Vibrio Parahaemolyticus Host Pathogen

FUNCTIONAL ANALYSIS OF THE ROLE OF ALTERNATIVE SIGMA

FACTORS IN VIBRIO PARAHAEMOLYTICUS HOST PATHOGEN

INTERACTIONS

Brandy L. Haines-Menges

A dissertation submitted to the Faculty of the University of Delaware in partial fulfillment of the requirements for the degree of Doctor of Philosophy in Biological Sciences

Summer 2015

ProQuest Number: 3730237

INFORMATION TO ALL USERS The quality of this reproduction is dependent upon the quality of the copy submitted.

In the unlikely event that the author did not send a complete manuscript and there are missing pages, these will be noted. Also, if material had to be removed, a note will indicate the deletion.

ProQuest 3730237

Published by ProQuest LLC (2015). Copyright of the Dissertation is held by the Author.

ProQuest LLC. 789 East Eisenhower Parkway P.O. Box 1346 Ann Arbor, MI 48106 - 1346

FUNCTIONAL ANALYSIS OF THE ROLE OF ALTERNATIVE SIGMA

FACTORS IN VIBRIO PARAHAEMOLYTICUS HOST PATHOGEN

INTERACTIONS

Brandy L. Haines-Menges

Approved: ______Robin W. Morgan, Ph.D. Chair of the Department of Biological Sciences

Approved: ______George H. Watson, Ph.D. Dean of the College of Arts and Sciences

Approved: ______James G. Richards, Ph.D. Vice Provost for Graduate and Professional Education

I certify that I have read this dissertation and that in my opinion it meets the academic and professional standard required by the University as a dissertation for the degree of Doctor of Philosophy.

Signed: ______E. Fidelma Boyd, Ph.D. Professor in charge of dissertation

Signed: ______Thomas E. Hanson, Ph.D. Member of dissertation committee

Signed: ______Michelle A. Parent, Ph.D. Member of dissertation committee

Signed: ______Daniel Simmons, Ph.D. Member of dissertation committee I certify that I have read this dissertation and that in my opinion it meets the academic and professional standard required by the University as a dissertation for the degree of Doctor of Philosophy.

Signed: ______Diane Herson, Ph.D. Member of dissertation committee

ACKNOWLEDGMENTS

When I thought of all the people who deserve an acknowledgement for their guidance and support throughout the Ph.D. process a simple ‘thank you’ seems insufficient to describe the impact they have had on my development as both a scholar and better version of myself. First I have to express sincere gratitude to my advisor and mentor, Dr. E. Fidelma Boyd, for providing the opportunity to work in her lab and for providing this project. She has shown extraordinary patience as I struggled with external factors and finding my scientific passion. It is because of her excellent mentorship and ability to deliver constructive criticism when it was most needed that I have been able to write this dissertation and that I feel prepared to enter the next phase of my career, whatever direction that may take me. Secondly, I would like to thank all of the current and past members of the Boyd lab; I could not have asked for a better group of individuals to work with and develop a friendship with. They are always ready with a listening ear, advice on experiments and constructive criticism when asked while reviewing presentations and manuscripts. I have to particularly thank and acknowledge Dr. W. Brian Whitaker for training me when I first joined the lab and for always answering any questions I ask and for offering advice, even after graduating from the lab. I wish all of you the best of luck in your future endeavors; you deserve all of the successes you achieve.

v I would also like to take this time to thank all of the members of my committee for their constant advice and guidance and for pushing me to always become better. Your time and efforts have been much appreciated. Lastly I thank all of the friends and fellow graduate students I have met during my time here. Thank you for your support and guidance and for allowing me to serve as the BGSA president. Thank you for your help in releasing the stresses of graduate school and my personal life throughout the past five years.

vi DEDICATIONS

I dedicate this dissertation to my husband for all of his love and support throughout my graduate school career. Thank you for appreciating the importance of my own dreams and career aspirations and not allowing yours to overshadow that. The distance between us has not been easy but it has been worthwhile to share this life accomplishment with you. As equal partners, I pledge to you to always be by your side as you continue to fight the traumatic stress left by war and to show the same love and support that you have shown to me. I can’t wait to begin a new journey together.

I dedicate this dissertation also to my parents who instilled in me the value of hard work and of obtaining an education. Thank you for your support throughout my entire life and for always pushing me towards higher intellectual pursuits.

I dedicate this dissertation to my late grandmother, Nancy Haines, who was always extremely supportive and proud of any accomplishments I have achieved and who showed remarkable strength and courage battling brain cancer. My only wish is that you would have achieved your last wish, to see my college graduation but I know that you were there and at my PhD graduation in spirit and your strength and courage and love will stay with me for the rest of my life.

vii TABLE OF CONTENTS

LIST OF TABLES ...... xii LIST OF FIGURES ...... xiii ABSTRACT ...... xv

Chapter

1 INTRODUCTION ...... 1

Vibrio parahaemolyticus ...... 1 Sigma Factors ...... 5

Function of Alternative Sigma Factors among Vibrio Species ...... 6

Dissertation Work ...... 15

2 EVOLUTIONARY ANALYSIS OF SIGMA 70 FAMILY SIGMA FACTORS AMONG VIBRIONACEAE ...... 20

Introduction ...... 20 Materials and Methods ...... 23

Housekeeping gene phylogenetic analysis ...... 23 Sigma factor sequence acquisition and functional groupings ...... 24 Sigma factor phylogenetic analysis ...... 26 RNA extractions and qPCR ...... 27 RNA-Seq analysis ...... 28

Results ...... 29

Domains 2 and 4 are the most highly conserved among Sigma 70 Family sigma factors found in V. parahaemolyticus ...... 29 There is a positive correlation between the total number of sigma factors and genome size ...... 30 Phylogenetic analysis of all Sigma70 family sigma factors among Vibrionaceae ...... 31 RpoD and RpoH are found in single copies in all species analyzed .... 32 Distribution of the second flagella system on chromosome two is clade specific ...... 32

viii Several Vibrio species encode a divergent second copy of the RpoS sigma factor ...... 33 V. parahaemolyticus possess 5 ECF type sigma factors with varying degrees of conservation ...... 34 ECF gene neighborhoods found in Vibrio parahaemolyticus are conserved throughout Vibrionaceae ...... 36 Expression pattern of V. parahaemolyticus sigma factors in M9 Mucus relative to M9 Glucose ...... 37

Discussion ...... 38

Supplementary Figures and Tables ...... 55

3 THE ALTERNATIVE SIGMA FACTOR RPOE IS IMPORTANT FOR VIBRIO PARAHAEMOLYTICUS CELL ENVELOPE STRESS RESPONSE AND INTESTINAL COLONIZATION ...... 61

Introduction ...... 61 Materials and Methods ...... 65

Bacterial strains, plasmids, and growth conditions ...... 65 Phylogenetic analysis ...... 66 Construction of V. parahaemolyticus ΔrpoE and ΔompU mutants ...... 67 Construction of rpoE complement ...... 68 Growth analysis ...... 69 Stress survival assays ...... 70 In vivo colonization ...... 71

Results ...... 73

Identification of five putative ECF alternative sigmas in V. parahaemolyticus ...... 73 RpoE is required for V. parahaemolyticus cell envelope stress response ...... 75 RpoE is important for in vivo intestinal colonization in an adult mouse model ...... 77 Role of RpoE on growth in mucus ...... 79 Deletion of OmpU does not affect the cell envelope stress response in V. parahaemolyticus ...... 79

Discussion ...... 81

4 GLUCONATE CATABOLISM AND REGULATION ...... 94

ix Introduction ...... 94 Materials and Methods ...... 97

Bacterial strain, plasmids and growth conditions ...... 97 Construction of V. parahaemolyticus Δeda and Δ vp0055 mutant strains ...... 98 Growth analysis ...... 99 Mucus extraction ...... 100 Phenotypic microarray analysis of growth on 180 carbon sources .... 101 RNA Extractions ...... 102 cDNA synthesis and qRT-PCR expression analysis ...... 102 In vitro competition analysis ...... 103 Bioinformatic analysis: Promoter and Regulatory binding site prediction ...... 104 Phylogenetic analysis ...... 105

Results ...... 105

The gluconate cluster is contiguous in V. parahaemolyticus ...... 105 Bioinformatics analysis predicts that gluconate catabolism genes are regulated by a sigma 70 sigma factor, CRP and GntR ...... 106 Gluconate catabolism genes are induced in the presence of gluconate ...... 107 An ecf2 mutant grows similarly to wild-type in various carbon sources ...... 108 An eda mutant (VP0065) shows a defect in growth and competition with wild-type in M9 gluconate ...... 109 Bioinformatics analysis demonstrates there are three homologues of the Entner-Doudoroff aldolase in Vibrio parahaemolyticus ...... 109 Expression analysis reveals that VPA1708 may be important in the vp0065 eda mutant’s ability to utilize M9 gluconate ...... 110 High throughput analysis of phenotypic microarrays indicates that VP0065 may be involved in catabolism of multiple carbon sources . 111

Discussion ...... 112

5 CONCLUSIONS AND FUTURE DIRECTIONS ...... 127

REFERENCES ...... 132

Appendix

A ACKNOWLEDGEMENT OF PREVIOUSLY PUBLISHED CHAPTERS . 145 B ANIMAL WORK APPROVAL ...... 146

x C VP0055 STRESS ANALYSIS ...... 151

xi LIST OF TABLES

Table 1 Table S1. Locus Tags for Housekeeping Tree ...... 56

Table 2 Real-time PCR Primers ...... 59

Table 3 List of Species and Number of Sigma Factors ...... 60

Table 4 Bacterial Strains and Plasmids ...... 93

Table 5 Bacterial Strains and Plasmids ...... 125

Table 6 Primers used in this study ...... 126

xii LIST OF FIGURES

Size Comparisons of Sigma Factors in Vibrio parahaemolyticus. ... 41

Comparison of Total Number of Sigma Factors Relative to Genome Size...... 42

Overview of All Identified Sigma Factors...... 43

Phylogenetic Analysis of FliAL (A) and Strains Lacking Any Flagella Sigma Factors (B)...... 44

RpoS and Rpos-like Phylogenetic Analysis...... 45

Phylogenetic Analysis of RpoS-like sigma factors...... 46

Gene Neighborhoods Surrounding the Primary like Sigma Factors of V. parahaemolyticus...... 47

Phylogenetic Analysis of the Extracytoplasmic Function (ECF) Type Sigma Factors...... 48

Phylogenetic Analysis of Ecf2...... 49

Phylogenetic Analysis of Ecf 3...... 50

Phylogenetic Analysis of Ecf4...... 51

Phylogenetic Analysis of Ecf5...... 52

Gene Neighborhoods of the ECF Sigma Factors of V. parhaemolyticus...... 53

Expression analysis in M9 Cecal Mucus vs. M9 Glucose...... 54

Figure S1. Major Clades of Vibrionaceae...... 55

Phylogeny of ECF sigmas among Vibrio species...... 85

Growth analysis of WT and mutant strains under optimum and high salt conditions...... 86

xiii Cell envelope stress response...... 87

Growth curves of V. parahaemolyticus under high temperature and NaCl stress conditions...... 88

In vivo and in vitro competition assays in adult mouse intestinal colonization ...... 89

In vivo localization ...... 90

Growth analysis of V. parahaemolyticus on intestinal mucus as a sole carbon source ...... 91

Phenotypes of ompU deletion mutant ...... 92

Gluconate cluster is contiguous in V. parahaemolyticus ...... 115

Binding consensus sequences for RpoN, CRP and GntR...... 116

Promoter region analysis of gluconate catabolism genes...... 117

Expression pattern of gluconate catabolism genes and putative regulators in M9 gluconate relative...... 118

Growth patterns of the vp0055 and rpoN mutants relative to wild- type in M9 glucose, M9 gluconate and M9 cecal mucus...... 119

In vitro competition analysis between the vp0055 mutant and WBWlacZ isogenic wild-type strain...... 120

Growth and in vitro competition analysis of an Entner-Doudoroff (EDA) aldolase mutant...... 121

Phylogeny reveals V. parahaemolyticus RIMD2210633 has three putative Entner-Doudoroff aldolases...... 122

Expression pattern of in M9 gluconate between the wild-type and eda mutant...... 123

Carbon phenotypic microarray analysis of the eda (VP0065) mutant relative to wild type...... 124

VP0055 stress analysis under various conditions...... 151

xiv ABSTRACT

Vibrio parahaemolyticus, a ubiquitous Gram-negative marine bacterium, is the leading cause of bacterial seafood borne gastroenteritis in humans. This organism must adapt to both host and marine environmental stresses. One mechanism bacteria employ to respond to rapid environmental changes is the switching on of specific gene expression patterns through the use of alternative sigma factors. V. parahaemolyticus has 11 sigma factors, compared to Escherichia coli which has 7. This work examined the distribution and functionality of sigma factors in V. parahaemolyticus. Distribution analysis of V. parahaemolyticus sigma factors among Vibrionacea revealed varying levels of conservation of each sigma. All members of Vibrionaceae were found to have single copies of sigmas RpoD and RpoH. A majority of Vibrio species possess

FliAP, the polar flagella sigma factor; conversely distribution of the lateral flagella sigma factor, FliAL, is mostly clade specific and unique to V. parahaemolyticus, compared to other notable pathogens Vibrio cholerae and Vibrio vulnificus . All studied species possess a single copy of RpoS, however 22 species possess 1 to 3 additional copies of a divergent RpoS-like sigma factor. The greatest amount of diversity is within the ECF subfamily; here we demonstrate there are 3 highly conserved ECFs, which include RpoE, and several others which are less conserved and show more variation. Upon finding that a number of V. parahaemolyticus sigma

xv factors are highly conserved, expression levels of these sigmas were compared in minimal media (M9 glucose) to complex media (M9 mucus). RpoD, RpoH and RpoE were found to be highly expressed under both conditions. Ecf3, which is highly conserved, was found to be the only sigma factor to be highly induced in M9 mucus.

As alternative sigma factor, RpoE (VP2578), was highly expressed and is highly conserved, its role in V. parahaemolyticus biology was investigated.

In this species, RpoE was shown to be important in in vivo fitness as well as survival under polymyxin B, ethanol, and high temperature stresses. In contrast, deletion of the regulator, RpoS, did not alter in vivo survival and is only limitedly involved in stress response in this organism. Additionally, the role of the outer membrane protein, OmpU, in RpoE signaling was investigated. OmpU is proposed to be the sole activator of RpoE in Vibrio cholerae . We found that an ompU deletion mutant and the rpoE mutant did not have overlapping phenotypes indicating OmpU is not essential for RpoE function in V. parahaemolyticus under the conditions examined. The function of the most divergent ECF (VP0055) found in V. parahaemolyticus was also investigated.

VP0055 was found to be in close proximity to the gluconate catabolism gene cluster. Previously gluconate catabolism genes were shown to be upregulated in an rpoN mutant strain, as was VP0055. The rpoN mutant strain was a hypercolonizer of an adult streptomycin treated mouse model compared to wild-type and carbon catabolism differences may be involved in this phenotype. The role of VP0055 and

RpoN in the potential regulation of gluconate catabolism was investigated. Genes in

xvi the gluconate catabolism gene cluster were found to be induced in the wild type in M9 gluconate relative to M9 glucose. The gluconate catabolism genes were found to be unchanged in the vp0055 mutant, additionally, the vp0055 mutant did not demonstrate a growth defect in M9 glucose, gluconate or mucus, suggesting it is not significantly involved in gluconate catabolism. In contrast the rpoN mutant grows better than wild- type in M9 gluconate and M9 mucus and genes involved in gluconate catabolism are upregulated in this mutant, suggesting that RpoN is involved in regulation of gluconate catabolism, acting as a repressor through an unknown indirect mechanism.

The significance of gluconate catabolism in V. parahaemolyticus was also investigated through the construction of a deletion mutant of the canonical aldolase (VP0065) of the Entner-Doudoroff pathway which is involved in gluconate catabolism.

Surprisingly, it was found that VP0065 (eda ), is important but not essential for growth in M9 gluconate or M9 mucus. In E.coli, EDA mutants are unable to utilize gluconate as the sole carbon source. It was hypothesized that this unusual phenotype may be attributed to either increased flux through the pentose phosphate pathway (PPP) or the presence of non-canonical aldolases partially compensating for the loss of vp0065.

Bioinformatics analysis determined that the presence of two additional aldolases on chromosome two (VPA0083 and VPA1708) in V. parahaemolyticus . Expression analysis in M9 gluconate relative to M9 glucose demonstrated that VP1708, the first gene in the pentose phosphate pathway, and all three putative aldolases are induced in gluconate. These data indicate a potential role for multiple aldolases and PPP in gluconate catabolism in this species. Both VPA1708 and VP1708 were expressed at

xvii higher levels in the vp0065 mutant grown in gluconate compared to wild-type.

Together these data demonstrate that gluconate catabolism and regulation is complex in V. parahaemolyticus .

xviii Chapter 1

INTRODUCTION

Vibrio parahaemolyticus

Vibrio parahaemolyticus is a Gram-negative rod-shaped moderate halophilic organism, commonly found in brackish waters such as coastal marine and estuarine waters worldwide (Kaneko and Colwell 1973; Joseph, Colwell et al. 1982;

Zimmerman, DePaola et al. 2007). Vibrio parahaemolyticus has been associated frequently with bacterial seafood borne gastroenteritis in humans following the consumption of raw or undercooked fish and shellfish; this is a result of this organism’s ability to colonize shellfish in high numbers (Blackstone, Nordstrom et al.

2003; McLaughlin, DePaola et al. 2005; Zimmerman, DePaola et al. 2007). Infection by V. parahaemolyticus commonly results in diarrhea and abdominal pain; furthermore septicemia and mortality have been documented in immunocompromised individuals and in cases following exposure of open wounds to the bacterium (Hondo,

Goto et al. 1987; Honda, Ni et al. 1988; Nishibuchi, Taniguchi et al. 1989; Honda, Ni et al. 1992; Honda 1993; Daniels, MacKinnon et al. 2000). In the United States the incidence rate of illness associated with Vibrio , including V. parahaemolyticus, has been on the rise in recent years. The CDC reports that in 2013 infections related to

Vibrio were at the highest levels observed since tracking began in 1996, with V.

1 parahaemolyticus accounting for roughly 62% of the speciated clinical isolates during that year. The overall rate of infections caused by Vibrio species had increased 32% since 2010-2012, while disease caused by other enteric species such as Escherichia coli O157 and Salmonella enterica had either no change or a decrease in infection rates during that same time duration (Crim et al. 2014). An understanding of the physiology of this organism and how it adapts to both the changing marine environment and host organisms may aid in management of the increasing rate of infections caused by V. parahaemolyticus.

It has been demonstrated that clinical isolates of V. parahaemolyticus caused hemolysis on Wagatsuma agar, known as the Kanagawa phenomenon (KP) (Honda et al. 1976; Nishibuchi et al. 1989; Honda 1993). This phenomenon has been attributed to the presence of a thermostable direct hemolysin (TDH); however KP-negative strains were also found to be associated with gastroenteritis leading to the identification of a second hemolysin termed the TDH-related hemolysin (TRH) (Honda et al. 1976; Hondo et al. 1987; Nishibuchi et al. 1989; Honda 1993; Nagayama et al. 1995). In recent years global outbreaks of V. parahaemolyticus have been associated with O3:K6 serotype strains. The complete genome of this pandemic serogroup, V. parahaemolyticus RIMD2210633, was sequenced in 2003 and led to the discovery of two type III secretion systems (T3SS) one located in each chromosome (T3SS-1 and T3SS-2), shifting focus from TDH-centered research to characterization of the T3SS effector proteins (Makino et al. 2003). The T3SS-2 resides within a 80- kb pathogenicity island (VPaI-7) also containing two copies of the tdh gene and its distribution is limited to clinical isolates (Makino et al. 2003; Hurley et al. 2006; Nair

2 et al. 2007; Boyd et al. 2008; Izutsu et al. 2008). More recently, a third T3SS was identified in a strain of V. parahaemolyticus found to be tdh-negative but trh -positive (Matsuda et al. 2010). In vitro characterization of several effector proteins associated with the different T3SSs have demonstrated their role in cell rounding, cell lysis, cell death, and induced autophagy in eukaryotic cells (Trosky et al. 2004; Ono et al. 2006; Kodama et al. 2007; Liverman et al. 2007; Burdette et al. 2009; Broberg et al. ; Hiyoshi et al. 2010 ; Pineyro et al. 2010 ; Whitaker et al.2012 ; Hiyoshi et al. 2011 ; Ham and Orth 2012). The role of the two T3SSs in V. parahaemolyticus has been analyzed in vivo through the use of intestinal models of both infection and colonization (Boutin et al. 1979; Park et al. 2004; Pineyro et al. 2010; Hiyoshi et al. 2010; Ritchie et al. 2012; Whitaker et al. 2012). The three intestinal models of infection, the rabbit ileal loop model and the orogastric route of infection infant rabbit and piglet models, all demonstrate distinct roles in pathogenesis for T3SS-1 and T3SS-2. The rabbit ileal loop model has been used to demonstrate that V. parahaemolyticus can penetrate the lamina propia of the small intestine (Boutin et al. 1979). Additionally in the ileal loop model, T3SS-2 was shown to be responsible for fluid accumulation, villi destruction, and neutrophil infiltration into the lamina propia and contributed to enterotoxicity while T3SS-1 was not required for these effects in vivo (Park et al. 2004; Hiyoshi et al. 2010). In the infant rabbit orogastric model of V. parahaemolyticus infection wild-type levels of colonization, intestinal fluid accumulation and diarrhea were shown to be dependent on T3SS-2, with disease progression influenced to a lesser degree by T3SS- 1 (Ritchie et al. 2012). In the piglet orogastric model of infection, a T3SS-2 mutant failed to produce any clinical signs of disease and bacteria were recovered in only 1 of

3 3 piglets infected with this mutant strain, whereas disease symptoms and bacterial colonization were similar to wild-type levels in a T3SS-1 mutant (Pineyro et al. 2010). These data demonstrate the importance in vivo of the T3SSs and that V. parahaemolyticus diarrhea and inflammation are T3SS-2 dependent, with T3SS-1 playing a minor role in disease severity in comparison (Park et al. 2004; Pineyro et al. 2010; Hiyoshi et al. 2010; Ritchie et al. 2012). It is important to note that the effects of the T3SSs require efficient survival within the host organism and binding to the host cell, therefore initial survival and colonization of the intestinal tract is a critical phase in pathogenesis. Determining the factors involved in in vivo survival and colonization will aid in understanding V. parahaemolyticus host pathogen interactions and pathogenesis. Vibrio parahaemolyticus, a marine and pathogenic organism, must possess the ability to alternate between natural and host environments by responding to rapid changes in the extracellular environment in order to survive and colonize a host. Previously, we developed a streptomycin treated adult murine model of colonization to study the bacterial factors required for this process (Whitaker et al. 2012; Whitaker, et al. 2014). This animal model was used to demonstrate that the Vibrio specific two component regulatory system, ToxRS, is important in establishing wild-type levels of colonization of the mouse gastrointestinal tract, as the toxRS mutant strain was defective in intestinal colonization (Whitaker et al. 2012). Additionally, ToxRS was demonstrated to be important for survival under acid (organic and inorganic) stresses, SDS and bile salt stresses in V. parahaemolyticus through its positive regulation of outer membrane protein OmpU (Whitaker et al. 2012). Another method by which bacteria regulate gene expression in response to changing extracellular conditions is

4 through the use of alternative sigma factors; this animal model has also been used to investigate the role of sigma factors in the critical step of intestinal colonization. The role of sigma factors in host pathogen interactions as well as their role in the organism’s survival under various stresses will be described below and throughout this dissertation.

Sigma Factors

Sigma factors are essential dissociable subunits of the bacterial RNA polymerase (RNAP) holoenzyme. In bacteria, the core RNAP alone is incapable of transcription initiation and recognition of specific promoter sequences. The sigma factor subunit has domains containing helix-turn-helix motifs, which enable recognition and direction of RNAP to specific promoters. Once the RNAP holoenzyme is bound to the promoter, transcription initiation can occur.

There are two major families of sigma factors: the sigma-70 family sigma factors and the sigma-54 family sigma factors. The sigma-70 family encompasses the largest group of sigma factors, and includes a primary sigma-70 factor, RpoD, responsible for transcription of housekeeping genes, and several alternative sigma factors, which regulate transcription in response to various stimuli (Osterberg et al.

2011). The sigma-54 family encompasses one alternative sigma factor annotated as

RpoN in Gram-negative bacteria. RpoN is functionally similar but structurally divergent from the sigma-70 family. Alternative sigma factors enable the cell to

5 globally alter transcription in response to various stimuli, including stress conditions that may occur within the bacterium’s natural environment or host to ensure survival.

The repertoire of alternative sigma factors available varies widely between different species of Vibrio , including closely related species, and may reflect the lifestyle of a particular species. Vibrio parahaemolyticus, the focus of this work, has

11 sigma factors in total (Whitaker et al. 2012; Haines-Menges et al. 2014). The 11 sigma factors include a single sigma-54 family sigma factor, RpoN, and 10 sigma-70 family sigma factors. The 10 sigma-70 family sigma factors include housekeeping sigma factor, RpoD, and several alternative sigma factors involved in the general stress response (RpoS), heat shock (RpoH), flagella synthesis (FliAP and FliAL) and extracytoplasmic stress responses (RpoE, Ecf2, Ecf3, Ecf4, Ecf5).

Function of Alternative Sigma Factors among Vibrio Species

The role of RpoS has been characterized in a number of Vibrio species where it has been found to function in response to starvation stress conditions. In V. cholerae,

RpoS was shown to be involved in the response to stresses such as hydrogen peroxide/oxidative stresses, osmotic shock, and starvation and was involved in the production of the HA/protease which processes the cholera toxin (Yildiz and

Schoolnik 1998; Dong and Schellhorn 2009). The role of RpoS in in vivo survival in

V. cholerae is inconclusive as it has been shown to be both required and not required for intestinal survival depending on the strain and growth conditions utilized (Yildiz and Schoolnik 1998; Merrell et al. 2000). More recently in V. cholerae RpoS was also

6 suggested to be important for the mucosa escape response. It was demonstrated that expression of motility and chemotaxis genes was up regulated by RpoS during this response in vivo (Nielsen et al. 2006).

In addition to V. cholerae, the role of RpoS has been studied in other Vibrio species as well. In V. vulnificus, it was found that RpoS protects cells from acid stress, oxidative stress and nutrient starvation (Hulsmann et al. 2003; Rosche et al. 2005). In

V. anguillarum an rpoS deletion mutant displayed reduced virulence in zebra fish

(Weber et al. 2008). In V. parahaemolyticus, it was demonstrated that RpoS had a limited involvement in acid stress and did not play a role in osmotic stress (Whitaker et al. 2012). The effect on colonization of an rpoS deletion mutation in V. parahaemolyticus was examined in both a mouse model of colonization and in oyster colonization and in both animal models RpoS was not required (Richards et al. 2012;

Haines-Menges et al. 2014). Analysis of an rpoS deletion mutant in V. harveyi, found that this mutant was more sensitive to stationary phase stress and high concentrations of ethanol in comparison to the wild-type, but was unaffected by high osmolarity or hydrogen peroxide stresses (Lin et al. 2002). In V. alginolyticus an rpoS mutant was more sensitive than wild-type to ethanol, hyperosmolarity, and hydrogen peroxide

(Tian et al. 2008). These studies demonstrate there are common core functions of

RpoS such as involvement in starvation stress and osmotic stress though this is not true of every studied species, suggesting that RpoS has evolved slightly different roles among different Vibrio species. Due to this conservation in many species of a common

7 core function for RpoS, it is expected that this sigma factor will also be highly conserved among Vibrionaceae.

A number of the Vibrio species possess additional RpoS-like sigma factors.

When described in the literature, these RpoS-like sigma factors have been termed

RpoX and RpoQ (Zhao et al. 2009; Cao et al. 2012). RpoX was originally identified in

V. alginolyticus and was shown to be involved in biofilm formation and stress response (Zhao et al. 2009). RpoQ was characterized in V. fischeri , and has 45% amino acid identity to the RpoS protein in this species (Cao et al. 2012).

Overexpression of RpoQ in V. fischeri led to increased chitinase activity but decreased motility and luminescence (Cao et al. 2012). It was found that RpoQ was controlled by LuxO via LitR, a LuxR homologue (Cao et al. 2012). We wanted to determine the distribution and conservation of these RpoS-like sigma factors amomg Vibrio species, the function of many of which are unknown.

The heat shock sigma factor, RpoH, a homologue of the RpoH in E. coli , has remained relatively uncharacterized across the Vibrio species. The V. cholerae RpoH can functionally complement an E. coli rpoH mutant suggesting it has evolved a similar role in both species (Sahu et al. 1997). A global gene expression and phenotypic analysis of a V. cholerae rpoH deletion mutant by Slamti and colleagues suggested that in this species, rpoH is an essential gene. The rpoH mutant was severely attenuated in a suckling mouse model of colonization (Slamti et al. 2007).

The core function of RpoH is predicted to be conserved among all Vibrionaceae , as this protein is highly conserved.

8 The flagellar sigma factors FliAP and FliAL (LafS) have been best characterized in V. parahaemolyticus (McCarter and Wright 1993; McCarter 1995;

Stewart and McCarter 2003; Whitaker et al. 2014). A study in 1993 by McCarter and co-workers identified the genes involved in the swarming flagellar motor of V. parahaemolyticus using transposon mutagenesis (McCarter and Wright 1993). They identified sigma-28 (FliAL) which is required for the synthesis of lateral flagella

(McCarter and Wright 1993). In V. parahaemolyticus, FliAP has been shown to be important in the development of the single polar flagellum required for swimming motility and 3 out of 4 flagellins are dependent on FliAP, the other flagellin expression is dependent on RpoN (McCarter 1995). Both fliAP and fliAL are regulated by RpoN, which is discussed below, and an rpoN mutant is non-flagellated and defective in swimming and swarming motility in V. parahaemolyticus (McCarter and Wright

1993; Whitaker et al. 2014).

The largest and most diverse group of sigma-70 family sigma factors is the extracytoplasmic function (ECF) type subfamily of sigma factors. The most well studied ECF-type sigma factor among bacteria is RpoE which is required for cell envelope stress response. RpoE has been characterized in single studies in V. vulnificus, V. harveyi, V. angustum, and V. parahaemolyticus and multiple studies in

V. cholerae (Hild et al. 2000; Kovacikova and Skorupski 2002; Mathur et al. 2007;

Brown and Gulig 2009; Davis and Waldor 2009; Rattanama et al. 2012). In V. cholerae, RpoE was shown to play an important role in intestinal survival and virulence in an infant mouse model (Kovacikova and Skorupski 2002). In this first

9 study, an rpoE mutant was created in O395, a biotype classical V. cholerae strain, and was highly attenuated for virulence and sensitive to 3% ethanol stress. The rpoE mutant similar to wild-type was resistant to heat stress, bile salts, hydrogen peroxide, the antimicrobial peptide polymyxin B, osmolarity and pH (5.5 to 10) stresses

(Kovacikova and Skorupski 2002). In contrast, a study by Waldor’s group, examining an rpoE mutant in a biotype El Tor background strain found that this mutant was sensitive to a bioactive peptide P2 and polymyxin B (Mathur et al. 2007). They determined that the outer membrane protein OmpU was a key determinant of basal rpoE expression and proposed that misfolded OmpU protein in the periplasm may be the signal that allows release of RpoE tethered to the cell membrane (Mathur et al.

2007). Using next generation high-throughput sequencing, they found that most rpoE mutants can be constructed only in the presence of suppressor mutations suggesting rpoE is an essential gene in this V. cholerae strain (Davis and Waldor 2009) . The authors found that out of all of the independently constructed rpoE mutants, 75% had a suppressor mutation in the promoter region of ompU , lending support to the proposal that OmpU is a key determinant in the requirement of RpoE (Davis and Waldor 2009).

In V. vulnificus , an rpoE mutant was more sensitive to membrane perturbing agents such as ethanol and SDS as well as hydrogen peroxide and there was a slight increase in sensitivity to heat and cold shock but was not attenuated for virulence in mice (Brown and Gulig 2009). In V. harveyi , rpoE was suggested to be essential in this species as an rpoE mutant could not be constructed. Instead mutants were constructed in the rpoE regulatory region rseABC and it was demonstrated that the

10 over expression of rpoE resulted in a reduction of hemolytic activity and attenuation for colonization in shrimp (Rattanama et al. 2012).

In V. parahaemolyticus , we constructed an in-frame deletion of VP2578 the E. coli rpoE homologue from V. parahaemolyticus RIMD2210633 (Haines-Menges et al.

2014). It was found that rpoE is essential for survival during cell envelope stress conditions such as polymyxin B, hydrogen peroxide and ethanol stresses and our in vivo colonization analysis in a streptomycin-treated adult mouse model of colonization demonstrated that the rpoE mutant was severely defective compared to wild-type

(Haines-Menges et al. 2014). These data suggest that RpoE is required for in vivo colonization probably through its role in cell envelope stress tolerance. Unlike in V. cholerae , it appears that in V. parahaemolyticus , OmpU may not be a signal for RpoE release from the membrane since our ompU deletion mutant strain was resistant to polymyxin B unlike the rpoE mutant which is sensitive (Haines-Menges et al. 2014).

Several divergent alternative sigmas are also present in V. parahaemolyticus,

VP0055 (Ecf2), VP2210 (Ecf3), VP2358 (Ecf4) and VPA1690 (Ecf5) whose function is unknown. We want to determine the distribution of these sigma factors and the conservation of the gene neighborhood, as these data may indicate functional conservation. The function of VP0055 is unknown, however in all Vibrio species which possess this sigma, the genes surrounding it are genes putatively involved in gluconate metabolism. VP2210 is embedded among fatty acid oxidation and transport genes, which may suggest a possible role for this sigma factor. VP2358 is in an operon which includes a putative anti-sigma factor containing a cupin domain that

11 may be involved in sensing reactive oxygen species. Other genes surrounding this sigma are involved in DNA damage repair and amino acid biosynthesis. VPA1690 is only present in V. parahaemolyticus , V. alginolyticus and Vibrio sp Ex25 strains. The genes immediately surrounding this sigma are conserved hypothetical proteins and transcriptional regulators, as well as genes involved in alkyl hydroperoxide reduction.

RpoN, the only member of the sigma-54 family, has been characterized in V. alginolyticus, V. anguillarum, V. cholerae, V. harveyi, V. fischeri, and V. parahaemolyticus (Kawagishi et al. 1997; O'Toole et al. 1997; Lilley and Bassler

2000; Wolfe et al. 2004; Ishikawa et al. 2009; Dong and Mekalanos 2009; Hao et al.

2012; Whitaker et al. 2014). In V. cholerae RpoN has been shown to be required for motility, nitrogen metabolism, biofilm formation, quorum sensing, type 6 secretion system synthesis, and virulence (Klose and Mekalanos 1998; Klose et al. 1998; Prouty et al. 2001; Ishikawa, Rompikuntal et al. 2009; Syed et al. 2009; Dong and Mekalanos,

2012). RpoN is required for colonization in an infant mouse model of cholera and the defect was not entirely related to the lack of motility or glutamine synthetase expression (Klose and Mekalanos 1998). Klose and colleagues recently determined that the V. cholerae RpoN regulon includes more than 500 genes in O1 pathogenic isolates (Syed et al. 2009). It was demonstrated that RpoN played a role in the regulation of flagella synthesis, ammonium assimilation, virulence factor synthesis, and dicarboxylic acid metabolism (Syed et al. 2009). A study published in 2012 showed that RpoN differentially regulates the type IV secretion system and flagella operons in V. cholerae serogroup O37 strain V52 (Dong and Mekalanos, 2012). In V.

12 fischeri, RpoN was shown to play a role in motility, biofilm formation, luminescence and colonization of the squid host (Millikan and Ruby 2003; Wolfe et al. 2004). The rpoN mutant examined in these studies was non motile, produced less biofilm, grew poorly on minimal media and could not colonize its symbiotic squid host. The rpoN mutant also had 3-4 fold higher levels of bioluminescence, suggesting that RpoN normally represses bioluminescence (Millikan and Ruby 2003; Wolfe et al. 2004). In

V. anguillarum, it was shown that RpoN is essential for flagellum production as well as virulence in fish. An rpoN mutant had loss of motility, but no loss of virulence when fish were intraperitoneally injected, however virulence was significantly reduced when fish were orally infected (O'Toole et al. 1997). In V. anguillarum, RpoN is also required for protease secretion, exopolysaccharide production, and biofilm formation

(Hao et al. 2012). RpoN is required for formation of the polar flagellum synthesis and motility in V. alginolyticus (Kawagishi et al. 1997).

RpoN plays a role in quorum sensing in V. harveyi, via the sigma-54 activator

LuxO. When LuxO and the RpoN – RNAP holoenzyme are both present, it leads to expression of LuxR, the regulator of luminescence and other phenotypes (Lilley and

Bassler 2000). This was also shown to be the case in V. cholerae, V. alginolyticus and

V. parahaemolyticus. In V. alginolyticus LuxO via RpoN regulates expression of

Hcp1, a hallmark of T6SS, while LuxR and LuxS are the negative regulators. RpoN was also suggested to regulate hcp1 , as well as other T6SS genes and motility via

VasH, a sigma-54 activator protein encoded within T6SSVA1 (Kitaoka et al. 2011;

Dong and Mekalanos 2012). As mentioned previously, in V. cholerae T6SS gene

13 clusters are also under the control of RpoN via VasH, and in V. parahaemolyticus

RpoN is also required for hcp1 expression, which is repressed by OpaR, the quorum sensing output regulator (the LuxR homologue) in V. parahaemolyticus that also represses the T3SS1 cluster (Ishikawa et al. 2009; Bernard et al. 2011; Gode-Potratz and McCarter 2011; Kitaoka et al.2011; Dong and Mekalanos, 2012).

Recent studies in V. parahaemolyticus RIMD2210633 have also demonstrated the requirement for RpoN in the synthesis of both polar and lateral flagellum

(Whitaker et al. 2014). The rpoN mutant was aflagellated and defective in swimming and swarming motility as well as biofilm production. Surprisingly, when the rpoN mutant was examined for its ability to colonize the mouse intestine, it was found to be a superior colonizer compared to the wild-type strain (Whitaker et al. 2014). To examine this phenotype further the ability of the rpoN mutant to grow in crude intestinal mucus as well as mucus components was determined. It was found that the rpoN mutant had a faster doubling time on a range of mucus sugars such as ribose, arabinose and gluconate (Whitaker et al. 2014). In addition key genes involved in the catabolism of these sugars were more highly expressed in the rpoN mutant compared with the wild-type strain. These data suggest that RpoN is involved in the regulation of these catabolic genes (Whitaker et al. 2014).

Taken together, it appears that the RpoN regulon is vast and complex within the Vibrio genus. Common themes are found such as a requirement for RpoN for flagellation, motility, biofilm formation and regulation of T3SS, T6SS and the quorum sensing regulator LuxR. Differences arise in the role of RpoN in the virulence of a

14 particular species, which reflects the different requirements for colonization and virulence among the species and the animal models used rather than differences in

RpoN regulation per se .

Dissertation Work

Vibrio parahaemolyticus is typically found in brackish marine and estuarine waters and is ubiquitous within this environment having the ability to colonize crustaceans, mollusks, and fish or found as a free-living organism. It also has the ability to colonize the human gastrointestinal tract and is the leading cause of bacterial seafood associated gastroenteritis worldwide. Due to its ubiquitous nature, V. parahaemolyticus must be able to alternate between natural and host environments and possess the ability to respond to rapid changes in the extracellular environment.

Altering gene expression allows the bacteria to respond to various environmental stimuli to ensure survival. One mechanism of globally altering gene expression is through the utilization of alternative sigma factors (σ). Alternative sigma factors redirect transcription initiation in response to environmental cues by guiding the core

RNA polymerase, to specific promoter regions.

Sigma factors are conserved transcriptional regulators present in all bacteria; however, the number varies from species to species. In V. parahaemolyticus we identified 11 sigma factors compared to 7 present in Escherichia coli . The 11 sigma factors possessed by V. parahaemolyticus include one primary sigma factor, RpoD, required for housekeeping gene regulation and 10 alternative sigma factors putatively

15 required for environmental stress response. The overall goal of this work is to further our understanding of alternative sigma factor regulatory systems in V. parahaemolyticus .

In chapter two we sought to examine the distribution of sigma factors, with a focus on those found in V. parahaemolyticus, among the Vibrionaceae. Species in this group have between 15 and 8 sigma factors, compared to Escherichia coli , which has

7. We found that all species have a single copy of RpoD and RpoH, and the phylogeny of these proteins followed a branching pattern similar to a housekeeping tree. A majority of Vibrio species possess FliAP, the polar flagella sigma factor, while only 24 of the 55 species examined possess the lateral flagella sigma factor, FliAL. FliAL distribution is mostly clade specific and unique to V. parahaemolyticus, among the notable pathogens. All studied species possess a single copy of RpoS, however 22 species possess 1 to 3 additional copies of an RpoS-like sigma factor. The greatest amount of diversity is within the ECF subfamily; here we demonstrate there are 3 highly conserved ancestral ECFs, which include RpoE. There are several other groupings of ECFs which are less conserved and show more variation.

To begin to examine the role of the 5 putative ECF sigma factors found in V. parahaemolyticus , we first investigated the functions of the canonical RpoE sigma factor. In chapter 3, we demonstrate that RpoE is required for the extracytoplasmic stress response. A gene deletion of rpoE , results in sensitivity to cell envelope stresses such as antimicrobial peptides. The Δ rpoE strain exhibited decreased fitness in vivo in

16 comparison to the wild-type demonstrating importance of this sigma for in vivo survival. This was the first work to look at the role of RpoE in V. parahaemolyticus .

In chapter 4, we investigated the role of the most divergent ECF found in V. parahaemolyticus, Ecf2 (VP0055). This putative sigma factor neighbors the gluconate catabolic genes and this is true for all Vibrio species which possess a homologue of

Ecf2. Additionally, preliminary data suggested that Ecf2 was upregulated in an rpoN mutant strain (Whitaker and Boyd, unpublished); this finding also contributed to the interest in whether or not Ecf2 was involved in gluconate catabolism regulation. It was previously shown that an rpoN deletion mutant in V. parahaemolyticus colonizes a streptomycin treated adult murine model more efficiently than wild-type (Whitaker et al. 2014). Investigation into the mechanism behind this super colonization ability suggested that there are differences in carbon utilization between the two strains which may play a role in the rpoN mutant phenotype. One of the carbon sources the two strains show a difference in is gluconate. When grown in M9 supplemented with gluconate as the sole carbon source, the rpoN mutant grows at a faster rate than the wild-type. Therefore we sought to determine whether or not Ecf2 as well as alternative sigma factor, RpoN, are involved in the regulation of gluconate catabolism. Data presented in this chapter suggests that regulation by RpoN is indirect and that Ecf2 plays little to no role in gluconate catabolism regulation. Bioinformatics analysis predicts that the gluconate catabolism genes are under regulation of the canonical

GntR negative regulator and CRP positive regulator, as binding sites were identified for each. We also examined whether or not Ecf2 plays a role in canonical

17 extracytoplasmic stresses such as 10% ethanol and bile salts through examination of a vp0055 mutant strain and found no role under the conditions we examined (data in appendix). Together these results demonstrate that Ecf2 is not significantly involved in metabolism or the membrane stress response under the specific conditions examined.

In general, there is very little information on carbon metabolism in Vibrio species, even though enhanced ability to utilize different carbon sources could enhance the in vivo fitness of a particular strain. Gluconate is a known component of intestinal mucus (Peekhaus and Conway 1998). In E. coli a functional Entner-

Doudoroff (ED) pathway as well as gluconate utilization has been shown to be important in colonization (Chang et al. 2004; Sweeney et al. 1996). Gluconate utilization was shown to be important for both initiation and maintenance of colonization of the host intestinal tract by E. coli (Chang et al. 2004). In V. cholerae gluconate utilization was shown to be important for survival within the intestinal environment (Patra et al. 2012). In the last section of chapter 4 we performed an in- frame deletion of the ED aldolase (2-deydro-3-deoxyphosphogluconate aldolase) homologue, vp0065 (eda) in V. parahaemolyticus . Surprisingly the eda mutant exhibited growth in M9 minimal media supplemented with gluconate as the sole carbon source. Investigation into the ability of the eda mutant to grow on gluconate revealed that the V. parahaemolyticus genome encodes two additional copies of the 2- deydro-3-deoxyphosphogluconate aldolase (VPA0083 and VPA1780); therefore growth may be due to these putative aldolases compensating for the loss of VP0065.

Alternatively or additionally, growth of the eda mutant on gluconate may be due to

18 additional metabolic flux through the pentose phosphate pathway. Lastly, we show that the vp0065 mutant strain and the wild-type strain have several different carbon utilization abilities and the mutant strain had a slight disadvantage when competed against the wild-type strain in M9 mucus in in vitro competition assays. Together this data suggests that this aldolase is important in catabolism and maybe a significant fitness factor.

19 Chapter 2

EVOLUTIONARY ANALYSIS OF SIGMA 70 FAMILY SIGMA FACTORS AMONG VIBRIONACEAE

Introduction

Transcription in bacteria is performed by the RNA polymerase holoenzyme.

The core of this holoenzyme consists of five subunits (β,β’,α 2,ω), which are incapable of initiation at specific promoter elements. The last component of the bacterial RNA polymerase holoenzyme is an essential subunit known as the sigma (σ) factor, which is capable of recognizing specific promoter elements, enabling transcription initiation.

There are two families of sigma factors: σ 54 and σ 70 , which are functionally similar but structurally divergent, the latter of which (σ 70 ) this work focuses on. Members of the sigma 70 family, direct the RNA polymerase to specific promoter elements at -35-bp and -10-bp, relative to the transcriptional start site. Most sigma factors are members of this family, which has been divided into 4 major subgroups based on function and sigma 70 family sigma factor structural domains present. Domain 1.1 and 1.2 are found in primary and primary like sigma factors, also known as Group 1 and Group 2 sigma factors, and may have inhibitory function when not bound to polymerase.

Domains 2 and 4 are the most highly conserved and are involved in recognition of the

-10 and -35 elements, respectively, as well as polymerase binding. All sigma factors, regardless of grouping, have domains 2 and 4, and ECF-type sigma factors commonly

20 have only domains 2 and 4. Domain 3 has weak polymerase binding and may recognize extended -10 elements, in the absence of -35 elements and is found in primary (Group 1), primary like (Group 2) and some Group 3 sigma factors which are similar to the primary like alternative sigma factors but more specific in function.

Group 4 sigma factors typically only have domains 2 and 4 and are the largest and most diverse group of sigma factors and most divergent from the primary sigma factor.

All bacteria possess a group 1 or essential sigma factor, RpoD, which is required for cell growth under optimal conditions. The other groups (group 2-4) are comprised of alternative sigma factors which recognize alternative -10 and -35 elements, switching on transcription of specific regulons in response to various signals. Group 2 sigma factors are closely related to group 1, and include sigma factors such as RpoS, the primary stress response sigma in Gram-negative organisms.

Group 3 sigma factors are more distantly related to group 1 and respond to more specific environmental signals and include factors such as RpoH, involved in the cytosolic heat shock response, and the flagellar biosynthesis sigma factors (FliAP for polar flagellum and FliAL for lateral flagella). Group 4 encompasses the largest and most divergent group of sigma factors, the extracytoplasmic function (ECF) subfamily, the most notable of which, RpoE, is involved in maintaining the cell envelope. The focus of this work is to elucidate the diversity and distribution of sigma

70 factors among Vibrio species.

21 Vibrio species are widespread in the marine and coastal environments and includes notable pathogens such as V. parahaemolyticus, the leading cause of bacterial seafood borne gastroenteritis. We are focusing on understanding the role of sigma factors in V. parahaemolyticus, which has 11 sigma factors, in comparison to

Escherichia coli , which only has 7 sigma factors. Vibrio species can contain up to 15 total sigma factors. All species have a single copy of RpoD and RpoH that by phylogenetic analysis follow a branching pattern similar to the housekeeping tree for the genus. The majority of Vibrio species possesses FliAP, the polar flagella sigma factor, while of the 55 species examined only 24 species possess the lateral flagella sigma factor, FliAL and this distribution is mostly clade specific. All studied species also possess a single copy of RpoS, and 22 species possess 1-2 additional copies of

RpoS-like sigma factors. The greatest amount of diversity is seen within the ECF subfamily; here we demonstrate there are 3 highly conserved ancestral ECFs and several others which are less conserved and show more variation. The diversity of sigma factors may have allowed Vibrio species to occupy a large diversity of ecological niches within the marine environment.

22 Materials and Methods

Housekeeping gene phylogenetic analysis

Amino acid sequences of the following housekeeping genes: RNA polymerase subunit beta ( rpoB ), malate dehydrogenase ( mdh ) and dihydroorotase ( pyrC ) were obtained from the NCBI database for all species analyzed as listed in Table S1 . The amino acid sequences for each protein from V. parahaemolyticus RIMD2210633 encoded by the following ORFs: VP2922 ( rpoB ), VP0325 ( mdh ) and VPA0408 ( pyrC ) were used as seed sequences in protein-protein BLASTs to identify housekeeping gene homologs in 54 additional species. A concatenated sequence of all 3 proteins from each species was aligned using MUSCLE in the software package, MEGA6.0 (Edgar

2004; Tamura et al. 2013). To infer evolutionary history, a phylogenetic tree was constructed using the Neighbor-Joining method (Saitou and Nei 1987). The evolutionary distances were computed using the Poisson correction method and are in the units of the number of amino acid substitutions per site (Zuckerkandl and Pauling

1965). The percentage of time taxa clustered together as shown, is indicated when above 45%, as determined by the bootstrap replicate test (1000x) (Felsenstein 1985).

Major taxonomic clades of species are labelled following previously described clades in the literature (Thompson et al. 2005; Urbanczyk et al. 2007; Thompson et al. 2009).

23 Sigma factor sequence acquisition and functional groupings

The primary sigma factor RpoD (VP0404), sigma family 54, RpoN (VP2670), stress response sigma factor RpoS (VP2553), two flagellar biosynthesis sigma factors

FliAP (VP2232) and FliAL (VPA1555), heat shock sigma factor RpoH (VP2953) and

5 ECF-type sigma factors, RpoE (VP2578) and ECFs 2-4 (VP0055, VP2210, VP2358,

VPA1690) were used as seed sequences in protein-protein BLASTs to identify homologs in 54 other Vibrio species. Based on homology, protein size and domains present, the putative sigma factors were functionally grouped. To identify homologs of

RpoD (VP0404), top BLAST hits for each species were filtered by size and protein domains present. All RpoD sigma factors identified were between 600 and 630 amino acids in size and the following conserved sigma factor domains were present in all RpoD homologs: 1.1, 1.2, 2, non-conserved region, 3 and 4. These domains have been previously shown to be highly conserved in primary housekeeping sigma factors

(Paget and Helmann 2003). For putative homologs of RpoH, the top hits for each species were filtered by annotation, size and protein domains present. A copy of RpoH was found in every species examined and these sigma factors averaged 285 amino acids in size and all had conserved domains 1.2, 2 and 4. Domain 3 was absent from all putative RpoH sigma factors identified.

RpoS top hits for each species were filtered based on annotation, size and protein domains present, the majority of which were between 310 and 330 amino acids in size and had the conserved sigma factor domains 1.2, 2, 3 and 4. Protein-protein

BLAST did not originally identify an RpoS homolog in Vibrio crassostrae and Vibrio

24 owensii. The gene neighborhood around the rpoS gene is highly conserved in Vibrio species; therefore we used vp2552 and vp2554 as seed sequences in a nucleotide

BLAST to determine if they were present in either V. crassostrae or V. owensii , which would indicate if the rpoS gene may have been lost or not yet annotated. Homologs were present of vp2552 (MutS) and vp2554 (NlpD) in both species. Between MutS and NlpD in V. owensii and V. crassostreae there was an unannotated 1074 bp and

1218 bp region, respectively, which was found to encode the rpoS gene. Additionally,

RpoS-like sigma factors have been studied in two Vibrio species and we used the amino acid sequence for RpoX (ACJ09227) of V. alginolyticus and RpoQ

(VF_A1015) of V. fischeri as seed sequences in protein-protein BLAST and top hits from the results were filtered based on size and domains present (Zhao,et al. 2009;

Cao et al. 2012). The identified RpoS-like proteins were slightly smaller than canonical RpoS homologs, averaging between 290-300 amino acids in size.

Homologs of the two flagellar sigma factors were filtered based on annotation, size (averaging 245 amino acids in length) and domains present (2, 3 and 4). FliAP and FliAL can be distinguished from each other as they share only 30 % identity and

FliAP is always found on chromosome 1 and FliAL is always found on chromosome

ECFs are typically between 180 and 200 amino acids in size and typically only have conserved sigma factor domains 2 and 4; these characteristics were used to identify putative ECFs. Phylogenetic analysis was used to group the putative ECFs

25 into those which are homologs of RpoE, Ecf2, Ecf3, Ecf4, Ecf5 and those which had no homology to ECFs found in V. parahaemolyticus.

Locus tags for all identified putative sigma factors are indicated on the respective phylogenies next to the corresponding species name.

Sigma factor phylogenetic analysis

Amino acids sequences of the identified putative sigma factors were obtained from the NCBI database for all species analyzed. For each functional group of sigma factors (RpoD, RpoH, RpoS and RpoS-like, FliAP, FliAL, and ECFs) protein sequences from each species were aligned using MUSCLE in the software package,

MEGA6.0 (Edgar 2004; Tamura et al. 2013). To infer evolutionary history, a phylogenetic tree was constructed using the Neighbor-Joining method (Saitou and Nei

1987). The evolutionary distances were computed using the Poisson correction method and are in the units of the number of amino acid substitutions per site, except for

Figure 3 in which the p-distance method was used (Zuckerkandl and Pauling 1965).

The percentage of time sigma factor proteins clustered together as shown, is indicated when above 45%, as determined by the bootstrap replicate test (1000x) (Felsenstein

1985).

26 RNA extractions and qPCR

RNA extractions were performed as described previously (Whitaker et al.

2014). Briefly, strains were grown at 37°C overnight, with aeration, in 5 ml LB broth containing 3% NaCl. Cells were then pelleted at 4000 x g for 10 min, washed twice in

PBS and resuspended in 5 ml PBS. Bacterial cells were then diluted 1:50 into M9 medium containing no ammonium and supplemented with cecal mucus as the sole carbon and nitrogen source or into M9 medium containing ammonium and supplemented with glucose (10mM). Early exponential phase cultures were utilized to determine expression pattern of genes in M9 mucus and cultures were incubated for 90 minutes statically at 37°C. Post incubation, total RNA was extracted using TRIzol

(Invitrogen, Carlsbad, CA) according to the manufacturer’s instructions. The RNA samples were treated with Turbo DNAse (Invitrogen) according to the manufacturer’s instructions in order to remove contaminating genomic DNA. The RNA samples were quantified using a Nanodrop spectrophotometer (Thermo-Fisher Scientific, Waltham,

MA). cDNA was synthesized with Superscript II reverse transcriptase (Invitrogen) according to the manufacturer’s instructions and 500 ng of RNA was used as the template in each synthesis reaction. The cDNA samples were diluted 1:50 and used as the template for quantitative real-time PCR (qPCR). The qPCRs were performed using the fast SYBR green master mix (Applied Biosystems) and run on an Applied

Biosystems (ABI) 7500 Fast real time PCR system. Gene primers were designed using

Primer 3 and V. parahaemolyticus RIMD2210633 genome sequence as the template and are listed in Table 2. Data was analyzed using the ABI 7500 software and the

27 expression levels of each gene, as determined by their cycle threshold (CT) values, were normalized using the 16S rRNA gene to correct for sampling errors. Differences in gene expression ratios were determined using the previously described ΔΔCT method (Pfaffl et al. 2001).

RNA-Seq analysis

RNA extractions were performed as described above. Post total RNA extraction, two biological replicate RNA samples from each condition (M9 cecal mucus or M9 Glucose) were combined in a 1:1 ratio, prior to rRNA removal using the bacterial Ribo-Zero rRNA removal kit (Epicentre Biotechnologies) according to the manufacturer’s instructions. The rRNA depleted RNA samples were sent to the

University of Delaware Sequencing Center for library preparation and sequencing.

The library was created using a stranded mRNA kit from Illumina and then sequenced on an Illumina HiSeq 2500; each sequencing read was 50 bp in length. The read outputs were subsequently checked for quality control using FastQC and cutadapt was used to remove adapter ends added during the library preparation. Following quality control, duplicate reads were identified and removed before proceeding with mapping reads to the reference genome. Reads were mapped to the reference genome of Vibrio parahaemolyticus RIMD2210633 using Burrows-Wheeler Aligner (BWA) with n=2 for the allowed number of mismatches (Li and Durbin 2009). Following genome mapping, the program HTSeq was used to generate a count file of the number of reads per locus tag (Anders et al. 2014). The counted number of reads was normalized using

28 reads per kilobase per million mapped reads (RPKM) as described previously

(Mortazavi et al. 2008). RPKM values from M9 mucus relative to M9 glucose were compared. Statistics were not calculated as there was only 1 sequence replicate per condition.

Results

Domains 2 and 4 are the most highly conserved among Sigma 70 Family sigma factors found in V. parahaemolyticus

We examined the distribution of domains 1, 2 3, and 4 among each sigma factor. Domain 1 is present in RpoD and RpoS, and RpoH. Domain 3 is present in

RpoD, RpoS and the flagellar sigma factors FliAP and FliAL. Whereas domains 2 and

4 which directly interact with the -10 and -35 boxes, respectively, are present in all identified sigma factors and are the only sigma factor domains present in the ECF subfamily sigma factors ( Fig. 1 ). The relative size and domains present is consistent throughout all Vibrionaceae. The variation in size and specific sigma factor domains present is likely related to the variation in function between the different groupings of sigma factors.

29 There is a positive correlation between the total number of sigma factors and genome size

It is hypothesized that there is a rough correlation between organism lifestyle and transcriptional complexity and it has been shown that the number of transcriptional regulators increases with genome size. Species which are free-living and occupy environments which are less stable such as soil and marine environments tend to have larger genomes and more transcriptional complexity (Konstantinidis and

Tiedje 2004). The Vibrionaceae family is comprised of species which occupy a wide range of niches within the marine aquatic environment, and which have variations in genome size and plasticity. We determined whether there was a correlation between genome size and total number of sigma factors among Vibrio species. As alternative sigma factors function in transcription initiation and enable the bacteria to synchronously respond to rapid changes within the environment, a higher number of sigma factors may indicate greater transcriptional complexity and regulatory networks.

We demonstrate here that there is an overall positive trend, indicating that larger genomes tend to have more sigma factors than smaller genomes among the

Vibrionaceae (Fig. 2 ). The average number of sigma factors possessed by members of

Vibrionaceae is 10 and the highest number is 15 total sigma factors ( Fig. 2, Table S1 ).

The Cholerae, Vulnificus, Anguillarum, Rumoiensis and Halioticoli clades tend to have less total sigma factors comparatively (avg. 8) and as predicted, have smaller genomes compared to other Vibrio species ( Table S1 ). Species which are members of the Photobacterium, Harveyi, Parahaemolyticus and Orientalis clades tend to have a

30 higher number of sigma factors (greater than 10), though there are exceptions, as well as greater variation in genome size and in the total number of sigma factors present between species within each clade ( Table S1 ). The variation in number of sigma factors may have allowed the Vibrio species to occupy such a wide range of ecological niches within the marine environment and a larger number of sigma factors may enable bacteria to quickly adapt to rapid environmental changes and to different marine organism hosts.

Phylogenetic analysis of all Sigma70 family sigma factors among Vibrionaceae

Phylogenetic analyses of the sigma factors demonstrate that the primary and primary alternative sigma factors are highly divergent from the ECF-type, forming two distinct subfamilies ( Fig. 3 ). Our phylogenetic analysis demonstrates that the sigma factors cluster together based on functional groupings, i.e. RpoD sigma factor homologues all cluster together, as do RpoS, RpoH, FliAL, FliAP, RpoE, Ecf2, Ecf3,

Ecf4 and Ecf5, suggesting that the core function of these sigma factors is likely conserved among species. Additionally, as the phylogeny indicates, sigma factors of the same functional grouping are more closely related to each other than sigma factors of different functional groupings are within a single species. For example, the minimum percent homology of sigma factor RpoD homologues among all

Vibrionaceae is 79%, whereas in V. parahaemolyticus the homology between RpoD

(VP0404) and RpoS (VP2553) is only 43%. As the different functional groups are

31 divergent from each other, we investigated the overall distribution of each sigma factor among Vibrionaceae .

RpoD and RpoH are found in single copies in all species analyzed

All Vibrio species analyzed contain a single copy of the housekeeping sigma

70 factor RpoD (data not shown). The phylogeny of this sigma factor followed a topology identical to that seen for the housekeeping tree and is highly conserved. We found that all 55 species also possessed a single copy of RpoH and a phylogeny based on these proteins among the species has an identical topology to that for the housekeeping tree (data not shown). The gene neighborhoods surrounding both RpoD and RpoH are also conserved among all Vibrio species ( Figure 7 ).

Distribution of the second flagella system on chromosome two is clade specific

FliAP and FliAL regulate flagellum synthesis for polar and lateral flagellum, respectively. FliAP is present in the majority of Vibrio species, with the exception of members of the Halioticoli and Rumoiensis clades, which also lack FliAL and are nonmotile ( Figure 4B ) (Sawabe et al. 1998; Nam et al. 2007; Beaz-Hidalgo et al.

2010). A much smaller number of Vibrio species possess FliAL ( Figure 4A ). The presence of both flagella regulators has an unusual distribution. Both the FliAP and

FliAL sigma factors are present in all members of the Harveyi clade and a majority of members of the Parahaemolyticus clade suggesting that retention of two flagella

32 systems is conserved in these clades. The two regulators are also present in all members of the Furnissii clades and in all V. mimicus isolates, as well as several members of the Orientalis clade including, V. coralliilyticus, V. brasilllensis, V. caribbenthicus , V. proteolyticus, V. shilonii and additionally, several Photobacterium species. FliAL is absent from members of the Splendidus, Scophthalmi, Anguillarum and Fischeri clades. Photobacterium angustum, possesses a second copy of the lateral flagella system. Overall, these data suggest that the two flagellar systems are potentially ancestral to the Harveyi, Parahaemolyticus, Photobacterium, Orientalis and

Cholerae clades and were possibly lost from V. cholerae, V. natriegens, V. sp. Ex25,

V. sinaloensis, V. orientalis, V. tubiashii and Photobacterium damselae isolates.

Several Vibrio species encode a divergent second copy of the RpoS sigma factor

All Vibrio species analyzed possess a copy of the E. coli RpoS homologue, which in this species is known as the stress response sigma factor. Phylogenetic analysis demonstrated that RpoS is highly conserved as evidenced by the short branch lengths ( Figure 5 ). We identified a number of Vibrio species that contained an additional divergent copy of RpoS. These RpoS-like sigma factors were not widely conserved and we show there are 2 major clusters and several smaller clusters of

RpoS-like sigma factors which are divergent from each other and from RpoS ( Figure

5, Figure 6 ). The previously described RpoX is a member of the largest and most highly conserved cluster of RpoS-like sigma factors; present in 12 species and these

33 12 species consist of members of the Splendidus and Harveyi clades and V. alginolyticus and V. sp. JCM 18904 species of the Parahaemolyticus clade. We found that the previously described RpoQ is confined to V. fischeri and V. salmonicida isolates. Additionally, we identified an RpoS-like sigma factor cluster in V. shilonii and V. proteolyticus isolates; V. shilonii have two RpoS-like sigma factors, the second of which is limited to V. shilonii isolates. We identified a divergent RpoS-like sigma factor in V. campbellii ATCC BAA-116, of which it is the only representative Vibrio species, and which does not cluster with RpoS-like sigma factors found in other members of the Harveyi clade suggesting a recent acquisition. The RpoS-like sigma factors from Photobacterium species formed their own cluster, with the exception of

P. damselae. Photobacterium sp SKA3 had 3 RpoS-like proteins and P. angustum and

P. leiognathi had 2 RpoS-like proteins, ( Figure 6 ).

V. parahaemolyticus possess 5 ECF type sigma factors with varying degrees of conservation

The extra-cytoplasmic function (ECF) family of sigma factors is highly divergent from the primary and primary alternative sigma factors just described with the ECF sigma factors forming distinct divergent clades (Fig 3 ). The number and type of ECFs varies even among closely related species with some species possessing 2

ECF factors and others possessing as many as 8. ECF factors typically respond to cell wall/cell envelope stress, iron levels and the oxidation state of the cell (Ho and

34 Ellermeier 2012). Many ECF factors have an associated anti-sigma factor, which generally suggests that tight regulation of the ECF factor is required.

The most widely studied ECF factor is RpoE from E. coli , a species which only possesses two ECF sigma factors, RpoE, and a second ECF, FecI which is involved in iron sensing and transport. Phylogenetic analysis revealed that among the

Vibrionaceae there are 2 well conserved ancestral ECFs, RpoE (VP2578) and Ecf3

(VP2210), and a 3 rd possibly ancestral ECF which includes two divergent clusters

(Ecf4 (VP2358) and Ecf4-like) and is also present in a majority of Vibrio species

(Figure 8 ). There are several other clusters which are less conserved and show more variation.

A large majority of the Vibrio species analyzed (51 of 55) have a copy of the

E. coli RpoE homologue and a phylogeny based on this sigma factor follows a topology similar to that of the housekeeping genes (data not shown). Ecf2 (VP0055) is less conserved, showing a deep branching pattern, and is represented by 16 species in total ( Figure 9 ) and is the most divergent of the ECFs found in V. parahaemolyticus. Ecf3 (VP2210) is highly conserved, found in 50 of 55 analyzed species. Phylogenetic analysis of Ecf3 shows a topology similar to that of the concatenated housekeeping tree with a few exceptions ( Figure 10 ). In the housekeeping phylogeny, V. caribbenthicus clusters within the Orientalis clade, not the Anguillarum clade, and V. vulnificus clusters more closely to the Cholerae and

Furnissii clades ( Figure 10 , Figure S1 ). Ecf4 (VP2358) is conserved within the

Parahaemolyticus, Cholerae, Scophthalmi, Harveyi, Orientalis, Furnissii, Vulnificus

35 and Halioticoli clades and Ecf4-like is conserved within the Splendidus and

Photobacterium clades and V. litoralis isolates. The inferred phylogeny of Ecf4 is distinct from that of the housekeeping gene tree topology ( Figure 11 ). The least conserved of the ECFs present in V. parahaemolyticus is Ecf5 (VPA1690), and is confined to V. parahaemolyticus, V. alginolyticus, V. sp. Ex25 and V. sp. JCM 18904 isolates ( Figure 12 ). There are several less conserved and more divergent clusters of

ECFs which are not homologous to any ECF proteins in V. parahaemolyticus , the function of which is unknown.

ECF gene neighborhoods found in Vibrio parahaemolyticus are conserved throughout Vibrionaceae

The gene neighborhoods surrounding the putative ECFs found within V. parahaemolyticus are well conserved among the Vibrio (Figure 7 ). RpoE is in an operon with regulators RseA, RseB and RseC and this is true for all species which have homologues of RpoE, suggesting regulation of RpoE by its anti-sigma factor,

RseA, is conserved. Ecf2 (VP0055) is embedded within an operon encoding two hypothetical proteins as well as a serine/threonine kinase (VP0057) which could suggest regulation of the sigma factor through phosphorylation. The gene neighborhood of Ecf3 (VP2210) is made up of genes encoding proteins involved in long chain fatty acid transport as well as the beta-oxidation of long and medium chain fatty acids under anaerobic conditions and this gene neighborhood is conserved among all Vibrio species. Ecf4 (VP2358) is in an operon with an anti-sigma factor known as

36 ChrR, suggesting tight regulation. ChrR anti-sigma factors contain zinc binding fingers as well as a cupin-domain; this cupin domain is capable of binding singlet oxygen species, suggesting that this sigma factor may respond to reactive oxygen species stress. Ecf4-like sigma factors are also in an operon with ChrR anti-sigma factors suggesting regulation of the two divergent sigma factors is similar. Ecf5

(VPA1690), the sigma factor unique to the Parahaemolyticus clade and located on chromosome 2 is surrounded by hypothetical proteins, and a putative glutamine amidotransferase (VPA1689).

Expression pattern of V. parahaemolyticus sigma factors in M9 Mucus relative to M9 Glucose

In order to begin to determine the function and role of sigmas in V. parahaemolyticus biology, the expression pattern of the sigma 70 family regulators in M9 minimal media supplemented with intestinal mucus relative to M9 supplemented with glucose was analyzed. This analysis demonstrates that RpoD, RpoE and RpoS are the most highly expressed sigma factors under both conditions examined. Additionally, RpoS expression pattern was shown to decrease in M9 mucus. ( Figure 14a,b ). The expression pattern of RpoE remains relatively unchanged between the two conditions. Lastly, Ecf3 (VP2210) is the only sigma factor that was demonstrated to be induced in the presence of mucus, indicating this highly conserved ECF may have a role in growth or survival in mouse intestinal mucus.

37 Discussion

In order to further our understanding of the evolution of sigma factors within Vibrio , we determined the distribution and reconstructed the phylogeny of sigma-70 family sigma. Vibrio parahaemolyticus has 11 total sigma factors, which is close to the average number of sigma factors of 10 found among the 55 examined species from Vibrionaceae. In general, the number of sigma factors encoded by a species increased with genome size, suggesting that larger genomes have more complex transcriptional regulatory networks. The lowest numbers of sigma factors were found in the Cholerae, Vulnificus, Anguillarum, Rumoiensis and Halioticoli clades, averaging around 8 total sigma factors. A large majority of species in the Halioticoli clade listed in the NCBI database are isolated in association with abalones ( Haliotis ) and are thought to be symbionts. Symbiotic bacteria have been demonstrated to have lost regulatory elements, including sigma factors, due to the lack in necessity for extensive gene regulation within the stable environments of the host organism (Fraser et al. 1995; Andersson and Kurland 1998; Shigenobu et al. 2000). It may be this symbiotic nature that leads to members of the Halioticoli clade having an overall smaller number of sigma factors; the ecological role of having less total sigma factors in other Vibrio species is unknown. Presumably, the free-living, sometimes host associated, V. parahaemolyticus as well as other Vibrio species encoding 10 or more sigma factors, have a larger number due to the greater diversity of environments inhabited. There is some dispersion around the mean in terms of total number of sigma factors relative to genome size suggesting that factors other than strictly genome size are playing a role in the expansion of these global transcriptional regulators.

38 The sigma factors encoded in the V. parahaemolyticus genome which were found to be the most highly conserved include RpoD; heat shock sigma factor, RpoH and stationary phase stress sigma factor, RpoS. RpoD and RpoH were both very highly conserved and found in a single copy in all 55 species examined indicating they are ancestral to Vibrionaceae. RpoS was also found in a single copy among all 55 species examined and also showed high level of conservation. We found that several members of this family also encode a second RpoS-like sigma which formed several divergent groupings. Vibrio parahaemolyticus encodes two flagellar sigma factors, FliAP and FliAL. FliAP was found in 50 of 55 species and absent from the Halioticoli and Rumoiensis clades, members of which are non-motile, are symbionts of abalones and have some of the smaller genome sizes within this family. Unlike FliAP, FliAL has a more limited distribution and was most frequently found in members of the Harveyi and Parahaemolyticus clades. The canonical RpoE (VP2578) is well conserved among Vibrionaceae , as was Ecf3 (VP2210) and Ecf4 (VP2358), whose functions are unknown. EcF2 and Ecf5 are less conserved: Ecf2 (VP0055) is found in only 16 species and is highly divergent from other ECFs. Ecf 5 (VPA1690) the only ECF present on chromosome 2 is only present in V. parahaemolyticus, V. alginolyticus and Vibrio sp. Ex 25 and the significance of this sigma factor is unknown. There have been studies into the development of new antimicrobials towards ECF type sigma factors (El-Mowafi et al. 2015), thus it is important to understand the role and distribution of these novel, uncharacterized ECFs and whether there is any functional overlap between them. The characterization of these putative ECFs, especially those which are highly conserved,

39 may also help to further our understanding of the pathogenesis and physiology of pathogenic Vibrio species. Lastly, we examined the expression patterns of these various sigma factors in V. parahaemolyticus in M9 mucus relative to M9 glucose through the use of RNA-Seq analysis to begin to unravel the roles of these factors in host survival. Previously we have shown that the loss of RpoE is detrimental to colonization, in contrast, the loss of RpoN, FliAP and FliAL resulted in increased in vivo fitness relative to wild-type and the loss of RpoS had no impact on intestinal colonization (Haines-Menges et al. 2014; Whitaker et al. 2014). Our expression analysis shows that RpoS and RpoN are both down regulated in M9 mucus relative to M9 glucose. The flagellar sigma factors, FliAP and FliAL both showed low levels of expression under all conditions. RpoE remained relatively unchanged in expression between the two conditions; however, it was expressed at a high level in both M9 glucose and M9 mucus relative to the expression of other sigma factors, supporting the importance of this sigma factor in V. parahaemolyticus. Ecf3 (VP2210), which was conserved among Vibrionaceae , was induced in the M9 mucus relative to M9 glucose.

Size Comparisons of Sigma Factors in Vibrio parahaemolyticus. Here we show a comparison of the size and domains present in each of the 11 sigma factors possessed by Vibrio parahaemolyticus . Only domains 2 and 4 are highly conserved and found in all sigma factors. The largest sigma factor is RpoD, which contains all of the known sigma factor domains. RpoN, which is not discussed in this paper, is a member of the sigma54 family of sigma factors and is the second largest in size and is structurally distinct from sigma70 family sigma factors. RpoS is the next largest sigma70 factor, followed by RpoH, and the flagellar sigma factors, FliAP and FliAL. All five ECF sigma factors have domains 2 and 4 only and are similar in size (200 or less amino acids). The domains present as well as the size are useful information in addition to homology in identifying sigma factors in other species and categorizing them into the various functional groupings.

Comparison of Total Number of Sigma Factors Relative to Genome Size. Here we demonstrate that there is a relationship between the total number of sigma factors relative to genome size. There is an overall trend that larger genomes tend to have a greater number of total sigma factors, as indicated by the positive slope of the best fit line. The positive slope is significantly nonzero (p<0.0001), supporting the trend seen.

Overview of All Identified Sigma Factors. Phylogenetic tree constructed from the alignment of sigma-70 family sigma factors using the amino acid sequences of all identified putative sigma factors. The software, MEGA6.0, was used to construct a neighbor-joining tree using the p-distance model, complete deletion and a bootstrap test of 1000x. Locus tags are indicated on the tree next to each species name. Clusters of sigma factors found in V. parahaemolyticus are collapsed. This overview phylogenetic analysis shows that there are two main subfamilies of sigma factors, primary and extracytoplasmic function (ECF)- type. Phylogenetic analysis demonstrates that there is more variation in number of ECFs among Vibrionaceae, than in the total number of primary alternative sigma factors.

Phylogenetic Analysis of FliAL (A) and Strains Lacking Any Flagella Sigma Factors (B). A. Phylogenetic analysis of the 24 species which possess at least 1 copy of FliAL, the lateral flagella sigma factor. The 24 species which encode a FliAL were identified using VPA1555, which encodes FliAL for V. parahaemolyticus RIMD2210633, as the seed in a BLAST search. The collected amino acid sequences were aligned via Muscle and a Neighbor-Joining Tree was constructed to infer the evolutionary history using MEGA6. Percentage values indicating the number of times the taxa clustered in replicate trees in the bootstrap test (1000X) are shown. A large number of species from the Parahaemolyticus, Harveyi, Furnissii, Orientalis and Photobacterium clades possess FliAL. B. There were five species of the analyzed 55 which do not possess any flagella sigma factors. The species found not to have FliAP/FliAL were all from the Halioticoli and Rumoiensis clades. These clades cluster together on the housekeeping tree, suggesting that a common ancestor between the two lost the flagella sigma factor(s). Interestingly, members of the Halioticoli clade are bivalve symbionts.

RpoS and Rpos-like Phylogenetic Analysis. Phylogenetic analysis of all RpoS and RpoS-like proteins (colored) found within Vibrionaceae. Here we demonstrate that all species analyzed possess a single copy of the canonical RpoS. This RpoS sigma factor is highly conserved while some species have an additional divergent copy of RpoS, which is distinct from the canonical RpoS, suggesting there function could also be distinct.

Phylogenetic Analysis of RpoS-like sigma factors. Here we show that there are several clusters of RpoS-like proteins distinct from each other. V. shilonii and most Photobacterium sp. have two copies of RpoS-like sigmas, while Photobacterium sp. SKA34 has three. Interestingly, the Vibrio campbellii RpoS-like sigma factor does not cluster with other Harveyi clade strains also possessing RpoS-like sigma factors, suggesting possible horizontal gene transfer (red arrow).

Gene Neighborhoods Surrounding the Primary like Sigma Factors of V. parahaemolyticus. This figure is an illustration of the gene neighborhoods which surround the primary alternative sigma factors in Vibrio parahaemolyticus (not drawn to scale). Gene neighborhood context can be an indication of function, though not always. Interestingly, the gene neighborhoods surrounding each primary alternative sigma factor in V. parahaemolyticus are highly conserved throughout Vibrionaceae. This would suggest that the function of these proteins may also be well conserved.

Phylogenetic Analysis of the Extracytoplasmic Function (ECF) Type Sigma Factors. There are five total ECFs in V. parahaemolyticus with different levels of conservation. This group, which we have termed Ecf2 (VP0055) is represented by 16 species. Deep branching patterns indicate that this particular ECF is not highly conserved. In species which have a copy of Ecf2, the sigma factor is neighboring gluconate catabolism genes suggesting a possible function.

94 Vibrio harveyi 1DA3 VME 02470 91 Vibrio sp. HENC-03 VCHENC03 0031

100 Vibrio campbellii ATCC BAA-1116 M892 10280 Vibrio parahaemolyticus RIMD2210633 VP0055 78 77 Vibrio alginolyticus ATCC 17749 VMC 10870 99 Vibrio sp.Ex25 VEA 001967 Vibrio vulnificus CMCP6 VV1 1093

57 Aliivibrio salmonicida LFI238 VSAL I0117 88 Vibrio fischeri ES114 VF 2498 61 Vibrio genomosp. F6 WP 017052091 Vibrio sinaloensis DSM 21326 VISI1226 18496 77 Vibrio fortis Dalian14 VFDL14 14900 Vibrio crassostreae WP 017060140 100 Vibrio tasmaniensis WP 017112121 Vibrio furnissii NCTC 11218 vfu A00240 Vibrio genomosp.F10 WP 017040058

0.1 Phylogenetic Analysis of Ecf2. There are five total ECFs in V. parahaemolyticus with different levels of conservation. This group, which we have termed Ecf2 (VP0055) is represented by 16 species. Deep branching patterns indicate that this particular ECF is not highly conserved. In species which have a copy of Ecf2, the sigma factor is neighboring gluconate catabolism genes suggesting a possible function.

49 Vibrio parahaemolyticus RIMD2210633 VP2210 67 Vibrio sp.Ex25 VEA 002854 Vibrio alginolyticus ATCC 17749 VAL01S 11 01880 Vibrio sp. JCM 18904 JCM18904 4163 Vibrio natriegens NBRC 15636 M272 11985 90 Vibrio sp.EJY3 VEJY3 11385 Vibrio owensii CAIM 1854 WP 020197092 Vibrio sp.HENC-03 VCHENC03 2564 67 Vibrio sp. JCM 19052 JCM19052 5587 54 Vibrio campbellii ATCC BAA-1116 M892 15450

62 Vibrio rotiferianus WP 029561022 Vibrio vulnificus CMCP6 VV1 1974 Vibrio shilonii AK1 VSAK1 03239 Vibrio genomosp.F10 WP 017035219 Vibrio genomosp.F6 WP 017052466 Vibrio proteolyticus NBRC 13287 VPR01S 02 01660 Vibrio coralliilyticus ATCC BAA-450 VIC 001795 Vibrio sinaloensis DSM 21326 VISI1226 23032 Vibrio orientalis CIP 102891 VIOR3934 11012 Vibrio brasiliensis LMG 20546 VIBR0546 07652 59 Vibrio tubiashii NCIMB 1337 VT1337 09667 Vibrio fortis Dalian14 VFDL14 07560 Vibrio cyclitrophicus FF75 M565 ctg1P1697 95 54 Vibrio crassostreae WP 017060646 78 Vibrio sp.624788 WP 017631747 67 Vibrio tasmaniensis WP 029223118

67 Vibrio sp. MED222 MED222 02953 71 Vibrio splendidus LGP32 VS 0863

100 Vibrio mimicus VM603 VMB 23890 Vibrio cholerae O1 biovar eltor str. N16961 VC1045

92 Vibrio fluvialis I21563 L911 1401 Vibrio furnissii NCTC 11218 vfu A02554 Vibrio ichthyoenteri ATCC 700023 VII00023 01590

100 Vibrio scophthalmi LMG 19158 VIS19158 20961 96 Vibrio sp.N418 VIBRN418 15233 Vibrio caribbenthicus ATCC BAA-2122 VIBC2010 13784 Vibrio anguillarum 775 VAA 02363 100 Vibrio ordalii ATCC 33509 WP 017044557 99 Vibrio litoralis DSM 17657 WP 027697420 Vibrio rumoiensis 1S-45 WP 017025797 Vibrio breoganii ZF-55 WP 017027787

99 Vibrio ezurae NBRC 102218 VEZ01S 07 00890 94 Vibrio halioticoli NBRC 102217 VHA01S 004 01340 Vibrio nigripulchritudo ATCC 27043 VINI7043 24692 Photobacterium damselae subsp. damselae CIP 102761 VDA 002566 Grimontia hollisae CIP 101886 VHA 003339 100 Photobacterium profundum SS9 PBPRA0960 48

88 Photobacterium leiognathi subsp. mandapamensis svers 1.1 PMSV 323 98 Photobacterium angustum S14 VAS14 17326 100 Photobacterium sp. SKA34 SKA34 02404

0.05 Phylogenetic Analysis of Ecf 3. There are five total ECFs in V. parahaemolyticus with different levels of conservation. This group, which we have termed Ecf3 (VP2210 is represented by 50 species. This ECF cluster is as well conserved as the canonical ECF, RpoE (Ecf1). Species which cluster differently relative to the housekeeping tree are V. caribbenthicus , which clusters in the Orientalis clade on the housekeeping tree and V. vulnificus which clusters in the housekeeping tree more closely with the Cholerae and Furnissii clades. Overall there is a high level of conservation of this sigma factor, suggesting that function may also be well conserved.

Phylogenetic Analysis of Ecf4. Phylogenetic analysis of putative Ecf4 sigma factors reveals that there are two major clusters: Ecf4 and Ecf4- like. Between the two clusters, there are 48 species which possess either an Ecf4 or Ecf4-like sigma factor. Species from the Parahaemolyticus, Harveyi, Orientalis, Anguillarum, Scopthalmi, Halioticoli, Cholerae and Furnissii clades tend to have the Ecf4 sigma factor, homologous to VP2358, which species from the Photobacterium, Splendidus and Fischeri clades possess Ecf4-like sigma factors.

98 Vibrio alginolyticus ATCC 17749 VMC 06000 Vibrio sp.JCM 18904 JCM18904 2622 Vibrio parahaemolyticus VPA1690 Vibrio sp. Ex25 VEA 001038

0.01 Phylogenetic Analysis of Ecf5. Ecf5 (VPA1690), the only ECF found on chromosome 2 of V. parahaemolyticus, is found exclusively in V. parahaemolyticus and V. alginolyticus species and strains V. sp. JCM 18904 and V. sp. Ex25, which are closely related to V. alginolyticus. The function of this unique sigma factor is unknown.

Gene Neighborhoods of the ECF Sigma Factors of V. parhaemolyticus. Gene neighborhood surrounding the ECFs found in V. parahaemolyticus. RpoE is embedded in an operon with its positive and negative regulators, RseA, RseB and RseC, as expected and this is true for all species which have a copy of RpoE. All of the gene neighborhoods depicted are well conserved throughout Vibrionaceae in species which have homologs of particular sigma factors, suggesting that the function may also be well conserved throughout.

53 A.

B. Expression in M9 Mucus 32

0.5

S 3 E o cf

Fold change relative to M9 M9 Glucose to relative change Fold o p p E R R

Expression analysis in M9 Cecal Mucus vs. M9 Glucose. Expression analysis from RNA sequencing RPKM values comparing M9 mucus to control M9 glucose (A). qPCR validations of RpoE, RpoS and Ecf3 gene expression patterns observed in the RNA sequencing (B).

54 Supplementary Figures and Tables

Figure S1. Major Clades of Vibrionaceae. Concatenated amino acid sequences of rpoB, mdh and pyrC for each species/strain were aligned in MEGA6 using Muscle. A Neighbor-joining tree was constructed to infer evolutionary history. Bootstrap test (1000x) was used to determine the percentage of time the taxa clustered together, as shown, when over 45%. The major clades of species are labelled.

55 Table 1 Table S1. Locus Tags for Housekeeping Tree

Locus Tag/location

Name rpoB mdh pyrC Aliivibrio VSAL_I2866 VSAL_I0359 VSAL_II0468 salmonicida LFI1238 Grimontia hollisae VHA_000316 VHA_002058 ZP_06053391 CIP 101886 Photobacterium VAS14_19156 VAS14_08310 VAS14_00951 angustum S14 Photobacterium damselae subsp. VDA_003092 VDA_002986 VDA_001843 damselae CIP 102761 Photobacterium leiognathi subsp. PMSV_3812 PMSV_4015 PMSV_604 mandapamensis svers.1.1. Photobacterium YP_131518 PBPRA0391 PBPRA2405 profundum SS9 Photobacterium sp. SKA34_16510 SKA34_17763 SKA34_15733 SKA34 Vibrio alginolyticusATCC VMC_13840 VMC_03420 VMC_15870 17749 Vibrio anguillarum VAA_00351 VAA_01685 VAA_00972 775 Vibrio azureus VAZ01S_081_001 VAZ01S_027_005 VAZ01S_015_001 NBRC 104587 60 80 30 Vibrio brasiliensis VIBR0546_19107 VIBR0546_19297 VIBR0546_14415 LMG 20546 Vibrio breoganii ZF- WP_017026989 WP_017029050 WP_017029592 55 Vibrio caribbenthicus VIBC2010_11541 VIBC2010_15622 VIBC2010_09342 ATCC BAA-2122 Vibrio sp. HENC-03 VCHENC03_0078 VCHENC03_3266 VCHENC03_4631 Vibrio cholerae VC0328 VC_0432 VCA0925 N16961 Vibrio coralliilyticus VIC_000047 VIC_004828 VIC_003248 ATCC BAA-450 Vibrio crassostreae WP_017065638 ADC99173 WP_017064296

56 9ZC13 Vibrio cyclitrophicus M565_ctg4P227 M565_ctg3P200 M565_ctg5P1078 FF75 Vibrio ezurae NBRC VEZ01S_46_0002 VEZ01S_05_0144 VEZ01S_21_0117 102218 0 0 0 Vibrio fischeri ES114 VF_2414 VF_0276 VF_A0412 Vibrio fluvialis L911_3519 L911_3912 L911_2616 121563 Vibrio fortis Dalian VFDL14_11735 VFDL14_08760 VFDL14_17560 14 Vibrio furnissii vfu_A00038 vfu_A03084 vfu_B01275 NCTC 11218 Vibrio genomosp. F6 WP_017053182 WP_017051159 WP_017051668 Vibrio genomosp. WP_017035402 WP_017038769 WP_017033477 F10 Vibrio harveyi 1DA3 VME_32530 VME_16640 VME_35630 Vibrio campbellii VIBHAR_00225 VIBHAR_00795 M892_25170 ATCC BAA-1116 Vibrio halioticoli VHA01S_038_001 VHA01S_003_017 VHA01S_008_010 NBRC 102217 40 60 80 Vibrio ichthyoenteri VII00023_15976 VII00023_17031 VII00023_05282 ATCC 700023 Vibrio kanaloae 5S- WP_017055915 WP_017055964 WP_017057947 149 Vibrio litoralis DSM WP_027695379 WP_027697876 WP_027695562 17657 Vibrio mimicus VMB_07350 VMB_31410 VMB_17360 VM603 Vibrio natriegens M272_03495 M272_19205 M272_16355 NBRC 15636 Vibrio nigripulchritudo VINI7043_00277 VINI7043_19588 VINI7043_04290 ATCC 27043 Vibrio ordalii ATCC VordA3_0101000 VordA3_0101000 VordA3_0101000 33509 06710 15387 01797 Vibrio orientalis CIP ZP_05946651 VIA_003995 VIA_000879 102891 Vibrio owensii *WP_009705466* WP_020196545 WP_020194060 CAIM1854 * Vibrio VP2922 VP0325 VPA0408 parahaemolyticus

57 RIMD 2210633 Vibrio proteolyticus VPR01S_29_0007 VPR01S_20_0068 VPR01S_05_0163 NBRC 13287 0 0 0 Vibrio rotiferianus VrotD_010100000 VrotD_010100003 VrotD_010100021 DAT722 953 320 328 Vibrio rumoiensis IS- WP_017026551 WP_017026338 WP_017023888 45 Vibrio scophthalmi VIS19158_14047 VIS19158_04331 VIS19158_18031 LMG 19158 Vibrio shilonii AK-I VSAK1_09853 WP_031496918 VSAK1_21679

Vibrio sinaloensis VISI1226_14532 VISI1226_19579 VISI1226_03785 DSM 21326

Vibrio sp. 624788 WP_017631517 *** WP_017633383 Vibrio sp. EJY3 VEJY3_14765 VEJY3_01590 VEJY3_22466 Vibrio sp. Ex25 VEA_002173 VEx25_0219 VEA_001337 Vibrio sp. JCM18904 JCM18904_5083 JCM18904_433 JCM18904_2317 Vibrio sp. JCM19052 JCM19052_5697 JCM19052_3681 JCM19052_3227

Vibrio sp. MED222 MED222_00572 MED222_17215 MED222_08928

Vibrio sp. N418 VIBRN418_07985 VIBRN418_11585 VIBRN418_08787 Vibrio splendidus VS_2963 VS_0358 VS_II0272 LGP32 Vibrio tasmaniensis WP_017104578 ADD00048 WP_017109012 5F-79 Vibrio tubiashii VT1337_16523 VT1337_16653 VT1337_19727 NCIMB 1337 Vibrio vulnificus VV1_1211 VV1_0673 VV2_1596 CMCP6

Table 2 Real-time PCR Primers

Primer Sequence Tm (°C) Product Size (bp) rpoE Forward CCC TTG AGC CAC AAT GTG AT 58 241 rpoE Reverse TGA GCG AGT TCA GAA TGG TG 58

rpoS Forward ATT TGA CGT ACA CGC TCA CG 56 165 rpoS Reverse CGT CTT TGA TCC ATT GGT TG 52

VP2210 Forward CAA AGC AAT TGC GGA AGA TT 56 231 VP2210 Reverse TGT GCT TGA AGC CAT TCT TG 57

16S Forward ACG GCC TGG GGA GTA CGG TC 60 234 16S Reverse TTG CGC TCG TTG CGG GAC TT 60

59 Table 3 List of Species and Number of Sigma Factors

Name Source Date of Isolation Location PA Total ECF Total Parahaemolyticus Clade Vibrio sp. JCM18904 sea cucumber 7 4 11 Vibrio alginolyticus ATCC 17749 Brazilian corals Brazil 7 5 12 Vibrio sp. Ex25 deap sea hydrothermal vent East Pacific Rise 6 5 11 Vibrio parahaemolyticus RIMD 2210633 Clinical January, 1996 India (Calcutta) 6 5 11 Vibrio natriegens NBRC 15636 salt marsh mud Sapelo Island, GA, USA 5 3 8 Vibrio sp. EJY3 grapsid crab West Sea, Incheon, Korea 5 3 8 Harveyi Clade Vibrio azureus NBRC 104587 sea water July, 2005 Kuroshio Region, Japan 6 2 8 Vibrio rotiferianus DAT722 mud crab larvae aquaculture tank Northern Territory, Australia 6 4 10 Vibrio sp. JCM19052 7 5 12 Vibrio harveyi 1DA3 7 6 13 Vibrio campbellii ATCC BAA-1116 environmental isolate 1993 7 6 13 Vibrio sp. HENC-03 environmental isolate 2010 Haiti 7 6 13 Vibrio owensii CAIM1854 spiny lobster larva North Queensland, Australia 6 3 9 Scopthalmi Clade Vibrio ichthyoenteri ATCC 700023 gut of flounder larvae Japan 5 5 10 Vibrio scophthalmi LMG 19158 fish intestines Spain 5 4 9 Vibrio sp. N418 5 4 9 Cholerae Clade Vibrio cholerae N16961 cholera patient stool 1971 Bangladesh 5 3 8 Vibrio mimicus VM603 riverine water 1990s Amazonian region of Brazil 6 3 9 Furnissii Clade Vibrio furnissii NCTC 11218 United Kingdom 6 4 10 Vibrio fluvialis 121563 severe diarrheal patient 1970 Bahrain 6 4 10 Vulnificus Clade Vibrio vulnificus CMCP6 human clinical isolate South Korea 5 4 9 Orientalis Clade Vibrio proteolyticus NBRC 13287 intestine, Limnoria tripunctata 7 5 12 Vibrio caribbenthicus ATCC BAA-2122 marine sponge, Scleritoderma cyanea May, 2000 Curacao 6 3 9 Vibrio coralliilyticus ATCC BAA-450 coral March, 1999 Zanzibar, Tanzania 6 8 14 Vibrio sinaloensis DSM 21326 spotted nose snapper liver November, 2003 Sinaloa, Mexico 5 5 10 Vibrio orientalis CIP 102891 seawater Yellow Sea, China 5 4 9 Vibrio brasiliensis LMG 20546 1999 Brazil 6 6 12 Vibrio tubiashii NCIMB 1337 oyster spat Milford, CT, USA 5 6 11 Anguillarum Clade Vibrio anguillarum 775 fish pathogen ( Oncorhynchus kisutch ) Pacific Ocean Coast, USA 5 4 9 Vibrio ordalii ATCC 33509 Coho Salmon kidney Puget Sound, WA, USA 5 3 8 Orphan Clades Vibrio nigripulchritudo ATCC 27043 seawater (chitin enrichment) 5 5 10 Vibrio genomosp. F10 zooplankton September, 2008 Plum Island, MA, USA 5 5 10 Vibrio genomosp. F6 filtered seawater September, 2006 Massachusetts, USA 5 3 8 Vibrio shilonii AK-I isolated from coral Mediterranean Sea 10 5 15 Splendidus Clade Vibrio fortis Dalian 14 red sea urchin October, 2010 Dalian, China 5 4 9 Vibrio kanaloae 5S-149 filtered seawater September, 2006 Massachusetts, USA 6 2 8 Vibrio sp. 624788 kelp frond 2010 La Jolla, CA, USA 5 3 8 Vibrio crassostreae 9ZC13 zooplankton September,2008 Plum Island, MA, USA 5 5 10 Vibrio cyclitrophicus FF75 sea water September, 2006 Plum Island, MA, USA 6 4 10 Vibrio tasmaniensis 5F-79 filtered seawater September, 2006 Massachusetts, USA 5 5 10 Vibrio sp. MED222 1 m depth sea water NW Mediterranean Sea 6 4 10 Vibrio splendidus LGP32 infected oysters summer, 2001 France (Atlantic Ocean) 6 4 10 Rumoiensis Clade Vibrio litoralis DSM 17657 seawater Korea 4 3 7 Vibrio rumoiensis IS-45 filtered seawater April, 2006 Massachusetts, USA 4 2 6 Halioticoli Clade Vibrio breoganii ZF-55 filtered seawater September, 2006 Plum Island, MA, USA 4 4 8 Vibrio halioticoli NBRC 102217 Gut of abalone 1992 Japan 4 4 8 Vibrio ezurae NBRC 102218 Gut of abalone Kanagawa, Japan 4 5 9 Fischeri Clade Vibrio fischeri ES114 squid light organ 1988 Hawaii, USA 6 5 11 Aliivibrio salmonicida LFI1238 Atlantic cod (cold water vibriosis) N/A Norway 6 2 8 Photobacterium Clade Grimontia hollisae CIP 101886 human feces Maryland, USA 6 6 12 Photobacterium profundum SS9 deep sea Sulu Sea trough 7 3 10 Photobacterium damselae subsp. damselae CIP 102761 damsel fish skin ulcer California, USA 7 2 9 Photobacterium leiognathi subsp. mandapamensis svers.1.1. cardinal fish symbiont 8 5 13 Photobacterium angustum S14 surface marine water Botany Bay, Australia 9 5 14 Photobacterium sp. SKA34 2-5m depth sea water Sweden 9 4 13

60 Chapter 3

THE ALTERNATIVE SIGMA FACTOR RPOE IS IMPORTANT FOR VIBRIO PARAHAEMOLYTICUS CELL ENVELOPE STRESS RESPONSE AND INTESTINAL COLONIZATION

Introduction

Vibrio parahaemolyticus is a Gram-negative organism, commonly found within brackish waters, such as coastal marine and estuarine, worldwide (Kaneko and

Colwell 1973; Joseph et al. 1982; Zimmerman et al. 2007). Vibrio parahaemolyticus is frequently associated with bacterial seafood borne gastroenteritis following the consumption of raw or undercooked fish and shellfish, resulting from this organism’s ability to colonize shellfish in high numbers (Blackstone et al. 2003; McLaughlin et al.

2005; Zimmerman et al. 2007). Disease caused by V. parahaemolyticus is marked by diarrhea and abdominal pain. Additionally, septicemia and mortality have been documented in immunocompromised individuals and in cases following exposure of open wounds to the organism (Daniels et al. 2000). In the United States the number of incidences of illness associated with Vibrio , including V. parahaemolyticus , has increased. According to the CDC, in 2012, the rate of infections caused by Vibrio species had increased 43 % since 2006-2008, while disease caused by other enteric species such as Escherichia coli O157 and Salmonella enterica had no change in infection rates during that same time duration.

61 Vibrio parahaemolyticus must be able to alternate between natural and host environments and possess the ability to respond to rapid changes in the extracellular environment in order to survive and cause disease. Previously, we developed a streptomycin treated adult murine model of colonization to study the bacterial factors required for host colonization (Whitaker, et al. 2012; Whitaker, et al. 2014). This animal model was used to demonstrate the importance of the Vibrio specific regulatory system ToxRS, in colonization of the mouse gastrointestinal tract (Whitaker et al. 2012). ToxRS was shown to be important for survival under acid (organic and inorganic) stresses, SDS and bile salt stresses in V. parahaemolyticus through its positive regulation of the outer membrane protein OmpU (Whitaker et al. 2010;

Whitaker et al. 2012). A toxRS mutant was defective in mouse intestinal colonization indicating its importance in host-pathogen interactions (Whitaker, et al. 2012).

Another method by which bacteria regulate gene expression in response to changing extracellular conditions is through the use of alternative sigma factors.

Stress response sigma factor, RpoS, has been studied in V. cholerae, V. vulnificus, V. anguillarum, V. harveyi, and V. alginolyticus and has been shown to be involved in a number of stress responses in these species including starvation, osmolarity, ethanol, hydrogen peroxide and acid stress responses (Yildiz and Schoolnik 1998; Merrell et al.

2000; Lin et al. 2002; Hulsmann et al. 2003; Rosche et al. 2005; Tian et al. 2008;

Weber et al. 2008) . Previously RpoS has also been studied in V. parahaemolyticus and was found to play a limited role in the stress response in this organism (Whitaker et al.

2012). Additionally, it has been demonstrated that preadaptation of V.

62 parahaemolyticus to high salinity results in enhanced survival under lethal acid stress and this phenotype is independent of RpoS (Kalburge et al. 2014). RpoS was also shown not to be required for oyster colonization (Richards et al. 2012). More recently, we examined RpoN, a sigma factor that has been shown to regulate over 500 genes in

V. cholerae (Kawagishi et al. 1997; O'Toole et al. 1997; Klose and Mekalanos 1998;

Wolfe et al. 2004; Yildiz et al. 2004; Syed et al. 2009; Dong and Mekalanos, 2012).

The V. parahaemolyticus rpoN deletion mutant was non-motile and defective in biofilm formation (Whitaker et al. 2014). In in vivo intestinal colonization assays, the rpoN mutant was shown to be a hypercolonizer compared to wild-type (WT) in the streptomycin pretreated mouse model (Whitaker et al. 2014). To determine whether loss of motility was the cause of the increased fitness in vivo , analysis of deletion mutants in the polar flagellum sigma FliAP and a double mutant in FliAP and the lateral flagella FliAL sigma factor were examined (Whitaker et al. 2014). It was found that these mutants were slightly better colonizers than the WT but not to the same extent as the rpoN mutant suggesting motility was not the cause of the phenotype. It was shown that the rpoN mutant had a metabolic advantage over WT since it grew at a faster rate than WT in intestinal mucus suggesting carbon utilization is an important colonization factor (Whitaker et al. 2014).

The focus of this study is to elucidate the role of the extracytoplasmic function

(ECF) sigma factor, RpoE, in stress response and colonization of V. parahaemolyticus.

RpoE was first identified and studied in E. coli and has been shown to be an essential protein, necessary for cell envelope integrity (De Las Penas et al. 1997; Missiakas and

63 Raina 1998; Alba and Gross 2004; Costanzo and Ades 2006). Under optimum growth conditions in E. coli , RpoE activity is low and it is bound to the inner membrane by

RseA, an antisigma factor (De Las Penas et al. 1997; Missiakas et al. 1997). Under stress conditions that result in the presence of misfolded proteins in the periplasmic space, RseA is degraded by DegS with release of RpoE (Walsh et al. 2003). RpoE has been characterized in a number of Vibrio species (Hild et al. 2000; Kovacikova and

Skorupski 2002; Mathur et al. 2007; Brown and Gulig 2009; Davis and Waldor 2009;

Rattanama et al. 2012). For example, in V. vulnificus an rpoE mutant was found to be sensitive to ethanol, SDS and hydrogen peroxide but was not attenuated for virulence in mice (Brown and Gulig 2009). In V. harveyi , rpoE appeared to be essential as an rpoE mutant could not be constructed (Rattanama et al. 2012). It was shown that overexpression of rpoE in this species resulted in a reduction of hemolytic activity and attenuation for colonization in shrimp (Rattanama et al. 2012). In a classical biotype

V. cholerae strain an rpoE mutant was important for intestinal survival and virulence in an infant mouse model (Kovacikova and Skorupski 2002). The rpoE mutant strain was sensitive to 3 % ethanol stress but resistant to heat stress, bile salts, hydrogen peroxide, the antimicrobial peptide polymyxin B, osmolarity and pH stresses

(Kovacikova and Skorupski 2002). In contrast, in an El Tor biotype V. cholerae strain, an rpoE mutant was determined to be sensitive to a bioactive peptide P2 and polymyxin B (Mathur et al. 2007). This group previously showed that the outer membrane protein OmpU was important for resistance to the bioactive peptide P2 and polymyxin B (Mathur and Waldor 2004). It was shown that in V. cholerae, an rpoE

64 mutant could only be made in the presence of suppressor mutations, 75% of which occurred in the promoter region of ompU, and that OmpU is a key requirement for

RpoE function (Davis and Waldor 2009).

The role of alternative sigma factors in V. parahaemolyticus has not been extensively studied. The aim of this study was to determine the function of the rpoE homologue VP2578 in V. parahaemolyticus. To accomplish this, an in-frame deletion of VP2578 was constructed and examined under a number of stress conditions. The effect of the deletion of this global regulator, RpoE, on the ability of V. parahaemolyticus to colonize the murine gastrointestinal tract was also examined.

Materials and Methods

Bacterial strains, plasmids, and growth conditions

All bacterial strains and plasmids used in this study are listed in Table 1 . A streptomycin-resistant V. parahaemolyticus RIMD2210633 O3:K6 clinical isolate and a streptomycin-resistant -galactosidase positive RIMD2210633 isolate named

WBWlacZ were used in this study (Whitaker, et al. 2012; Whitaker, et al. 2014).

Genetic manipulations to construct the Δ rpoE mutant strain used Escherichia coli strains DH5α λ pir and β2155 λ pir . Unless otherwise noted, all strains were grown at 37° C in Luria-Bertani (LB) broth (ThermoFisher Scientific, Waltham, MA) with aeration (250 rpm). The final NaCl concentration was adjusted to either 1 % for E. coli strains or 3 % for V. parahaemolyticus strains. The E. coli β2155, a

65 diaminopimelic acid (DAP) auxotroph, was grown on medium supplemented with 0.3 mM DAP (Sigma Aldrich, St. Louis, MO). When needed antibiotics were added to the medium at the following concentrations: streptomycin (Str) 200 µg/ml; chloramphenicol (Cm), 25 µg/ml; ampicillin, 100 µg/ml.

Phylogenetic analysis

The phylogenetic tree was constructed from the alignment of sigma-70 family sigma factors using the amino acid sequences of the highly conserved domains 2 and

4. The software, Molecular Evolutionary Genetic Analysis version 5 (MEGA5), was used to construct a neighbor-joining tree using the poisson model, complete deletion and a bootstrap value of 1000 (Felsenstein 1985; Saitou and Nei 1987; Tamura et al.

2011). The locus tags used in the construction of the phylogenetic tree were as follows: VP2578, b2573, VMC_13050, VIBHAR_03542, VC2467, VVMO6_00468,

VS_2625, VAA_03781, VF_2093, VSAL_I2531,vfu_A00830; VP2210,

VIBHAR_03122, VVM_01689, vfu_A02554, VAA_02363,VC1045, VS0863,

VPA1690, VMC_06000, VVM_01689, VS_0863, VIBHAR_03122, VAA_02363,

VC1045, VF0972; VP2358, VMC_17260, VIBHAR_03284, VAA_03623, vfu_A02820, VC2302, VS_II1448, VF_A0766, VF_A0820; VP0055, VMC_10870,

VIBHAR_00504, VVM_00142, VF2498, vfu_A00240, VSAL_I0117; b4293.

66 Construction of V. parahaemolyticus ΔrpoE and ΔompU mutants

Splicing by overlap extension (SOE) PCR and homologous recombination

(double crossover event) were used to construct in-frame deletions of genes of interest

(Ho, Hunt et al. 1989). Using V. parahaemolyticus RIMD2210633 genome sequence as the template, primers were designed and purchased from Integrated DNA

Technologies (Coralville, IA) to perform SOE PCR and construct an in-frame deletion mutation of the rpoE gene VP2578 (Makino, et al. 2003). A 177-bp truncated version of rpoE was constructed. Briefly, the rpoE truncated PCR fragment was constructed by amplifying two products using primer pair SOE ArpoE

(CCGTATTGCTGCACACCTAA)/SOE BrpoE (ATTGCTGAAGAGATGGATTG) and SOE CrpoE (CAATCCATCACTTCAGCAATCAGCAGGTTGAATGCTTGCT)/

SOE DrpoE (TGCGTGACATCCGTCACTAAG), which were ligated and cloned into the pJET1.2 vector and transformed into the E. coli strain DH5α λ pir . Plasmid DNA was extracted from DH5α λ pir harboring pJETΔrpoE and ligated into the suicide vector pDS132 which was designated pDSΔ rpoE . pDSΔ rpoE was subsequently transformed into the E. coli strain β2155 and then conjugated with V. parahaemolyticus RIMD2210633 via cross streaking onto LB plates containing 0.3 mM DAP. Growth from these plates was streaked onto LB plates containing 3 %

NaCl streptomycin and chloramphenicol to select only for V. parahaemolyticus containing pDSΔ rpoE . Exconjugate colonies (positive for single crossover event) were cultured overnight in the absence of antibiotics to promote

67 recombination and serial dilutions were plated on LB 3 % NaCl plus 10 % sucrose to select for cells which had lost pDSΔ rpoE . Double-crossover deletion mutants were then screened and confirmed by PCR using the SOEFLrpoEF

(ATTCTTACTCGCCTCGCTCA) and SOEFLrpoER

(GACACGTAAAGCCAACGACA) primers. The same protocol was followed to construct the ompU (VP2467) deletion mutant strain BHM2467 using the primer pairs

SOE AompU (CAGCATAACGAACCGAATCA)/SOE BompU

(AGAAGTGCCGTCTTGGTTGT) and SOE CompU

(ACAACCAAGACGGCACTTCTGGTGGCAACACTACAGCAT)/ SOE DompU

(GTTGGACGGATACCATCGAG). A double-crossover deletion mutant was confirmed by PCR using the SOEFLompUL (CCACGTAGGGTCATTGGAAC) and

SOEFLompUR (CGCAGGTGGAAATAGTTGGT) primer pair.

Construction of rpoE complement

The Δ rpoE strain was complemented with the rpoE gene creating strain

BHM2578C. PCR primers rpoEF (AGAAGAGTAGGGGCATAACAAA) and rpoER

(TGTTCTTTGTCAGCCATTGTTT) were designed to amplify a promoterless copy of

VP2578 encoding rpoE from V. parahaemolyticus RIMD2210633, which was cloned into vector pJET1.2 and transformed into E. coli DH5α λpir. The fragment was then subcloned into the vector pBAD33, resulting in pBA rpoE , and subsequently transformed into E. coli β2155 λpir, which was then cross-streaked with the

68 rpoE mutant strain BHM2578 onto LB plates containing 0.3 mM DAP. Resulting bacterial growth was then streaked onto LB 3 % NaCl plates containing chloramphenicol and streptomycin (but no DAP) to positively select for Δ rpoE cells harboring pBA rpoE . To induce the expression of the complemented gene,

BHM2578C harboring pBA rpoE were grown in the presence of 0.10 % arabinose.

Growth analysis

Strains were grown overnight at 37°C with aeration in 5 ml LB 3 % NaCl. To set up growth assays, 5 µl from each overnight culture was used to inoculate 200 µl of

LB 1 % NaCl or LB 3 % NaCl. Alternatively, late log phase cultures (4 h) were used in place of stationary phase cultures for assays in LB 9 % NaCl. Growth assays were carried out at 37°C for a 24 h period. OD 595nm was taken hourly by a Tecan Group

Ltd.-Sunrise plate reader and Magellan plate reader software. Data was plotted in

Origin 8.5. The experiment was repeated as above but grown at 42°C when appropriate.

To assay growth in mouse intestinal mucus, the same experiment as outlined above was performed in M9 supplemented with 30 µg/ml of large intestinal, small intestinal or cecum streptomycin-treated mouse mucus as the sole carbon source.

Intestinal mucus was extracted from the gastrointestinal tract of mice as follows. Mice were pretreated with streptomycin and 24 h later mice were sacrificed and their gastrointestinal (GI) tracts were dissected out; mucus was collected by flushing the GI

69 sections with PBS and then by gently scraping the walls of the intestine. Extracts from small intestine, cecum or large intestine were collected and stored at -80°C.

Overnight cultures were set up as described for previous assays, however cells were pelleted at 4000 x g for 10 min and washed in M9 (ThermoFisher Scientific) medium and resuspended in M9 before the growth assay was performed.

Stress survival assays

Cells were first grown overnight at 37°C with aeration and100 µl of this culture was used to inoculate 5 ml LB 3 % NaCl and the strains assayed, WT, Δ rpoE ,

ΔrpoS, ΔompU and Δ rpoE complemented with rpoE, were grown to early log phase (2 h) at 37°C with aeration. Cells were pelleted at 4000 x g and then resuspended in LB

3 % NaCl containing either: 200 µg polymyxin B (Sigma Aldrich), 15 % bile salt

(Sodium cholate) (Sigma Aldrich), 0.5 % sodium dodecyl sulfate (SDS)

(ThermoFisher Scientific) or 10 % ethanol (EtOH). At 0 min, 30 min and 60 min, the cells were serially diluted in phosphate-buffered saline (PBS) (Sigma Aldrich) and plated on LB 3 % NaCl agar plates (1.5 % agar). Plates were incubated overnight at

37°C. Colony counts were used to determine colony forming units (CFUs) at the indicated time points, and the percent survival was determined by dividing the number of CFUs at 30 min or 60 min by the initial starting concentration at zero min. For survival assays in LI mucus, the same procedure as outlined above was performed

70 except that CFUs were taken at 6h, 12h and 24 h timepoints. Each experiment was performed in duplicate with at least two biological replicates.

In vivo colonization

This assay utilized a previously described streptomycin-treated mouse model of colonization and a LacZ positive V. parahaemolyticus RIMD2210633 strain

WBWlacZ (Whitaker, et al. 2012). All experiments involving animals were approved by the University of Delaware Institutional Animal Care and Use Committee. Male

C57BL/6 mice, aged 6 to 10 wk were housed under specific-pathogen-free conditions in standard cages in groups (4-5 per group) and provided standard mouse feed and water ad libitum . Treatment with streptomycin and inoculations were performed as previously described (Whitaker, et al. 2012). Briefly, mice were treated orogastrically with streptomycin 24 h prior to infection. Food and water were returned upon antibiotic treatment. Prior to infection, the mice were fasted for 4 h and then inoculated with a 100 μl bacterial suspension in PBS by gavage. Water was returned immediately upon infection and food was returned 2 h post-infection. The inoculum was prepared as follows. The WBWlacZ and rpoE mutant strains were grown in 5 ml of LB 3 % NaCl overnight at 37°C, with shaking. The WBWlacZ strain is

RIMD2210633 with a β-galactosidase gene knock-in that enables a blue white screen to differentiate between Δ rpoE and WT (Whitaker, et al. 2012; Whitaker, et al.

2014). Overnight cultures were diluted 1:40 and were then allowed to grow to late log

71 phase (4 h) subsequently pelleted and washed at 4000 rpm for 10 min. Cells were then resuspended in PBS to a concentration of approximately 1 × 10 10 CFU/ml. An aliquot of 1 ml was mixed in a 1:1 ratio of WT to WBWlacZ, rpoE or rpoS in PBS, resulting in an inoculum of 1 × 10 10 CFU/ml. Mice were inoculated orogastrically with 1 × 10 9 CFU of that mixed culture. A 100µl aliquot of the inoculum was added to 5 ml LB 3 % NaCl and incubated overnight with aeration at 37°C; serial dilutions were plated and were counted for CFUs to determine the in vitro competitive index

(CI). Mice were sacrificed 24 h post-inoculation and the gastrointestinal tract was harvested and homogenized in 8 ml PBS. Samples were plated for CFUs on LB 3 %

NaCl supplemented with streptomycin and X-gal for a blue (WBWlacZ) versus white

(WT or deletion mutant) screen after overnight incubation at 37°C. By dividing the ratio out by the ratio in, the CI was calculated, CI = ratio out (mutant/WT) /ratio in (mutant/WT) .

A CI of less than 1 would indicate a defect in vivo of the mutant strain, while a CI greater than 1 would indicate the mutant strain out-competed WBWlacZ. An in vivo single localization colonization analysis was also performed to determine if there were any differences in colonization localization between WT and rpoE . The in vivo single infection localization analysis was performed: mice received 1x10 9 CFU inoculum of either WT or rpoE. Mice were sacrificed 24 h post infection and the small intestine, cecum, and large intestine were harvested and samples were placed in

8 ml of sterile PBS, mechanically homogenized, serially diluted in PBS, and plated on

LB 3 % NaCl plus streptomycin and X-gal for CFUs of each strain.

72 Results

Identification of five putative ECF alternative sigmas in V. parahaemolyticus

Alternative sigma factors are global regulators that enable bacteria to respond and adapt to changes in their environment. An analysis of the V. parahaemolyticus genome revealed 11 putative sigma factors in all: VP0055, VP0404, VP2210,

VP2232, VP2358, VP2553, VP2578, VP2670 and VP2953 in chromosome I and

VPA1555 and VPA1690 in chromosome II. A BLAST analysis of all sequenced

Vibrio species (39 fully sequenced genomes available), using the sigma factors identified in V. parahaemolyticus as seeds, was conducted to determine the distribution of these sigma factors. VP0404 encoded RpoD (σ 70 ), the primary housekeeping sigma-factor, VP2670 encoded the master flagellar regulator RpoN (σ 54 ),

VP2553 encoded RpoS (σ 38 ), the stationary phase stress sigma factor, and VP2953 encoded a homologue of RpoH (σ 32 ), the heat-shock response sigma factor and all of these sigmas were present in all sequenced Vibrio species. The V. parahaemolyticus genome encoded two additional sigma factors involved in flagallar synthesis regulation: VP2232 encoded fliAP (σ 28 ), involved in polar flagellar synthesis, was present in all sequenced Vibrio species and VPA1555 encoded fliAL (σ 28 ), required for lateral flagella synthesis was present in only 13 Vibrio species. The V. parahaemolyticus genome encoded 5 putative ECF sigma factors: VP0055, VP2210,

VP2358, VPA1690 and VP2578. VP0055 showed homology to an ECF in eight other

Vibrio species. VP2210 encoded a putative ECF sigma and was present in nearly all

73 species of sequenced Vibrio , with the exception of Vibrio fischeri and Vibrio salmonicida (aka Allivibrio salmonicida ). VP2358 encoded another putative ECF which was present in 30 Vibrio species. VPA1690 was a putative ECF sigma that was present in only 3 species of Vibrio . Lastly, VP2578 encoded a homologue of RpoE

(σ 24 ) that was highly related76% amino acid identity to the E. coli RpoE and was present in all sequenced Vibrio. VP2578 shared 91 % amino acid identity with RpoE from V. cholerae, a species that has a total of eight sigma factors.

In order to examine the relationships among the five putative ECF alternative sigma factors further, a phylogenetic tree was constructed using the amino acid sequences from the following 10 representative species (abbreviations match those on tree): E. coli (Ec) ; V. alginolyticus (Va) , V. anguilarium (Vaa) , V. cholerae (Vc,) ; V. fischeri (Vf) ; V. furnissii (Vfu), V. harveyi (Vh), V. parahaemolyticus (Vp) , V. salmonicida (As) ; V. splendidus (Vs) ; and V. vulnificus (Vv). The sequences were aligned by ClustalW and were used to construct a neighbor-joining tree. This phylogeny demonstrated that there were at least five major clades which encompass the identified putative ECF factors ( Fig. 16 ). VP2578 clustered tightly with RpoE from all other Vibrio species examined and with the E. coli RpoE indicating that this is the ancestral RpoE ( Fig. 16) . VP2210 also formed a tight clustering with ECF sigma factors from other Vibrio species suggesting possible conservation in function. The other three V. parahaemolyticus ECF sigma factors each formed a distinct highly divergent branching pattern unlike the tight closely related clustering in both VP2578 and VP2210 lineages ( Fig. 16 ).

74 RpoE is required for V. parahaemolyticus cell envelope stress response

In order to determine the role of the putative RpoE in the stress response of V. parahaemolyticus, we constructed an in-frame deletion mutation of the rpoE gene

VP2578. This deletion mutant strain, BHM2578 (Δ rpoE) , has 402 bp of the gene deleted. There was no detectable difference in growth between BHM2578 and WT in

LB 3 % NaCl indicating that the deletion did not result in an overall growth defect

(Fig. 17) . We wanted to examine the role of RpoE on cell envelope stresses that would be encountered within the natural environment and within a host. In vivo bacteria encounter numerous antimicrobial peptides that are critical for innate antibacterial defense. We examined sensitivity to the peptide antibiotic polymyxin B of our rpoE mutant BHM2578 compared to WT by performing survival assays. In these assays, survival in 200 µg polymyxin B showed the rpoE mutant is more sensitive in comparison to WT as the mutant strain had significantly reduced survival rate of 15 % compared with 95 % for WT after 30 min ( Fig. 18A ). The survival rate was restored to near WT levels when the mutant was complemented with rpoE (Fig.

18A ). Next, we examined survival in LB 3 % NaCl supplemented with 10 % EtOH a compound that targets the cell envelope. In these survival assays, the mutant was more sensitive, showing reduced survival rates in comparison to WT ( Fig. 18B ).

Increased resistance to 10 % EtOH stress was restored in the mutant similar to WT level via complementation ( Fig. 18B ). The survival of the rpoE mutant was also examined in the presence of 1 mM H 2O2 and the mutant had reduced survival after 30

75 min in comparison to WT (data not shown) . Growth analysis of the mutant and WT strains was examined at 42°C in LB 3 % NaCl, and it was found that the mutant had a longer lag phase and reached a lower final OD compared to WT suggesting it was more sensitive to high temperature. This temperature sensitivity in the mutant was alleviated via complementation with rpoE (Fig. 19A ). V. parahaemolyticus is a moderate halophile and whether or not RpoE played a role in the ability of the organism to adapt to changes in salinity was assayed. This was accomplished by comparing the growth of BHM2578 with WT under low and high salt (NaCl) stress conditions ( Fig. 17B, Fig. 19B ). At high salinity (9 % NaCl) there was no difference in the growth pattern between BHM2578 and WT but a slight difference was noted in

LB 1 % NaCl ( Fig. 17B, Fig. 19B ). A previously described rpoS mutant, which encodes the stationary phase sigma factor, was also examined under the same conditions described above and showed phenotypes similar to WT ( Fig. 17, Fig. 18 and Fig. 19 ).

In addition, there was no difference in survival between the rpoE mutant and

WT strains under acid stress conditions either in cells grown in LB 3 % NaCl pH 5.5 or in the presence of 4 mM acetic acid (data not shown). Similarly, mutant and WT strains behaved identically under anionic detergents stress conditions in 15 % bile salt

(Fig. 23B ) or 0.5 % SDS indicating that RpoE does not play a role in these stress responses under these conditions (data not shown).

76 RpoE is important for in vivo intestinal colonization in an adult mouse model

Given the defect shown in survival under cell envelope stress conditions, we wanted to examine whether the rpoE mutant would have a defect in in vivo intestinal colonization . In order to accomplish this, the streptomycin-treated adult mouse model of colonization was utilized (Whitaker, et al. 2012; Whitaker, et al. 2014). A - galactosidase positive RIMD2210633 strain WBWlacZ was used in order to allow for a blue-white screen differentiation with Δ rpoE (Whitaker, et al. 2012; Whitaker, et al. 2014). An in vivo competition assay in adult mice was carried out by pretreating mice with an orogastric dose of streptomycin (20 mg/mouse) 24 h prior to orogastric co-inoculation with a mixture of WBWlacZ and either the WT strain (n=10), Δ rpoE

(n=9) or Δ rpoS (n=5). As previously shown, the WT and WBWlacZ strains do not out-compete each other indicating that the lacZ knock-in has no fitness effect under the conditions examined here (Whitaker, et al. 2012; Whitaker, et al. 2014)(Fig.

20A ). Similarly, the WT versus WBWlacZ in an in vitro assay in LB 3 % NaCl also had a CI of 1. In contrast, in an in vivo assay between the rpoE mutant and WBWlacZ strains, there was a significant reduction (p<0.001) in colonization with the mutant having a competitive index of 0.07 ( Fig. 20A ). In an in vitro competition assay in LB

3 % NaCl between WT and Δ rpoE, a CI close to 0.4 was obtained after 24 h incubation showing an in vitro growth defect. This in vitro defect may reflect a requirement for RpoE in the stationary phase response; therefore we examined the CI of mutant and WT after 6, 12 and 24 h incubations. We found that there was no

77 difference in CI at 6 h but at 12 h and 24 h the CI between the strains was 0.45 and

0.55 indicating a defect in the rpoE mutant in stationary phase cells ( Fig . 20B ).

Overall, these data demonstrate that the rpoE mutant had a significant defect in vivo compared to WT and that RpoE plays a significant role in in vivo survival. The importance of RpoE in intestinal colonization by V. parahaemolyticus is in contrast to the role of RpoS (VP2553). In an in vivo competition assay between WBWlacZ and

ΔrpoS , it was found that the strains did not out-compete each other having a competitive index close to 1 ( Fig. 20A ). This result indicates that in V. parahaemolyticus RpoS does not play a role in intestinal colonization.

An intestinal localization analysis was also performed in order to determine whether there was a difference in fitness of the WT strain and the rpoE deletion strain in different regions of the mouse intestinal tract. Mice were orogastrically inoculated with either the WT or ΔrpoE strain alone. After 24 h the small intestine, cecum, and large intestine were harvested separately and plated for CFUs. Colonization levels between the two strains were highly similar in the small intestine ( Fig. 21 ). In the cecum and large intestine there was a significantly (p<0.05) greater amount of the WT present in comparison to ΔrpoE , suggesting that the mutant was less fit in these environments ( Fig. 21 ). Overall, our results demonstrate that the Δ rpoE mutant has a defect in colonization and that the cell envelope stress response is an important determinant for efficient in vivo survival.

78 Role of RpoE on growth in mucus

To complement the in vivo data and to elucidate whether there was a defect in growth on mucus that contributed to the defect in in vivo colonization, we analyzed the growth of the WT strain and ΔrpoE strain in M9 media supplemented with mucus from small intestine, cecum or large intestine. The two strains grow similarly in the small intestine ( Fig. 22A ) and show a slight but not statistically significant defect in cecum mucus ( Fig. 22B ). In the large intestinal mucus, the rpoE strain reaches a significantly lower OD than WT (p<0.05) ( Fig. 22C ). We speculate that the large intestinal mucus may contain more antimicrobial peptides than other regions of the intestine and may explain the defect, as the RpoE mutant is sensitive to antimicrobial peptides but not bile or acid stresses. To test this, a survival assay was performed in LI intestinal mucus and CFUs were determined at 6h, 12h and 24h time-points ( Fig.

22D ). This data demonstrates that the mutant strain is more sensitive to LI mucus compared to WT.

Deletion of OmpU does not affect the cell envelope stress response in V. parahaemolyticus

It was proposed that in a V. cholerae El Tor strain in the presence of antimicrobial peptides, OmpU signals the release of RpoE from the membrane

(Mathur et al. 2007; Davis and Waldor 2009). In order to test whether or not OmpU may be required for the RpoE stress response in V. parahaemolyticus , we constructed

79 an ompU mutant strain. An unmarked non-polar 849-bp deletion of the ompU gene

(VP2467) was created. We compared growth of the mutant with that of the WT strain on LB 3 % NaCl and found that both strains gave similar growth curves (data not shown). We reasoned that if there was a relationship between OmpU and RpoE function there should be an overlap in phenotypes. For example in V. cholerae both ompU and rpoE deletion mutant strains are sensitive to the antimicrobial peptide P2 and to polymyxin B (Mathur et al. 2007; Davis and Waldor 2009). Therefore, we compared growth of WT, ΔompU , ΔtoxRS, and ΔrpoE on TCBS agar plates which contain bile salts as a selective agent ( Fig.23A ). Both WT and ΔrpoE showed similar growth patterns whereas both ΔompU and ΔtoxRS show defects in growth ( Fig. 23A ).

To examine this further, we performed survival assays in the presence of 15 % bile salt. In this assay, the WT and rpoE mutant strains showed similar percent survival, and ΔompU and ΔtoxRS showed a significant defect ( Fig. 23B ). Next, a survival assay was performed on WT, ΔompU , ΔtoxRS, and ΔrpoE in the presence of polymyxin B.

In this assay ΔompU and ΔtoxRS survived similar to WT, and ΔrpoE showed a significant defect ( Fig. 23C ). Overall, the results demonstrate that the ompU and rpoE mutant strains have no overlapping phenotypes suggesting that under the conditions analyzed, OmpU is not essential in signaling the release of RpoE in V. parahaemolyticus.

80 Discussion

In order to further our understanding of the factors important for V. parahaemolyticus stress response and colonization, we constructed an rpoE deletion strain, which in other enteric species is required for the cell envelope stress response.

We demonstrated that the loss of rpoE renders the mutant strain more sensitive to cell envelope stresses such as polymyxin B, a cationic antimicrobial peptide; ethanol and high temperature.

We also demonstrated that the loss of RpoE reduces fitness in vivo as the rpoE mutant was out-competed by WBWlacZ and also showed significantly reduced colonization of the cecum and large intestine in comparison to the WT strain. This defect in colonization is predicted to be due to the increased sensitivity of the rpoE mutant to cationic antimicrobial peptides, as the rpoE mutant strain was not any more sensitive than WT to bile salts, SDS and acid stress conditions. The intestinal tract produces a consortium of cationic antimicrobial peptides such as α-defensins, β- defensins, and bactericidal/permeability-increasing protein (BPI) and the mechanism of action of many of these peptides is via the insertion and subsequent disruption of microbial membranes (Zasloff 2002). BPI, for example, is specific to Gram-negative bacteria due to its high affinity for the lipid A region of lipopolysaccharide (LPS) and permeabilizes the outer membrane (Gazzano-Santoro, et al. 1992; Capodici, et al.

1994; Zasloff 2002). Polymyxin B, used in this study to mimic the antimicrobial peptides found throughout the intestinal tract is also capable of destabilizing the LPS

81 and insertion into microbial membranes (HsuChen and Feingold 1973; Schindler and

Teuber 1975; Hancock 1997). Sensitivity of our rpoE mutant to polymyxin B may indicate sensitivity to host cationic antimicrobial peptides in vivo and is predicted to be responsible for the colonization defect of the rpoE mutant. Secreted antimicrobial activity, such as that of α-defensins, has been shown to predominantly localize to the mucosal surface layer. By measuring the secreted antimicrobial activity of mouse intestinal extracts from the crypt/mucus/lumen compartments, it was demonstrated that this antimicrobial activity is predominantly confined to the mucus layer (Meyer-

Hoffert, et al. 2008). The idea that extracted mucus has the ability to retain antimicrobial activity from secreted host antimicrobials may explain the differences in biomass between the WT and rpoE mutant strains when grown in M9 supplemented with large intestine mucus; supporting the notion that resistance to antimicrobial peptides is important for survival in the intestinal environment.

The role of RpoE in survival in the presence of antimicrobial peptides as well intestinal colonization has previously been studied in other Vibrio species. In V. cholerae, an rpoE mutant in a classical biotype strain was defective in colonization.

Interestingly, this mutant was not more sensitive than WT to bile salts, hydrogen peroxide nor polymyxin B, suggesting for this particular strain the importance of

RpoE in colonization may be independent of antimicrobial peptide sensitivity

(Kovacikova and Skorupski 2002). Conversely, an rpoE mutant of a V. cholerae El

Tor biotype was shown to be more sensitive than WT to both the bioactive peptide, P2 and polymyxin B; and it was demonstrated that in the presence of antimicrobial

82 peptides, misfolded OmpU in the periplasm signaled release of RpoE from the membrane (Mathur et al. 2007; Davis and Waldor 2009). In V. harveyi, disruption of two regulators of rpoE , rseB and rseC , resulted in an rseBC mutant strain that was out- competed in vivo by WT and which demonstrated reduced hemolytic activity compared to WT, suggesting changes in RpoE activity have an impact on virulence of

V. harveyi (Rattanama et al. 2012). .

In V. parahaemolyticus ompU and toxRS mutant strains, both are more sensitive to bile salt and SDS compared to WT. In V. cholerae, it was proposed in an

El Tor biotype strain, that OmpU signals the release of RpoE in the presence of antimicrobial peptides (Mathur et al. 2007). In V. parahaemolyticus , we created an ompU mutant and found no overlap in phenotype between the ompU and rpoE mutant suggesting that OmpU may not signal release of RpoE. It may be that in V. parahaemolyticus , stimulation and release of RpoE may be regulated by several factors as is the case in E. coli (Alba and Gross 2004). In E. coli, RpoE activity and release from the membrane by proteolytic cleavage by DegS and YaeL, is modulated though many different OMPs and OMP-like proteins (Alba and Gross 2004). In V. parahaemolyticus, as in V. cholerae and E. coli , rpoE is found clustered in an operon with the putative anti sigma factor and the regulators, rseABC. RseA, RseB and RseC in V. parahaemolyticus have 65%, 72% and 57% and 43 %, 44 % and 30 % amino acid identity, respectively, to homologues found in V. cholerae and E. coli respectively.

83 In conclusion, these results demonstrate that RpoE is a key cell envelope stress regulator and is important for intestinal survival. Here we expand upon the use of our streptomycin treated mouse model by showing the requirement for RpoE but not RpoS in intestinal survival and colonization for the first time in V. parahaemolyticus . Previously it has been shown that in V. parahaemolyticus RpoS plays a limited role in stress response (Whitaker et al. 2010). Our group has shown that deletion of RpoN in V. parahaemolyticus results in a hypercolonizer strain which out-competes the WBWlacZ strain in vivo (Whitaker et al. 2014). This suggests that the different sigma factors and their regulons play discordant roles during in vivo colonization and survival of V. parahaemolyticus . It will be interesting to examine further whether the additional ECFs are important for V. parahaemolyticus pathogenesis.

84 VaRpoE 98 VhRpoE 63 Vp2578 27 VvRpoE 34 VaaRpoE 99 VsRpoE VcRpoE 57 56 VfuRpoE 100 VfRpoE 99 AsRpoE 24 EcRpoE Vf0972 VsII1255 48

45 99 VfA0820 52 Vh05265

100 Vh00554 VaaSigK

84 VsII1448 67 VfA0766 Vc2302 99

46 78 Vaa03623 100 Vfu02820

84 Vv2599 Vh03284 68 97 Vp2358 79 Va17260

100 VpA1690 Va06000

100 Vfu02554 Vc1045 100 Vs0863 71 Vaa02363 72 Vp2210 51 Vv2442 83 32 Va12080 34 Vh03122 EcFecI VfuA00240 AsI0117 100 Vf2498 65 Vv00142 85 Vh00504 82 96 Vp0055 83 Va10870

0.2 Phylogeny of ECF sigmas among Vibrio species. Phylogenetic tree constructed from the alignment of alternative sigma factors using the amino acid sequences of the highly conserved domains 2 and 4. The molecular evolutionary genetics analysis software, MEGA5, was used to construct a neighbor-joining tree using the poisson model, complete deletion and a bootstrap value of 1000 (Tamura, Peterson et al. 2011). Abbreviations are: Ec, E.coli; Vp, V. parahaemolyticus; Vc, V. cholerae; Vv; V. vulnificus; Vh, V. harveyi; Vf, V. fischeri; Va, V. alginolyticus; Vs, V. splendidus; Vaa , Vibrio anguilarium; Vfu, Vibrio furnissii; As, V. salmonicida (A. salmonicida). Phylogenetic analysis shows that there are five clusters of ECF-type sigma factors among Vibrio species and that VP2578 clusters closely with the conical E. coli RpoE suggesting this is the ancestral copy.

85 A. Growth in LB 3% NaCl

OD (595nm)

WT D rpoE D rpoS

0 10 20 Time (hours)

B. Growth in LB 9% NaCl

(595nm) OD

WT D rpoS D rpoE

0 10 20 Time (hours)

Growth analysis of WT and mutant strains under optimum and high salt conditions. Cells were incubated over a 24 h period. An absorbance reading (595 nm) was taking hourly and the data was then plotted in Origin8.5. A. The figure shows that in LB 3 % NaCl the rpoE mutant BHM2578 grows similar to WT. B. The figure shows that in LB 9 % NaCl, BHM2578 (ΔrpoE ) as well as LMN2553the rpoS mutant, grow similar to WT. All cultures were grown in triplicate with at least two biological replicates. Error bars indicate standard deviation.

A. Polymyxin B

100 80

40 WT D rpoE D

Percent Survival rpoEpRpoE 20 D rpoS

0 10 20 30 40 50 60 Time (minutes) B. 10% EtOH

100

WT 1 D rpoE pRpoE D rpoE D rpoS 0.1 Percent Survival 0.01

1E-3 0 10 20 30 40 50 60 Time (minutes)

Cell envelope stress response. WT (closed square), ∆rpoE (BHM2578 closed triangle), ∆rpoS (LMN2553 open circle) and ∆rpoE pBA rpoE (BHM2578C closed inverted triangle) cells were grown in LB 3 % NaCl to early log phase and then subjected for 60 min to either (A) polymyxin B stress or (B) EtOH stress. Survivability was determined by dividing the surviving population at various time points by the initial population. Each experiment was performed in duplicate with at least two biological replicates. Error bars indicate standard deviation.

87 A Growth at 42 C

OD (595nm) OD WT D rpoS D rpoE D rpoE pRpoE

0 10 20 Time (hours) B Growth in LB 1% NaCl

OD(595nm) WT D rpoS D rpoE D rpoE pRpoE

0 10 20 Time (hours)

Growth curves of V. parahaemolyticus under high temperature and NaCl stress conditions. (A) Heat stress was examined by growth analysis at 42°C for WT, ΔrpoE and ΔrpoS strains (B) Low salt stress was examined by growth in LB 1 % NaCl. All cultures were grown in triplicate with at least two biological replicates. Error bars indicate standard deviation. An unpaired Student’s t-test was used to determine statistical difference between the final biomass of WT cells in comparison to the rpoE mutant (*p<0.05, **p<0.005)

In vivo and in vitro competition assays in adult mouse intestinal colonization . A. In vivo competition assay. Strains shown were grown to late log phase and then mixed in a 1:1 ratio and inoculated into mice which were treated with streptomycin. After 24 h, the mice were sacrificed and the gastrointestinal tract was harvested and plated for CFUs. The ratio of cells out was divided by the ratio of cells in, to determine the competitive index. The WT vs WBWlacZ assay was done concurrently with a previously published study from our group (Whitaker, Richards et al. 2014). The rpoE mutant, but not rpoS mutant shows a significant defect in colonization B. In vitro competition assay. Strains shown were grown to late log phase and then mixed in a 1:1 ratio and grown in LB 3 % NaCl and CFUs were calculated at the indicated time-points and a CI was calculated for each time-point. The rpoE mutant shows a defect in stationary phase survival. P values were calculated using a Kruskal-Wallis one-way ANOVA followed by a Dunn multiple-comparison posttest. (*** p<0.001)

89 A Small Intestine 1.0 ·· ·· 10 07

1.0 ·· ·· 10 06

1.0 ·· ·· 10 05

CFU/organ 1.0 ·· ·· 10 04

1.0 ·· ·· 10 03

DDD D rpoE WBWlacZ B

Cecum 1.0 ·· ·· 10 10

1.0 ·· ·· 10 09 * 1.0 ·· ·· 10 08

CFU/organ 07 1.0 ·· ·· 10

1.0 ·· ·· 10 06

rpoE WlacZ DDD D B C W

Large Intestine 1.0 ·· ·· 10 09

·· 08 1.0 ·· 10 *

1.0 ·· ·· 10 07

CFU/organ 1.0 ·· ·· 10 06

1.0 ·· ·· 10 05

oE p DDD D r BWlacZ W

In vivo localization . Mice pre-treated with streptomycin were inoculated with either D rpoE or WT. After 24 h, mice were sacrificed and the small intestine, cecum, and large intestine were harvested separately and plated for CFUs. P values were calculated using an unpaired Student's t- test with a 95% confidence interval. The rpoE mutant shows a defect in colonization of the cecum and large intestine. (*p<0.05)

Growth analysis of V. parahaemolyticus on intestinal mucus as a sole carbon source . An rpoE mutant and WT strains were grown in M9 supplemented with mucus from the (A) small intestine, (B) cecum or (C) large intestine as the sole carbon source. D. Survival assay in LI mucus. All cultures were grown in triplicate with at least two biological replicates. Error bars indicate standard deviation. An unpaired Student’s t-test was used to determine statistical difference between the final biomass (OD) of WT in comparison to the rpoE mutant. (***, p<0.001)

Phenotypes of ompU deletion mutant . Strains were grown on TCBS agar to assess sensitivity to bile salts (A). Strains were grown to early log phase in LB 3 % NaCl before being subjected to (B) 15 % bile or (C) 200 μg of polymyxin B for 60 min. Percent survival was determined by dividing the number of viable cells at a given time point by the number of viable cells in the initial population. Each experiment was performed in triplicate and repeated at least twice. Error bars indicate standard deviation.

92 Table 4 Bacterial Strains and Plasmids

Strains, genotype or plasmid Relevant characteristics References Vibrio parahaemolyticus RIMD2210633 O3:K6 clinical isolate Str R (Makino et al. 2003) WBWlacZ RIMD2210633:: lacZ Str R (Whitaker et al. 2012 ; Whitaker et al. 2014) BHM2578 (Δ rpoE) RIMD2210633Δ rpoE (VP2578) This study LMN2553( Δ rpoS) RIMD2210633Δ rpoS (VP2553) (Whitaker et al. 2010) BHM2467 (Δ ompU) RIMD2210633Δ ompU (VP2467) This study BHM2578C ΔrpoE pBA rpoE This study WBW0819-820 (Δ toxRS ) RIMD2210633Δ toxRS (VP VP0819-20) (Whitaker et al. 2012) Escherichia coli DH5α λ pir Δlac pir Β2155 DAP ΔdapA::erm pir for bacterial conjugation DH5 pΔrpoE DH5α λ pir containing pJ ΔrpoE This study Β2155p ΔrpoE Β2155 DAP containing pDS ΔrpoE This study DH5 pΔompU DH5α λ pir containing pJ ΔompU This study Β2155 DAP- ΔompU Β2155 DAP containing pDS ΔompU This study Β2155 DAP- prpoE Β2155 DAP containing pB rpoE This study Plasmids pJET1.2 Cloning vector pJEΔ rpoE pJET1.2 harboring truncated rpoE This study pJEΔ ompU pJET1.2 harboring truncated ompU This study pDS132 Suicide plasmid; Cm r; SacB (Philippe et al. 2004) pDSΔ rpoE pDS132 harboring truncated rpoE This study pDSΔ ompU pDS132 harboring truncated ompU This study pBAD33 Expression vector, araC promoter, Cm r (Guzman et al. 1995) pBA rpoE pBAD33 harboring rpoE gene This study

93 Chapter 4

GLUCONATE CATABOLISM AND REGULATION

Introduction

Vibrio parahaemolyticus is a Gram-negative moderately halophilic organism, typically found in brackish marine and estuarine waters. This bacterium is ubiquitous within this environment having the ability to colonize crustaceans, mollusks, and fish or found as a free-living organism. Additionally, V. parahaemolyticus has the ability to colonize the human gastrointestinal tract and is the world’s leading cause of bacterial seafood associated gastroenteritis. Due to its ubiquitous nature, V. parahaemolyticus must alternate between natural and host environments, requiring the ability to respond to rapid changes in the extracellular environment. Altering gene expression allows the bacteria to respond to various environmental stimuli to ensure survival. One mechanism of globally altering gene expression is through the utilization of alternative sigma factors. Alternative sigma factors redirect transcription initiation in response to environmental cues by guiding the core RNA polymerase, to specific promoter regions. Sigma factors are conserved transcriptional regulators present in all bacteria; however, the number varies from species to species. In V. parahaemolyticus we identified 11 sigma factors compared to 7 present in Escherichia coli .

94 The 11 sigma factors encoded by V. parahaemolyticus include the housekeeping sigma factor, RpoD, and 10 alternative sigma factors. The alternative sigma factors include the heat shock factor RpoH, general stress response sigma factor

RpoS, two flagellar sigma factors FliAP and FliAL, five putative ECF type sigma factors including the canonical RpoE and the sigma 54 family sigma factor, RpoN.

Using a streptomycin pretreated adult murine model, the role of sigma factors in host pathogen interactions, specifically at the stage of colonization have been investigated

(Whitaker et al. 2012; Haines-Menges et al. 2014; Whitaker et al. 2014). It was shown that RpoE is important in colonization, while RpoS plays no role in colonization

(Haines-Menges et al. 2014). Additionally it was showed that strains lacking either

RpoN, FliAP, FliAL or both FliAP/FliAL were super colonizers compared to the wild- type strain and this phenotype was most pronounced in the RpoN mutant suggesting the super colonization of the RpoN mutant strain is not solely due to it being an amotile strain (Whitaker, et al. 2014). Further investigation into the enhanced fitness of the RpoN mutant strain led to the discovery that there are carbon catabolism differences between the two strains which may contribute to the rpoN mutant phenotype (Whitaker, et al. 2014). One of the sugars in which the RpoN mutant exhibited a faster doubling time was gluconate; additionally, the gluconokinase

(VP0063) involved in gluconate catabolism was upregulated in the RpoN mutant relative to wild-type in M9 mucus suggesting dysregulation of these catabolism genes in this mutant strain (Whitaker, et al. 2014).

95 Gluconate is a six carbon acid, which is one step more oxidized than glucose. Gluconate, upon uptake, is phosphorylated to 6-phosphogluconate by gluconokinase. It can then be further catabolized by either the Entner-Doudoroff (ED) pathway most commonly or more rarely the Pentose phosphate (PP) pathway. The PP pathway has oxidative and non-oxidative branches. The oxidative branch provides NADPH for biosynthesis (Zhao et al. 1995). The non-oxidative branch of the PP pathway is needed for growth on pentoses and for the portion of the gluconate metabolism not using the ED pathway (de Silva and Fraenkel 1979). Enteric bacteria typically use the ED pathway (and its two enzymes: 6-phosphogluconate dehydratase ( edd ) and 2-keto- 3-deoxyphosphogluconate aldolase ( eda )) for the inducible metabolism of gluconate. EDA is also involved in galactonate, glucuronate and possibly glyoxylate metabolism. EDD mutants have been shown to grow at a reduced rate on gluconate, using the pentose phosphate pathway (Zablotny and Fraenkel 1967). EDA mutants do not grow at all on uronic acids, or on gluconate, possibly due to the toxicity of intermediate accumulation since EDD EDA double mutants do grow on gluconate (Fraenkel 1967). Gluconate is a known component of intestinal mucin (Peekhaus and Conway 1998). In E. coli a functional ED pathway as well as gluconate utilization has been shown to be important in colonization (Chang et al. 2004; Sweeney et al. 1996). Gluconate utilization was shown to be important for both initiation and maintenance of colonization of the host intestinal tract in E. coli (Chang et al. 2004). In V. cholerae it has been shown to be important for survival of the organism within the intestinal environment (Patra et al. 2012). There is limited research on carbon metabolism in V. parahaemolyticus , however the ability to utilize carbon sources present more efficiently than other bacteria presumably enhances the in vivo fitness of a particular

96 strain therefore we want to understand the regulation of gluconate catabolism as well as the role of gluconate in V. parahaemolyticus. In this study we examined the potential role of RpoN in the regulation of the gluconate catabolism genes. We also examined the role of a putative ECF type sigma factor, VP0055, in gluconate catabolism as this sigma factor is found in close proximity to the gluconate catabolism cluster. Lastly we examined the phenotype of an ED aldolase mutant strain (Δ vp0065 ) to determine its role in gluconate catabolism in V. parahaemolyticus . This is the first study characterizing VP0055 and VP0065 and gluconate catabolism in V. parahaemolyticus .

Materials and Methods

Bacterial strain, plasmids and growth conditions

All plasmids and bacterial strains used in this present study are listed in Table 5. A streptomycin-resistant O3:K6 clinical isolate, V. parahaemolyticus RIMD2210633; a streptomycin-resistant environmental isolate, Vibrio parahaemolyticus UCM-V493, a streptomycin-resistant ΔrpoN strain and a streptomycin-resistant β-galactosidase-positive RIMD2210633 isolate, called WBWlacZ, were used in this study (Whitaker et al. 2010; Whitaker et al. 2012; Kalburge et al. 2014; Whitaker et al. 2014). To construct the Δ eda and Δ vp0055 mutant strains, Escherichia coli strains DH5α λ pir and β2155 λ pir were used for genetic manipulations. All strains were grown at 37°C, with aeration (250 rpm), in Luria-Bertani (LB) broth (Thermo Fischer Scientific, Waltham, MA) unless otherwise noted. The final adjusted NaCl (Thermo Fischer Scientific, Waltham, MA)

97 concentration was 1% for all E. coli strains and 3% for all V. parahaemolyticus strains. The E. coli strain, β2155, is a diaminopimelic acid (DAP) auxotroph and was grown on medium supplemented with 0.3mM DAP (Sigma-Aldrich, St. Louis, MO). Antibiotics were added to growth medium at the following concentrations: streptomycin, 200 μg/ml; chloramphenicol, 25 μg/ml; and ampicillin, 100 μg/ml, when required.

Construction of V. parahaemolyticus Δeda and Δ vp0055 mutant strains

The protocols of Splicing by Overlap Extension (SOE) PCR and homologous recombination (a double-crossover) were utilized to construct in-frame deletions of the genes of interest (Horton et al. 1989). Primers were designed (Integrated DNA

Technologies, Coralville, IA), using the V. parahaemolyticus RIMD2210633 genome as template sequence (Makino et al. 2003), to construct an in-frame deletion of the eda gene VP0065 by performing SOE PCR. Briefly, the truncated eda PCR product was constructed by amplification of two products using the primer pairs

SOEA eda/ SOEB eda and SOEC eda/ SOED eda (Table 6) which were then ligated and cloned into the pJET1.2 vector. The vector was subsequently transformed into the E. coli strain DH5α λ pir to allow propagation of plasmid pJEΔeda. Plasmid DNA harboring pJEΔ eda was extracted from DH5α λ pir and then ligated into the suicide vector, pDS132, forming pDSΔ eda. This vector, pDSΔ eda, was transformed into the

E. coli strain β2155 λ pir and subsequently conjugated with V. parahaemolyticus

RIMD2210633. This conjugation occurred via cross-streaking onto LB agar plates

98 supplemented with 0.3mM DAP. The growth from these plates was then streaked onto LB medium plates supplemented with 3% NaCl, streptomycin and chloramphenicol to select for only those V. parahaemolyticus colonies which have incorporated pDSΔ eda into their genome (single-crossover event). Colonies positive for the single-cross over event were subsequently grown overnight in LB 3% NaCl broth, in the absence of antibiotics, to promote recombination. This culture was serially diluted and plated onto LB 3% NaCl medium containing 10% sucrose to select for cells which had lost pDSΔ eda (double-crossover event) . The double-crossover deletion mutants were screened and confirmed by PCR using the primer pair

SOEFledaF/SOEFledaR (Table 6). The same protocol was utilized to construct the vp0055 (VP0055) deletion strain using the primer pairs SOEAVP0055/SOEBVP0055 and SOECVP0055/SOEDVP0055 (Table 6). The vp0055 double-crossover deletion mutant was screened for and confirmed by PCR using primer pairs

SOEVP0055FFor/SOEVP0055FRev (Table 6).

Growth analysis

Strains were grown aerobically overnight at 37°C in 5 ml LB broth containing 3% NaCl. Overnight cultures were pelleted by centrifugation at 4000 x g for 10 minutes and subsequently washed twice in 1X phosphate buffered saline (PBS) (Thermo Fischer Scientific) and resuspended in 5 ml 1X PBS. The cultures were then diluted 1:50 into fresh M9 minimal medium (Thermo Fischer Scientific) supplemented

99 with either: 10 mM glucose, 10 mM gluconate, 1 mM glucose and 5 mM gluconate combined, or 30 µg of protein/ml cecum mucus (Whitaker et al. 2014). For growth of the Δ rpoN strain, M9 medium plus carbon source was supplemented with 2 mM glutamine to overcome the defect in the ability to utilize ammonium present in M9 as the sole nitrogen source (Whitaker et al. 2014). Cultures (200 µl) were transferred to a 96 well plate for the growth assay. The growth assay was carried out over a period of

24 h at 37°C and the optical density at 595 nm (OD 595 ) was taken hourly via a Sunrise plate reader (Tecan Group, Ltd.) and Magellan plate reader software. Each experiment was performed in triplicate with at least two biological replicates.

Mucus extraction

Mucus was extracted to assay for growth of all strains as described previously (Haines-Menges, Whitaker et al. 2014; Whitaker, et al. 2014). Mice were treated with streptomycin orogastrically as previously described (Whitaker et al. 2012; Haines- Menges et al. 2014; Whitaker et al. 2014). Briefly, mice were fasted for 4 h and then orogastrically administered 20 mg streptomycin per mouse (100 μl of streptomycin at 200 mg/ml); twenty-four h following the antibiotic treatment mice were sacrificed and their gastrointestinal (GI) tracts were harvested and dissected into small intestine, cecum and large intestine. Mucus was collected by flushing the GI tract components with PBS and subsequently scraping the intestinal walls to extract the mucus. Mucus was extracted from the small intestine, cecum and large intestine and stored at -80°C until use. For use in growth and competition assays, mucus was processed by diluting 200 mg of mucus in 5 ml PBS, followed by homogenization and centrifugation for 10

100 min at 500 x g to remove any contaminating tissue and fecal matter. To assay growth, cecum mucus was added to M9 medium at a concentration of 30 µg of protein/ml (Haines-Menges et al. 2014; Whitaker et al. 2014).

Phenotypic microarray analysis of growth on 180 carbon sources

Strains were grown in M9 medium supplemented with 10mM glucose, overnight, at 37°C with aeration (250 rpm). Overnight cultures were then diluted 1:50 into 5 ml M9 medium supplemented with 10mM glucose and grown aerobically for 4 h at 37°C. Cells were then pelleted at 4000 x g for 10 min and washed twice with PBS. Cells were resuspended in 5 ml PBS and diluted 1:50 into fresh M9 medium with no carbon source and 100 µl was transferred to each well of either a PM1A or PM2A Biolog Phenotypic MicroArray 96 well plate (Biolog, Hayward, CA). Biolog plates were subsequently incubated at 37°C for 24 h and optical density readings at 595 nm

(OD 595 ) were taken hourly using a Sunrise Tecan plate reader and Magellan software. Experiments were performed in duplicate.

To assay the growth patterns of each strain on the various carbon sources, the area under the curve over the 24 h of growth was calculated for each carbon source.

The first well on each PM plate contained M9 medium plus cells but no carbon source and the area under the curve for this well was used as the blank and basis for the no growth comparison. This value was subsequently subtracted from the area under the curve for each carbon source to assess on which carbon sources V. parhaemolyticus exhibited growth. The area under the curve for each carbon source, minus the blank,

101 was averaged between the duplicate experiments and then compared between the strains.

RNA Extractions

Strains were grown at 37°C overnight, with aeration, in 5 ml LB broth containing 3% NaCl. Cells were then pelleted at 4000 x g for 10 min, washed twice in PBS and resuspended in 5 ml PBS. The resuspended culture was diluted 1:50 into 25 ml of M9 media supplemented with either 10 mM glucose or 10 mM gluconate. Cultures were grown with aeration at 37°C until late log phase (4 h). RNA was then extracted using TRIzol (Invitrogen, Carlsbad, CA) according to the manufacturer’s instructions. Total RNA samples were treated with Turbo DNAse (Invitrogen) according to the manufacturer’s instructions to remove contaminating genomic DNA. Subsequently, RNA samples were quantified using a Nanodrop spectrophotometer (Thermo-Fisher Scientific, Waltham, MA).

cDNA synthesis and qRT-PCR expression analysis

cDNA was synthesized with Superscript II reverse transcriptase (Invitrogen) according to the manufacturer’s instructions using 500 ng of RNA as the template and 200 ng of random hexamers in each synthesis reaction. The cDNA samples were diluted 1:50 and used as the template for quantitative real-time PCR (qPCR). The qPCRs were performed using the fast SYBR green master mix (Applied Biosystems) according to the manufacturer’s instructions and run on an Applied Biosystems (ABI)

102 7500 Fast real time PCR system. Gene primers were designed using Primer 3 and V. parahaemolyticus RIMD2210633 genome sequence as the template and are listed in Table 3. Data was analyzed using the ABI 7500 software (Applied Biosciences). The expression levels of each gene, determined by their cycle threshold (CT) values, were normalized using the 16S rRNA gene to correct for sampling errors. Differences in gene expression ratios were determined using the previously described ΔΔCT method (Pfaffl et al. 2001).

In vitro competition analysis

Strains WBWlacZ and either rpoN, vp0055 or vp0065 mutant strains were grown in 5 ml of LB 3 % NaCl overnight at 37°C, with shaking. WBWlacZ is a strain of RIMD2210633 with a β-galactosidase gene knock-in enabling a blue white screen to differentiate between mutant strains and the isogenic wild-type (Whitaker et al. 2012; Haines-Menges et al. 2014; Whitaker et al. 2014). Overnight cultures were diluted 1:40 and allowed to grow to late log phase (4 h); subsequently pelleted and washed at 4000 rpm for 10 min. Cells were resuspended in PBS to a concentration of approximately 1 × 10 10 CFU/ml. An aliquot of 1 ml was mixed in a 1:1 ratio of

WBWlacZ to wild-type, rpoN, vp0055 or vp0065 mutants in PBS, resulting in an inoculum of 1 × 10 10 CFU/ml. This inoculum was plated for CFUs on on LB 3 % NaCl supplemented with streptomycin and X-gal. A 100µl aliquot of this inoculum was added to 5 ml M9 supplemented with either 10 mM glucose, 10 mM gluconate or 30µg/ml mucus and incubated for 24 h with aeration at 37°C. Serial dilutions were plated for CFUs on LB 3 % NaCl supplemented with streptomycin and X-gal for a

103 blue (WBWlacZ) versus white (wild-type or deletion mutant) to determine the in vitro competitive index (CI). By dividing the ratio out by the ratio in, the CI was calculated, CI = ratio out (mutant/WT) /ratio in (mutant/WT) . A CI of less than 1 would indicate a defect in vivo of the mutant strain, while a CI greater than 1 would indicate the mutant strain out-competed WBWlacZ.

Bioinformatic analysis: Promoter and Regulatory binding site prediction

In order to determine the regulatory proteins involved in gluconate catabolism regulation, 250 bp upstream of the start codon for each operon were extracted and analyzed using several bioinformatics programs to identify putative binding cites for regulatory proteins. The putative promoter regions were analyzed for RpoN binding sites (-12 and -24 recognition sites) using a consensus sequence in V. parahaemolyticus created via the alignment of 31 RpoN binding sites predicted by BPROM (Softberry). The -12 and -24 promoter elements binding is unique to RpoN, as all other sigma factors recognize -10 and -35 sequence binding elements. The putative promoter regions were also analyzed for CRP binding sites, GntR binding sites and for putative promoter sites (-10 and -35) recognized by a sigma 70 family sigma factor. Programs used for this analyses included PRODORIC, RegPredict and Softberry (Schneider 2001; Munch et al. 2005). Consensus sequences for RpoD binding at the pribnow box (-10) and CRP and GntR regulatory binding sites obtained from PRODORIC were aligned with the 250 bp sequence region mentioned previously which presumably contains the promoter region.

104 Phylogenetic analysis

VP0065 was used as a seed sequence in a protein BLAST (pBLAST) to identify putative aldolases found in Vibrio parahaemolyticus as well as several other Vibrio species. The phylogenetic tree was constructed from the alignment of the amino acid sequences of the identified putative aldolases. The software, Molecular Evolutionary Genetic Analysis version 6 (MEGA6), was used to construct a neighbor- joining tree using the poisson model, complete deletion and a bootstrap value of 1000 (Felsenstein 1985; Saitou and Nei 1987; Tamura et al. 2013).

Results

The gluconate cluster is contiguous in V. parahaemolyticus

In order to begin unraveling the regulation of the gluconate catabolism cluster in V. parahaemolyticus RIMD221063, we wanted to compare the genes known to be involved in gluconate catabolism in E. coli with those found in V. parahaemolyticus. As shown in Figure 24, the predicted gluconate catabolism genes in V. parahaemolyticus are clustered together; however in E. coli they are scattered throughout the genome. In addition, in E. coli , the genes involved in the Entner- Doudoroff pathway ( b1850, b1851 ) cluster together in an operon whereas this is not seen in V. parahaemolyticus. This clustering of the gluconate catabolism genes is found throughout Vibrionaceae. The alternative sigma factor ecf2 (VP0055) is shown to be in close proximity to the gluconate catabolism genes ( Figure 24).

105 Bioinformatics analysis predicts that gluconate catabolism genes are regulated by a sigma 70 sigma factor, CRP and GntR

We next wanted to investigate whether RpoN regulated gluconate catabolism genes in V. parahaemolyticus . Previously it was shown that VP0063, the gluconokinase (galK ), was upregulated in an rpoN mutant strain grown in M9 mucus (Whitaker et al. 2014). A consensus sequence was determined for RpoN promoter recognition of the -12 and -24 elements from the alignment of the promoter region of 31 genes potentially regulated by RpoN. The RpoN consensus sequence for V. parahaemolyticus includes the highly conserved GGC residues at -24 and GC at -12. (Figure 25). When the upstream region of the gluconate catabolism genes were scanned for the consensus RpoN promoter binding sequence, it was not identified, suggesting that any regulation of the gluconate catabolism genes by RpoN is not direct. The identified promoters have high similarity to those recognized by sigma-70 family sigma factors, with potential -10 and -35 binding sites identified. Gluconate catabolic genes in E. coli are known to be under positive regulation by the cAMP receptor protein (CRP) and negative regulation by the regulator, GntR (Klemm et al. 1996; Porco et al. 1997; Peekhaus and Conway 1998). Bioinformatics analysis using consensus sequences from the known E. coli CRP and GntR regulatory binding sites allowed us to identify putative binding sites for both CRP and GntR indicating that the gluconate catabolism genes may be under the same regulatory mechanism ( Figure 26). Bioinformatics predicts that gntR is not under regulation by CRP and does not self-regulate through binding of its own promoter region.

106 Gluconate catabolism genes are induced in the presence of gluconate

Bioinformatics analysis indicated that the gluconate catabolism genes appear to be regulated in a similar mechanism to E. coli , in V. parahaemolyticus. In order to investigate this further, the expression pattern of crp (VP2793), gntR (VP0058), gntK (VP0063) and the gluconate transporter, gntT (VP0064) were examined in M9 gluconate relative to M9 glucose. The expression pattern of ecf2 ( VP0055), a potential sigma factor involved in regulation of gluconate catabolism was also examined. The data shows that gntK (VP0063) and gntT (VP0064) are both significantly upregulated as expected in the presence of gluconate, indicating their involvement in gluconate catabolism (Figure 27 ). The negative regulator gntR is upregulated in the presence of gluconate, though it is unclear why this may be; however it would not be expected to bind to its repressor binding site as it will be bound to gluconate and unable to bind. The crp gene (VP2793) was down regulated in the presence of gluconate, and it has been shown previously that gluconate can act as a catabolic repressor in the same manner as glucose (Hogema, Arents et al. 1997). Lastly ecf2 was slightly induced in the presence of gluconate suggesting it could be involved in gluconate regulation ( Figure 27 ). Next we examined the expression pattern of the catabolism genes and regulators of gluconate were examined in the rpoN mutant strain in M9 gluconate relative to wild-type. Data shows gntK (VP0063) and gntT (VP0064) are induced at an enhanced rate in the rpoN mutant strain, though the mechanism of the indirect dysregulation of these genes is unknown. The ecf2 ( VP0055) and crp (VP2793) genes are both down expressed at lower levels in gluconate in the rpoN mutant relative to wild-type and gntR (VP0058) is expressed at higher levels relative to wild-type.

107 Lastly, due to its proximity to the gluconate catabolism genes the potential involvement of ecf2 in gluconate catabolism regulation was also investigated. The promoter recognition binding sites for this sigma factor are unknown; therefore in order to determine whether or not ecf2 was involved in gluconate catabolism an in- frame deletion mutant of ecf2 was constructed. The expression pattern of the previously mentioned gluconate catabolism genes and potential regulators were also examined in the ecf2 mutant in M9 gluconate relative to wild-type. This data demonstrates that the gluconate catabolism genes, gntK (VP0063) and gntT (VP0064) were only slightly down regulated in the ecf2 mutant and were still expressed in gluconate, indicating a limited role, if any, of ecf2 in gluconate catabolism regulation (Figure 27 ).

An ecf2 mutant grows similarly to wild-type in various carbon sources

In addition to expression analysis, the growth pattern of the ecf2 in M9 gluconate, M9glucose and M9 supplemented with mucus was also examined. The mutant grew similarly to wild type under all conditions examined suggesting it does not play a role in catabolism regulation ( Figure 28). This is in contrast to an rpoN mutant which grew better than the wild-type and ecf2 mutant strains in M9 gluconate and M9 mucus. Additionally, in vitro competition assays between the ecf2 mutant strain and WBWlacZ in M9 glucose, M9 gluconate and M9 mucus were also performed and the CI for all three conditions was close to 1, or only slightly below 1, indicating that the ecf2 mutant has a similar fitness to wild-type and is not significantly involved in gluconate catabolism when gluconate is present as the sole carbon source or as one of many carbon sources in the mucus ( Figure 29).

108 An eda mutant (VP0065) shows a defect in growth and competition with wild- type in M9 gluconate

In addition to understanding the regulation of gluconate catabolism, it was also of interest to our lab to investigate the role of gluconate catabolism in V. parahaemolyticus , as there is very little information on carbon metabolism in this organism. In order to investigate this, an in-frame deletion mutant of eda (vp0065) was constructed and the growth patterns of this mutant were examined in M9 media supplemented with either: glucose, gluconate or mucus. The eda mutant grew similarly to wild-type in M9 glucose ( Figure 30A) and M9 mucus ( Figure 30C). In in vitro competition assays with WBWlacZ, the eda mutant strain is outcompeted in M9 mucus, suggesting it may play a role in intestinal survival (Figure 30D). Surprisingly, though there is a defect, the mutant was still capable of growing in M9 media supplemented with gluconate as the sole carbon source; the ED pathway is an essential requirement for gluconate catabolism in V. cholerae (Patra, Koley et al. 2012).

Bioinformatics analysis demonstrates there are three homologues of the Entner- Doudoroff aldolase in Vibrio parahaemolyticus

Investigation into why the eda mutant was still capable of growth on gluconate as the sole carbon source led to the discovery of two additional copies of 2-keto-3- deoxyphosphogluconate aldolases found in chromosome 2 (VPA0083 and VPA1708).

VP0065 was subsequently used as a seed sequence in protein BLAST to determine if other Vibrio species also possessed multiple copies of this particular aldolase. Indeed several other species also possess one to two additional copies of the 2-keto-3-

109 deoxyphosphogluconate aldolase (Figure 31). In V. parahaemolyticus the putative aldolase VPA0083 clusters with genes involved in galacturonate metabolism and is the most distantly related to VP0065. Notably, VPA0083 is absent from V. cholerae.

VPA1708 clusters with genes involved in glucoronate catabolism and also forms a distinct cluster from VP0065. Notably, VPA1708 is absent from V. cholerae and is also absent from an environmental isolate, V. parahaemolyticus UCM-V493. Both V. cholerae N16961 and V. parahaemolyticus UCM-V493 are incapable of growth on glucoronate (Boyd lab, unpublished data). Attempts to create an in-frame deletion of

VPUCM_0062 in V. parahaemolyticus UCM-V493, which has 99% identify to

VP0065, were unsuccessful.

Expression analysis reveals that VPA1708 may be important in the vp0065 eda mutant’s ability to utilize M9 gluconate

In order to determine if one of the putative aldolases was compensating for the loss of VP0065 or if there was increased flux through the pentose phosphate pathway at the transcriptional level, the expression of VP1708, a 6-phosphogluconate dehydrogenase and the first gene of the pentose phosphate pathway, VP0065, VPA0083 and VPA1708 was examined in both the wild-type and eda mutant strains in M9 gluconate relative to M9 glucose. In the wild-type strain VP1708, VP0065, VPA0083 and VPA1708 are all significantly induced in the presence of gluconate relative to their expression levels in M9 glucose, indicating that all three aldolases and the pentose phosphate pathway may be contributing to the catabolism of gluconate.

110 VP0065 was the most significantly induced in the presence of gluconate ( Figure 32A). Expression pattern of VP1708, VPA0083 and VPA1708 were also examined in the eda mutant in M9 gluconate and compared to the expression pattern of those genes in the wild-type strain in M9 gluconate. In comparison to expression levels in wild- type, VP1708 is upregulated indicating there may be some increased flux through the pentose phosphate pathway due to the absence of VP0065. Only 1 of the two putative aldolases is upregulated relative to wild-type levels in the vp0065 mutant indicating that VPA1708 may be more important than VPA0083 in compensating for the loss of VP0065 when grown on gluconate, at least at the transcriptional level. VPA1708 clusters with glucoronate genes in chromosome two and is absent from V. parahaemolyticus UCM-V493.

High throughput analysis of phenotypic microarrays indicates that VP0065 may be involved in catabolism of multiple carbon sources

Assaying 150 carbon sources through the use of phenotypic microarrays (Biolog) provided insight into whether or not VP0065 was involved only in catabolism of gluconate or in the catabolism of other carbon sources. The heatmap indicates that there are differences in growth on several different carbon sources between wild-type and the eda mutant ( Figure 33). As expected there are differences in growth on gluconate between the two strains, additionally there are differences in growth on other hexuronate sugars such as glucoronate. The eda mutant also grows better on glycyl-amino acid carbon sources such as glycyl-aspartic acid and glycyl-L-glutamic

111 acid (Figure 33). The eda mutant shows less growth on several sugars found in intestinal mucus, gluconate, glucoronate and galactose.

Discussion

Vibrio parahaemolyticus must alternate between host and the marine environment. Within these two environments it will encounter a number of stress conditions; including fluctuation in nutrients. Previously, it was shown that carbon catabolism is an important aspect of V. parahaemolyticus’ ability to colonize a host (Whitaker, et al. 2014). An rpoN mutant was a hypercolonizer and one contributing factor to this phenotype was the ability of this mutant to utilize carbon sources more efficiently than the wild-type; one carbon source that was utilized more efficiently than the wild-type was an intestinal hexuronate sugar, gluconate. In this work we aimed to determine the role of RpoN in the regulation of gluconate catabolism. Expression analysis demonstrated that gntT (VP0064) and gntK (VP0063) are induced in gluconate at a higher level in the rpoN mutant relative to wild-type; however the positive regulator CRP (VP2793) was not found to be upregulated in this mutant suggesting that the indirect regulation of this pathway by RpoN is not through CRP but through an unknown intermediate.

Additionally, we examined whether an alternative sigma factor, Ecf2 VP0055, played a role in gluconate catabolism regulation due to its close proximity to the gluconate catabolism cluster. Data suggest that Ecf2 plays only a limited role, if any, as a mutant grew similarly to the wild-type strain in M9 gluconate. Lastly, this study aimed to determine the role of the ED pathway in gluconate catabolism . This pathway has been shown to be important in intestinal survival and to be involved in virulence

112 regulation in V. cholerae (Patra et al. 2012). An in-frame deletion mutant was constructed of eda (vp0065 ), the predicted canonical Entner-Doudoroff aldolase. Surprisingly, this mutant showed growth on M9 media supplemented with gluconate as the sole carbon source. In E. coli, aldolase mutants are not capable of growth on gluconate (Fraenkel 1967). Investigation into determining this unusual phenotype led to the discovery of two additional aldolases with homology to VP0065, which are not found in E. coli or in V. cholerae. This led to the hypothesis that one or both of these putative aldolases VPA0083 and VPA1708 may be compensating for the loss of VP0065 in V. parahaemolyticus . Another possibility is that gluconate is being catabolized through the pentose phosphate pathway in this organism in the absence of the Entner-Doudoroff pathway. Expression analysis indicates that the pentose phosphate pathway and all three aldolases are induced at the transcriptional level in the presence of gluconate. Additionally, in the eda mutant, expression data demonstrates that VPA1708 is the aldolase most induced relative to wild-type and may play a larger role than VPA0083 in compensating for the loss of VP0065. Further data supporting the notion that VPA1708 is involved in compensation for the loss of VP0065 in the presence of gluconate is that this aldolase is absent from an environmental isolate of V. parahaemolyticus, strain UCM-V493. In addition to the novel discovery of multiple aldolases involved in the catabolism of gluconate in Vibrio , the work here also demonstrates that a fully functional ED pathway (VP0065 and VP0062) is important for growth and competition with the wild-type strain in cecal intestinal mucus, which would indicate that this pathway may be important for in vivo survival of this organism. It would be interesting to look at the role of this pathway in intestinal colonization through the use of our streptomycin treated adult

113 murine model of colonization to further understand the role of metabolism in V. parahaemolyticus host pathogen interactions (Whitaker, et al. 2012).

114

Vibrio parahaemolyticus

Gluconate cluster is contiguous in V. parahaemolyticus . Schematic of the gluconate catabolism cluster in V. parahaemolyticus compared to that found in Escherichia coli.

115

RpoN binding consensus

Vibrio parahaemolyticus

CRP binding consensus

Münch, R., et al. 2005. Bioinformatics.

GntR binding consensus

Mao, F., et al. 2009. Nucleic Acid Research

Binding consensus sequences for RpoN, CRP and GntR. Weblogo depictions of the binding sequences used in identification of the putative regulatory binding sites.

116

Promoter region analysis of gluconate catabolism genes. Shown here is the binding sites that were identified for the putative positive regulator CRP and putative negative regulator GntR as well as putative sigma 70 promoter sequences. CRP is predicted to bind and interact with RpoD and the RNAP to enhance transcription. GntR is predicted to bind at the indicate sites, overlapping the -10 region, to block transcription of the catabolism genes when they are not needed. VP0058 does not contain CRP or GntR binding sites and is predicted to be expressed constitutively.

117

* * * *

Expression pattern of gluconate catabolism genes and putative regulators in M9 gluconate relative. A. Expression pattern in wild-type (WT) in M9 gluconate relative to M9 glucose. Catabolism genes GntK (VP0063) and GntT (VP0064) are significantly induced in the presence of gluconate. B. Expression pattern of genes in the rpoN mutant in M9 gluconate relative to wild-type levels in M9 gluconate. Catabolism genes are significantly upregulated in the rpoN mutant relative to wild-type indicating RpoN is, at least indirectly, playing a role in gluconate catabolism gene regulation. C. Expression pattern in the vp0055 mutant relative to wild-type in M9 gluconate. CRP is significantly down regulated in this mutant strain and GntR is up regulated. The catabolism genes are down regulated, this may be indirect due to the down regulation of CRP and not due to the lack of VP0055, per se . *p<0.05

118 A. B.

Growth patterns of the vp0055 and rpoN mutants relative to wild- type in M9 glucose, M9 gluconate and M9 cecal mucus. In M9 glucose (A), M9 gluconate (B) and M9 cecal mucus (C) the vp0055 mutant grows similarly to wild-type. This would suggest that the vp0055 mutant is not involved in gluconate catabolism. The rpoN mutant grows similar to wild-type in M9 glucose (A); however it has an advantage over wild-type in M9 gluconate (B) and M9 mucus (C), growing at a faster rate in M9 gluconate and reaching a higher OD in M9 mucus.

119

In vitro competition analysis between the vp0055 mutant and WBWlacZ isogenic wild-type strain. The mutant strain has a similar competitive index as wild-type in all conditions examined, indicating that VP0055 is not involved in catabolism of glucose or gluconate and is not involved in growth or survival in intestinal mucus.

120 B. A.

C.. D..

* *

Growth and in vitro competition analysis of an Entner-Doudoroff (EDA) aldolase mutant. In order to determine the role of gluconate catabolism in V. parahaemolyticus we performed an in-frame deletion of the E. coli homologue of eda (VP0065). The eda mutant strain grows similarly to wild-type in M9 glucose (A). Surprisingly, though defective, the eda mutant showed growth in gluconate (B). The eda mutant grew similarly to wild-type in M9 cecum mucus (C). The eda mutant showed a defect in fitness relative to the wild-type in M9 gluconate and M9 mucus, indicating it may play a role in intestinal survival. * p<0.05

121 VII 003440 Vibrio mimicus MB-451

42 VCA 002371 Vibrio albensis VL426 eda Vibrio cholerae O395 VC0285 Vibrio cholerae O1 biovar eltor str. N16961 19 AND4 17304 Vibrio campbellii AND4 VV11102 Vibrio vulnificus CMCP6 VP0065 Vibrio parahaemolyticus RIMD 2210633 17 VIBHAR 00515 Vibrio harveyi ATCC BAA-1116 VMC 22660 Vibrio alginolyticus 40B B878 15320 Vibrio campbellii CAIM 519 64 VPUCM 0062 Vibrio parahaemolyticus UCM-V493 VV0062 Vibrio vulnificus YJ016 VCHENC03 0041 Vibrio sp. HENC-03 VEA 001957 Vibrio sp. Ex25 G79DRAFT 00401 Vibrio rotiferianus DAT722 Ec eda Escherichia coli K 12 58 VF0090 Vibrio fischeri ES114

3 98 VSAL I2956 Vibrio salmonicida LFI1238 VCHENC03 1631 Vibrio sp. HENC-03 G79DRAFT 04825 Vibrio rotiferianus DAT722 46 VII 000206 Vibrio mimicus MB-451 51 VPA1708 Vibrio parahaemolyticus RIMD 2210633 15 VV21072 Vibrio vulnificus CMCP6

28 VVA1596 Vibrio vulnificus YJ016 64 VFA0987 Vibrio fischeri ES114 VII00023 14002 Vibrio ichthyoenteri ATCC 700023 38 30 VII00023 05462 Vibrio ichthyoenteri ATCC 700023 12 69 VIS19158 18296 Vibrio scopthalmi LMG 19158 VEJY3 09375 Vibrio sp. EJY3 4 VCHENC03 1539 Vibrio sp. HENC-03 24 VIC 002982 Vibrio coralliilyticus ATCC BAA-450 15 VIBHAR 06346 Vibrio harveyi ATCC BAA-1116 27 40 VS II0040 Vibrio splendidus LGP32 20 VIA 002048 Vibrio orientalis CIP 102891 vfu A02209 Vibrio furnissii NCTC 11218 10 B878 18253 Vibrio campbellii CAIM 519 VCHENC03 1118 Vibrio sp. HENC-03 10 49 VIA 001873 Vibrio orientalis CIP 102891 VIC 003755 Vibrio coralliilyticus ATCC BAA-450 VII 000605 Vibrio mimicus MB-451 VII00023 18654 Vibrio ichthyoenteri ATCC 700023 44 VIS19158 13822 Vibrio scophthalmi LMG 19158 VV20904 Vibrio vulnificus CMCP6 22 VII00023 12206 Vibrio ichthyoenteri ATCC 700023 VV0555 Vibrio vulnificus YJ016 21 VVA1387 Vibrio vulnificus YJ016 VEJY3 16061 Vibrio sp. EJY3

14 VIS19158 07660 Vibrio scophthalmi LMG 19158 vfu B01230 Vibrio furnissii NCTC 11218 12 VSAL II0664 Vibrio salmonicida LFI1238 VPA0083 Vibrio parahaemolyticus RIMD 2210633 VS 1242 Vibrio splendidus LGP32 11 VMC 35190 Vibrio alginolyticus 40B 39 VPUCM 20077 Vibrio parahaemolyticus UCM-V493

19 VCHENC03 0530 Vibrio sp. HENC-03 VEA 000917 Vibrio sp. Ex25 54 vfu A00536 Vibrio furnissii NCTC 11218 VAA 03277 Vibrio anguillarum 775 VEJY3 00255 Vibrio sp. EJY3 VIBHAR 06348 Vibrio harveyi ATCC BAA-1116 VIS19158 16171 Vibrio scophthalmi LMG 19158

0.2 Phylogeny reveals V. parahaemolyticus RIMD2210633 has three putative Entner-Doudoroff aldolases. Phylogenetic tree reveals three clusters of putative aldolases among the Vibrio species. The three aldolases in V. parahaemolyticus RIMD2210633 include VP0065, which clusters with the E. coli EDA protein, VPA1708 and VPA0083. V. cholerae has only 1 putative EDA. VPA0083 is absent from an environmental isolate of V. parahaemolyticus.

122

A. B.

Expression in M9 Gluconate Expression in M9 Gluconate 10000 *** *

1000 10

100 ** ** * 1 10 Expression relative to relative Expression wild-type M9 gluconate M9 wild-type wild-type M9 Glucose M9 wild-type Expression relative to relative Expression

8 3 8 1 0 8 0 7 0 7 8 5 3 8 1 0 1 0 6 8 0 P A A 7 0 0 7 V P P 1 0 0 1 V V P P A A V V P P V V

Expression pattern of in M9 gluconate between the wild-type and eda mutant. A. Expression analysis of the first gene in the pentose phosphate pathway (VP1708) and the three putative aldolases (VP0065, VPA0083, VPA1708). This data demonstrates that all three aldolases are induced in the presence of gluconate and may be playing a role in gluconate catabolism; the canonical EDA (VP0065) is induced significantly more than the other aldolases indicating it may be the most important aldolase in gluconate catabolism. VP1708 is also induced in gluconate and indicates there is some flux of gluconate catabolism through the pentose phosphate pathway. B. Expression analysis of VP1708 and the two putative aldolases (VPA0083, VPA1708) in the vp0065 aldolase mutant strain in gluconate relative to the expression of these genes in the wild-type in gluconate. Relative to wild-type, VP1708 is upregulated indicating there may be some increased flux through the pentose phosphate pathway due to the absence of VP0065. Interestingly, only 1 of the two putative aldolases is upregulated relative to wild-type levels in the vp0065 mutant indicating that VPA1708 may be the most important method for compensating for the loss of VP0065. *p<0.05, **p<0.01, ***p<0.001

123

Carbon phenotypic microarray analysis of the eda (VP0065) mutant relative to wild type. A high throughput analysis of growth on 190 different carbon sources reveal that there are differences in carbon catabolism abilities between the mutant and wild-type strain, including but not limited to gluconate. This would indicate that this aldolase is involved in catabolism of other sugars despite clustering in with the other gluconate catabolism genes.

124 Table 5 Bacterial Strains and Plasmids

Strains, genotype or Relevant characteristics References plasmid

Vibrio parahaemolyticus

RIMD2210633 O3:K6 clinical isolate Str R (Makino et al. 2003)

(Whitaker et al. 2012 ; WBWlacZ RIMD2210633:: lacZ Str R Whitaker et al. 2014)

RIMD2210633Δ vp0055 BHM0055 (Δ vp0055) This study (VP0055) BHM0065( Δ eda) RIMD2210633Δ eda (VP0065) This study ΔrpoN RIMD2210633 ΔrpoN (VP2670) (Whitaker et al., 2014) Escherichia coli

DH5α λ pir Δlac pir

ΔdapA::erm pir for bacterial Β2155 DAP conjugation DH5 pΔ0055 DH5α λ pir containing pJ Δ0055 This study Β2155 DAP containing Β2155p Δ0055 This study pDS Δ0055 DH5 pΔeda DH5α λ pir containing pJ Δeda This study Β2155 DAP- Δeda Β2155 DAP containing pDS Δeda This study Plasmids

pJET1.2 Cloning vector

pJET1.2 harboring truncated pJEΔ 0055 This study vp0055 pJEΔ eda pJET1.2 harboring truncated eda This study

pDS132 Suicide plasmid; Cm r; SacB (Philippe et al. 2004)

pDS132 harboring truncated pDSΔ 0055 This study vp0055 pDSΔ eda pDS132 harboring truncated eda This study

125 Table 6 Primers used in this study

Tm Product Size Primer Sequence (°C) (bp) Splice Overlap Extension PCR SOEVP0055A TCTAGACGATGCAAGCCTATACACCC 63 359 SOEVP0055B GCTTGTTTATTACCAGACTGCCA 60

TGGCAGTCTGGTAATAAACAAGCAGACCTCAAGTTCTCACG SOEVP0055C 59 383 CA SOEVP0055D GAGCTCTCACGGCTGTCAGATCGTAA 60

SOEVP0055FFor ACACATCCAACACAGCAACC 59 1499 SOEVP0055FRev TTGCTGATCGGCTTGTTCTG 59

SOEVP0065A TCTAGAAACCGTAGCGCTAACCACTA 63 414 SOEVP0065B AATGTCACTTCCGCACATGG 59

SOEVP0065C CCATGTGCGGAAGTGACATTTGCAATGATGGATAACGGCG 59 426 SOEVP0065D GAGCTCCAGGCCCCAATTTTGAGACC 60

SOEVP0065FFor GTGTGGTGAGTCATTGGCTC 55 1537 SOEVP0065FRev GCCAATGCGTACGACAAAGA 50

Real-Time PCR crp Forward GAGCACGCTAATTCACGCAG 60 278 crp Reverse GCGCAGAAAGACGCATTAGG 60

gntR Forward ACATTGCAGGATGTCGCAGA 60 249 gntR Reverse AGTGACCGTCTCTATGCCCT 60

VP0055 Forward GCTAAAGTCATGCGCCAAAT 57 215 VP0055 Reverse TCGCTGATCTCCTGGTTCTT 58

gntK Forward TCA ACT CCA TAT CGC CAT CA 54 219 gntK Reverse CAC GAG CGA ACA TTC AGA AA 53

gntT Forward GGCGTTTGTGATTTCAACCT 57 222 gntT Reverse TCATCCATCTCAAGCAGACG 57

VP0065 Forward ACCGGGTGTAAACAACCCAA 60 212 VP0065 Reverse TACCGCCACAAGCTACAACC 60

VPA1708 CACGCCAGTAGAAGGTGACA 60 199 Forward VPA1708 Reverse GTTGCCTAGGAACGCAGAAC 59

VPA0083 GCAAGGCAGTGAAATTGGCA 60 247 Forward VPA0083 Reverse ACGTTACGCTGTTGGCAGTA 60

VPA1708 CAGCCGCTGAAATCACCTTC 55 195 Forward VPA1708 Reverse TTTCTTGGCACGCTTTGACG 50

16S Forward ACG GCC TGG GGA GTA CGG TC 60 234 16S Reverse TTG CGC TCG TTG CGG GAC TT 60

126 Chapter 5

CONCLUSIONS AND FUTURE DIRECTIONS

This dissertation outlines work conducted to better understand the role of sigma factors, as global transcriptional regulators, in the biology of Vibrio parahaemolyticus. V. parahaemolyticus , a marine bacterium is the leading cause of seafood borne bacterial gastroenteritis. Cases of infection due to this organism have been on the rise in recent years; in the United States the incidence rate has risen 32% since 2012 (Crim et al. 2014). This trend is speculated to continue with the increase in levels of Vibrio in the marine environment as the ocean waters increase in temperature (Levy 2015). The increase in numbers and infection rate, make understanding the biology of V. parahaemolyticus an important endeavor. As a marine organism and an enteric pathogen, V. parahaemolyticus must be able to adapt to rapid changes in its environment. Alternative sigma factors, which sit atop the hierarchy of transcriptional regulation, are expected to play in a role in this adaptation as they enable the bacteria to simultaneously switch on a large number of genes in response to specific stress conditions. To begin to unravel the involvement of sigma factors in V. parahaemolyticus stress response and host colonization, we focused on examining the distribution of sigma 70 family sigma factors among Vibrionaceae and their expression in mucus, as well as a functional analysis of sigma factors RpoE, RpoS, VP0055 and RpoN. Additionally, we examined the role of the Entner-Doudoroff pathway in V. parahaemolyticus metabolism, as we had previously

127 demonstrated carbon catabolism to also be an important factor in host colonization for this organism (Whitaker et al. 2014). We demonstrated that the number of sigma factors among Vibrionaceae can vary from as many as 15 to as few as 8 and this is correlated with genome size. Larger genomes tend as a whole to have more sigma factors than smaller genomes. V. parahaemolyticus has 11 sigma factors, which is close to the average number of sigma factors of 10 found among Vibrio species. We show that a majority of sigma factors found in V. parahaemolyticus are highly conserved with the exception of the lateral flagellar sigma factor, FliAL, and ECF sub family type sigmas VP0055 and VPA1690. Of the 11 sigma factors encoded in the V. parahaemolyticus genome, 5 are ECF type sigma factors, compared to the highly studied enteric bacteria, E. coli , which only has two ECF type sigma factors. We examined two of those ECF type sigma factors, the canonical and highly conserved RpoE (VP2578); and the most divergent ECF, VP0055 by creating single in-frame deletion mutants of each. We demonstrated that RpoE is involved in cell membrane stress, including polymyxin B and ethanol as well as low osmolality, heat shock and hydrogen peroxide stresses (Haines-Menges et al. 2014). An rpoE mutant was also shown to be less fit relative to the wild-type in in vivo colonization assays and had a growth defect in cecum and large intestinal mucus, indicating the importance of the RpoE regulon in host survival; this was in contrast to an rpoS mutant which had the same relative fitness in vivo as wild-type (Haines-Menges et al. 2014). Future studies, such as RNA sequence analysis, probing the RpoE regulon under various stress and nutrient conditions including but not limited to 1% NaCl, 200µg polymyxin and intestinal mucus would yield important information on what

128 genes are regulated by RpoE as well as what genes are important for the overall adaption of V. parahaemolyticus to those stress conditions. Additionally, our data indicates that in V. parahaemolyticus OmpU does not signal the release of RpoE under the conditions examined, contrasting data in V. cholerae which indicates that RpoE release is signaled by accumulation of misfolded OmpU in the periplasm (Mathur, Davis et al. 2007). Future studies examining gene expression of other alternative sigma factors in the ompU mutant relative to wild-type under conditions in which OmpU is important for survival could enable elucidation of which sigma factor regulon, if any, may be triggered by misfolded OmpU. Additionally, there is a second homologue of OmpU on chromosome two and it is not known whether or not this putative OmpU (VPA0526) or any other outer membrane proteins could trigger release of RpoE from the inner membrane under any membrane stress and warrants further investigation to understand the regulation of RpoE. LPS extractions from the rpoE mutant and ompU mutant strains compared to wild-type would also be useful in further understanding the differences between the two mutant strain phenotypes. We found that VP0055 was only limitedly involved, if at all, in the indirect regulation of gluconate catabolism despite its close proximity to the gluconate catabolism gene cluster. The function of this sigma factor is thus unknown at this point in time. This particular sigma factor has many novel characteristics including being highly divergent from other ECFs, unique to Vibrionaceae, and found in an operon with a putative serine/threonine protein kinase making any future studies yielding information on the function of this factor novel and informative to Vibrio biology. High-through put analyses, rather than choosing select stress conditions, examples including biolog phenotypic microarrays and RNA sequencing may be more useful in

129 determining the function, if any, of this sigma factor in V. parahaemolyticus. Additionally, in vivo competition assays or persistence assays could be conducted to determine if this sigma factor is involved in colonization of the intestinal tract. Lastly, we examined the role of the Entner-Doudoroff pathway in V. parahaemolyticus. We found that the gene encoding the canonical Entner-Doudoroff aldolase, VP0065, when knocked out resulted in a strain exhibiting a growth defect in gluconate utilization. A vp0065 mutant was also outcompeted by a LacZ+ wild-type strain in in vitro competition assays in M9 mucus and M9 gluconate, demonstrating the importance of this gene in utilization of those two carbon sources. The reduced fitness in M9 mucus of the vp0065 mutant may indicate a role in intestinal colonization and could be examined further through the use of in vivo competition assays in the streptomycin mouse model of colonization. Perhaps the most interesting discovery in this last chapter was that the vp0065 mutant was able to grow on M9 media containing gluconate as the sole carbon source. In other bacteria such as V. cholerae and E. coli, mutations in the ED-pathway lead to lack of growth and even cell death in the presence of gluconate and it is predicted that the ED pathway and not the pentose phosphate pathway is primarily used for energy production in the catabolism of gluconate in these species. We demonstrated that the first gene of the pentose pathway is induced in gluconate in V. parahaemolyticus and that the V. parahaemolyticus genome encodes two additional aldolases which are also induced in the presence of gluconate and may compensate for the absence of VP0065. Gene expression analysis in the vp0065 mutant demonstrates that VPA1708 and not VPA0083 is expressed at higher levels than wild-type in gluconate and may be the aldolase primarily responsible for the compensation of the loss of VP0065, though this

130 is not proven. It would be interesting to determine through metabolic flux analysis or examination of the expression of other genes in the pentose phosphate pathway as well as protein levels, whether the pentose phosphate pathway or the other putative aldolases are contributing the most to the growth of the vp0065 mutant.

131 REFERENCES

1. Alba, B. M. and C. A. Gross (2004). "Regulation of the Escherichia coli sigma-dependent envelope stress response." Mol Microbiol 52 (3): 613-9.

2. Anders, S., P. T. Pyl, et al. (2014). "HTSeq--a Python framework to work with high-throughput sequencing data." Bioinformatics 31 (2): 166-9.

3. Andersson, S. G. and C. G. Kurland (1998). "Reductive evolution of resident genomes." Trends Microbiol 6(7): 263-8.

4. Beaz-Hidalgo, R., S. Balboa, et al. (2010). "Diversity and pathogenecity of Vibrio species in cultured bivalve molluscs." Environ Microbiol Rep 2(1): 34-43.

5. Bernard, C. S., Y. R. Brunet, et al. (2011). "Regulation of type VI secretion gene clusters by sigma54 and cognate enhancer binding proteins." J Bacteriol 193 (9): 2158-67.

6. Blackstone, G. M., J. L. Nordstrom, et al. (2003). "Detection of pathogenic Vibrio parahaemolyticus in oyster enrichments by real time PCR." J Microbiol Methods 53 (2): 149-55.

7. Boutin, B. K., S. F. Townsend, et al. (1979). "Demonstration of invasiveness of Vibrio parahaemolyticus in adult rabbits by immunofluorescence." Appl Environ Microbiol 37 (3): 647-53.

8. Boyd, E. F., A. L. Cohen, et al. (2008). "Molecular analysis of the emergence of pandemic Vibrio parahaemolyticus ." BMC Microbiol 8: 110.

9. Broberg, C. A., L. Zhang, et al. (2010). "A Vibrio effector protein is an inositol phosphatase and disrupts host cell membrane integrity." Science 329 (5999): 1660-2.

10. Brown, R. N. and P. A. Gulig (2009). "Roles of RseB, sigmaE, and DegP in virulence and phase variation of colony morphotype of Vibrio vulnificus ." Infect Immun 77 (9): 3768-81.

132 11. Burdette, D. L., J. Seemann, et al. (2009). " Vibrio VopQ induces PI3- kinase-independent autophagy and antagonizes phagocytosis." Mol Microbiol 73 (4): 639-49.

12. Cao, X., S. V. Studer, et al. (2012). "The novel sigma factor-like regulator RpoQ controls luminescence, chitinase activity, and motility in Vibrio fischeri ." MBio 3(1).

13. Capodici, C., S. Chen, et al. (1994). "Effect of lipopolysaccharide (LPS) chain length on interactions of bactericidal/permeability-increasing protein and its bioactive 23-kilodalton NH2-terminal fragment with isolated LPS and intact Proteus mirabilis and Escherichia coli ." Infect Immun 62 (1): 259-65.

14. Chang, D. E., D. J. Smalley, et al. (2004). "Carbon nutrition of Escherichia coli in the mouse intestine." Proc Natl Acad Sci U S A 101 (19): 7427-32.

15. Costanzo, A. and S. E. Ades (2006). "Growth phase-dependent regulation of the extracytoplasmic stress factor, sigmaE, by guanosine 3',5'- bispyrophosphate (ppGpp)." J Bacteriol 188 (13): 4627-34.

16. Crim, S. M., M. Iwamoto, et al. (2014). "Incidence and trends of infection with pathogens transmitted commonly through food--Foodborne Diseases Active Surveillance Network, 10 U.S. sites, 2006-2013." MMWR Morb Mortal Wkly Rep 63 (15): 328-32.

17. Daniels, N. A., L. MacKinnon, et al. (2000). " Vibrio parahaemolyticus infections in the United States, 1973-1998." J Infect Dis 181 (5): 1661-6.

18. Davis, B. M. and M. K. Waldor (2009). "High-throughput sequencing reveals suppressors of Vibrio cholerae rpoE mutations: one fewer porin is enough." Nucleic Acids Res 37 (17): 5757-67.

19. De Las Penas, A., L. Connolly, et al. (1997). "SigmaE is an essential sigma factor in Escherichia coli ." J Bacteriol 179 (21): 6862-4.

20. de Silva, A. O. and D. G. Fraenkel (1979). "The 6-phosphogluconate dehydrogenase reaction in Escherichia coli ." J Biol Chem 254 (20): 10237- 42.

21. Dong, T. and H. E. Schellhorn (2009). "Role of RpoS in virulence of pathogens." Infect Immun 78 (3): 887-97.

133 22. Dong, T. G. and J. J. Mekalanos (2012). "Characterization of the RpoN regulon reveals differential regulation of T6SS and new flagellar operons in Vibrio cholerae O37 strain V52." Nucleic Acids Res 40 (16): 7766-75.

23. Edgar, R. C. (2004). "MUSCLE: a multiple sequence alignment method with reduced time and space complexity." BMC Bioinformatics 5: 113.

24. El-Mowafi, S. A., E. Sineva, et al. (2015). "Identification of inhibitors of a bacterial sigma factor using a new high-throughput screening assay." Antimicrob Agents Chemother 59 (1): 193-205.

25. Felsenstein, J. (1985). "Confidence limits on phylogenies: An approach using the bootstrap." Evolution 39 : 783-791.

26. Fraenkel, D. G. (1967). "Genetic mapping of mutations affecting phosphoglucose isomerase and fructose diphosphatase in Escherichia coli ." J Bacteriol 93 (5): 1582-7.

27. Fraser, C. M., J. D. Gocayne, et al. (1995). "The minimal gene complement of Mycoplasma genitalium ." Science 270 (5235): 397-403.

28. Gazzano-Santoro, H., J. B. Parent, et al. (1992). "High-affinity binding of the bactericidal/permeability-increasing protein and a recombinant amino- terminal fragment to the lipid A region of lipopolysaccharide." Infect Immun 60 (11): 4754-61.

29. Gode-Potratz, C. J. and L. L. McCarter (2011). "Quorum sensing and silencing in Vibrio parahaemolyticus ." J Bacteriol 193 (16): 4224-37.

30. Guzman, L. M., D. Belin, et al. (1995). "Tight regulation, modulation, and high-level expression by vectors containing the arabinose PBAD promoter." J Bacteriol 177 (14): 4121-30.

31. Haines-Menges, B., W. B. Whitaker, et al. (2014). "Alternative sigma factor RpoE is important for Vibrio parahaemolyticus cell envelope stress response and intestinal colonization." Infect Immun 82 (9): 3667-77.

32. Ham, H. and K. Orth (2012). "The role of type III secretion system 2 in Vibrio parahaemolyticus pathogenicity." J Microbiol 50 (5): 719-25.

33. Hancock, R. E. (1997). "Peptide antibiotics." Lancet 349 (9049): 418-22.

134 34. Hao, B., Z. L. Mo, et al. (2012). "Role of alternative sigma factor 54 (RpoN) from Vibrio anguillarum M3 in protease secretion, exopolysaccharide production, biofilm formation, and virulence." Appl Microbiol Biotechnol.

35. Hild, E., K. Takayama, et al. (2000). "Evidence for a role of rpoE in stressed and unstressed cells of marine Vibrio angustum strain S14." J Bacteriol 182 (24): 6964-74.

36. Hiyoshi, H., T. Kodama, et al. (2010). "Contribution of Vibrio parahaemolyticus virulence factors to cytotoxicity, enterotoxicity, and lethality in mice." Infect Immun 78 (4): 1772-80.

37. Hiyoshi, H., T. Kodama, et al. (2011). "VopV, an F-actin-binding type III secretion effector, is required for Vibrio parahaemolyticus -induced enterotoxicity." Cell Host Microbe 10 (4): 401-9.

38. Ho, S. N., H. D. Hunt, et al. (1989). "Site-directed mutagenesis by overlap extension using the polymerase chain reaction." Gene 77 (1): 51-9.

39. Ho, T. D. and C. D. Ellermeier (2012). "Extra cytoplasmic function sigma factor activation." Curr Opin Microbiol 15 (2): 182-8.

40. Hogema, B. M., J. C. Arents, et al. (1997). "Catabolite repression by glucose 6-phosphate, gluconate and lactose in Escherichia coli ." Mol Microbiol 24 (4): 857-67.

41. Honda, T., lida T (1993). "The pathogenicity of Vibrio parahaemolyticus and the role of the thermostable direct heamolysin and related heamolysins." Reviews in Medical Microbiology 4: 106–113.

42. Honda, T., Y. Ni, et al. (1992). "The thermostable direct hemolysin of Vibrio parahaemolyticus is a pore-forming toxin." Can J Microbiol 38 (11): 1175-80.

43. Honda, T., Y. X. Ni, et al. (1988). "Purification and characterization of a hemolysin produced by a clinical isolate of Kanagawa phenomenon- negative Vibrio parahaemolyticus and related to the thermostable direct hemolysin." Infect Immun 56 (4): 961-5.

44. Honda, T., S. Taga, et al. (1976). "Identification of lethal toxin with the thermostable direct hemolysin produced by Vibrio parahaemolyticus , and some physicochemical properties of the purified toxin." Infect Immun 13 (1): 133-9.

135 45. Hondo, S., I. Goto, et al. (1987). "Gastroenteritis due to Kanagawa negative Vibrio parahaemolyticus ." Lancet 1(8528): 331-2.

46. Horton, R. M., H. D. Hunt, et al. (1989). "Engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap extension." Gene 77 (1): 61-8.

47. HsuChen, C. C. and D. S. Feingold (1973). "The mechanism of polymyxin B action and selectivity toward biologic membranes." Biochemistry 12 (11): 2105-11.

48. Hulsmann, A., T. M. Rosche, et al. (2003). "RpoS-dependent stress response and exoenzyme production in Vibrio vulnificus ." Appl Environ Microbiol 69 (10): 6114-20.

49. Hurley, C. C., A. Quirke, et al. (2006). "Four genomic islands that mark post-1995 pandemic Vibrio parahaemolyticus isolates." BMC Genomics 7: 104.

50. Ishikawa, T., P. K. Rompikuntal, et al. (2009). "Quorum sensing regulation of the two hcp alleles in Vibrio cholerae O1 strains." PLoS One 4(8): e6734.

51. Izutsu, K., K. Kurokawa, et al. (2008). "Comparative genomic analysis using microarray demonstrates a strong correlation between the presence of the 80-kilobase pathogenicity island and pathogenicity in Kanagawa phenomenon-positive Vibrio parahaemolyticus strains." Infect Immun 76 (3): 1016-23.

52. Joseph, S. W., R. R. Colwell, et al. (1982). " Vibrio parahaemolyticus and related halophilic Vibrios ." Crit Rev Microbiol 10 (1): 77-124.

53. Kalburge, S. S., S. W. Polson, et al. (2014). "Complete Genome Sequence of Vibrio parahaemolyticus Environmental Strain UCM-V493." Genome Announc 2(2).

54. Kalburge, S. S., W. B. Whitaker, et al. (2014). "High-salt preadaptation of Vibrio parahaemolyticus enhances survival in response to lethal environmental stresses." J Food Prot 77 (2): 246-53.

55. Kaneko, T. and R. R. Colwell (1973). "Ecology of Vibrio parahaemolyticus in Chesapeake Bay." J Bacteriol 113 (1): 24-32.

136 56. Kawagishi, I., M. Nakada, et al. (1997). "Cloning of a Vibrio alginolyticus rpoN gene that is required for polar flagellar formation." J Bacteriol 179 (21): 6851-4.

57. Kitaoka, M., S. T. Miyata, et al. (2011). "VasH is a transcriptional regulator of the type VI secretion system functional in endemic and pandemic Vibrio cholerae ." J Bacteriol 193 (23): 6471-82.

58. Klemm, P., S. Tong, et al. (1996). "The gntP gene of Escherichia coli involved in gluconate uptake." J Bacteriol 178 (1): 61-7.

59. Klose, K. E. and J. J. Mekalanos (1998). "Distinct roles of an alternative sigma factor during both free-swimming and colonizing phases of the Vibrio cholerae pathogenic cycle." Mol Microbiol 28 (3): 501-20.

60. Klose, K. E., V. Novik, et al. (1998). "Identification of multiple sigma54- dependent transcriptional activators in Vibrio cholerae ." J Bacteriol 180 (19): 5256-9.

61. Kodama, T., M. Rokuda, et al. (2007). "Identification and characterization of VopT, a novel ADP-ribosyltransferase effector protein secreted via the Vibrio parahaemolyticus type III secretion system 2." Cell Microbiol 9(11): 2598-609.

62. Konstantinidis, K. T. and J. M. Tiedje (2004). "Trends between gene content and genome size in prokaryotic species with larger genomes." Proc Natl Acad Sci U S A 101 (9): 3160-5.

63. Kovacikova, G. and K. Skorupski (2002). "The alternative sigma factor sigma(E) plays an important role in intestinal survival and virulence in Vibrio cholerae ." Infect Immun 70 (10): 5355-62.

64. Levy, S. (2015). "Warming trend: how climate shapes Vibrio ecology." Environ Health Perspect 123 (4): A82-9.

65. Li, H. and R. Durbin (2009). "Fast and accurate short read alignment with Burrows-Wheeler transform." Bioinformatics 25 (14): 1754-60.

66. Lilley, B. N. and B. L. Bassler (2000). "Regulation of quorum sensing in Vibrio harveyi by LuxO and sigma-54." Mol Microbiol 36 (4): 940-54.

67. Lin, Y. H., C. Miyamoto, et al. (2002). "Cloning, sequencing, and functional studies of the rpoS gene from Vibrio harveyi ." Biochem Biophys Res Commun 293 (1): 456-62.

137 68. Liverman, A. D., H. C. Cheng, et al. (2007). "Arp2/3-independent assembly of actin by Vibrio type III effector VopL." Proc Natl Acad Sci U S A 104 (43): 17117-22.

69. Makino, K., K. Oshima, et al. (2003). "Genome sequence of Vibrio parahaemolyticus : a pathogenic mechanism distinct from that of V. cholerae ." Lancet 361 (9359): 743-9.

70. Mathur, J., B. M. Davis, et al. (2007). "Antimicrobial peptides activate the Vibrio cholerae sigmaE regulon through an OmpU-dependent signalling pathway." Mol Microbiol 63 (3): 848-58.

71. Mathur, J. and M. K. Waldor (2004). "The Vibrio cholerae ToxR-regulated porin OmpU confers resistance to antimicrobial peptides." Infect Immun 72 (6): 3577-83.

72. Matsuda, S., T. Kodama, et al. (2010). "Association of Vibrio parahaemolyticus thermostable direct hemolysin with lipid rafts is essential for cytotoxicity but not hemolytic activity." Infect Immun 78 (2): 603-10.

73. McCarter, L. L. (1995). "Genetic and molecular characterization of the polar flagellum of Vibrio parahaemolyticus ." J Bacteriol 177 (6): 1595-609.

74. McCarter, L. L. and M. E. Wright (1993). "Identification of genes encoding components of the swarmer cell flagellar motor and propeller and a sigma factor controlling differentiation of Vibrio parahaemolyticus ." J Bacteriol 175 (11): 3361-71.

75. McLaughlin, J. B., A. DePaola, et al. (2005). "Outbreak of Vibrio parahaemolyticus gastroenteritis associated with Alaskan oysters." N Engl J Med 353 (14): 1463-70.

76. Merrell, D. S., A. D. Tischler, et al. (2000). " Vibrio cholerae requires rpoS for efficient intestinal colonization." Infect Immun 68 (12): 6691-6.

77. Meyer-Hoffert, U., M. W. Hornef, et al. (2008). "Secreted enteric antimicrobial activity localizes to the mucus surface layer." Gut.

78. Millikan, D. S. and E. G. Ruby (2003). "FlrA, a sigma54-dependent transcriptional activator in Vibrio fischeri , is required for motility and symbiotic light-organ colonization." J Bacteriol 185 (12): 3547-57.

138 79. Missiakas, D., M. P. Mayer, et al. (1997). "Modulation of the Escherichia coli sigmaE (RpoE) heat-shock transcription-factor activity by the RseA, RseB and RseC proteins." Mol Microbiol 24 (2): 355-71.

80. Missiakas, D. and S. Raina (1998). "The extracytoplasmic function sigma factors: role and regulation." Mol Microbiol 28 (6): 1059-66.

81. Mortazavi, A., B. A. Williams, et al. (2008). "Mapping and quantifying mammalian transcriptomes by RNA-Seq." Nat Methods 5(7): 621-8.

82. Munch, R., K. Hiller, et al. (2005). "Virtual Footprint and PRODORIC: an integrative framework for regulon prediction in prokaryotes." Bioinformatics 21 (22): 4187-9.

83. Nagayama, K., T. Oguchi, et al. (1995). "Purification and characterization of a cell-associated hemagglutinin of Vibrio parahaemolyticus ." Infect Immun 63 (5): 1987-92.

84. Nair, G. B., T. Ramamurthy, et al. (2007). "Global dissemination of Vibrio parahaemolyticus serotype O3:K6 and its serovariants." Clin Microbiol Rev 20 (1): 39-48.

85. Nam, Y. D., H. W. Chang, et al. (2007). " Vibrio litoralis sp. nov., isolated from a Yellow Sea tidal flat in Korea." Int J Syst Evol Microbiol 57 (Pt 3): 562-5.

86. Nielsen, A. T., N. A. Dolganov, et al. (2006). "RpoS controls the Vibrio cholerae mucosal escape response." PLoS Pathog 2(10): e109.

87. Nishibuchi, M., T. Taniguchi, et al. (1989). "Cloning and nucleotide sequence of the gene (trh) encoding the hemolysin related to the thermostable direct hemolysin of Vibrio parahaemolyticus ." Infect Immun 57 (9): 2691-7.

88. O'Toole, R., D. L. Milton, et al. (1997). "RpoN of the fish pathogen Vibrio (Listonella) anguillarum is essential for flagellum production and virulence by the water-borne but not intraperitoneal route of inoculation." Microbiology 143 ( Pt 12) : 3849-59.

89. Ono, T., K. S. Park, et al. (2006). "Identification of proteins secreted via Vibrio parahaemolyticus type III secretion system 1." Infect Immun 74 (2): 1032-42.

139 90. Osterberg, S., T. del Peso-Santos, et al. (2011). "Regulation of alternative sigma factor use." Annu Rev Microbiol 65 : 37-55.

91. Paget, M. S. and J. D. Helmann (2003). "The sigma70 family of sigma factors." Genome Biol 4(1): 203.

92. Park, K. S., T. Ono, et al. (2004). "Functional characterization of two type III secretion systems of Vibrio parahaemolyticus ." Infect Immun 72 (11): 6659-65.

93. Patra, T., H. Koley, et al. (2012). "The Entner-Doudoroff pathway is obligatory for gluconate utilization and contributes to the pathogenicity of Vibrio cholerae ." J Bacteriol 194 (13): 3377-85.

94. Peekhaus, N. and T. Conway (1998). "Positive and negative transcriptional regulation of the Escherichia coli gluconate regulon gene gntT by GntR and the cyclic AMP (cAMP)-cAMP receptor protein complex." J Bacteriol 180 (7): 1777-85.

95. Peekhaus, N. and T. Conway (1998). "What's for dinner?: Entner- Doudoroff metabolism in Escherichia coli ." J Bacteriol 180 (14): 3495-502.

96. Pfaffl, M. W., I. G. Lange, et al. (2001). "Tissue-specific expression pattern of estrogen receptors (ER): quantification of ER alpha and ER beta mRNA with real-time RT-PCR." APMIS 109 (5): 345-55.

97. Philippe, N., J. P. Alcaraz, et al. (2004). "Improvement of pCVD442, a suicide plasmid for gene allele exchange in bacteria." Plasmid 51 (3): 246- 55.

98. Pineyro, P., X. Zhou, et al. (2010). "Development of two animal models to study the function of Vibrio parahaemolyticus type III secretion systems." Infect Immun 78 (11): 4551-9.

99. Porco, A., N. Peekhaus, et al. (1997). "Molecular genetic characterization of the Escherichia coli gntT gene of GntI, the main system for gluconate metabolism." J Bacteriol 179 (5): 1584-90.

100. Prouty, M. G., N. E. Correa, et al. (2001). "The novel sigma54- and sigma28-dependent flagellar gene transcription hierarchy of Vibrio cholerae ." Mol Microbiol 39 (6): 1595-609.

140 101. Rattanama, P., J. R. Thompson, et al. (2012). "Sigma E regulators control hemolytic activity and virulence in a shrimp pathogenic Vibrio harveyi ." PLoS One 7(2): e32523.

102. Richards, G. P., J. P. Fay, et al. (2012). "Predatory bacteria as natural modulators of Vibrio parahaemolyticus and Vibrio vulnificus in seawater and oysters." Appl Environ Microbiol 78 (20): 7455-66.

103. Ritchie, J. M., H. Rui, et al. (2012). "Inflammation and disintegration of intestinal villi in an experimental model for Vibrio parahaemolyticus - induced diarrhea." PLoS Pathog 8(3): e1002593.

104. Rosche, T. M., D. J. Smith, et al. (2005). "RpoS involvement and requirement for exogenous nutrient for osmotically induced cross protection in Vibrio vulnificus ." FEMS Microbiol Ecol 53 (3): 455-62.

105. Sahu, G. K., R. Chowdhury, et al. (1997). "The rpoH gene encoding sigma 32 homolog of Vibrio cholerae ." Gene 189 (2): 203-7.

106. Saitou, N. and M. Nei (1987). "The neighbor-joining method: a new method for reconstructing phylogenetic trees." Mol Biol Evol 4(4): 406-25.

107. Sawabe, T., I. Sugimura, et al. (1998). " Vibrio halioticoli sp. nov., a non- motile alginolytic marine bacterium isolated from the gut of the abalone Haliotis discus hannai ." Int J Syst Bacteriol 48 Pt 2 : 573-80.

108. Schindler, P. R. and M. Teuber (1975). "Action of polymyxin B on bacterial membranes: morphological changes in the cytoplasm and in the outer membrane of Salmonella typhimurium and Escherichia coli B." Antimicrob Agents Chemother 8(1): 95-104.

109. Schneider, T. D. (2001). "Strong minor groove base conservation in sequence logos implies DNA distortion or base flipping during replication and transcription initiation." Nucleic Acids Res 29 (23): 4881-91.

110. Shigenobu, S., H. Watanabe, et al. (2000). "Genome sequence of the endocellular bacterial symbiont of aphids Buchnera sp. APS." Nature 407 (6800): 81-6.

111. Slamti, L., J. Livny, et al. (2007). "Global gene expression and phenotypic analysis of a Vibrio cholerae rpoH deletion mutant." J Bacteriol 189 (2): 351-62.

141 112. Stewart, B. J. and L. L. McCarter (2003). "Lateral flagellar gene system of Vibrio parahaemolyticus ." J Bacteriol 185 (15): 4508-18.

113. Sweeney, N. J., D. C. Laux, et al. (1996). " Escherichia coli F-18 and E. coli K-12 eda mutants do not colonize the streptomycin-treated mouse large intestine." Infect Immun 64 (9): 3504-11.

114. Syed, K. A., S. Beyhan, et al. (2009). "The Vibrio cholerae flagellar regulatory hierarchy controls expression of virulence factors." J Bacteriol 191 (21): 6555-70.

115. Tamura, K., D. Peterson, et al. (2011). "MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods." Mol Biol Evol 28 (10): 2731-9.

116. Tamura, K., G. Stecher, et al. (2013). "MEGA6: Molecular Evolutionary Genetics Analysis version 6.0." Mol Biol Evol 30 (12): 2725-9.

117. Thompson, C. C., A. C. Vicente, et al. (2009). "Genomic taxonomy of Vibrios ." BMC Evol Biol 9: 258.

118. Thompson, F. L., C. C. Thompson, et al. (2005). " Photobacterium rosenbergii sp. nov. and Enterovibrio coralii sp. nov., vibrios associated with coral bleaching." Int J Syst Evol Microbiol 55 (Pt 2): 913-7.

119. Tian, Y., Q. Wang, et al. (2008). "Role of RpoS in stress survival, synthesis of extracellular autoinducer 2, and virulence in Vibrio alginolyticus ." Arch Microbiol 190 (5): 585-94.

120. Trosky, J. E., S. Mukherjee, et al. (2004). "Inhibition of MAPK signaling pathways by VopA from Vibrio parahaemolyticus ." J Biol Chem 279 (50): 51953-7.

121. Urbanczyk, H., J. C. Ast, et al. (2007). "Reclassification of Vibrio fischeri, Vibrio logei, Vibrio salmonicida and Vibrio wodanis as Aliivibrio fischeri gen. nov., comb. nov., Aliivibrio logei comb. nov., Aliivibrio salmonicida comb. nov. and Aliivibrio wodanis comb. nov." Int J Syst Evol Microbiol 57 (Pt 12): 2823-9.

122. Walsh, N. P., B. M. Alba, et al. (2003). "OMP peptide signals initiate the envelope-stress response by activating DegS protease via relief of inhibition mediated by its PDZ domain." Cell 113 (1): 61-71.

142 123. Weber, B., A. Croxatto, et al. (2008). "RpoS induces expression of the Vibrio anguillarum quorum-sensing regulator VanT." Microbiology 154 (Pt 3): 767-80.

124. Whitaker, W. B., M. A. Parent, et al. (2012). "The Vibrio parahaemolyticus ToxRS regulator is required for stress tolerance and colonization in a novel orogastric streptomycin-induced adult murine model." Infect Immun 80 (5): 1834-45.

125. Whitaker, W. B., M. A. Parent, et al. (2010). "Modulation of responses of Vibrio parahaemolyticus O3:K6 to pH and temperature stresses by growth at different salt concentrations." Appl Environ Microbiol 76 (14): 4720-9.

126. Whitaker, W. B., G. P. Richards, et al. (2014). "Loss of sigma factor RpoN increases intestinal colonization of Vibrio parahaemolyticus in an adult mouse model." Infect Immun 82 (2): 544-56.

127. Wolfe, A. J., D. S. Millikan, et al. (2004). " Vibrio fischeri sigma54 controls motility, biofilm formation, luminescence, and colonization." Appl Environ Microbiol 70 (4): 2520-4.

128. Yildiz, F. H., X. S. Liu, et al. (2004). "Molecular analysis of rugosity in a Vibrio cholerae O1 El Tor phase variant." Mol Microbiol 53 (2): 497-515.

129. Yildiz, F. H. and G. K. Schoolnik (1998). "Role of rpoS in stress survival and virulence of Vibrio cholerae ." J Bacteriol 180 (4): 773-84.

130. Zablotny, R. and D. G. Fraenkel (1967). "Glucose and gluconate metabolism in a mutant of Escherichia coli lacking gluconate-6-phosphate dehydrase." J Bacteriol 93 (5): 1579-81.

131. Zasloff, M. (2002). "Antimicrobial peptides of multicellular organisms." Nature 415 (6870): 389-95.

132. Zhao, G., A. J. Pease, et al. (1995). "Biochemical characterization of gapB- encoded erythrose 4-phosphate dehydrogenase of Escherichia coli K-12 and its possible role in pyridoxal 5'-phosphate biosynthesis." J Bacteriol 177 (10): 2804-12.

133. Zhao, J. J., C. Chen, et al. (2009). "Cloning, identification, and characterization of the rpoS-like sigma factor rpoX from Vibrio alginolyticus ." J Biomed Biotechnol 2009 : 126986.

143 134. Zimmerman, A. M., A. DePaola, et al. (2007). "Variability of total and pathogenic Vibrio parahaemolyticus densities in northern Gulf of Mexico water and oysters." Appl Environ Microbiol 73 (23): 7589-96.

135. Zuckerkandl, E. and L. Pauling (1965). Evolutionary divergence and convergence in proteins. Evolving Genes and Proteins. V. Bryson and H. J. Vogel. New York, Academic Press.

144 Appendix A

ACKNOWLEDGEMENT OF PREVIOUSLY PUBLISHED CHAPTERS

Results and text in Chapter 3 previously published by American Society for Microbiology as Alternative sigma factor RpoE is important for Vibrio parahaemolyticus cell envelope stress response and intestinal colonization. Copyright © American Society for Microbiology, Infection and Immunity, 2014 Sep;82(9):3667-77. doi: 10.1128/IAI.01854-14

145 Appendix B

ANIMAL WORK APPROVAL

146

147

148

149

150 Appendix C

VP0055 STRESS ANALYSIS

Percent Viable Cells Viable Percent Percent Viable Cells Viable Percent

VP0055 stress analysis under various conditions. The vp0055 mutant was assayed for its stress response phenotype under a variety of conditions using survival assays. The survival assays were performed following the same methods outlined in Chapter 3. Here we show that under all conditions examined the vp0055 mutant survives at similar levels to wild-type. This data demonstrates that VP0055 is not involved in V. parahaemolyticus stress response for the conditions examined.

151