed. These can be grouped under 106 ornamental and 67 food fish- es. The biodiversity status of these fishes was assessed according to IUCN criteria. The results showed that populations of the majority of fish species showed drastic reduction over the past five decades. Thirty-three fish species were found to be endemic to the rivers of Kerala. The distributions of the species were found to vary within and between the river systems and some of the species exhibited a high degree of habitat specificity. The diversity and abundance of the species generally showed an inverse relationship with altitude. The serious threats faced by the freshwater fishes of Kerala are mostly in the form of human interventions and habitat alter- ations and conservation plans for the protection and preservation of the unique and rare fish bio- diversity of Kerala are also highlighted. 164 Biodiversity status of fishes inhabiting rivers of Kerala (S.India) INTRODUCTION river. Habitat diversity was given foremost importance during selection of locations within the river system. Kerala is a land of rivers which harbour a rich The sites for habitat inventory were selected based on and diversified fish fauna characterized by many rare channel pattern, channel confinement, gradient and and endemic fish species.
    [Show full text]
  • Resolving Cypriniformes Relationships Using an Anchored Enrichment Approach Carla C
    Stout et al. BMC Evolutionary Biology (2016) 16:244 DOI 10.1186/s12862-016-0819-5 RESEARCH ARTICLE Open Access Resolving Cypriniformes relationships using an anchored enrichment approach Carla C. Stout1*†, Milton Tan1†, Alan R. Lemmon2, Emily Moriarty Lemmon3 and Jonathan W. Armbruster1 Abstract Background: Cypriniformes (minnows, carps, loaches, and suckers) is the largest group of freshwater fishes in the world (~4300 described species). Despite much attention, previous attempts to elucidate relationships using molecular and morphological characters have been incongruent. In this study we present the first phylogenomic analysis using anchored hybrid enrichment for 172 taxa to represent the order (plus three out-group taxa), which is the largest dataset for the order to date (219 loci, 315,288 bp, average locus length of 1011 bp). Results: Concatenation analysis establishes a robust tree with 97 % of nodes at 100 % bootstrap support. Species tree analysis was highly congruent with the concatenation analysis with only two major differences: monophyly of Cobitoidei and placement of Danionidae. Conclusions: Most major clades obtained in prior molecular studies were validated as monophyletic, and we provide robust resolution for the relationships among these clades for the first time. These relationships can be used as a framework for addressing a variety of evolutionary questions (e.g. phylogeography, polyploidization, diversification, trait evolution, comparative genomics) for which Cypriniformes is ideally suited. Keywords: Fish, High-throughput
    [Show full text]