DOCSLIB.ORG

The Bax Inhibitor-1 Gene Is Differentially Regulated in Adult Testis and Developing Lung by Two Alternative TATA-Less Promoters Jyh Chang Jean, Sean M

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
The Bax Inhibitor-1 Gene Is Differentially Regulated in Adult Testis and Developing Lung by Two Alternative TATA-Less Promoters Jyh Chang Jean, Sean M Genomics 57, 201–208 (1999) Article ID geno.1999.5761, available online at http://www.idealibrary.com on The Bax Inhibitor-1 Gene Is Differentially Regulated in Adult Testis and Developing Lung by Two Alternative TATA-less Promoters Jyh Chang Jean, Sean M. Oakes, and Martin Joyce-Brady1 The Pulmonary Center, Boston University School of Medicine, Boston, Massachusetts 02118 Received October 9, 1998; accepted January 20, 1999 INTRODUCTION We identified Bax inhibitor-1, BI-1, as a developmen- tally regulated gene product in perinatal lung using A dramatic reorganization occurs as the lung is trans- suppressive subtractive hybridization. BI-1 is a novel formed from a organ of secretion to one of gas exchange suppressor of apoptosis that was previously cloned as near the end of gestation. The developmental program testis-enhanced gene transcript (TEGT). However, se- that orchestrates this process is initiated in the fetus quence analysis of lung BI-1 revealed unique nucleo- and, in most mammals, extends into the postnatal tides starting 29 bases upstream of the ATG initiation period. While the structural and cellular features of this codon and extending to the 5* end of lung-derived BI-1 transition have been well described, the genes involved cDNA compared to the original transcript from the remain poorly defined. Hence we used suppression sub- testis. Cloning and sequencing of the upstream region tractive hybridization (Diatchenko et al., 1996) to iden- of the BI-1 gene revealed that these unique sequences tify developmentally regulated genes in the perinatal originated from two alternative first exons, located in lung and found the testis-enhanced gene transcript, tandem and separated by ;600 bases. Neither was pre- TEGT, to be up-regulated in the perinatal period. The ceded by a TATA box in the usual position, and S1 function of this gene was unknown, until recently, nuclease mapping at each exon 1 revealed multiple when it was shown to be identical with a newly defined transcription start points with a major site being over- mammalian suppressor of apoptosis termed Bax inhib- lapped by a consensus initiator element. Promoter ac- itor-1, BI-1 (Xu and Reed, 1998). Recent studies have tivity from each region was documented by transient also shown that a period of intense cellular apoptosis transfection analysis in vitro using DNA sequences occurs in the perinatal lung, particularly in mesenchy- ligated to a reporter gene. The proximal promoter, P1, mal cells (Kresch et al., 1998). We noted that lung BI-1 may exhibit cell type-specific differences in fibroblasts cDNA differed from the TEGT sequence in the litera- versus epithelia, whereas the distal promoter, P2, may ture and decided to characterize the rat BI-1 gene exhibit species-specific differences in rat versus hu- further. Herein we identify two tandem BI-1 promot- man cells. RT-PCR analysis for expression in adult * * ers, P1 and P2, map their respective transcription start tissues using exon 1-specific 5 primers and common 3 points, and demonstrate their differential activity in primers revealed that P1 is tissue-specific; P2 is ubiq- 2 1 vitro. Both appear to be TATA Inr promoters, but the uitously active. The developmental regulation of BI-1 proximal one, P1, has tissue-specific activity in vivo. in the late fetal and early postnatal lung is specific for The distal promoter, P2, is active in a ubiquitous fash- P2, indicating that these two TATA-less promoters are ion but developmentally regulated in the lung during differentially regulated in adult testis and developing the perinatal period. We speculate that this gene may lung. Since Bax inhibitor-1 functions as a suppressor of apoptosis, its expression could provide a survival play a key role in lung cell survival at birth. advantage for select cell populations during the peak period of apoptosis that occurs at birth. © 1999 Academic MATERIALS AND METHODS Press Materials and probes. Tri-Reagent (Molecular Research Center, Inc., Cincinnati, OH) and QIAamp Tissue Kit (Qiagen, Germany) were used according to the manufacturer’s protocol to isolate total RNA and genomic DNA, respectively. Electrophoresis-grade agarose was from International Biotechnologies, Inc. (New Haven, CT), and Sequence data from this article have been deposited with the DNA standards were from BRL. X-OMAT film for radiography was EMBL/GenBank Data Libraries under Accession No. AF118564. from The Eastman Kodak Co. (Rochester, NY). [a-32P]CTP, 800 Ci/ 1 To whom correspondence should be addressed at The Pulmonary mmol, was from ICN (Irvine, CA). The pGL3-basic vector and pGL3- Center, Boston University School of Medicine, 715 Albany Street, promoter vector were obtained from Promega (Madison, WI). Plas- R304, Boston, MA 02118-2394. Telephone: (617) 638-4860. Fax: (617) mid constructs were prepared, and the b-galactosidase assay was 536-8093. E-mail: [email protected]. performed as previously described (Joyce-Brady et al., 1996). The 201 0888-7543/99 $30.00 Copyright © 1999 by Academic Press All rights of reproduction in any form reserved. 202 JEAN, OAKES, AND JOYCE-BRADY substrate buffer for the luciferase assay was obtained from Boeh- nary Center at Boston University School of Medicine, and 20-3 cells ringer Mannheim. The PCR primers for b-actin are exactly as de- were an equally generous gift of Dr. Roy Levine at Cornell Veteri- scribed in Joyce-Brady et al. (1994). These were used to monitor nary School (Ithaca, NY). All cells were maintained with MEM mRNA integrity during PCR and to generate an actin cDNA probe to supplemented with 10% FCS. Transfection was performed by elec- do the same for Northern experiments. Primer synthesis and nucle- troporation using subconfluent cells. These were suspended at 2–6 3 otide sequencing were performed at the DNA–Protein Core facility of 106 cells/ml in serum-free RPMI medium with 10 mM dextrose and Boston University School of Medicine. 0.1 mM dithiothreitol, combined with 15 mg of plasmid DNA (13 mg BI-1-luciferase, 2 mg of CMV-b-galactosidase) in a 400-ml volume in Isolation and characterization of rat lung BI-1 clones. The sup- a 0.4-cm gene pulser cuvette (Bio-Rad) and exposed to a single- pression subtractive hybridization analysis of prenatal and perinatal voltage pulse at 300 V, 960 mF at room temperature using a Bio-Rad lung will be described in detail elsewhere. Briefly, this was carried Gene pulser transfection apparatus (Graham and Van Der Eb, 1973). out exactly as described by Diatchenko et al. (1996). We used 1 The cells were incubated for 10 min at 23°C before being plated and poly(A) mRNA from 1.5-day-old lung as the tester and 20-day fetal were then harvested and assayed for reporter gene activity 40–48 h lung as the driver. PCR products were cloned into the TA vector later. Each transfection experiment was repeated at least three (InVitrogen, San Diego, CA), sequenced, and analyzed using the times. In all transfection experiments the promoterless-luciferase BLASTN program at the National Center for Biotechnology Infor- construct, pGL3-Basic, was examined as a negative control, and the mation (Altschul et al., 1990). We identified three independent clones SV40 promoter-luciferase construct, pGL3-SV40, was examined as of rat BI-1. the positive control. The luciferase assay was performed according to 59 RACE and genomic cloning. The 59 end of our lung-derived the manufacturer’s guidelines. Cotransfection with a CMV-b-galac- BI-1 transcript was cloned by 59 RACE using the Marathon cDNA tosidase construct was used to correct for transfection efficiency. This Amplification Kit according to the manufacturer’s instructions (Clon- assay was performed as described in Joyce-Brady et al. (1996). 1 tech, Palo Alto, CA). Poly(A) RNA was isolated from the lung, RNA analysis. The Northern blot method is described in detail in reverse transcribed, and amplified in a primary PCR with adaptor Oakes et al. (1997). Briefly, total RNA was isolated from various primer 1 (AP-1) and BI-1 primer BI-2, CAGGGCAGAGAGCAGGC- tissues, quantitated, electrophoresed on a 1.0% agarose gel, trans- CAGCCTG, followed by a secondary reaction with AP1 and BI-6, ferred to a HyBond membrane, and cross-linked with a Stratagene GCTGCTGTGTGGAGGGAGTTATGTGG, and the products were UV cross-linker. The membrane was prehybridized, incubated with cloned and sequenced. Upstream BI-1 genomic DNA was amplified [a-32P]CTP radiolabeled probe, washed, and dried. Absolute counts in two sequential PCRs with BI-5, GAGGGCATCAAAGTTGATCT- were measured on a Packard Instrument Image Analyzer (Downer’s 9 TCCG, as the 3 primer in each reaction and BI-12, CAGAGCA- Grove, IL), and then the filter was exposed to Kodak X-OMAT film. CATCCGGTTTTAGCCG, and BI-10, GCGGGGAAGCTCCGAAGA- The absolute counts were used to determine relative levels of mRNA 9 GGTGGGC, as the 5 primers for primary and secondary PCR, re- expression. The RT-PCR is described in detail in Joyce-Brady et al. spectively, followed by cloning and sequencing. Additional upstream (1994). PCR primers were selected for each PCR, which was per- genomic DNA was amplified by using the GenomeWalker Kit accord- formed for 30 cycles on a MJ Research thermal cycler. PCR products ing to the manufacturer’s directions (Clontech) with adaptor prim- were isolated by agarose gel electrophoresis, eluted, cloned, and er-1 (AP-1) and BI-1 primer BI-13, CGGAGCAGACTTTGGGGCT- sequenced. The primers for P1-derived BI-1 cDNA were AGGT- CACC, in the primary PCR and adaptor primer-2 (AP-2) and BI-16, GAGAAGCCCCGAGCTTGGCC and GCTGCTGTGTGGAGGGAGT- ACCTCGGCCTCTACCGTTGGCTTC, in the secondary PCR. A sec- TATGTGG for the 59 and 39 ends, respectively. The primers for P2 ond genomic walk was performed using AP-1 and BI-20, ACT- were TCCGAAGAGGTGGGCTAAGAAGCG and CAGGGCAGAGA- GAAATCACAAGTACAGAATG, and then AP-2 and BI-19, CA- GCAGGCCAGCCTG.
Load more

Recommended publications
  • Classification of Cell Death
    Cell Death and Differentiation (2005) 12, 1463–1467 & 2005 Nature Publishing Group All rights reserved 1350-9047/05 $30.00 www.nature.com/cdd News and Commentary Classification of cell death: recommendations of the Nomenclature Committee on Cell Death G Kroemer*,1, WS El-Deiry2, P Golstein3, ME Peter4, D Vaux5, with or without, caspase activation and that ‘autophagic cell P Vandenabeele6, B Zhivotovsky7, MV Blagosklonny8, death’ represents a type of cell death with (but not necessarily W Malorni9, RA Knight10, M Piacentini11, S Nagata12 and through) autophagic vacuolization. This article details the G Melino10,13 2005 recommendations of NCCD. Over time, molecular definitions are expected to emerge for those forms of cell 1 CNRS-UMR8125, Institut Gustave Roussy, 39 rue Camille-Desmoulins, death that remain descriptive. F-94805 Villejuif, France 2 University of Pennsylvania School of Medicine, Philadelphia, PA 19104, USA Preface 3 Centre d’Immunologie INSERM/CNRS/Universite de la Mediterranee de Marseille-Luminy, Case 906, Avenue de Luminy, 13288 Marseille Cedex 9, It is obvious that clear definitions of objects that are only France shadows in Plato’s cage are difficult to be achieved. Cell death 4 The Ben May Institute for Cancer Research, University of Chicago, 924 E 57th and the different subroutines leading to cell death do not Street, Chicago, IL 60637, USA 5 escape this rule. Even worse, the notion of death is strongly Sir William Dunn School of Pathology, University of Oxford, Oxford OX1 3RE, influenced by religious and cultural beliefs, which may UK 6 Molecular Signalling and Cell Death Unit, Department for Molecular Biomedical subliminally influence the scientific view of cell death.
    [Show full text]
  • The Biochemistry of Cell Death Cell Death: Apoptosis and Other Means to an End, Second Edition by Douglas R
    Zampieri et al. Cell Death and Disease (2020) 11:259 https://doi.org/10.1038/s41419-020-2465-5 Cell Death & Disease BOOK REVIEW Open Access The biochemistry of cell death Cell Death: Apoptosis and Other Means to an End, Second Edition by Douglas R. Green, St. Jude Children’s Research Hospital, Cold Spring Harbor Laboratory Press, New York, 2018 Carlotta Zampieri 1, Carlo Ganini 1 and Gerry Melino 1 Can we impress you with a mind-blowing revelation? Douglas Green is one of the worldwide leading experts “Cells are not eternal in our bodies, but rather they on apoptosis and cell death. He has dealt with the role of encounter death!”1. cell death in the regulation of cancer and immune If someone pronounces this sentence at a biology class, response, studying the molecular events that drive the students will laugh. Why? Because cell death has been process, focusing on the induction-activation of apoptosis studied since the 60s of the last century. When we speak in T cells and the role of Myc, death receptors and Bcl-2 about apoptosis nowadays, we regard it as a well-known in this context. His deep understanding of the field truth. Anyway, this truth did not catch the attention of allowed him to write the first edition of this book in a scientists until the 1980s, where the interest in the field clear and straightforward manner, enriched by extremely exploded, leading to a dramatic increase of publications. informative figures. His talent as a biologist, as well as a Cell death passed “from neglect to hysteria” in only a few communicator, has been condensed in this second edi- years, citing Martin Raff2, one of the founders of the field.
    [Show full text]
  • Dual Effects of Thyroid Hormone on Neurons and Neurogenesis
    Lin et al. Cell Death and Disease (2020) 11:671 https://doi.org/10.1038/s41419-020-02836-9 Cell Death & Disease ARTICLE Open Access Dual effects of thyroid hormone on neurons and neurogenesis in traumatic brain injury Chao Lin1,2, Nan Li3, Hanxiao Chang1,2,Yuqishen1,2,ZhengLi1,2,Wuwei1,2,HuaChen1,2,HuaLu1,2,JingJi 1,2 and Ning Liu1,2 Abstract Thyroid hormone (TH) plays a crucial role in neurodevelopment, but its function and specific mechanisms remain unclear after traumatic brain injury (TBI). Here we found that treatment with triiodothyronine (T3) ameliorated the progression of neurological deficits in mice subjected to TBI. The data showed that T3 reduced neural death and promoted the elimination of damaged mitochondria via mitophagy. However, T3 did not prevent TBI-induced cell death in phosphatase and tensin homolog (PTEN)-induced putative kinase 1 (Pink1) knockout mice suggesting the involvement of mitophagy. Moreover, we also found that T3 promoted neurogenesis via crosstalk between mature neurons and neural stem cells (NSCs) after TBI. In neuron cultures undergoing oxygen and glucose deprivation (OGD), conditioned neuron culture medium collected after T3 treatment enhanced the in vitro differentiation of NSCs into mature neurons, a process in which mitophagy was required. Taken together, these data suggested that T3 treatment could provide a therapeutic approach for TBI by preventing neuronal death via mitophagy and promoting neurogenesis via neuron–NSC crosstalk. 1234567890():,; 1234567890():,; 1234567890():,; 1234567890():,; Introduction treatments focus only on preventing complications or Traumatic brain injury (TBI) is considered to be a providing support in nature. leading cause of substantial mortality and long-term dis- Thyroid hormone (TH) is crucial for neural stem cell ability among young adults worldwide1.
    [Show full text]
  • Estimation of Postmortem Interval Based on Cell Death Progression in Biological Fluids
    Estimation of Postmortem Interval Based on Cell Death Progression in Biological Fluids Author: Mónica Cristina Francisco Tomé Dissertation submitted to the Faculty of Medicine of University of Porto for the Master degree in Forensic Sciences Supervisor: Prof. Doutor Agostinho Almiro de Almeida (Faculty of Pharmacy, University of Porto) Co-supervisors: Prof. Doutor Agostinho José Carvalho dos Santos (Faculty of Medicine, University of Porto) Doutora Daniela Sofia Almeida Ribeiro (Faculty of Pharmacy, University of Porto) Porto, September 2017 Acknowledgments My special acknowledgments to: My supervisor Professor Agostinho Almeida that accepted to work with me and provided me the indispensable help to finish my master degree. My co-supervisor Professor Agostinho Santos, without him I would not be doing my dissertation, he opened my eyes and I am glad that he did. My co-supervisor Doctor Daniela Ribeiro that welcomed me with open arms and was always with me. Doctor Rui Almeida who is a very professional person and who was always ready to help me in whatever it takes! To Professor Eduarda Fernandes who was always present during the development of this study and was always trying to find solutions to the problems. To all of my friends, especially to Cátia Pereira, Margarida Pereira, Miguel Pinto and Sofia Salsinha, that provided me the emotional strength to continue to fight and get my motivation. To my parents and brother, that always listened to me and gave me the emotional support while I was far away from home. I have to thank also to all of those who were present during this period of my life and never let me give up.
    [Show full text]
  • The Dynamic Tumor Ecosystem: How Cell Turnover and Trade-Offs Affect Cancer Evolution
    bioRxiv preprint doi: https://doi.org/10.1101/270900; this version posted February 26, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. The dynamic tumor ecosystem: how cell turnover and trade-offs affect cancer evolution Jill A. Gallaher1, Joel Brown1*, and Alexander R. A. Anderson1* 1 Department of Integrated Mathematical Oncology, H. Lee Moffitt Cancer Center, Tampa, FL USA *These authors contributed equally. ABSTRACT Tumors are not static masses of cells but rather dynamic ecosystems where cancer cells experience constant turnover and evolve fitness-enhancing phenotypes. Selection for different phenotypes may vary with 1) the tumor niche (edge or core), 2) cell turnover rates, 3) the nature of the tradeoff between traits (proliferation vs migration), and 4) whether deaths occur in response to demographic or environmental stochasticity. In an agent based, spatially-explicit model, we observe how two traits (proliferation rate and migration speed) evolve under different trade-off conditions with different turnover rates. Migration rate is favored over proliferation at the tumor’s edge and vice-versa for the interior. Increasing cell turnover rates only slightly slows the growth of the tumor, but accelerates the rate of evolution for both proliferation and migration. The absence of a tradeoff favors ever higher values for proliferation and migration. A convex tradeoff tends to favor proliferation over migration while often promoting the coexistence of a generalist and specialist phenotype.
    [Show full text]
  • Scientific Justification of Cryonics Practice
    REJUVENATION RESEARCH Volume 11, Number 2, 2008 http://www.ncbi.nlm.nih.gov/pubmed/18321197 http://www.liebertonline.com/doi/abs/10.1089/rej.2008.0661 Scientific Justification of Cryonics Practice Benjamin P. Best* ABSTRACT Very low temperatures create conditions that can preserve tissue for centuries, possibly including the neurological basis of the human mind. Through a process called vitrification, brain tissue can be cooled to cryogenic temperatures without ice formation. Damage associated with this process is theoretically reversible in the same sense that rejuvenation is theoretically possible by specific foreseeable technology. Injury to the brain due to stopped blood flow is now known to result from a complex series of processes that take much longer to run to completion than the six minute limit of ordinary resuscitation technology. Reperfusion beyond the six minute limit primarily damages blood vessels rather than brain tissue. Apoptosis of neurons takes many hours. This creates a window of opportunity between legal death and irretrievable loss of life for human and animal subjects to be cryopreserved with possibility of future resuscitation. Under ideal conditions, the time interval between onset of clinical death and beginning of cryonics procedures can be reduced to less than a minute, but much longer delays could also be compatible with ultimate survival. Although the evidence that cryonics may work is indirect, indirect evidence is essential in many areas of science. If complex changes due to aging are reversible at some future date, then similarly complex changes due to stopped blood flow and cryopreservation may also be reversible, with life-saving results for anyone with medical needs that exceed current capabilities.
    [Show full text]
  • The Effect of Laughter on Stress and Natural Killer Cell Activity
    Nurul Husniyah binti Che Soh et al /J. Pharm. Sci. & Res. Vol. 12(12), 2020, 1496-1498 The Effect of Laughter on Stress and Natural Killer Cell Activity Nurul Husniyah binti Che Soh Graduate Student, Department of Physiology,Saveetha Dental College and Hospital, Saveetha Institute of Medical and Technical Sciences, Chennai, India. Dr. Jothipriya Assistant professor, Department Physiology, Saveetha Dental College, Saveetha Institute of Medical and Technical Sciences, Chennai. Abstract Aim: To find out the effect of laughter on stress and natural killer cell activity. Background and reason: Stress is a well-known slow killer, is rampant in our society, which impact everyone differently, but the final results are easy to observe and explain. Laughter triggers the release of a cocktail of happy chemicals, including NK cells, endorphins, serotonin, and growth hormone that are produced each time we laugh that boosts the immune responses. Laughter stimulates circulation and helps muscle relaxation which is releasing stress. Effect of laughter on stress and natural killer cells are to be reviewed as laughter significantly can reduce stress as well as improve the natural killer cells activity. Thorough literature research performed with present inclusion and exclusion criteria. Keywords: stress, natural killer cells, endorphins, apoptosis, enzymes INTRODUCTION Cousins. In a study, a group of heart attack patients were Laughter is the best way to reduce stress in people live, separated into two smaller groups; the first group was and can aid us to deal and survive a stressful lifestyle. situated under standard medical care whereas the second Since 20 years ago, it is frequently documented by group watched humorous video for about 30 minutes per psycho-neuro-immunological (PNI) research related to day.
    [Show full text]
  • Inside Front.Qxp
    Prevention of Immune Cell Apoptosis as Potential Therapeutic Strategy for Severe Infections Janie Parrino,* Richard S. Hotchkiss,† and Mike Bray* Some labile cell types whose numbers are normally or all severe infections that could be targets for pharmaco- controlled through programmed cell death are subject to logic intervention. Such generic therapies could supple- markedly increased destruction during some severe infec- ment agent-specific treatment by increasing resistance to tions. Lymphocytes, in particular, undergo massive and infection, potentially improving outcomes for patients in a apparently unregulated apoptosis in human patients and variety of disease states. laboratory animals with sepsis, potentially playing a major role in the severe immunosuppression that characterizes One physiologic process that characterizes some the terminal phase of fatal illness. Extensive lymphocyte severe infections is a massive loss of lymphocytes, den- apoptosis has also occurred in humans and animals infect- dritic cells, gastrointestial epithelial cells, and other cell ed with several exotic agents, including Bacillus anthracis, types through apoptosis, or programmed cell death. This the cause of anthrax; Yersinia pestis, the cause of plague; process is an apparent acceleration or dysregulation of the and Ebola virus. Prevention of lymphocyte apoptosis, same process by which these cell populations are regulat- through either genetic modification of the host or treatment ed during normal health (1,2). By impairing the develop- with specific inhibitors, markedly improves survival in ment of adaptive immune responses needed for recovery, murine sepsis models. These findings suggest that inter- the apoptotic destruction of lymphocytes and dendritic ventions aimed at reducing the extent of immune cell apop- tosis could improve outcomes for a variety of severe cells could have a particularly adverse effect on disease human infections, including those caused by emerging outcome.
    [Show full text]
  • Epidermal Development, Growth Control, and Homeostasis in the Face of Centrosome Amplification
    Epidermal development, growth control, and PNAS PLUS homeostasis in the face of centrosome amplification Anita Kulukiana, Andrew J. Hollandb,1, Benjamin Vitrec,1, Shruti Naika, Don W. Clevelandd, and Elaine Fuchsa,e,2 aRobin Chemers Neustein Laboratory of Mammalian Cell Biology and Development, The Rockefeller University, New York, NY 10065; bDepartment of Molecular Biology and Genetics, Johns Hopkins University School of Medicine, Baltimore, MD 21205; cCNRS UMR-5237, Centre de Recherche en Biochimie Macromoleculaire, University of Montpellier, Montpellier 34093, France; dLudwig Institute for Cancer Research and Department of Cellular and Molecular Medicine, University of California at San Diego, La Jolla, CA 92093; and eHoward Hughes Medical Institute, The Rockefeller University, New York, NY 10065 Contributed by Elaine Fuchs, September 29, 2015 (sent for review July 2, 2015) As nucleators of the mitotic spindle and primary cilium, centrosomes with mitotic-origin aneuploidy in human embryos, suggestive of a play crucial roles in equal segregation of DNA content to daughter possible link among PLK4, aneuploidy, and pregnancy loss (6). cells, coordination of growth and differentiation, and transduction of Centrosome amplification, or the condition of having more than homeostatic cues. Whereas the majority of mammalian cells carry no acell’s customary pair of such structures, has garnered attention more than two centrosomes per cell, exceptions to this rule apply in for more than a century (11). Given the enhanced apoptosis re- certain specialized tissues and in select disease states, including sulting from centrosome amplification in the brain, it is intriguing cancer. Centrosome amplification, or the condition of having more that centrosome amplification was originally noted for its presence than two centrosomes per cell, has been suggested to contribute to in cancer cells (9).
    [Show full text]
  • Biomass Burning in the Amazon Region Causes DNA Damage and Cell Death in Human Lung Cells
    www.nature.com/scientificreports OPEN Biomass burning in the Amazon region causes DNA damage and cell death in human lung cells Received: 28 April 2017 Nilmara de Oliveira Alves1, Alexandre Teixeira Vessoni2,3, Annabel Quinet2,4, Rodrigo Soares Accepted: 11 August 2017 Fortunato 5, Gustavo Satoru Kajitani2, Milena Simões Peixoto6, Sandra de Souza Hacon7, Published: xx xx xxxx Paulo Artaxo8, Paulo Saldiva1, Carlos Frederico Martins Menck2 & Silvia Regina Batistuzzo de Medeiros9 Most of the studies on air pollution focus on emissions from fossil fuel burning in urban centers. However, approximately half of the world's population is exposed to air pollution caused by biomass burning emissions. In the Brazilian Amazon population, over 10 million people are directly exposed to high levels of pollutants resulting from deforestation and agricultural fres. This work is the frst study to present an integrated view of the efects of inhalable particles present in emissions of biomass burning. Exposing human lung cells to particulate matter smaller than 10 µm (PM10), signifcantly increased the level of reactive oxygen species (ROS), infammatory cytokines, autophagy, and DNA damage. Continued PM10 exposure activated apoptosis and necrosis. Interestingly, retene, a polycyclic aromatic hydrocarbon present in PM10, is a potential compound for the efects of PM10, causing DNA damage and cell death. The PM10 concentrations observed during Amazon biomass burning were sufcient to induce severe adverse efects in human lung cells. Our study provides new data that will help elucidate the mechanism of PM10-mediated lung cancer development. In addition, the results of this study support the establishment of new guidelines for human health protection in regions strongly impacted by biomass burning.
    [Show full text]
  • Burn Injury: Mechanisms of Keratinocyte Cell Death
    medical sciences Review Burn Injury: Mechanisms of Keratinocyte Cell Death Hans-Oliver Rennekampff 1,* and Ziyad Alharbi 2 1 Department of Plastic Surgery, Hand and Burn Surgery, Burn Center, Rhein Maas Klinikum, 52146 Wuerselen, Germany 2 Plastic Surgery and Burn Unit, Fakeeh Care & Fakeeh College of Medical Sciences, P.O. Box 2537, Jeddah 21461, Saudi Arabia; [email protected] * Correspondence: [email protected] Abstract: Cutaneous burn injury is associated with epidermal loss in the zone of coagulation zone and delayed tissue loss in the zone of stasis. Thus, thermal stress can trigger both necrosis and regulated cell death (RCD) or apoptosis. Experimental in vitro and in vivo work has clearly demonstrated apoptotic events of thermally injured keratinocytes that are accompanied by morphological and biochemical markers of regulated cell death. However, in vivo data for the different pathways of regulated cell death are sparse. In vitro experiments with heat-stressed human keratinocytes have demonstrated death receptor involvement (extrinsic apoptosis), calcium influx, and disruption of mitochondrial membrane potential (intrinsic apoptosis) in regulated cell death. In addition, caspase- independent pathways have been suggested in regulated cell death. Keratinocyte heat stress leads to reduced proliferation, possibly as a result of reduced keratinocyte adhesion (anoikis) or oncogene involvement. Understanding the underlying mechanisms of RCD and the skin’s responses to thermal stress may lead to improved strategies for treating cutaneous burn trauma. Keywords: burn; wound; keratinocyte; apoptosis; cell death; review Citation: Rennekampff, H.-O.; Alharbi, Z. Burn Injury: Mechanisms of Keratinocyte Cell Death. Med. Sci. 1. Introduction 2021, 9, 51. https://doi.org/ 10.3390/medsci9030051 Cutaneous burn injury is associated with epidermal loss that necessitates skin grafting in deep partial and full-thickness burns.
    [Show full text]
  • (12) United States Patent (10) Patent No.: US 6,921,633 B2 Baust Et Al
    USOO6921633B2 (12) United States Patent (10) Patent No.: US 6,921,633 B2 Baust et al. (45) Date of Patent: Jul. 26, 2005 (54) METHODS AND COMPOSITIONS FOR THE Evan & Littlewood, “A Matter of Life and Cell Death', PRESERVATION OF CELLS, TISSUES OR Science (1998) V. 281 p. 1317-22. ORGANS IN THE WITREOUS STATE Kerr, et al., “Apoptosis: Its Significance in Cancer and Cancer Therapy”, Cancer (1994) V. 73 p. 2013–26. (75) Inventors: John M. Baust, Candor, NY (US); Lane et al., “Addition of AScorbate During Cryopreservation John G. Baust, Candor, NY (US); Stimulates Subsequent Embryo Development” Human Robert VanBuskirk, Apalachian, NY Reproduction, vol. 17, No. 10, pp. 2686–2693, Oct. 2002. (US); Aby J. Mathew, Binghamton, DeBiasi et al., “Calpain Inhibition Protects Against Virus NY (US) Induced Apopotic Mycocardial Injury’ 2001, J. Virol. 351-361, 75. (73) Assignee: Biolife Solutions Incorporated, Pahernik et al., “Hypothermic Storage of Pig Hepatocytes: Binghamton, NY (US) Influence of Different Storage Solutions and Cell Density', 1996, Cryobiology 33: 552-566. (*) Notice: Subject to any disclaimer, the term of this Fisher et al., “Cold-Cryopreservation of Dog Liver and patent is extended or adjusted under 35 Kidney Slices” 1996, Cryobiology 33: 163–171. U.S.C. 154(b) by 0 days. Rodriguez et al., “Protective Effect of Glutathione (GSH) Over Glutathione Monoethyl-Ester (GSH-E) on Cold Pres (21) Appl. No.: 10/298,497 ervation of Ioslated Rat Liver Cells' 1995, Cell Transplant. 4: 245-251. (22) Filed: Nov. 18, 2002 Levi et al., “Cold Storage of Peripheral Nerves: An In Vitro (65) Prior Publication Data Assay of Cell Viability and Function' 1994, Glia 10:121-131.
    [Show full text]