Effects of Chronic Oxidative Stress on TRPM2 and TRPC3 Channels: Potential Implications for Bipolar Disorder

Angela Selina Roedding

A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy Pharmacology and Toxicology Department University of Toronto

Effects of Chronic Oxidative Stress on TRPM2 and TRPC3

Channels: Potential Implications for Bipolar Disorder

Angela Selina Roedding

Doctor of Philosophy

Department of Pharmacology and Toxicology University of Toronto

2013 Abstract

Intracellular calcium and oxidative stress dyshomeostasis, which can be highly interactive, occur in bipolar disorder (BD), but the pathogenesis of these disturbances is unknown. The transient receptor potential (TRP) melastatin subtype 2 (TRPM2) and canonical subtype 3

(TRPC3) calcium-permeable non-selective ion channels, already implicated in BD, are involved in calcium and oxidative stress signalling. Thus, I sought to determine whether the expression and function of these channels are modulated by oxidative stress exposure in rat cortical neurons, astrocytes, and in human B lymphoblast cell lines (BLCLs), a cell model that reports diagnostically relevant abnormalities in BD.

This thesis work demonstrated that TRPC3 expression and function are decreased after chronic, but not acute oxidative stress exposure in both human and rat cell models. TRPM2 expression, on the other hand, was increased after both acute and chronic stressor treatments in rat cortical neurons. In BLCLs, TRPM2-mediated calcium entry was blunted although no ii

difference in TRPM2 mRNA expression was detected. Moreover, BLCLs from BD-I patients exhibited greater susceptibility to cell death and a differential sensitivity of

TRPM2-mediated calcium influx to acute oxidative stress compared with healthy subjects, further supporting reduced cellular resilience in the pathophysiology of BD-I. I also demonstrated that TRPC3 protein is expressed in human brain from 8 days to 83 years old supporting an ongoing role in the developing and adult human brain.

These findings support an important role for TRPM2 and TRPC3 in sensing and responding to oxidative stress, and in transducing oxidative stress signalling to intracellular calcium homeostatic and cellular stress responses, which have been implicated in the pathophysiology of BD. Finally, this work has highlighted an inherent difference in TRPM2 channel functionality in BD type I subjects compared with controls, adding functional evidence to the genetic and differential expression findings implicating TRPM2 dysfunction in BD.

iii

Acknowledgments

The completion of my PhD program would not have been possible without the help and support of numerous people. First and foremost, Dr. Jerry Warsh, I would like to express my utmost gratitude for all of the guidance and instruction you have given me throughout my training. You gave me the opportunity to develop and hone my skills as a scientist under your excellent tutelage. Your mentorship and confidence in my ability enabled me to successfully tackle grant writing, project management, scientific writing, and mentorship of several excellent undergraduate project students. Dr. Peter Li was also instrumental in my training and advised me on elements of study design, acting as a valuable sounding board.

I was also fortunate to work with a wonderful group of talented staff and students in the lab. Many thanks to Marty Green for sharing her RT-PCR expertise and her general resourcefulness around the lab; and to Clarissa Pasiliao for all of her help with the neuronal cell cultures and her companionship during the dissection process. I would also like to thank all of the undergraduate project students that helped in the execution of my project, Andrew Gao, Alex Wu, Wynne Au-Yeung, Tiffany Scarcelli, and Lydia Zhou, for their hard work and friendship. I really enjoyed sharing with you my enthusiasm for science and you taught me about how rewarding working as a team can be. I also really enjoyed working alongside Michael Tseng, Takuji Uemura, Steven Tong and Dharshini Ganeshan.

Finally, the support of my family and friends has been vital to the successful completion of my research program. The strength and support of my loving husband, Landon Roedding, has allowed me to pursue my interests and given me the strength to continue after the birth of our beautiful daughter. I would also like to thank my wonderful little girl, Grace June Roedding, for her angelic temperament that enabled me to continue and complete my thesis writing after her arrival. The love and support of my families, both Harrison and Roedding, has given me the confidence (and child care) I needed to reach my goals. I am truly lucky to have such a wonderful group of people in my life.

Table of Contents

Acknowledgments ...... iv

Table of Contents ...... v

List of Tables...... ix

List of Figures ...... x

List of Appendices ...... xii

List of Abbreviations...... xiii

1 Introduction ...... 1

1.1 Bipolar Disorder ...... 2

1.2 Evidence of altered cellular resilience in the neuropathology of bipolar disorder ...... 4

1.3 Oxidative stress and mitochondrial dysfunction in bipolar disorder ...... 10

1.4 Calcium signalling disturbances in bipolar disorder ...... 17

1.5 Transient receptor potential channels...... 19

1.5.1 TRPC channels ...... 22

1.5.2 TRPM channels ...... 27

1.5.3 TRP channels and oxidative stress ...... 33

1.6 Cellular models used for the study of bipolar disorder pathophysiology ...... 36

1.7 Hypotheses and objectives ...... 38

2 TRPC3 Protein is Expressed Across the Lifespan in Human Prefrontal Cortex and Cerebellum ...... 41

2.1 Abstract ...... 42

2.2 Introduction ...... 42

2.3 Methods ...... 44

2.3.1 Subjects ...... 44 v

2.3.2 Preparation of brain samples ...... 44

2.3.3 SDS-PAGE and Western blotting...... 44

2.3.4 Statistics ...... 45

2.4 Results ...... 46

2.4.1 Subject demographics ...... 46

2.4.2 TRPC3 immunodetection specificity and quantification ...... 48

2.4.3 TRPC3 expression in human prefrontal cortex and cerebellum ...... 48

2.5 Discussion ...... 52

3 Chronic Oxidative Stress Modulates TRPC3 and TRPM2 Channel Expression and Function in Rat Primary Cortical Neurons: Relevance to the Pathophysiology of Bipolar Disorder ...... 54

3.1 Abstract ...... 55

3.2 Introduction ...... 56

3.3 Methods ...... 58

3.3.1 Preparation of rat cortical neuron cultures ...... 58

3.3.2 Preparation of rat cortical astrocyte cultures ...... 59

3.3.3 RT-PCR detection of TRPC1, TRPC3, TRPM2, HO-1 transcripts ...... 60

3.3.4 Western immunoblotting ...... 60

3.3.5 Viability assays ...... 61

3.3.6 Determination of TRPC3-mediated intracellular calcium flux ...... 62

3.3.7 Statistics ...... 63

3.4 Results ...... 64

3.4.1 Stressor effects on cell viability and ROS levels ...... 64

3.4.2 Changes in TRPM2/TRPC3 channel expression after acute and chronic rotenone treatment in rat cortical neurons ...... 66 vi

3.4.3 Chronic rotenone treatment also reduces activator-stimulated TRPC3 channel gating ...... 68

3.4.4 Paraquat treatment causes similar alterations in TRPM2/TRPC3 expression ...... 71

3.4.5 TRPC3 channel expression is not modulated by ROS levels in rat cortical astrocytes ...... 73

3.5 Discussion ...... 74

3.6 Acknowledgements ...... 81

4 Effect of Oxidative Stress on TRPM2 and TRPC3 Channels in B Lymphoblast Cells in Bipolar Disorder ...... 82

4.1 Abstract ...... 83

4.2 Introduction ...... 84

4.3 Methods ...... 86

4.3.1 Preparation of B Lymphoblast cultures...... 86

4.3.2 Determination of cell viability using propidium iodide ...... 87

4.3.3 Measurement of intracellular Ca2+ levels ...... 87

4.3.4 RT-PCR detection of TRPC3, TRPM2 and HO-1 transcripts ...... 88

4.3.5 Western blotting ...... 89

4.3.6 Statistics ...... 90

4.4 Results ...... 90

4.4.1 Subject demographics ...... 90

4.4.2 Effects of rotenone on cell viability and ROS levels ...... 92

4.4.3 Changes in TRPM2/TRPC3 channel expression after acute and chronic rotenone treatment of BLCLs ...... 95

4.4.4 Functional impact of oxidative stress on TRPC3/TRPM2 channels ...... 97

4.5 Discussion ...... 101 vii

4.5.1 Acknowledgements ...... 106

5 Conclusions and Future Work ...... 107

5.1 Summary of results ...... 108

5.2 What are the possible mechanisms underlying ROS effects on TRPC3/TRPM2 channels? ...... 110

5.3 Limitations ...... 114

5.3.1 Statistical ...... 114

5.3.2 Research Design ...... 115

5.3.3 Definition of acute and chronic stress treatment ...... 116

5.4 Future Work ...... 117

5.4.1 Examine the mechanism of ROS effects on TRPM2/TRPC3 ...... 117

5.4.2 Investigate elevated levels of cell death in BD cells versus controls ...... 120

5.4.3 Investigate TRPM2 functional difference and expression changes ...... 121

5.5 Significance: Unveiling the role of TRPC3/TRPM2 in the pathophysiology of BD ...... 123

5.5.1 TRPC3 channels are present throughout the lifespan ...... 123

5.5.2 Are decreases in TRPC3 neuroprotective or detrimental to cells? ...... 123

5.5.3 TRPM2 channel responsivity is altered in BD ...... 126

5.5.4 Support for decreased cellular resilience in BD ...... 126

5.5.5 Hypothetical model that links TRPC3, TRPM2, ROS and BD ...... 127

6 References ...... 131

7 Appendices ...... 168

viii

List of Tables

Table 2-1 Subject Demographics ...... 47

Table 3-1 Summary of TRPC3 and TRPM2 expression levels after oxidative stressor

treatment...... 78

Table 4-1 Demographic characteristics of bipolar I disorder patients and comparison

subjects ...... 91

Table 5-1 Summary of findings showing direction of change in TRPC3 and TRPM2 mRNA

and protein levels after oxidative stressor treatment...... 109

List of Figures

Figure 1-1 ROS sources and biochemical properties ...... 12

Figure 1-2 Calcium signalling: dynamics, homeostasis and remodeling ...... 16

Figure 1-3 Phylogenetic tree of the TRP superfamily ...... 20

Figure 1-4 Canonical TRP protein family based on amino acid sequence ...... 23

Figure 1-5 Transmembrane topology of the TRP channel ...... 24

Figure 1-6 Melastatin TRP protein family based on amino acid sequence...... 27

Figure 1-7 TRPM2 protein structure, transmembrane topology, and surface representation ...... 29

Figure 1-8 TRPC3 and TRPM2 channels integrate Ca2+ dynamics and oxidative stress

signalling ...... 40

Figure 2-1 Linearity of TRPC3 immunoreactive signal intensity with respect to protein

concentration in FCX and CBM...... 50

Figure 2-2 TRPC3 protein levels in human prefrontal cortex and cerebellum across age...... 51

Figure 3-1 Effects of rotenone and paraquat exposure on HO-1 expression, cell viability and

morphology of rat cortical neurons ...... 65

Figure 3-2 Rotenone-induced alterations in TRPC3/TRPM2 mRNA and protein expression ..... 67

Figure 3-3 Inhibition of OAG-induced calcium flux by Pyr3...... 69

Figure 3-4 Chronic rotenone treatment reduces OAG-induced calcium responses in primary

rat cortical neurons ...... 70

Figure 3-5 Paraquat-induced alterations in TRPC3/TRPM2 mRNA and protein expression ...... 72

Figure 3-6 Acute and chronic rotenone treatment does not induce changes in TRPC3 protein

expression in rat astroglial cells ...... 74 x

2+ Figure 4-1 TRPM2 inhibitors significantly decreased H2O2-mediated Ca entry ...... 88

Figure 4-2 Oxidative stress increases HO-1 mRNA levels, differentially affects viability in

BLCLs from BD-I subjects versus healthy controls, and decreases TRPC3

protein levels with chronic exposure...... 93

Figure 4-3 No significant difference in TRPM2 mRNA expression was noted in BLCLs...... 96

Figure 4-4 Chronic oxidative stress treatment decreases TRPC3 channel responsivity...... 98

Figure 4-5 TRPM2-dependent Ca2+ fluxes are reduced in bipolar I disorder (BD-I) patient

cell lines in comparison to healthy controls...... 100

Figure 5-2 Interplay between ROS, Ca2+ and TRP channels ...... 129

Figure 7-1 Chemical structures of rotenone and paraquat ...... 168

List of Appendices

7.1 Mechanisms of action for rotenone and paraquat ...... 168

7.2 Tables containing data from figure 3-1 ...... 169

Table 7.2.1 HO-1 mRNA levels (2ΔΔCt) after 1 day rotenone treatment in rat cortical

neurons ...... 169

Table 7.2.2 HO-1 mRNA levels (2ΔΔCt) after 4 day rotenone treatment in rat cortical

neurons ...... 170

Table 7.2.3 HO-1 mRNA levels (2ΔΔCt) after 1 day paraquat treatment in rat cortical

neurons ...... 170

Table 7.2.4 HO-1 mRNA levels (2ΔΔCt) after 4 day paraquat treatment in rat cortical

neurons ...... 171

Table 7.2.5 Viability of rat cortical neurons after 1-4 days of rotenone treatment ...... 171

Table 7.2.6 Viability of rat cortical neurons after 1-4 days of paraquat treatment ...... 173

7.3 Tables containing data from figure 4-1 ...... 173

Table 7.3.1 HO-1 mRNA levels (fold-change) after 1 day rotenone treatment in BLCLs . 173

Table 7.3.2 HO-1 mRNA levels (fold-change) after 4 day rotenone treatment in BLCLs . 174

Table 7.3.3 Viability of BLCLs after 1 day of rotenone treatment ...... 174

Table 7.3.4 Viability of BLCLs after 4 days of rotenone treatment ...... 174

xii

List of Abbreviations

Adenosine diphosphate ADP Adenosine diphosphate ribose ADPR Adenosine monophosphate AMP Activator protein-1 AP-1 Adenosine-5'-triphosphate ATP Area under the curve AUC Bcl-2 associated anthogene BAG-1 Bicinchoninic acid BCA B cell lymphoma 2 BCL-2 Bipolar disorder BD Brain-derived neurotrophic factor BDNF B lymphoblast cell lines BLCL Calcium Ca2+ Calmodulin CaM Calmodulin-dependent protein kinase CaMK Cerebellum CBM Central nervous system CNS cAMP response element CRE cAMP response element binding protein CREB Cysteine CYS Day in vitro DIV Deoxyribonucleic acid DNA 5,5'-dithio-bis-(2-nitrobenzoic acid) DTNB Endoplasmic reticulum ER Frontal cortex FCX Glyceraldehyde 3-phosphate dehydrogenase GAPDH G-protein coupled receptor GPCR

Hydrogen peroxide H2O2 Hank's buffered saline solution HBSS Heme oxygenase 1 HO-1

Inositol-1,4,5-triphosphate receptor IP3R Kilodalton kDa Lactate dehydrogenase LDH Lysophosphatidic acid LPA Major depressive disorder MDD Methionine MET Messenger ribonucleic acid mRNA 3-(4,5-dimethylthiazol-2-yl)-2,5- MTT diphenyltetrazolium bromide xiii

Myeloid zinc finger 1 MZF-1 N-acetyl aspartate NAA Nicotinamide adenine dinucleotide NAD+ Sodium/calcium exchanger NCX Nuclear factor of activated T-cells NFAT Nuclear factor-kappa B NF-ΚB N-methyl-D-aspartate NMDA Nitric oxide NO 1-oleoyl-2-acetyl-sn-glycerol OAG Polyadenosine diphosphate ribose PARP polymerase Propidium iodide PI Phospholipase C PLC Plasma-membrane calcium ATPase PMCA Polyvinylidene difluoride PVDF Pyrazole-3 Pyr3 Receptor-operated calcium entry ROCE Regions of interest ROI Reactive oxygen species ROS Ryanodine receptor RYR Sarco(endo)plasmic reticulum SERCA calcium ATPase Single nucleotide polymorphism SNP Specificity protein 1 SP-1 Store-operated calcium entry SOCE Superoxide dismutase SOD Stromal interacting protein-1 STIM-1 Transmembrane TM Transient receptor potential TRP Transient receptor potential-ankyrin TRPA Transient receptor potential-canonical TRPC Transient receptor potential-melastatin TRPM Long variant, TRPM2 TRPM2-L Short variant, TRPM2 TRPM2-S Transient receptor potential-mucolipin TRPML Transient receptor potential-polycystin TRPP Transient receptor potential-vanillin TRPV

xiv 1

1 Introduction

1.1 Bipolar Disorder

Bipolar disorder (BD) comprises a cluster of chronic, recurrent mood disorders characterized by cycling episodes of mania or hypomania, and depression (First 1994). Two of the major subtypes of BD are BD-I and BD-II. According to the current clinical standards used for diagnosis, the

Diagnostic and Statistical Manual of Mental Disorders Version IV (DSM-IV) (First 1994), BD-I is defined by at least one episode of mania, while BD-II patients experience at least one period of hypomania (less severe mood elevation than mania and without psychosis) and an episode of depression. The modal age of onset for BD is between 15-25 years old (Goodwin et al. 1990).

Several axis I psychiatric disorders commonly accompany BD such as substance abuse and anxiety disorders (panic disorder, obsessive compulsive disorder) and eating disorders, as well as medical illnesses including diabetes, hypertension, and obesity that may complicate diagnosis and/or treatment of the disorder (Kilbourne et al. 2004; Krishnan 2005; Kupfer 2005; Kemp et al.

2010). Moreover, disruptions in circadian rhythms, cognition, and executive function are experienced by individuals with BD (Soreca et al. 2009). However, the causal relationships among comorbid disorders are unknown; that is whether the illness itself predisposes patients to the associated comorbidities and/or whether they are secondary to the effects of medications used (Krishnan 2005). Some comorbidities, such as panic disorder and cognitive impairment show familial transmission and are suggested to be subphenoptypes or endophenotypes of BD, respectively (MacKinnon et al. 2003; Christensen et al. 2006; Szöke et al. 2006; Antila et al.

2007; Fagiolini et al. 2007; Daban et al. 2012).

BD is considered one of the world’s ten most disabling conditions, as determined by the “Global

Burden of Disease” study carried out by the World Health Organization (reviewed by Lopez et al. 1998) and is associated with functional decline and significant health care costs (Kilbourne et

3 al. 2004). As BD is a chronic illness with relatively lower mortality rates in the short term in comparison to serious nonpsychiatric illnesses; afflicted individuals can live many years with the disability and the associated costs of treatment mounts. In fact, treatment and lost productivity cost more than $24 billion US dollars a year (Kleinman et al. 2003). Furthermore, family members living with BD patients report increased health care spending of roughly three times that of controls, as reported by a Blue Cross Blue Shield Program in the US, likely due to the emotional, financial and social stresses incurred (Gianfrancesco et al. 2005). A study that sampled eleven different countries reported a life-time prevalence of approximately 2.4% for the combined BD I and II subtypes across all populations with no predilection for race or economic status (Kupfer 2005; Merikangas et al. 2011). However, it has been suggested that with the use of broader classifications, the life-time prevalence would increase to as much as 5%

(Baldessarini et al. 2003). In addition, markedly elevated suicide rates are characteristic of BD

(Angst et al. 2002) with an approximate increased risk of 15 times that of the general population

(Harris et al. 1997). Considering the devastating effects this illness has on afflicted individuals and their families, as well as the large economic burden imposed on the health care system, it is critical to continue advancing our knowledge of the pathophysiology of BD and the development of novel therapeutics.

1.2 Evidence of altered cellular resilience in the neuropathology of bipolar disorder

The current concept of the aetiology of BD is that it involves a major contribution from inherited vulnerability traits that predispose individuals to develop mood disorders in response to environmental factor(s) and/or stressor(s) (Manji et al. 2003; Charney et al. 2004). Cellular and molecular studies have illuminated the key role of signal transduction disturbances in the pathophysiology of BD that may represent evidence of this vulnerability (Hudson et al. 1993; Li et al. 1993; Jope et al. 1996; Warsh et al. 1996; Mathews et al. 1997; Warsh et al. 1999; Li et al.

2000; Manji et al. 2000; Manji et al. 2001; Warsh et al. 2004; Schloesser et al. 2007). Alterations in signalling cascades are likely elements of a larger picture of subtle, but nonetheless critical changes in the homeostatic balance of intracellular signalling networks that impair cellular function and/or resilience. Due to the complex interconnectivity of signalling systems necessary to multiplex and modulate physiological target responses in spatially and temporally confined domains (Berridge 1997; Babcock et al. 1998; Hill 1998; Hardingham et al. 1999; Berridge et al.

2000; Brini 2003), it is not surprising that alterations are evident in multiple signalling cascades in BD. While some changes may be more fundamental to the initiation of the pathophysiological process(es) in BD, others may be adaptations to sustain normal physiological function, but which may fail under the strain of stressors over time. Furthermore, a growing body of evidence implicates the effects of psychosocial stress exposure in the cellular remodelling observed in this illness (Phillips et al. 2008; McEwen et al. 2011). A better understanding of effects of stress on cellular signalling pathways is important to unravelling the pathogenesis of BD. This study investigates the impact of cellular stress on elements of calcium (Ca2+) signalling pathways and cellular resilience, two important systems implicated in the pathophysiology of BD (Manji et al.

2000; Warsh et al. 2004).

The relationship between psychosocial stress, and induction and course of BD and major depressive disorder (MDD) on the one hand, and the triggering by stressful life events of the elevation of stress hormones (i.e. hypercortisolemia) on the other, are well recognized (reviewed in Muller et al. 2002). It has been reported that episodes of depression, experienced in MDD and

BD, are preceded by stressful life events at higher rates than in controls (reviewed in Paykel

2003; Johnson 2005), possibly due to the inability of the compromised cellular mechanisms to maintain homeostasis in the face of stressor insults. The “kindling hypothesis” suggests that initial affective episodes in unipolar and bipolar depression are precipitated by stressful or negative life events inducing downstream pathological stress response mechanisms in susceptible individuals leading to further progression of the illness phenotype: subsequent episodes may be induced by less stressful events or may occur even in the absence of further stressful triggers

(Post 1992; Kendler et al. 2001; Horesh et al. 2010). Furthermore, chronic stress, also referred to as an increase in “allostatic load”, has been implicated in the pathogenesis of mood and other chronic anxiety disorders (reviewed in McEwen 2004). Chronic restraint stress, psychosocial stress and administration of the stress-hormone corticosterone have all been shown to alter the morphology of rat hippocampus CA3 pyramidal and amygdalar neurons, and these changes were prevented by chronic lithium treatment (Wood et al. 2004; Johnson et al. 2009). Exposure to stressors such as repeated restraint stress in rats, and psychologically induced stress in humans, for example, examination stress in university students, results in increases in lipid peroxidation

(a measure of oxidative damage), increased superoxide production and decreased antioxidant enzyme activity in rat hippocampus, prefrontal cortex, whole rat brain and human blood plasma, respectively (Sivonova et al. 2004; Fontella et al. 2005; Dhir et al. 2006; Lucca et al. 2009).

Although preliminary, these findings link psychosocial stress with reactive oxygen species

(ROS) formation and subsequent oxidative damage. Thus, it is pertinent that the effects of stress

6 on cellular function are investigated further to advance our understanding of the pathophysiology of BD and other illnesses linked to stress effects.

The notion that compromised cellular resilience, or the ability of the cell to adapt and respond to cellular insults or stressors, is a key component in the pathophysiology of BD stems from complementary evidence from morphometric studies and neurochemical investigations in postmortem brain, molecular studies of mood stabilizer action, from cell biology studies in surrogate cell model systems from BD patients, and from in vivo neuroimaging research (reviewed by

Hunsberger et al. 2009). The most salient findings from this body of research are considered in the following background sections.

Morphometric and Neurochemical Investigations:

Observations of reduced total brain volume (Frey et al. 2008) and altered number, size and/or density of neurons and glial cells in prefrontal, anterior cingulate, entorhinal and hippocampal cortices in BD brain (Drevets et al. 1997; Ongur et al. 1998; Vawter et al. 2000; Rajkowska et al.

2001; Rajkowska 2002; Pantazopoulos et al. 2007; Bora et al. 2010; Konradi et al. 2010) could imply irregularities in BD of the mechanisms that maintain cellular integrity and resilience

(Manji et al. 2000; Schloesser et al. 2007). Alterations in density and/or number of cells in distinct brain regions may lead to the disease manifestations of improper mood regulation, and impaired cognition (Drevets et al. 2008; Phillips et al. 2008). For example, the selective loss of hippocampal interneurons expressing somatostatin and parvalbumin in BD described by Konradi et al. may result in hippocampal disinhibition leading to altered neuronal network synchronization and new memory formation (Konradi et al. 2010). Furthermore, glial cells play an important role in energy homeostasis in the central nervous system (CNS) as well as development, maintenance and remodelling of synapses (Frey et al. 2004). Thus, a reduction of

7 glial cell density may lead to a decrease in the number of functional synaptic connections and altered circuitry in BD brain (Frey et al. 2004). N-acetyl aspartate, which is primarily localized to neurons and is involved in neuronal development and myelination, has been used as a putative marker to assess neuronal viability and function in vivo (Tsai et al. 1995). Reduced levels of

NAA were detected in the hippocampal and prefrontal cortex regions in BD patients compared with healthy controls (Bertolino et al. 2003). Together, these findings suggest the importance of some form of cellular injury, regional neuronal loss and aberrations in neuronal/glial viability and/or function with consequent impairment of cellular resilience and plasticity in the pathophysiology of BD.

Interestingly, in vivo chronic stress paradigms or glucocorticoid treatment in animals reveal morphometric changes in the brain that are similar to some of those observed in BD. Chronic restraint stress or corticosterone treatment in rat results in decreased hippocampal dendritic arborisation, spine density and neurogenesis (Woolley et al. 1990; Watanabe et al. 1992; Alonso et al. 2003; Pham et al. 2003). Furthermore, reductions in dendritic arborisation and spine density in the medial prefrontal cortex of rats treated chronically with corticosterone or restraint stress have also been shown (Wellman 2001; Radley et al. 2004; Radley et al. 2006; Radley et al. 2008;

Liston et al. 2011). Even chronic exposure to mild stress, such as daily injections of vehicle, resulted in changes in the dendritic structure of the medial prefrontal cortex (Seib et al. 2003;

Brown et al. 2005). In humans, individuals with Cushing’s disease, an illness characterized by hypercortisolemia, have decreased hippocampal volumes which are moderately reversed upon treatment (Starkman et al. 1992; Starkman et al. 1999). Other evidence demonstrating stress- related decreases in hippocampal, prefrontal cortical and/or orbitofrontal cortical volumes were reported in human subjects with no psychiatric or neurological disorders over a span of three

8 months in healthy postmenopausal women with greater perceived stress across a twenty year period (Gianaros et al. 2007; Papagni et al. 2011). These studies highlight the potential interaction between stress effects and the mechanisms of cellular resilience underlying neurological changes observed in BD.

Molecular Studies of Mood Stabilizer Action:

The effect of mood stabilizers on multiple signalling pathways involved in neuroprotection further supports the importance of cellular resilience and plasticity to the pathophysiology and pharmacotherapy of BD (reviewed in Schloesser et al. 2007). Lithium and valproate act on two key transcription factors involved in neuroprotective responses, activator protein-1 (AP-1) and cAMP response element (CRE) binding protein (CREB). Lithium treatment, at therapeutically relevant concentrations, increased AP-1 and CRE DNA binding activity in rat cerebellar granule cells, rat C6 glioma cells, rat brain, and SH-SY5Y cells (Ozaki et al. 1997; Yuan et al. 1998;

Miller et al. 2007). Valproate increased c-fos and c-jun levels, and AP-1 DNA binding activity in rat C6 glioma and SH-SY5Y cells (Asghari et al. 1998; Chen et al. 1999). Interestingly, downstream of CREB, chronic treatment with lithium and valproate upregulates levels of brain- derived neurotrophic factor (BDNF) (Fukumoto et al. 2001; Yuan et al. 2001; Hammonds et al.

2009), a neurotrophin that is essential to the growth and survival of neurons, synaptic plasticity, and cellular resilience (Duman 2002; Chuang 2005). Neuroprotective effects of lithium and valproate may also be attributed to their ability to increase expression of B cell lymphoma 2

(Bcl-2), a major anti-apoptotic and neuroprotective protein, in neuronal preparations and rat hippocampus (Chen et al. 1999; Yuan et al. 2001; Corson et al. 2004; Schloesser et al. 2007;

Hammonds et al. 2009). It has been shown that Bcl-2 protects neurons from oxidative stressors, glucocorticoids and growth factor deprivation likely through its antioxidant effects, mitochondrial stabilization and endoplasmic reticulum (ER) Ca2+ regulation (Hockenbery et al.

1993; Murphy et al. 1996; He et al. 1997; Adams et al. 1998). In addition, Bcl-2-associated athanogene (BAG-1) is upregulated by chronic lithium and valproate in rat hippocampus, has anti-apoptotic properties, and inhibits glucocorticoid receptor translocation and transcriptional activity (Takayama et al. 1995; Zhou et al. 2005). Both mood stabilizers may also protect against glutamate-induced excitotoxicity through inhibition of N-methyl-D-aspartate (NMDA) receptor- mediated Ca2+ entry in cultured neurons (Nonaka et al. 1998; Hashimoto et al. 2003; Kanai et al.

2004).

These effects of mood stabilizers on the molecular components of cellular resilience machinery support the notion that treatment with these agents in individuals with BD may result in a reversal of the observed morphological changes in the brain of these subjects. Indeed, several studies that have examined the effects of lithium and/or valproate on grey matter volume and neurogenesis have revealed significant changes after chronic mood stabilizer treatment (reviewed in Schloesser et al. 2007). Significant increases in total brain grey matter in BD subjects has been observed after chronic lithium treatment (Moore et al. 2000; Sassi et al. 2002; Moore et al.

2009). Moore et al. also observed an increase in prefrontal cortex grey matter in lithium responders, those that showed a >50% decrease in Hamilton Depression Score ratings, versus non-responders after four weeks of lithium treatment (Moore et al. 2009). Furthermore, evidence that lithium and valproate enhance cell proliferation in vitro in rat cortical neuron cultures and in vivo in rat hippocampus also suggests that mood stabilizers act as agents of cellular renewal

(Chen et al. 2000; Hashimoto et al. 2003; Son et al. 2003; Hao et al. 2004; Wexler et al. 2007).

As mentioned above, chronic lithium treatment has also been shown to prevent corticosterone- induced morphology changes in rat hippocampal dendrites (Wood et al. 2004). These findings

10 suggest that mood stabilizers may exert their therapeutic effects by bolstering cellular resilience and/or neurogenesis in brain regions that are susceptible to injury in the BD brain.

1.3 Oxidative stress and mitochondrial dysfunction in bipolar disorder

The characteristic physiology and biochemistry of the brain make it particularly susceptible to injury by ROS, by-products generated through mitochondrial oxidative respiration as well as nicotinamide adenine dinucleotide phosphate (NADPH) and xanthine oxidases. Several factors contribute to the vulnerability of the brain to ROS including its high energy demand and rate of oxygen consumption, the limited availability of antioxidant mechanisms, the abundance of redox metals such as iron and copper, and the high lipid content (Floyd 1999; Valko et al. 2007). Non- enzymatic formation of the superoxide anion occurs at both complex I and III in the respiratory chain and by reacting with nitric oxide produces peroxynitrate (ONOO-), a powerful oxidant and nitrating agent (see Figure 1-1) (Carreras et al. 2004; D'Autreaux et al. 2007). While ROS subserve useful physiological roles at moderate levels, an overproduction of these molecules leads to cellular injury in the form of protein, lipid and DNA damage (Cochrane 1991). The deleterious effects of ROS have received considerable attention to date in regards to the pathophysiology of several neurodegenerative disorders (reviewed in Sayre et al. 2005; Valko et al. 2007), however only recently has ROS come to be scrutinized in relation to the pathogenesis of BD (reviewed in Andreazza et al. 2008; Kato 2008; Shao et al. 2008; Berk et al. 2011).

Findings of oxidative damage in post-mortem brain of BD subjects supports the hypothesis that

ROS is contributing to the pathology of BD. Wang et al. demonstrated an increase of 59% in the levels of 4-hydroxynonenal, a product of lipid peroxidation, in the anterior cingulate of BD in comparison to healthy controls (Wang et al. 2009). In addition, heightened levels of oxidative

11 protein damage in the form of carbonylation and tyrosine nitration has been noted in the prefrontal cortex of individuals with BD compared with controls (Andreazza et al. 2010). These findings of elevated levels of oxidative damage in post-mortem BD brain agree with recent data demonstrating that the expression levels of some of the main antioxidant defences of the brain, either glutathione, glutathione peroxidase and/or superoxide dismutase, are reduced in the prefrontal cortex (Sun et al. 2006; Gawryluk et al. 2011) and hippocampus (Benes et al. 2005) of

BD subjects. Indirect measures of ROS activity in BD have also been conducted through the quantification of antioxidant enzyme activity and/or expression. Increased superoxide dismutase and catalase activity (Kuloglu et al. 2002; Savas et al. 2006), and higher levels of the lipid peroxidation product, malondialdehyde, have been detected in serum and plasma of BD patients compared with controls (Kuloglu et al. 2002). In fact, a meta-analysis of numerous studies examining peripheral markers of oxidative stress in BD demonstrated that the level of thiobarbituric acidic reactive substances and nitric oxide activity were significantly elevated in

BD subjects whereas superoxide dismutase, catalase and glutathione peroxidise levels were unchanged in comparison to controls (Andreazza et al. 2008). Moreover, Kapczinski et al. even suggest that measurements of ROS damage peripherally, such as lipid peroxidation and protein carbonylation, as well as the levels of specific neurotrophins and cytokines can be used as biomarkers in the assessment of illness activity in BD (Kapczinski et al. 2011). While the specific basis for disturbances in the redox status of individuals with BD is still uncertain, recent neuroimaging (Kato et al. 1998; Kato et al. 2000; Stork et al. 2005), post-mortem brain (Kato et al. 1997; Konradi et al. 2004; Iwamoto et al. 2005) and gene expression (Kato et al. 1997; Karry et al. 2004; Benes et al. 2005; Iwamoto et al. 2005; Sun et al. 2006) studies suggest that mitochondrial energetics may, in fact, be altered in brain in BD.

Figure 1-1 ROS sources and biochemical properties

Reproduced with permission: (D'Autreaux et al. 2007)

Mitochondria play critical roles in the maintenance of intracellular Ca2+ homeostasis and signalling dynamics (Babcock et al. 1998; Carafoli et al. 2001; Bianchi et al. 2004) in addition to their crucial role in oxidative phosphorylation, supplying most of the energy requirements for the cell (see Figure 1-2 Berridge et al. 2003). Recent studies have linked mitochondrial function with neurotransmitter release and neuronal plasticity (reviewed in Mattson 2007). Thus, abnormalities in mitochondrial function would be detrimental to the cell and could lead to alterations in cellular resilience as well as intracellular Ca2+ signalling, as observed in BD (see below). That said, the

13 interconnectivity of Ca2+ signalling systems with mitochondrial function and regulation and dependence of mitochondrial oxidative phosphorylation rates on cytosolic Ca2+ levels (Gellerich et al. 2012) suggest that disturbed intracellular Ca2+ homeostasis may predicate mitochondrial dysfunction in the pathogenesis of BD.

As mentioned above, levels of NAA, a neurochemical synthesized in the mitochondria of mature neurons, are decreased in several brain regions of BD subjects in comparison to controls, suggesting that BD brains manifest metabolic dysfunction and/or decreased neuronal resilience

(Winsberg et al. 2000; Cecil et al. 2002; Bertolino et al. 2003; Chang et al. 2003; Deicken et al.

2003; Yildiz-Yesiloglu et al. 2006; Reynolds et al. 2011). Kato and colleagues studied mitochondrial energetics and DNA in relation to BD pathophysiology after they noted some parallels in mitochondrial disorders and BD (reviewed in Kato et al. 2000). Studies using in vivo phosphorus-31 magnetic resonance spectroscopy revealed decreased levels of phosphocreatine and/or ATP in BD patients with respect to controls (Deicken et al. 1995; Kato et al. 1995; Frey et al. 2007) as well as reduced brain intracellular pH (Kato et al. 1998; Hamakawa et al. 2004).

Furthermore, mitochondrial DNA deletion mutations have been shown to occur more frequently in BD subjects in comparison to controls [eg. 3644C: BD, 1.43%; controls, 0.14%; p=0.007

(Munakata et al. 2004), and 5178C/10398A haplotype: 33.6% in bipolar, 16.8% in control, p<0.001 (Kato et al. 2001)] and that these polymorphisms are likely to impact ROS and Ca2+ regulation of this organelle (reviewed by Kato 2008). Genetic variation in nuclear encoded mitochondrial gene encoding complex I protein, NDUFV2, has also been associated with BD and schizophrenia (Washizuka et al. 2003; Washizuka et al. 2006; Xu et al. 2008). Examination of NDUFV2 expression and polymorphisms in lymphoblastoid cell lines from a Japanese population demonstrated both decreased mRNA expression in BD-I subjects compared with

14 controls, as well as significant diagnostic differences in haplotype frequencies using four polymorphisms from the promoter region (Washizuka et al. 2003). In a replication study conducted in a Caucasian population, the significant association between the NDUFV2 promoter region (single nucleotide polymorphism, rs1156044) and BD-I was confirmed (Xu et al. 2008).

However, no differences in mRNA expression were observed, no association between the associated polymorphisms and intracellular Ca2+ concentration was detected, and the risk- associated genotype differed between studies (A vs G) (Xu et al. 2008). Further examination of

NDUFV2, along with NDUFV1 and NDUFS1 expression in post-mortem brain has also identified alterations in BD as well as schizophrenia. The protein levels of both NDUFV1 and 2 were significantly increased in the ventral parieto-occipital cortices of BD subjects in comparison to healthy controls (Karry et al. 2004). In contrast, a decrease in NDUFV1 and

NDUFS1 protein expression was observed in the cerebellum of BD subjects (Ben-Shachar et al.

2008). Additional gene expression profiling studies conducted on a large scale have demonstrated significant down-regulation of nuclear encoded mRNA expression for mitochondrial proteins in post-mortem BD brain in comparison to controls (Konradi et al. 2004;

Iwamoto et al. 2005; Sun et al. 2006). Finally, the morphology and distribution of mitochondria is altered in both brain and peripheral cells of BD patients (Cataldo et al. 2010). In post-mortem prefrontal cortex, the mitochondria were found to be smaller in BD than in the healthy control group; while in antemortem fibroblasts and lymphocytes, mitochondria formed “dense or bulky networks” that clustered around the nucleus rather than the “highly organised and interconnected network” and even intracellular distribution observed in the control group (Cataldo et al. 2010).

Taken together, these findings from disparate measures all suggest that mitochondrial dysfunction may be involved in the pathophysiology of BD. It is unknown whether mitochondrial abnormalities are inherited vulnerability traits, medication effects, adaptations to

15 compensate for altered homeostasis or triggered downstream of causative pathology (Carlson

2006). Nonetheless, it is important to investigate and understand the effects that mitochondrial irregularities have on intracellular signalling pathways, such as Ca2+ and redox signalling, which have also been linked with BD.

Given these findings implicating mitochondrial dysfunction in BD, it is not surprising that results of several recent studies suggest that mood stabilizers may normalize the disturbances at the mitochondrial level. For example, chronic treatment with therapeutically relevant concentrations of lithium and valproate has been shown to enhance mitochondrial potential, increase oxidation, prevent cytochrome c release, and increase the mitochondrial Bcl-2/Bax ratio in rat prefrontal cortex when challenged with methamphetamine exposure (Bachmann et al. 2009). Also, chronic treatment of neuronal models with these mood stabilizers prevented rotenone, hydrogen peroxide

(H2O2), and -bungarotoxin-induced cytotoxicity and/or caspase activation (Tseng et al. 2003;

King et al. 2005; Lai et al. 2006). It has also been shown that valproate exerts a neuroprotective effect against FeCl3-induced oxidative stress in primary rat cortical neurons (Wang et al. 2003).

Thus, stabilization of mitochondrial function by mood stabilizers may also contribute to their neuroprotective action. Taken together, these findings suggest that the ability of mood stabilizers to attenuate deficits in neuroplasticity and cellular resilience may be critical cellular and biological effects that account for their efficacy in BD (Bachmann et al. 2005).

Figure 1-2 Calcium signalling: dynamics, homeostasis and remodeling During the 'on' reactions, stimuli induce both the entry of external Ca2+ and the formation of second messengers that release internal Ca2+ that is stored within the endoplasmic/sarcoplasmic reticulum (ER/SR). Most of this Ca2+ (shown as circles) is bound to buffers, whereas a small proportion binds to the effectors that activate various cellular processes that operate over a wide temporal spectrum. During the 'off' reactions, Ca2+ leaves the effectors and buffers and is removed from the cell by various exchangers and pumps. The Na+/ Ca2+ exchanger (NCX) and the plasma-membrane Ca2+-ATPase (PMCA) extrude Ca2+ to the outside, whereas the sarco(endo)plasmic reticulum Ca2+-ATPase (SERCA) pumps Ca2+ back into the ER. Mitochondria also have an active function during the recovery process in that they sequester Ca2+ rapidly through a uniporter, and this is then released more slowly back into the cytosol to be dealt with by the SERCA and the PMCA. Cell survival is dependent on Ca2+ homeostasis, whereby the Ca2+ fluxes during the off reactions exactly match those during the on reactions. 2+ 2+ [Ca ], Ca concentration; Ins(1,4,5)P3R, inositol-1,4,5-trisphosphate receptor; RYR, ryanodine receptor. Reproduced with permission: (Berridge et al. 2003)

1.4 Calcium signalling disturbances in bipolar disorder

Calcium is a ubiquitous intracellular second messenger which plays key roles in numerous cellular processes such as neuroprotection, plasticity, apoptosis, necrosis, gene expression, neurotransmitter release, growth and differentiation (Berridge et al. 2000; Mattson et al. 2000;

Carafoli 2002; Berridge et al. 2003). The notion that Ca2+ dynamics may be altered in BD

(reviewed in Warsh et al. 2004) received substantial support with numerous reports of significantly higher basal and agonist-stimulated intracellular Ca2+ concentrations in platelets and/or lymphocytes from untreated manic and depressed BD patients compared with controls

(Dubovsky et al. 1989; Tan et al. 1990; Dubovsky et al. 1991; Dubovsky et al. 1992; Berk et al.

1995; Emamghoreishi et al. 1997). That these abnormalities might be trait dependant (Dubovsky et al. 1994) was substantiated by studies from our group (Emamghoreishi et al. 1997; Yoon et al.

2001; Yoon et al. 2001; Wasserman 2003; Wasserman et al. 2003a; Perova et al. 2008) and those of others (Kato et al. 2003; Iwamoto et al. 2004) showing altered indices of intracellular Ca2+ homeostasis in B lymphoblast cell lines (BLCLs) from BD patients. It has been shown that mood stabilizing medications used in the treatment of BD modify components of Ca2+-linked signal transduction pathways such as G-proteins, protein kinase C isozymes, and phosphoinositide turnover (Chen et al. 1999; Gould et al. 2002; Coyle et al. 2003). In this respect, findings that chronic lithium treatment normalizes disrupted intracellular Ca2+ homeostasis and agonist- induced responses in BD peripheral cell models (Suzuki et al. 2004; Wasserman et al. 2004;

Perova et al. 2009) are particularly noteworthy.

The specific pathophysiological mechanisms which account for the Ca2+ homeostatic abnormalities identified in BD are poorly understood but may involve disturbances in one or more of the toolkits (Berridge et al. 2003) that regulate intracellular Ca2+ homeostasis and Ca2+

18 signalling (Bowden et al. 1988; Meltzer et al. 1988; Brown et al. 1993; Cherry et al. 1994; Kato et al. 2000; Soares et al. 2001). More recent findings have implicated disturbances of receptor- operated Ca2+ entry (ROCE) (Wasserman et al. 2004), and store-operated Ca2+ entry (SOCE)

(Hough et al. 1999; Kato et al. 2003), as well as endoplasmic reticulum (ER) (Kakiuchi et al.

2003; So et al. 2007) and mitochondrial function, as noted above, in BD. It is possible that functional irregularities in one or more of the Ca2+ channels and accessory proteins that mediate

ROCE and/or SOCE responses lead to the observed alterations in cellular Ca2+ regulation. In fact, several different Ca2+ channels have been implicated in BD including the voltage-gated, L- type Ca2+ channel, alpha 1C subunit encoded by the CACNA1C gene (Ferreira et al. 2008;

Perrier et al. 2011), the purinergic receptor ligand-gated ion channel subtype 7 (P2RX7,

McQuillin et al. 2008), and members of the transient receptor potential (TRP) channels (TRPC3 and TRPM2) examined in this work (see below for details).

1.5 Transient receptor potential channels

Advances in understanding of the mechanisms of ROCE into cells, have brought to the forefront the key role of members of the TRP protein family in intracellular Ca2+ dynamics and homeostasis. Several excellent reviews have been written regarding the physiology, regulation and structure of this large channel family (Montell et al. 2002; Clapham 2003; Putney 2003;

Groschner et al. 2004; Moran et al. 2004; Vazquez et al. 2004; Nilius et al. 2005; Parekh et al.

2005; Venkatachalam et al. 2007). It consists of several subtypes including canonical (TRPC), vanilloid (TRPV), melastatin (TRPM), and the more distantly related polycystin (TRPP), ankyrin

(TRPA), NO-mechano-potential (NOMP, TRPN) and mucolipin (TRPML) subgroups (see

Figure 1-3). Within these subgroups, homo- and heteromeric tetramers combine to generate functional channels (Schaefer 2005). Building evidence indicates that these channels are spatially localized to cellular microdomains and operate in functional complexes or “signalplexes” (Li et al. 2000) with other TRP channel subtypes, Na+/Ca2+ exchangers (Rosker et al. 2004), and accessory modulating proteins (Ambudkar et al. 2006; Kiselyov et al. 2007) to form a variety of toolkits that handle signal processing through modulation of Ca2+ dynamics. These

“signalplexes” also provide the structural means to constrain and fine-tune Ca2+ dynamics in functional microdomains in which Ca2+ signalling concentrations reach levels that would otherwise be toxic (Berridge et al. 2003). The versatility of TRP channels in terms of signal integration and transduction implicates their involvement as cellular sensors responsible for mediating responses to a variety of physical, chemical, and environmental cues as well as intracellular metabolic stimuli and stresses (Clapham 2003; Voets et al. 2005; Miller 2006;

Takahashi et al. 2011). It is now known that a number of the TRP channel subtypes are

20 expressed in the peripheral nervous system as well as the brain (Moran et al. 2004; Fonfria et al.

2006; Talavera et al. 2008).

Figure 1-3 Phylogenetic tree of the TRP superfamily

Reproduced with permission: (Pedersen et al. 2005)

Due to the role of TRP channels in regulating Ca2+ homeostasis and signal transduction, it is likely that TRP channelopathies would have deleterious effects on cellular function and may be involved in disease states that are associated with abnormal Ca2+ signalling. In fact, numerous heritable TRP mutations (reviewed in Everett 2011) have been described at this time that directly result in several different disease states including congenital stationary night blindness (mutation in TRPM1, Audo et al. 2009), progressive familial heart block (TRPM4, Kruse et al. 2009), hypomagnesemia with secondary hypocalcemia (TRPM6, Schlingmann et al. 2002), mucolipidosis type IV (TRPML1, Bach 2001), autosomal dominant polycystic kidney disease

(TRPP1 and 2, Wu et al. 2000), focal segmental glomerular sclerosis (TRPC6, Winn et al. 2005), brachyolmia (TRPV4, Rock et al. 2008), spondylometaphyseal and metatropic dysplasia

(TRPV4, Krakow et al. 2009), and hereditary motor, sensory neuropathy, and spinal muscular atrophy (TRPV4, Auer-Grumbach et al. 2010; Deng et al. 2010). While complex trait disorders such as BD cannot be ascribed to mutations in a single gene, it remains important to consider members of the TRP channel family as possible components of a pathological signalling network leading to the observed Ca2+ dyshomeostasis in the disorder given their roles in Ca2+ signalling dynamics.

Very recently, striking genetic findings from our group (Xu et al. 2006; Xu et al. 2009) and others (McQuillin et al. 2006) strongly implicate the TRP protein melastatin subtype 2 (TRPM2), a non-selective Ca2+ permeable channel, in the pathogenesis of BD. TRPM2 is particularly important in the context of Ca2+ and ROS signalling dynamics, as it appears to be a sensor of metabolic and oxidative-stress signalling that is regulated in part by adenosine diphosphate

(ADP)-ribose generated in the mitochondria, as well as by Ca2+/calmodulin (Kuhn et al. 2005;

Tong et al. 2006; Chung et al. 2011; Naziroglu 2011). Thus, TRPM2 is a highly relevant

22 pathophysiological candidate for BD, as its dysfunction may affect Ca2+ signalling and cellular resilience. Another TRP channel of interest in the pathophysiology of BD is the canonical TRP subtype 3 (TRPC3) channel. Physiologically, neuronal TRPC3 channel activity is involved in

BDNF-induced growth-cone turning (Li et al. 1999; Li et al. 2005), neuroprotection (Jia et al.

2007), dendritic arborisation (Hartmann et al. 2008; Becker et al. 2009) and spine formation

(Amaral et al. 2007). TRPC channels are thought to act as signal transducers that integrate various cellular signals into consequent regulation of intracellular Ca2+ homeostasis (Clapham

2003; Glazebrook et al. 2005; Groschner et al. 2005). Of interest to the pathophysiology of BD, pharmacological evidence implicates TRPC3 as a possible site of dysfunction in this disorder as reviewed in the following section.

1.5.1 TRPC channels

TRPC channels are non-selective cation channels permeable to Ca2+ and Na+ with varying selectivity ratios. Their presence has been described in both excitable and non-excitable cells with a distribution that is often described as ubiquitous (Hofmann et al. 2000). The seven TRPC subtypes can be classified into groups based on sequence homology and shared functional and regulatory characteristics (see Figure 1-4, 1-5). TRPC3/6/7, often referred to as the TRPC3 subfamily, are ~75% identical in amino acid sequence and can be activated by diacylglycerol analogues (Hofmann et al. 1999). TRPC1, 4 and 5 form another subfamily, while TRPC2 is a pseudogene in humans. TRPC channel gating is a topic of controversy, as these channels exhibit various functional characteristics including SOCE and ROCE as well as constitutive basal cation conductance (Pedersen et al. 2005; DeHaven et al. 2009; Yuan et al. 2009). In fact, it has been shown that the concentration of TRPC3 protein expressed affects the mode of regulation

(Vazquez et al. 2003; Yuan et al. 2007). The consensus of research in this area is that TRPC

23 channels, in both experimental and physiological conditions, have multiple modes of regulation determined by the tetrameric subunit composition, lipid environment, and the accessory proteins such as regulatory subunits and scaffolding proteins (eg. Homer, calmodulin, stromal interacting protein-1 [STIM1]) that are assembled in the cellular microdomains in which the TRPC channels reside (Goel et al. 2002; Kiselyov et al. 2005; Ambudkar et al. 2006; Graziani et al. 2006; Yuan et al. 2007; Lockwich et al. 2008; Groschner 2010). The interaction between these signalling elements and TRPC channel subunits means that different cell types may display alternative modes of channel regulation depending on the accessory proteins present as well as the expression level of these components. Moreover, the use of artificial expression systems for the investigation of TRPC channel signalling likely does not reflect in vivo physiology given the inherent differences in stoichiometry between accessory proteins and TRPC channels in these systems. Therefore, careful selection of relevant native cell types for the examination of TRPC channel function is critical. TRPC channel research is a rapidly growing area with numerous laboratories exploring various channel aspects such as structure, function and regulatory mechanisms, as well as the role these channels play in cellular physiology.

Figure 1-4 Canonical TRP protein family based on amino acid sequence

Figure 1-5 Transmembrane topology of the TRP channel

Adapted from (Vennekens et al. 2002)

Important roles for TRPC channels have been identified in smooth muscle contractility

(reviewed in Dietrich et al. 2006; Gonzalez-Cobos et al. 2010), cardiopulmonary vasculature

(Inoue et al. 2006; Dietrich et al. 2011), kidney function (Dietrich et al. 2010; Greka et al. 2011) and most importantly for this work, neuronal function (Tai et al. 2009; Bollimuntha et al. 2011).

TRPC3, in particular, is involved in numerous physiological processes in the brain, including neuronal growth, depolarization (Zhou et al. 2008), neuronal resilience (Jia et al. 2007), synaptic transmission (Hartmann et al. 2008), differentiation (Wu et al. 2004), development (Amaral et al.

2007; Becker et al. 2009), and astrocyte activation (Nakao et al. 2008; Shirakawa et al. 2010).

TRPC3-dependent Ca2+ signalling may also underlie BDNF’s role in neuronal growth and development (Li et al. 1999; Li et al. 2005). Li et al. demonstrated the co-localization of TrkB receptors and TRPC3 channels in neurons of several rat brain regions as well as a BDNF- induced Ca2+ current with TRPC3-like properties (Li et al. 1999). Pharmacological inhibition or knockdown of TRPC3 in cortical pyramidal neurons and cerebellar granule cells inhibited

BDNF-induced increases in dendritic spine density (Amaral et al. 2007) and growth cone attraction (Li et al. 2005) as well as decreasing cellular resilience (Jia et al. 2007). Thus, disturbances in TRPC3 function and expression could potentially disrupt BDNF signalling in neuronal development and resilience machinery in these two brain regions. For instance, alterations in BDNF signalling have been implicated in the impairment of neuronal plasticity observed in BD (reviewed in Shaltiel et al. 2007; Kapczinski et al. 2008), possibly through a signalling cascade involving TRPC3 (Li et al. 1999).

To better understand the physiological roles that TRPC3 subserves in the brain, it is important to know the anatomical pattern of its expression in brain, in cell types, and in the stages of development. Several studies in rat cerebellum, mouse dorsal root ganglion, and rat basal ganglia show TRPC3 channel expression in adult brain (Chung et al. 2007; Elg et al. 2007; Huang et al.

2007). In fact, in rat cerebellum and mouse dorsal root ganglion an increase in TRPC3 expression was observed from postnatal day 1 to 42 and embryonic day 12 through adulthood, respectively. In humans, TRPC3 channel expression has been observed throughout the CNS including cerebellum and cortical regions as well as multiple peripheral tissues (Riccio et al.

2002). However, some contrasting studies report that TRPC3 protein is only expressed during a narrow developmental window in rat (Li et al. 1999; Strubing et al. 2003; Fusco et al. 2004) and human brain (Li et al. 1999).

Several indirect lines of evidence implicate TRPC3 as a potential candidate involved in the pathophysiology of BD. Firstly, Ca2+ entry via a TRPC3-like channel that is activated by lysophosphatidic acid (LPA) (Roedding et al. 2006) evokes a significantly more rapid rise in intracellular Ca2+ concentrations in BLCL lines from BD-I patients than controls (Perova et al.

2008). Moreover, basal intracellular Ca2+ levels were higher in BD-I subjects in comparison to

26 controls in these same cell lines used to measure LPA-induced Ca2+ fluxes, whereas TG-induced

SOCE showed no change between diagnostic groups. This suggests that a ROCE mechanism was the source of the heightened activator-induced Ca2+ entry in BLCLs from BD subjects. As LPA is thought to act in a OAG-like manner on the TRPC3/6/7 subfamily of channels, and TRPC3 is the only subtype expressed in BLCLs, it was hypothesized that TRPC3 functionality may be altered in BD (Roedding 2006). Secondly, chronic lithium treatment of BLCLs from BD patients significantly decreased TRPC3 protein levels, as determined by immunoblotting, when compared to vehicle with no effect on TRPC1 levels (Andreopoulos et al. 2004). In addition, cell lines from healthy controls treated under the same experimental conditions did not show any significant change. These results suggest that lithium may act to correct abnormal Ca2+ homeostasis through downregulation of TRPC3 channels in BLCLs in a disease-specific manner (Andreopoulos et al.

2004). Results from our laboratory have also shown that chronic, but not acute, treatment of

BLCLs with a therapeutic concentration of lithium lowered both LPA (ROCE-dependent) and thapsigargin-mediated (SOCE-dependent) Ca2+ mobilization (Wasserman et al. 2004; Perova et al. 2009). These findings support the hypothesis that lithium exerts its therapeutic action through correction/amelioration of disrupted Ca2+ homeostasis observed in BD and that TRPC3 may be an important site of action. As TRPC3 is regulated in response to a diverse set of stimuli, including ROS (Groschner et al. 2005), it is important to consider TRPC3 as another component of the molecular circuitry connecting mitochondria, TRPM2 and Ca2+ dynamics (Groschner et al.

2005; Kiselyov et al. 2005; Putney 2005). This makes the study of TRPC3 channels and their importance to cellular processes a particularly hot topic with potentially broader consequences in terms of understanding disease states and potential therapeutics.

1.5.2 TRPM channels

The melastatin transient receptor potential (TRPM) family is comprised of eight members that form largely non-selective channels and are important for Ca2+ and/or magnesium influx (see

Figure 1-6) (Fleig et al. 2004). These channels are ubiquitously expressed and exhibit diverse physiological roles in melanoma cells (TRPM1), immune cells (TRPM2), pancreatic β cells

(TRPM2,4 and 5), brain (TRPM2 and 7), smooth muscle (TRPM4), kidney (TRPM6 and 7), and sensory neurons (TRPM3 and 8), to name a few (reviewed in Farooqi et al. 2011). TRPM4, 5, and 8 are voltage-regulated, Ca2+-activated, monovalent cation channels that are important for

Ca2+ homeostasis through cellular depolarization (Launay et al. 2002; Hofmann et al. 2003).

TRPM6 and 7 have been noted for their importance in the maintenance of intracellular and whole organism magnesium homeostasis (Chubanov et al. 2005; Ryazanova et al. 2010).

Figure 1-6 Melastatin TRP protein family based on amino acid sequence

Adapted from (Vennekens et al. 2002)

TRPM2, the TRPM channel of interest to this thesis, is a Ca2+-permeable non-selective cation channel that is particularly important in the context of Ca2+ and ROS signalling dynamics. This channel is gated in response to exposure of its cytosolic structures to low μM concentrations of

ADP ribose (Perraud et al. 2001) and mM concentrations of the related molecule nicotinamide adenine dinucleotide (NAD+) (Hara et al. 2002), in addition to exposure of cells to a variety of oxidant and nitrosative ROS generating stresses (see Figure 1-7) (Hara et al. 2002; Wehage et al.

2002; Kraft et al. 2004), such as those generated from mitochondrial and nuclear stress response mechanisms. Thus, TRPM2 appears to function as a “metabolic stress” sensor that gates Ca2+ entry in response to intracellular stress signals. TRPM2 is also regulated by intracellular Ca2+ levels (McHugh et al. 2003; Du et al. 2009). The Ca2+ sensor protein, calmodulin, and its binding site on the N-terminus of the channel protein are required for TRPM2 activation (Tong et al.

2006; Du et al. 2009). These findings suggest that Ca2+ entry through alternative pathways of sufficient magnitude and duration to significantly raise cytosolic Ca2+ concentrations (e.g. through ROCE and/or TRPC3 function) could act to sensitize cells to subsequent ADP ribose or

NAD+-dependent gating of TRPM2 channels, at least for the period during which cytosolic Ca2+ concentrations are elevated. This mechanism may integrate signals entrained in Ca2+ entry through non-TRPM2 pathways and metabolic events to TRPM2. In fact, Ca2+ influx following voltage-dependent channel activation, in the presence of ADPR, is sufficient to activate TRPM2- like currents in primary neurons (Olah et al. 2009).

Figure 1-7 TRPM2 protein structure, transmembrane topology, and surface representation

A) Human TRPM2 is a protein of ∼170 kDa composed of 1503 amino acids. The channel’s N- terminal has four homologous regions (MHR) and a calmodulin (CaM) binding IQ-like motif, followed by six transmembrane segments (TM). The TRPM2 C-terminus contains a TRP box and a coil–coil domain (CC), and a C-terminal adenosine diphosphate ribose (ADPR) pyrophosphatase domain (Nudix-like domain or NUDT9 homology domain, NUDT9-H). B)

2+ TRPM2 gating by ADPR is facilitated by H2O2, cADPR and Ca . Adenosine monophosphate

(AMP) acts as a negative regulator of TRPM2 gating by ADPR and 8Br-cADPR inhibits cADPR- and H2O2-mediated effects. Reproduced with permission (Sumoza-Toledo et al. 2011).

C) Side view of the surface representation of the TRPM2 molecule. Positions of cross-sections at

1.22-nm intervals throughout the channel, and at 0.97-nm intervals around the TM region, are indicated by numbers 1–21. Inset, a side view of the surface representation of TRPC3 is shown at half-scale. Two lines indicate the putative position of the lipid bilayer. Reproduced with permission (Maruyama et al. 2007).

The human TRPM2 gene consists of 33 exons spread over approximately 95 kb, with an additional exon 5 to exon 1, designated as exon –1 (Uemura et al. 2005), compared to that reported originally (Nagamine et al. 1998). These account for the 5.5 and 6.5 kb transcripts, corresponding to a variant that is expressed specifically in human striatum (Uemura et al. 2005), and long form of TRPM2 (TRPM2-L). Other splice variants have also been described (Perraud et al. 2003). One such splice variant contains an additional stop codon between exon 16 and 17 which results in a short variant (TRPM2-S) that suppresses TRPM2-L activity (Zhang et al.

2003). The long form of TRPM2 is highly expressed in brain, particularly cerebral cortex, in cells of hematopoietic and monocytic lineage, and a number of peripheral tissues (Fonfria et al.

2006). In brain, TRPM2 is prominently expressed in microglia (Kraft et al. 2004) and in neurons, based on expression studies in primary cortical, striatal and hippocampal cultures (Fonfria et al.

2005; Kaneko et al. 2006; Olah et al. 2009) and in situ hybridization studies in mouse brain

(Fonfria et al. 2006; Kunert-Keil et al. 2006). The TRPM2 protein contains a NUDT9-H domain which has substantial homology to the NUDT9 ADP ribose hydrolase and possesses intrinsic

ADP ribose hydrolase activity (Perraud et al. 2003). TRPM2-ΔC channels, encoded by transcripts with an exon 27 deletion, exhibit oxidant gating but are deficient in ADP ribose gating (Wehage et al. 2002), supporting separate regulatory sites for ROS action mediated through H2O2 and ADP ribose derived from nuclear and mitochondrial sources. Finally, TRPM2- encoded proteins assemble into multimeric (tetramers) channels, as is characteristic of a number of TRP channel subtypes, as well as other cation channels (Clapham et al. 2001).

Evidence of linkage of BD to the long arm of chromosome 21 was first reported by Straub et al. using a marker approximately 128 kb from TRPM2 in an extended BD pedigree (Straub et al.

1994). A number of subsequent independent studies confirmed that the 21q22.2-22.3 region

31 harbours BD susceptible loci (Detera-Wadleigh et al. 1997; Smyth et al. 1997; Aita et al. 1999;

Kwok et al. 1999; Kelsoe et al. 2001; Liu et al. 2001; Ewald et al. 2003) with positive results in the same region in an additional three family collections (Maziade et al. 2001; Turecki et al.

2001; Kaneva et al. 2004). In contrast, the results of several meta-analyses show non-significant trends (Badner et al. 2002; Segurado et al. 2003) or no evidence of linkage (McQueen et al.

2005) in this region. Some possible explanations for this discrepancy include the presence of genetic and phenotypic heterogeneity, as well as differences in populations, ascertainment and diagnostic criteria, sets of genetic markers, and analytic methods may limit the utility of pooling original data geared toward the identification of candidate loci (McQueen et al. 2005).

Evidence of altered SOCE in BD (Hough et al. 1999) led to the scrutiny of Ca2+ channels in the same non-excitable cell models that reported these abnormalities in Ca2+ signalling. As the

TRPM2 gene maps to a region containing BD susceptible loci and is a functional Ca2+ channel in non-excitable cell models, its gene expression was investigated in BLCLs from BD patients and healthy controls (Yoon et al. 2001). It was shown that an inverse relationship exists between total

TRPM2 mRNA levels and resting Ca2+ levels in BLCLs from BD patients but not in controls

(Yoon et al. 2001). This finding suggests that TRPM2 is an interesting candidate gene that may be involved in the dysregulation of Ca2+ homeostasis observed in BD.

The evidence supporting pathophysiological and positional candidacy of TRPM2 in BD prompted an examination of the relationship between BD and TRPM2 genetic variants in a case- control design (Xu et al. 2006). Significant association was found between single nucleotide polymorphism (SNP) rs1618355 in intron 18 and BD as a whole (P <7.0  10-5; Odds Ratio (OR)

= 2.60), and when patients were stratified into BD-I (P < 7.0  10-5, OR = 2.48) and BD-II (P =

7.0  10-5, OR = 2.88) subgroups. In addition, one of the 7-locus-haplotypes was in excess in BD

(12.0% in BD vs 0.9% in controls; P = 2.3  10-12) (Xu et al. 2006). The SNP rs1556314 in exon

11 was also found to be significantly associated with risk for BD as a whole (P = 0.047, OR =

1.4) and when patients were stratified into a BD-I (P < 0.011, OR = 1.59) subgroup in a case- control design conducted in our laboratory and others (McQuillin et al. 2006; Xu et al. 2009).

This SNP is particularly interesting in terms of its functional implications as deletions of this region result in loss of TRPM2 channel activation upon addition of ADP ribose (Wehage et al.

2002). The findings of McQuillin and coworkers can be taken as support for association of genetic variation of TRPM2 with BD, although their results differ from those of Xu et al. from this laboratory with respect to the intronic SNPs and regions within this gene that show significant association with BD (McQuillin et al. 2006).

These initial findings suggested genetic variants of TRPM2 increase risk for BD. To further support the association of TRPM2 with BD and also to rule out population stratification as a confounder (Marchini et al. 2004), Xu et al. from this laboratory conducted a second study, a family-based analysis of the SNPs identified in the case-control design. It was shown that a statistically significant overtransmission of the G allele of the exon 11 SNP rs1556314 occurs in families with BD-I affected individuals in a sample of 300 BD families comprising trios and discordant sibpairs (Xu et al. 2009). In addition, haplotype analyses of associations between BD-

I subjects with early age of onset (≤ 24 years old) and the C-T-A haplotype of rs1618355, rs933151, and rs749909 (corresponding to introns 18, 20 and 27) revealed a significant association. However, the intronic SNPs that showed significant association with BD risk in the case-control study design were not found to be significantly associated with risk for BD when analyzed individually in the family-based design. In summary, the significant association of

TRPM2 variants with BD confirmed in this family-based dataset further strengthens the notion

33 that genetic variation of TRPM2 increases risk for BD and that a TRPM2 channelopathy may be involved in the pathophysiology of this disorder.

In an effort to connect potentially pathogenic SNP variations with functional consequences, the various intronic SNPs identified in the case-control design were compared to resting intracellular

Ca2+ levels in BLCLs (Xu et al. 2006). Significantly lower resting intracellular Ca2+ levels (54.4

 6.5 nM) in BD-I patients with the TRPM2-intron 19 rs1612472 C/C genotype compared to those with T/T (62.6  9.8 nM; P = 0.008) and T/C (61.2  8.5 nM, P = 0.035) genotypes (Xu et al. 2006) is noteworthy as this SNP resides close to the exonic region encoding the pore area of

TRPM2, which is critical to the gating of Ca2+ entry through this channel. While the difference in this index of intracellular Ca2+ homeostasis was modest, this could reflect its limited sensitivity to detect the specific functional disturbances related to TRPM2 variants. In this respect, the

2+ response to H2O2 (Wehage et al. 2002), ADP ribose (Perraud et al. 2001), or Ca /CaM (Tong et al. 2006), which act at specific regulatory domains of the protein to stimulate Ca2+ influx, may bear a stronger relationship to altered intracellular Ca2+ homeostasis in BD. In summary, the study of cellular components that are known to affect both cellular resilience and Ca2+ signalling, such as TRPM2 and TRPC3, and the nature and impact of disturbances in their physiological function, as now suggested in the case of BD, are vital to advancing the understanding of the pathophysiology of BD.

1.5.3 TRP channels and oxidative stress

In recent years, a growing appreciation for the impact of oxidative stress and its role in intracellular signal transduction has developed. Important roles for ROS in TRP activation and/or channel modification have been observed for TRPC, TRPM and TRPV channels (Groschner et al. 2005; Poteser et al. 2006; Susankova et al. 2006; Yoshida et al. 2006; Xu et al. 2008; Miller et

34 al. 2011). In TRPV1 and TRPM2, oxidation and reduction of specific residues has been shown to alter the sensitivity of the channel to subsequent temperature-dependent activation (Susankova et al. 2006; Chuang et al. 2009; Kashio et al. 2012). The first evidence of oxidative stress signalling having an impact on TRPC channel activation was reported by Balzer et al., in which TRPC3- like channels were activated by tert-butylhydroperoxide in endothelial cells (Balzer et al. 1999).

Further research using cholesterol oxidase as the stressor suggested that TRPC3/4 heteromers were activated by ROS in endothelial cells (Poteser et al. 2006). It is unknown whether this channel activation was due to direct effects on TRPC3/TRPC4 channels or if the stress effects were mediated through alterations in lipid rafts that are present in the channel “signalplex”

(Groschner et al. 2004). Nitric oxide has also been shown to activate recombinant TRPC1, 4, and

5 as well as TRPV1, 3 and 4 through S-nitrosylation of intracellular cysteine residues that are present in a conserved sequence amongst these TRP proteins (Yoshida et al. 2006). Moreover, the application of thioredoxin, an intracellular redox protein, initiates TRPC5 activation through the cleavage of a disulfide bridge (Xu et al. 2008). In human monocytes, the addition of high glucose concentrations, shown to induce ROS generation, or peroxynitrite for four hours resulted in an increase of TRPC1, TRPC3, TRPC5, TRPC6, TRPM6, and TRPM7 mRNA as well as

TRPC3 and TRPC6 protein. However, high glucose treatment of glomerular mesangial cells resulted in a decrease in TRPC6 mRNA and protein expression after two days of treatment with a peak in TRPC6 down-regulation after seven days (Graham et al. 2007). No change in TRPC1 and 3 expression was observed at any time point measured. These findings indicate that the duration that cells are exposed to ROS as well as the cell type that is used are important in the study of oxidative stress effects.

The importance of ROS in TRPM2 activation is better understood and has been the subject of several landmark publications (Hara et al. 2002; Kaneko et al. 2006). As mentioned above,

+ TRPM2 channels are gated by H2O2, NAD , and through mitochondrial and nuclear generation of ADP ribose. In response to DNA damage, repair mechanisms are initiated, including activation of poly(ADP ribose) polymerase (PARP), which cleaves NAD+ into nicotinamide and

ADP ribose to generate polymers of the latter (Kuhn et al. 2005). Importantly, TRPM2 activation by oxidative stress has been linked to cell death in a number of different cell types (Hara et al.

2002; McNulty et al. 2005; Kaneko et al. 2006; Zhang et al. 2006). The resultant increase in intracellular Ca2+ levels after TRPM2 stimulation leads to PARP cleavage and caspase activation that can be inhibited by Ca2+ chelation and inhibition of TRPM2 function (Hara et al. 2002;

Kaneko et al. 2006; Zhang et al. 2006). Thus, injury or illness in which ROS levels are elevated may lead to TRPM2 activation and subsequent cell death (Takahashi et al. 2011). Effects of increased ROS levels on TRPM2 channel activation and/or expression have been noted in neurons, cardiomyocytes and vascular endothelium (Fonfria et al. 2005; Yang et al. 2005; Chung et al. 2011; Belrose et al. 2012; Takahashi et al. 2012). Recently, Belrose et al. have shown that inhibition of the antioxidant enzyme glutathione in hippocampal neurons is sufficient to alter

TRPM2 channel currents in a model of senescence (Belrose et al. 2012). This is particularly interesting given the findings of reduced glutathione levels in individuals with BD (Gawryluk et al. 2011). Some other physiological roles of H2O2 that are mediated via TRPM2 activation include chemokine production and regulation of vascular endothelial permeability (Hecquet et al.

2010; Takahashi et al. 2011). Further research of the role oxidative stress plays in TRPC and

TRPM regulation of expression and function is needed to fully understand how these channels are involved in the maintenance of Ca2+ homeostasis and signal transduction. In particular, a comparison of acute oxidative stress effects with a more prolonged stressor exposure is

36 necessary to investigate the potential differences provoked by sustained elevations in ROS levels, as observed in studies of BD pathophysiology.

1.6 Cellular models used for the study of bipolar disorder pathophysiology

Functional studies of signal transduction pathways cannot be accomplished using post-mortem tissue, generating the need for alternative disease and cell type relevant models to examine the underlying cellular pathophysiology in BD. Various models including rat neuronal cell lines, human neuronal cell lines, platelets, mononuclear leukocytes, and BLCLs have been used in BD research, each with their own inherent strengths and weaknesses. In this thesis work, primary rat cortical neurons, primary rat cortical astrocytes and BLCLs were used. As with any model, it is important to interpret findings within the context of their limitations and the tissue and/or cells that they are meant to reflect.

Rat cortical neurons and astrocytes are useful for the study of TRP channel signalling as they can be grown ex vivo and exposed to various treatments and experimental paradigms. These cells allow for the study of live cell processes including signal transduction in the form of Ca2+ fluxes in a cell model that is obtained from brain, an important consideration when studying mood disorders. Moreover, in rat neurons and glia, the physiological stoichiometry of the different TRP channel protein subunits, scaffolding proteins and other components of signalling complexes are maintained. Artificial expression systems, on the other hand, do not recapitulate the proper ratio of these elements, leading to differences in TRP channel behaviour (Vazquez et al. 2003). Albeit of nonhuman origin, the use of both rat cortical neurons and astrocytes allows for comparisons to be made between two vital cell types of the brain, both cell types implicated in BD (reviewed in section 1.2).

Peripheral cells such as fibroblasts and those of hematopoietic origin have been used in various psychobiological studies. Peripheral blood cells are easy to obtain via simple venipunture but findings using these cells may be confounded by stress effects, state of illness and drug effects.

In contrast, BLCLs are less likely to be confounded by these factors as they are virally transformed and expanded in culture ex vivo, thereby reporting stable, and putatively trait- relevant changes (Emamghoreishi et al. 1997). Collection of these lines from affected patients and control subjects adds a degree of clinical relevance above that of animal models or human clonal cell lines most often of neoplastic origin. Although they are not of CNS origin, BLCLs share many of the same signal transduction pathways present in neurons and glia including many members of the TRP channel family (Cushley et al. 1993; Pietruck et al. 1996; Rosskopf et al.

1998; Emamghoreishi et al. 2000; Andreopoulos et al. 2004; Roedding 2006). In this regard, several lines of evidence suggest that BLCLs can be used as reporters of disease-relevant abnormalities linked to CNS related dysfunctions (Sie et al. 2009). For example, abnormalities expressed in brain from patients with Huntington’s, Parkinson’s, and Alzheimer’s diseases are present in BLCLs (Polymeropoulos et al. 1997; Sawa et al. 1999; Urcelay et al. 2001; Toneff et al. 2002; Scherzer et al. 2004; Cannella et al. 2005). Recent studies have detected abnormalities in various cellular processes in BD subjects as well, such as irregular mitochondrial function, protein expression, ER stress response and Ca2+ signalling with the aid of the BLCL model

(Emamghoreishi et al. 1997; Yoon et al. 2001; Kato et al. 2003; Andreopoulos et al. 2004;

Karege et al. 2004; Wasserman et al. 2004; Washizuka et al. 2005; So et al. 2007; Perova et al.

2008; Perova et al. 2009). Thus, BLCLs offer a minimally-invasive obtained tool that may be used to investigate the etiopathogenesis of disorders of the CNS including BD.

1.7 Hypotheses and objectives

As reviewed, substantial evidence implicates altered signal transduction (reviewed in Hudson et al. 1993; Manji et al. 1995; Jope et al. 1996; Gould et al. 2002; Warsh et al. 2004) in the pathophysiology of BD. Two inter-related signalling cascades that appear to be altered in BD are

Ca2+ signalling (reviewed in Warsh et al. 2004) and cellular stress responses (Kakiuchi et al.

2003; Kato et al. 2003; Manji et al. 2003; Washizuka et al. 2005; So et al. 2007). Either directly or indirectly, disturbances in both Ca2+ signalling and cellular stress responses can be intimately related to impaired cellular resilience, suggested to be an important pathophysiological aspect of

BD (Manji et al. 2000; Manji et al. 2000). In the course of exploring the mechanistic basis of altered intracellular Ca2+ homeostasis in BD, findings garnered from genetic, molecular and/or biochemical methods have implicated TRPM2 and TRPC3 in the pathogenesis of BD

(Andreopoulos et al. 2004; McQuillin et al. 2006; Xu et al. 2006; Perova et al. 2008; Xu et al.

2009). The findings regarding the regulation of these channels, as discussed above, support the

2+ idea that TRPC3, TRPM2 and oxidative stress regulate intracellular Ca homeostasis and cellular stress responses that may be important in the development and progression of BD

(Figure 1-8). Thus, investigating the impact of chronic oxidative stress on this toolkit is important to understand these channels’ roles in governing cellular resilience and the potential effects of elevated ROS levels over time. In this regard, the proposed research aims to further characterize TRPM2 and TRPC3 channel regulation and how they are affected by chronic oxidative stress.

The primary objective of this thesis research is to determine whether acute and/or chronic oxidative stress exposure alters the expression and function of TRPM2 and TRPC3 in primary rat cortical neurons, glia and human B lymphoblast cell lines.

My main hypotheses are that exposure to ROS originating from the mitochondria will:

1. Alter the mRNA and protein expression levels of TRPC3/TRPM2.

2. Affect the sensitivity of these channels to agonist-induced activation, as measured by

respective TRPC3/TRPM2-mediated Ca2+ fluxes.

3. Demonstrate time-dependent regulation in which chronic, but not acute elevations in

ROS result in the subsequent changes in channel expression and function.

The specific objectives of the study are as follows:

1. To confirm that TRPC3 is present and thus able to subserve ongoing functions in adult

human brain, its expression profile in brain across the lifespan was determined (Chapter

2).

2. Examine ROS-mediated regulation of TRPC3/TRPM2 expression and function in

primary rat cortical neurons (Chapter 3); and

3. Investigate possible cell-type dependent differences in ROS-mediated regulation of

TRPC3/TRPM2 expression within rat brain (Chapter 3).

4. Explore the human and disease relevance of ROS-dependent TRPC3/TRPM2 channel

regulation using human B lymphoblast cell lines from BD-I patients and healthy controls

(Chapter 4).

Figure 1-8 TRPC3 and TRPM2 channels integrate Ca2+ dynamics and oxidative stress signalling

ADPR: adenosine diphosphate ribose, Bcl2: B cell lymphoma 2, DAG; diacylglycerol, ER: endoplasmic reticulum, GPCR: G-protein coupled receptor, IP3: inositol

1,4,5-trisphosphate, , NAD: nicotinamide adenine dinucleotide, NCX: sodium/calcium exchanger, NMDA: N-methyl-D-aspartate, PIP2: phosphatidylinositol 4,5- bisphosphate, PKC: protein kinase C, PLCβ: phospholipase C beta, PMCA: plasma membrane calcium ATPase, SERCA: sarco(endo)plasmic reticulum calcium ATPase, STIM1: stromal interacting protein-1, UP: uniporter

2 TRPC3 Protein is Expressed Across the Lifespan in Human Prefrontal Cortex and Cerebellum

This chapter has been published in Brain Research (Roedding et al., 2009).

Authorization to reproduce this work has been obtained from the publisher and co-authors.

2.1 Abstract

The canonical transient receptor potential type 3 (TRPC3) channel is a non-selective, voltage- independent cation channel that is expressed in both excitable and non-excitable cells. As little is known regarding its presence in human brain and the influence of age on its expression, we examined TRPC3 protein expression by immunoblotting in postmortem prefrontal cortex and cerebellum obtained from subjects (8 days to 83 years) with no history of psychiatric or neurological disorder. The expression of TRPC3 protein in the prefrontal cortex (Brodmann area

A9/A10) of the neonates/infants (<2 y) was significantly higher (25%) than that in the adolescent to adult (11y–83y) age group, whereas cerebellar TRPC3 levels showed no age-related changes.

The results indicate that TRPC3 may be developmentally regulated in prefrontal cortex, and its expression in discrete human brain regions throughout the lifespan suggests a physiological role for TRPC3 during postnatal and adult life.

2.2 Introduction

The TRPC3 channel (for review see Eder et al. 2007) is involved in numerous neurophysiological processes, including neuronal growth, depolarization (Zhou et al. 2008), neuronal resilience (Jia et al. 2007) and development (Amaral et al. 2007). TRPC3-dependent

Ca2+ signalling may underlie BDNF’s role on neuronal growth and development (Li et al. 1999;

Li et al. 2005). Pharmacological inhibition or knockdown of TRPC3 in cortical pyramidal neurons and cerebellar granule cells inhibit BDNF-induced increases in dendritic spine density

(Amaral et al. 2007) and growth cone guidance (Li et al. 2005) as well as decreasing cellular resilience (Jia et al. 2007). Thus, disturbances in TRPC3 function and expression could potentially disrupt BDNF signalling in neuronal development and resilience machinery in these two brain regions. For instance, alterations in BDNF signalling have been implicated in the

43 impairment of neuronal plasticity observed in bipolar disorder (BD) (Shaltiel et al. 2007;

Kapczinski et al. 2008), possibly through a signalling cascade involving TRPC3 (Li et al. 1999).

Studies using peripheral cells from BD patients have probed the link between TRPC3 and BD.

Chronic exposure to the mood stabilizer lithium decreases the expression of TRPC3 protein in B- lymphoblast cell lines from BD patients, suggesting this effect may be important in its therapeutic action (Andreopoulos et al. 2004). Moreover, LPA, which activates Ca2+ entry via a

TRPC3-like channel (Roedding et al. 2006), evokes a significantly more rapid rise in intracellular Ca2+ in BLCLs from BD (type 1) patients than controls (Perova et al. 2008). To support further examination of the role of TRPC3 in human neuropsychiatric disorders such as

BD, it is necessary to unequivocally establish the presence and expression pattern of this protein in adult human brain.

Several studies have examined the expression of TRPC3 in mammalian brain during postnatal life with mixed results. In rat cerebellum, TRPC3 protein levels significantly increased from postnatal day 1 to 42 (Huang et al. 2007). Similar findings were reported in a peripheral nervous system model, mouse dorsal root ganglion, from embryonic day 12 to adult age (Elg et al. 2007).

TRPC3 protein and mRNA have also been detected in adult rat basal ganglia (Chung et al. 2007) and several human brain regions including cerebellum and cortex (Riccio et al. 2002), respectively. While such findings support the notion that TRPC3 is expressed in adult mammalian brain, several contrasting reports found that TRPC3 protein was expressed only during a narrow developmental window in rat brain (Li et al. 1999; Strubing et al. 2003; Fusco et al. 2004) and a human fetal, but not adult, cerebral cortex (Li et al. 1999).

Elucidating the pattern of TRPC3 protein expression in human brain is important, not only in justifying its continued study as a pathophysiological candidate in BD but also in determining whether TRPC3 signalling is important for temporally confined events such as neurodevelopment or if it has a persistent functional role throughout the lifespan. Accordingly, the objective of this study was to confirm the expression of TRPC3 in postmortem human cerebral cortex and cerebellum and to examine TRPC3 protein expression across the lifespan.

2.3 Methods

2.3.1 Subjects

Postmortem human prefrontal cortex (Brodmann areas 9/10, N=29) and cerebellum samples

(N=27) were obtained from 31 subjects (either sex; ages 8 days to 83 years) (Table 1). This study was approved by the Centre for Addiction and Mental Health Research Ethics Board.

2.3.2 Preparation of brain samples

Frozen postmortem human brains were dissected on glass plates over dry ice as described previously (Kish et al. 1988); prefrontal and cerebellar cortex were collected and then stored at -

80oC. Brain samples (50-100 mg) were homogenized by sonication (Vibra Cell Sonicator) for 10 sec at 30% intensity in 10 volumes of 1% SDS (100oC). Insoluble debris was removed by centrifugation at 1000g for 10 min. Supernatants were collected and protein concentrations were determined by the bicinchoninic acid (BCA) method, after which aliquots of supernatants were stored at -80oC.

2.3.3 SDS-PAGE and Western blotting.

Brain lysates (10 µg) were prepared in Laemmli buffer, resolved on 7.5% acrylamide gels, and electrophoretically transferred to polyvinylidene difluoride (PVDF) membranes. For

45 immunodetection of TRPC3 protein, membranes were blocked with 0.5% egg white albumin (1 h, room temperature [RT]), then incubated with 1:500 anti-TRPC3 antibody (Alomone)

(overnight, 4oC) followed by 1:1000 Protein A-HRP (BioRad) (40 min, RT). For immunodetection of α-tubulin, membranes were blocked with 5% milk, and subsequently incubated with 1:35000 anti-α-tubulin antibody (Sigma) (2 hours, RT) followed by 1:20000 anti- mouse IgG (Sigma) (40 min, RT). Immunoreactive proteins were visualized with ECL+

(Amersham Biosciences) and chemifluorescence intensity quantified on a STORM phosphorimaging system using ImageQuant 5.2 software (Amersham Pharmacia Biotech). To assess linearity, 5 to 40 µg of brain lysates were loaded, resolved and immunodetected with anti-

TRPC3 and anti-α-tubulin specific antibodies, respectively, on the same gel and blots. The specificity of the anti-TRPC3 antibody was tested further in a competition experiment whereby control immunogen peptide were incubated with anti-TRPC3 antibody in a 1 to 1 ratio for 1 hour prior to addition to the membrane. TRPC3 protein expression was quantified by normalizing

TRPC3 immunoreactive signals against α-tubulin and then to a reference cortical or cerebellar sample that was run on each gel to control for inter-blot variation. This allowed comparison of normalized TRPC3 signal intensity across different blots.

2.3.4 Statistics

Differences in normalized TRPC3 immunoreactive signal intensity of comparison age groups were tested by one-way ANOVA. Additionally, the relationship between TRPC immunoreactive levels and age were assessed by linear and nonlinear regression analyses, and the best fit model determined by goodness of fit through examination of the residuals with runs tests and least squares analysis (Motulsky et al. 2004). Differences between neonate/infant (< 2y) and

“adolescent/adult” (11-83 y) age groups across gender were tested using a two-way ANOVA.

Data are expressed as mean ± standard deviation. Statistical significance of differences in means was taken as p<0.05. Statistical and regression analyses were performed with SPSS, version 14

(SPSS Inc.) and GraphPad Prism version 4 software, respectively.

2.4 Results

2.4.1 Subject demographics

Cerebellar tissue was obtained from 29 subjects and prefrontal cortex from 27 with a total of 31 different subjects used. Demographics of the cohort used in this study are presented in Table 2-1.

Subjects’ samples were divided into 8 age groups for analysis: 8-9 days (d), 2-4 months (m), 7-

10 m, 1.5-2 years (y), 11-18 y, 28-31 y, 48-55 y, and 80-83 y. Each group contained 3-4 subjects and where possible, gender was distributed equally in each group. For statistical comparisons, subjects were also examined in two larger aggregate age groups representative of

“neonates/infants” (8 d–2 y; n=16) and maturity “adolescent/adult/aged” (11–83 y; n=15) to test whether a general difference exists in TRPC3 expression between early and later life, as has been previously suggested (Li et al., 1999; Strubing et al., 2003). There was no evidence of neurological or psychiatric illness and no subjects died by suicide. Examination of the formalin- fixed half of the brain revealed no gross abnormalities. Mean postmortem interval was 13.7 hours (range 5.25-22.25 h) and the most common causes of mortality were cardiovascular in nature, comprising 55% of the total.

Table 2-1 Subject Demographics

2.4.2 TRPC3 immunodetection specificity and quantification

Anti-TRPC3 antibody detected a single, well-resolved immunoreactive band migrating at approximately 95 kDa in human prefrontal cortex and cerebellum. Pre-incubation with the peptide immunogen to which the anti-TRPC3 antibody was raised completely competed out putative TRPC3 immunoreactive bands in both prefrontal cortex and cerebellum (Fig. 2-1A). To verify that TRPC3 and α-tubulin signal intensity varies in a linear fashion in proportion to the amount of protein loaded onto the gel, the relationship of signal intensity with respect to protein concentration through a range of 5 to 40 μg was examined. As shown (Fig. 2-1B,D,E), TRPC3 and α-tubulin antibodies detect their respective cognate proteins in a linear fashion in tissue lysates of both brain regions from 5-40 and 5-20 µg sample protein, respectively (Fig. 2-1D, E).

Additionally, when normalized to α-tubulin immunoreactivity, relative TRPC3 levels remain linear between 5 to 40 μg protein (prefrontal cortex: r2=0.95; cerebellum: r2=0.97, Fig. 2-1C).

Intra-assay reproducibility as assessed by the coefficient of variation at a protein concentration of

10 μg sample protein was 17% (n=10) for reference prefrontal cortex and 16% (n=8) for cerebellum samples. Inter-assay reproducibility, assessed by comparing a prefrontal cortex sample (10 μg) on three separate assays, was 13%.

2.4.3 TRPC3 expression in human prefrontal cortex and cerebellum

TRPC3 protein was expressed throughout all ages in both brain regions. In prefrontal cortex, highest expression was observed in subjects of age 2-4 months (1.36 ± 0.15, mean ± SD normalized immunoreactivity) and lowest in the 28-31 years age group (0.93 ± 0.09). No statistically significant differences in TRPC3 expression among the eight age groups

(F7,19=1.458, p=0.241) were found. As visual inspection of the data suggested a nonlinear relationship of prefrontal cortex TRPC3 immunoreactive signal intensities with age, the data was

49 subjected to both linear and nonlinear regression analyses to establish the model best fit by the data. Linear regression analysis yielded a slope that was not significantly different from zero

(slope=-0.003, p=0.067, Fig. 2-2A); the best fit model which was obtained by nonlinear

2 regression was that of single phase exponential decay (R =0.299 F1,24=5.84, p=0.024) versus linear regression (r2=0.128) although the relationship was not robust. Since the exponential decay model suggests higher TRPC3 protein levels in younger subjects and findings in rat suggested that TRPC3 is developmentally regulated, we tested further whether TRPC3 protein levels were differentially expressed in an aggregate “neonate/infant” age group in comparison to older subjects. Indeed, significantly higher TRPC3 immunoreactivity levels were observed in the

“neonate/infants” compared to the “adolescent/adult” age group (1.26 ± 0.18 vs. 1.00 ± 0.23,

F1,23=9.804, p=0.005) (Fig. 2-2B). There was no significant effect of gender (F1,23=1.764, p=0.197) or an interaction between age and gender (F1,23=0.289, p=0.596) on TRPC3 immunoreactive levels in this brain region. Finally, there were no significant differences in cerebellar TRPC3 levels among individual (F7,21=0.696, p=0.675) (Fig. 2C-D) or aggregate age groups (1.08 ± 0.25 vs. 0.96 ± 0.15, F1,25=3.037, p=0.094), and no significant effect of gender

(0.99 ± 0.20 vs. 1.05 ± 0.22, F1,25=0.682, p=0.417) or interaction between age and gender

(F1,25=2.718, p=0.11).

A comparison of TRPC3 protein expression levels between prefrontal cortex and cerebellum was conducted in those subjects from which samples were available from both brain regions (N=25).

No significant difference was detected (paired t-test, 1.13 ± 0.24 vs. 1.24 ± 0.24, p=0.082).

Moreover, postmortem interval did not correlate with TRPC3 signal intensity (prefrontal cortex: r=-0.28, p=0.15; cerebellum: r=0.12, p=0.54). Also, there was no relationship between age and

α-tubulin immunoreactivity (prefrontal cortex: r=-0.043, p=0.83; cerebellum: r=-0.090, p=0.64).

Figure 2-1 Linearity of TRPC3 immunoreactive signal intensity with respect to protein concentration in FCX and CBM.

(A) Competition of cognate peptide against TRPC3 immunoreactive bands. (B) Representative

Western blots showing the linear relationship between TRPC3 signal intensities and lysate protein concentration (left: FCX, right: CBM). The positions of the 115.4, 94.9, and 54.3 kDa molecular weight markers are indicated. (C) TRPC3 signals normalized to α-tubulin were linear with respect to protein concentration between 5 and 40 μg in prefrontal cortex (FCX; r=0.98, p=0.001) and cerebellum (CBM; r=0.99, p=0.002) lysates. The signal intensity of TRPC3 and α- tubulin were linear from 5-40 and 5-20 µg, respectively, in FCX (D) and CBM (E). FCX: prefrontal cortex; CBM: cerebellum. Sub: Subject number; Ref: Reference sample.

Figure 2-2 TRPC3 protein levels in human prefrontal cortex and cerebellum across age.

(A) Relationship between TRPC3 immunoreactive levels and age is best described by a monophasic exponential decay model (y=0.298 × e-0.188x + 1.00, R2=0.299; n=27) in prefrontal cortex. (B) Higher prefrontal cortex TRPC3 levels in neonates/infants (n=14) compared to adolescent/adult (n=13) (p=0.005). (C) TRPC3 signals in cerebellum are not affected by age

(F7,21=0.696, p=0.68; n=3 or 4 per group). (D) Linear regression analysis of age and TRPC3 protein level revealed no significant relationship in cerebellum (slope=-0.002, R2=0.058, p=0.210; n=29). Data are presented as the means ± SD. FCX: prefrontal cortex; CBM: cerebellum.

2.5 Discussion

The primary finding in this study is that TRPC3 protein is expressed over a wide age range in human prefrontal cortex and cerebellum. However, the level of expression was higher in the neonates/infants group than later ages in the prefrontal cortex. In contrast, there were no age dependent changes in cerebellum.

The expression of TRPC3 protein in prefrontal cortex across the lifespan is best described by a one phase exponential decay model. Although the goodness of fit of this model to the data is not strong, it suggests that the expression of TRPC3 protein is higher in younger subjects and then decreases to a plateau in older subjects. This is corroborated by our finding of a statistically significant increase in TRPC3 protein levels in the aggregate neonate/infant group compared with the group representing adolescent/adult ages. These results are in contrast to those of Li et al. (1999) in which TRPC3 protein was not reported to be present in the cerebral cortex of a human adult. However, our findings are consistent with more recent data from rat in which

TRPC3 protein expression was found higher in whole brain of early postnatal (2 days) development (Fusco et al. 2004) in comparison to adult brain (8 weeks), albeit with a greater relative difference than found here for human prefrontal cortex. The basis for the discrepancy between findings among these studies is unlikely to be attributable to species specific differences as TRPC3 protein was detected in adult rat brain (Fusco et al. 2004; Chung et al. 2007; Huang et al. 2007), and mRNA was found in human brain (Zhu et al. 1996; Riccio et al. 2002). Possibly, the difference might be explained by a weaker avidity of the TRPC3 antibody, which Li et al.

(1999) generated and purified for their study, that also failed to detect TRPC3 in rat kidney and heart, tissues that are known to express TRPC3 (Goel et al. 2006; Goel et al. 2007). While

Strubing et al. (2003) also failed to detect TRPC3 protein expression in the rat adult brain despite

53 using the same anti-TRPC3 antibody (Alomone; product ACC-016) as that used in the current study, TRPC3 levels in rat brain microsomal fractions that were analysed may have been below the level of detection as TRPC3 is mostly located on the plasma membrane.

There are several limitations to consider with respect to this study. First, tissue lysates rather than plasma membrane-enriched fractions were used in the immunoassay which did not allow detection of differences, if any, in TRPC3 expression in specific subcellular locations. In addition, since samples from postmortem brain homogenates consist of neurons, glia, vascular endothelia, and various other cell types residing in the tissue matrix, it was not possible to discriminate changes in the TRPC3 expression within these individual cell types.

In summary, the findings of this study demonstrate that TRPC3 protein is expressed in human prefrontal cortex and cerebellum from an early age through to old age. While TRPC3 plays an important role in neurodevelopment such as by mediating some of the actions of BDNF (Amaral and Pozzo-Miller 2007, Li et al. 2005), the continued expression of TRPC3 protein in the adult brain suggests that TRPC3 may play a broader physiological role. Furthermore, direct evidence of TRPC3 expression in human adult brain provides an important platform for pathophysiological studies of TRPC3 in neuropsychiatric disorders, such as BD in which this channel has already been indirectly implicated in studies using a peripheral cell model.

3 Chronic Oxidative Stress Modulates TRPC3 and TRPM2 Channel Expression and Function in Rat Primary Cortical Neurons: Relevance to the Pathophysiology of Bipolar Disorder

This chapter has been submitted for publication in Neuroscience (Roedding et al., 2012).

Authorization to reproduce this work has been obtained from the co-authors.

3.1 Abstract

Recent findings implicate the Ca2+-permeable transient receptor potential (TRP) melastatin subtype 2 (TRPM2) and canonical subtype 3 (TRPC3) channels in the pathogenesis of bipolar disorder (BD). As both channels are involved in Ca2+ and oxidative stress signalling, thought to be disrupted in BD, we sought to determine the effects of elevated oxidative stress on their expression and function. Primary rat cortical neurons and astrocytes were treated with oxidative stressors for 1 (acute) and 4 days (chronic). Expression of TRPC3 and TRPM2 were determined by immunoblotting and real-time PCR. Channel functionality was assessed using a TRPC3 activator, 1-oleoyl-2-acetyl-sn-glycerol (OAG), and ratiometric live cell fluorometry with the

Ca2+ sensitive dye, Fura-2. Neurons treated with rotenone (15-30 nM) for 4 days but not 24 hours showed significant dose-dependent decreases in TRPC3 mRNA (31%, p<0.001) and protein levels (60%, p<0.001). Similar dose-dependent attenuation of TRPC3-mediated Ca2+ fluxes was demonstrated upon chronic rotenone exposure relative to vehicle controls. In contrast, TRPM2 mRNA but not protein levels increased (47%, p=0.017) after acute and chronic rotenone treatment. Chronic exposure of neurons to paraquat (1-2 µM), an alternate oxidative stressor, similarly decreased TRPC3 expression (mRNA: 41%; protein: 61%). Unlike neurons, rotenone treatment incurred no changes in astrocyte TRPC3 levels. These findings demonstrate that

TRPC3 and TRPM2 channel expression and/or function is sensitive to the redox status of rat primary neurons and that these changes are time dependent. This provides a critical mechanistic link between altered oxidative stress markers, dysfunction of these TRP channels and Ca2+ dyshomeostasis in BD.

3.2 Introduction

Considerable attention has been focused on the role of ROS in the pathophysiology of several neurodegenerative disorders including Parkinson’s disease, Alzheimer’s disease and amyotrophic lateral sclerosis (reviewed in Lin et al. 2006; Gibson et al. 2010). Recently, the impact of oxidative stress and mitochondrial dysfunction has also come under closer scrutiny in relation to the pathogenesis of BD (Andreazza et al. 2008; Kato 2008; Ng et al. 2008). Evidence of oxidative damage has been observed in the form of lipid peroxidation in the anterior cingulate

(Wang et al. 2009) and protein oxidation in the prefrontal cortex of post-mortem tissue from BD subjects (Andreazza et al. 2010). Furthermore, indirect indices of ROS activity in BD patients based on serum and plasma measures demonstrate increased superoxide dismutase and catalase activity (Kuloglu et al. 2002; Savas et al. 2006), and higher levels of lipid peroxidation and tyrosine nitration in comparison with controls (Kuloglu et al. 2002; Andreazza et al. 2009).

It is unlikely that heightened levels of oxidative stress occur independently of alterations in intracellular Ca2+ signalling as many factors that influence cellular ROS levels also impact intracellular Ca2+ handling and vice versa (Görlach et al. 2006). In this respect, numerous reports describe disrupted Ca2+ homeostasis in the same disorders that have been linked to altered oxidative stress levels, namely Parkinson’s disease, Alzheimer’s disease and BD (reviewed in

Warsh et al. 2004; Zundorf et al. 2011). Investigations of the mechanisms that might account for these abnormalities revealed the potential role of the TRP family of non-selective cation channels in neurodegenerative disorders (Yamamoto et al. 2007; Selvaraj et al. 2010). Of note, both TRPC3 and TRPM2 have been implicated in these Ca2+ disturbances in BD. Expression of

TRPM2 was found altered in BLCLs with elevated Ca2+ levels from BD-I patients (Yoon et al.

2001) and significant genetic associations between several intronic (Xu et al. 2006) and exonic

(McQuillin et al. 2006; Xu et al. 2009) SNPs in TRPM2 and BD have been reported.

Furthermore, hyperactive TRPC3-mediated Ca2+ responses have been observed in BLCLs from

BD patients compared to controls (Wasserman et al. 2004; Perova et al. 2008). Moreover, chronic treatment of BLCLs with therapeutically relevant concentrations of lithium resulted in significant decreases in TRPC3 protein levels that were greater in BD patient cell lines relative to vehicle compared with those from healthy subjects treated similarly (Andreopoulos et al. 2004).

The TRPM2 and TRPC3 channels are members of the TRP superfamily of cation channels, which are localized to cellular microdomains and operate in functional complexes (Li et al.

2000) that handle signal processing through modulation of Ca2+ dynamics (Venkatachalam et al.

2007). Of particular note, TRPM2 channels are gated in response to a variety of oxidant and nitrosative ROS generating stresses (Hara et al. 2002; Wehage et al. 2002). In addition, redox and nitric oxide mediated modifications of TRPC channels can regulate their activity (Poteser et al. 2006; Yoshida et al. 2006; Xu et al. 2008). Collectively, such findings highlight the important role of ROS on aspects of TRP channel function and intracellular Ca2+ signalling dynamics. In neurons and glia, TRPC3 channels have been shown to play critical physiological roles, such as in growth cone guidance (Wang et al. 2005) and dendritic growth and spine formation (Amaral et al. 2007; Tai et al. 2008), whereas TRPM2 channels provide a molecular convergence between

ROS and Ca2+ signalling responses (Heiner et al. 2006).

The findings implicating TRPM2 and TRPC3 in disturbances of intracellular Ca2+ signalling in

BD have been obtained using a non-excitable cell type, BLCLs, as a putative disease reporter cell model (Sie et al. 2009). In addition, we have shown that chronic, but not acute oxidative stress modulates TRPC3 and TRPM2 channel expression and/or function in BLCLs (see Chapter

4). Little is known, however, about the regulation of TRPM2 and TRPC3 in response to ROS in

58 neurons and oxidative stress effects on intracellular Ca2+ homeostasis and neuronal integrity.

Thus, in this study we sought to determine the effect of sustained, as compared with acute oxidative stress on the expression and/or function of TRPC3 and TRPM2 in primary rat cortical neurons and astroglial cells, widely studied models of neuron and glial cell biology.

3.3 Methods

3.3.1 Preparation of rat cortical neuron cultures

Rat cortical neurons were cultured as previously described with minor modifications (Shahar et al. 1989; Feeney et al. 2008). Briefly, cerebral cortex was dissected from fetal Sprague-Dawley rats (embryonic day 18) and triturated to obtain a single cell suspension in growth media

(Neurobasal media, 10% fetal bovine serum, 2 mM L-glutamine, and 100 U/mL penicillin- streptomycin). The cells were plated at a density of 1.5 x 105 cells/cm2 on polyethyleneimine coated glass (Corning, MA, USA), 96-well plates (Corning), or 60 mm dishes (BD Falcon,

o Mississauga, ON), and kept in a 95% air, 5% CO2 humidified incubator at 37 C. The following day half of the media was replaced with growth media containing Neurobasal media, 2% B-27 supplement containing antioxidants, 2 mM L-glutamine, and 100 U/mL penicillin-streptomycin.

Cytosine arabinoside (5 μM, Sigma, Oakville, ON) was used to inhibit glial cell growth 3 days after plating. All subsequent media changes were carried out using the media as above but with a

B-27 supplement without antioxidants. All experimental procedures involving animals conformed to the guidelines of the Canadian Council on Animal Care and were approved by the

CAMH Animal Care Committee.

Oxidative stressors (rotenone [Sigma]: 15 and 30 nM, paraquat [Sigma]: 1 and 2 µM) or respective vehicles were added to cultured neurons for 24 h (acute) and 4 days (chronic) starting on the 10th and 7th day in vitro (DIV), respectively. For chronic treatment, the media was

59 replaced and stressors added on the 9th DIV (48 h after initial stressor addition). Phase contrast images of treated and untreated neuronal cultures were taken daily to monitor changes in cell morphology, as well as measures of viability. After 24 h or 4 days of stressor treatment, cells were collected for immunoblotting and quantitative real-time PCR experiments.

3.3.2 Preparation of rat cortical astrocyte cultures

Cortical astrocyte cultures were prepared as previously described (Shahar et al. 1989; Feeney et al. 2008) from the same cell suspension used for preparation of neuronal cultures. The growth media for primary astrocyte culture consisted of Minimum Essential Medium containing Earle’s salts, 2 mM L-glutamine, 10% horse serum, and 100 U/mL penicillin-streptomycin. The cells were plated in uncoated 175 cm2 culture flasks (Sarstedt, Montreal, QC), incubated in a 5%

CO2/95% air incubator, and fed every 48 h with fresh culture medium until confluence was reached (≈3 weeks). Oligodendrocyte and microglial cell types yielding phase-gray astrocytes were removed using standard stratification/shaking procedures (Shahar et al. 1989). The remaining cells were then subcultured using a 0.05% trypsin wash onto polyethyleneimine- coated dishes, coverslips and 96-well plates.

Rotenone (600 and 1200 nM) and vehicle controls were added to purified astrocyte cultures for

24 h (acute) or 4 days (chronic) beginning once the cells reached approximately 80% confluency.

The media was replaced and rotenone added again 48 h after initial stressor addition.

All cell culture materials were purchased from Invitrogen (Burlington, ON), unless otherwise specified.

3.3.3 RT-PCR detection of TRPC1, TRPC3, TRPM2, HO-1 transcripts

Real-time quantitative PCR was performed using an ABI 7300 cycler (Applied Biosystems,

Foster City, CA, USA) to assess transcript abundance of TRPC1, TRPC3, TRPM2, heme oxygenase 1 (HO-1), and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) after acute and chronic treatment of neurons and astrocytes with the stressors outlined above. Total RNA was extracted from 3.5 x 106 cells using an RNeasy® kit (QIAGEN, Mississauga, ON) with on- column DNase digestion following the manufacturer’s instructions. First-strand cDNA synthesis was performed using random hexamers and SuperScript III® reverse transcriptase. Gene-specific primer pairs for amplification of TRPC1, TRPC3, TRPM2, HO-1 and GAPDH were designed using Primer Express® v2.0 (Applied Biosystems, Foster City, CA, USA) and synthesized by

ACGT (Toronto, ON). The RT-PCR conditions were: 50°C for 2 min then 95°C for 10 min followed by 40 cycles of 95°C for 15 s and 60°C for 1 min. Measurements of ΔCt [Ct (gene of interest)-Ct (GAPDH)] and ΔΔCt [ΔCt stress-treated - ΔCt vehicle-treated] (Livak et al. 2001) were made in triplicate for each sample with Sybr Green PCR Master Mix (Applied Biosystems) following the manufacturer’s guidelines. All PCR materials, except those noted, were from

Invitrogen.

3.3.4 Western immunoblotting

Quantification of TRPC3 and TRPM2 isoforms present in cell lysates from treated cells were performed using standard immunoblotting protocols, as previously described (Roedding et al.

2009) with modifications for cell lysate preparation. Media was removed from the culture dishes and 1% SDS (100oC) was added. The cells were collected using a rubber policeman and sonicated (Vibra Cell Sonicator) for 30 s at 30% intensity. Cell lysate protein concentrations were determined using the BCA method (Smith et al. 1985), heated (3 min, 95oC) in Laemmli

61 buffer, and 20-25 µg of protein was loaded onto 7.5% SDS-PAGE gels for electrophoretic separation. For immunodetection of TRPC3 protein, nitrocellulose membranes (Perkin-Elmer,

Woodbridge, ON) were blocked with 0.5% egg white albumin (1 h, room temperature [RT]), then incubated with 1:500 anti-TRPC3 antibody (Alomone, Israel) (overnight, 4oC) followed by

1:1000 Protein A-HRP (BioRad) (40 min, RT). For immunodetection of TRPM2, membranes were blocked with 5% milk/1% bovine serum albumin (1 h, RT), then incubated with 1:500 anti-

TRPM2 antibody (Novus, Littleton, CO, USA) (overnight, 4oC) followed by 1:10,000 goat anti- rabbit IgG (Biorad, Mississauga, ON) (40 min, RT). For β-actin, a blocking solution of 5% milk was used, 1:20,000 anti-β-actin antibody (New England Biolabs, Pickering, ON) (overnight,

4oC) followed by 1:10,000 anti-rabbit IgG (Sigma) (40 min, RT). Immunoreactive bands were visualized with ECL™ (Amersham Pharmacia, Baie d'Urfe, QC) and chemifluorescence quantified on a STORM phosphorimaging system using ImageQuant 5.2 software (Amersham

Pharmacia). Samples from individual primary cultures were run in triplicate on the same gel including vehicle and both stress conditions to avoid confounding effects of interblot variability.

Because of differences in slopes of band signal intensities versus lysate protein concentration between the TRP protein analytes and the housekeeping protein, β-actin, included to monitor uniformity of protein loading, signal intensities were not normalized against the latter as this increased the variance of estimates. Rather, separate statistical analyses were performed for β- actin signal intensities for all immunoblots to confirm β-actin levels in all loaded samples did not change under the stressor treatment conditions.

3.3.5 Viability assays

Propidium iodide (PI), MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] and

LDH [lactate dehydrogenase] assays were used to determine cell viability following the

62 manufacturer’s instructions. For propidium iodide experiments, half of the media was removed and replaced with Hank’s buffered saline solution containing propidium iodide (Sigma) to a final concentration of 50 µM. The cells were incubated for 20 min at 37oC and endpoint fluorescence measurements were performed using a microplate reader (Fluoroskan Ascent FL) with excitation/emission at 544 nm/590 nm. To conduct MTT assays (Promega, Madison, WI, USA),

o 15 µL of dye solution was added to microplate wells and incubated at 37 C and 5% CO2 for 4 h.

Solubilization buffer/stop solution was then added and the microplate was incubated for an additional 60 min followed by measures of absorbance at 570 nm. For LDH assays (Promega), culture media was transferred from the 96-well plate containing the stressed cells to a clean microplate followed by incubation at RT with CytoTox-ONETM reagent (1:1 ratio) for 10 min.

After adding stop solution (1:4 ratio), fluorescence was measured using 560 nm excitation and

590 nm emission wavelengths. Percent change in viability was calculated using a maximum signal intensity (Fmax) measurement taken using wells that were treated with 600 nM rotenone or

50 µM paraquat for 24 hours in rat cortical neurons and 0.1% Triton-X for at least 10 min in astrocytes [100-((Fstress treatment–Fmin)/(Fmax–Fmin) x100)]. Signals from cells treated with vehicle were considered as background fluorescence (Fmin).

3.3.6 Determination of TRPC3-mediated intracellular calcium flux

Intracellular Ca2+ flux was quantified ratiometrically using Fura-2-acetoxymethyl ester (Fura-2

AM) on a BD Pathway 855 bioimager (BD Biosciences, Mississauga, ON). After exposure to rotenone (0, 15 or 30 nM) for 4 days, neuronal cultures were loaded with 1 µM Fura-2 AM in assay buffer (Hank’s buffered saline solution containing 1.25 mM probenecid and 5 mM HEPES

(Sigma) for 30 min at 37C in a 5% CO2/95% air atmosphere. The loading buffer was then replaced with 100 µL of fresh assay buffer and cultures were incubated for an additional 30 min

63 at 37C. Images of 50 to 200 neuronal soma per field of view were acquired at excitation and emission wavelengths of 340/380 nm and 510 nm, respectively, through a 10x objective with well-to-well laser-guided auto-focusing. Exposure settings were 0.07s for 340 nm and 0.15s for

380 nm and autofluroescence background correction was applied. Image segmentation to define neuronal soma (regions of interest, ROI) was achieved using the whole cell polygon algorithm of the BD Attovision software. After establishing a stable baseline fluorescence ratio, cells were stimulated with 100 µM 1-oleoyl-2-acetyl-sn-glycerol (OAG, Calbiochem) and ratiometric fluorescent images acquired at 1.9 second intervals for a 4 min period. Mean maximum intensity, rate of rise, and area under the curve (AUC) of the baseline normalized relative fluorescence ratios were determined using the BD IDE software. Responding cells were defined as ROIs with maximum intensity within 2 standard deviations of the mean maximum intensity of paired unstressed cells. Each treatment condition was assayed in duplicate wells of cultured neurons and replicated in four independent experiments using separate batches of primary rat cortical neurons derived from different dams.

3.3.7 Statistics

Statistical analyses were performed with PASW (formerly SPSS) statistical software v18.

Repeated measures ANOVA was used to analyze the effect of stressor concentration (within factor) on channel function and mRNA expression of the various genes of interest with pair-wise comparisons corrected for multiple testing (Tukey and Bonferroni, respectively). The effect of stressors on the protein levels of the various genes of interest were examined using the nonparametric Friedman`s test as these data were not normally distributed and the variance between individual primary cultures was high. Differences with two-tailed probability values of p < 0.05 were considered statistically significant.

3.4 Results

3.4.1 Stressor effects on cell viability and ROS levels

Using the isolation and differential growth conditions described, the respective primary cultures were confirmed by immunohistochemical staining to be routinely highly enriched in neurons

(>99% MAP-2 positive staining) and astrocytes (>85% GFAP positive staining), respectively

(data not shown).

Rotenone and paraquat are both known to generate superoxide at complex I of the mitochondrial electron transport chain (Li et al. 2003; Cocheme et al. 2008). Preliminary experiments were conducted to establish the appropriate concentrations of stressor that would result in elevations in

ROS levels in neurons and astrocytes with limited cell death for up to 4 days of stressor treatment. Exposure of rat primary cortical neurons to rotenone (15-30 nM) and paraquat (1-2

µM) for 4 days resulted in dose-dependent increases [rotenone: F(2,7)=14.43, p<0.001, paraquat:

F(2,5)=10.57, p=0.002] in HO-1 mRNA levels, an index of oxidative stress (Keyse et al. 1990)

(Fig 4-1 a,b). In addition, the viability of rat primary cortical neurons after 4 days of treatment with 15 and 30 nM rotenone (n≥8), as measured using PI and MTT assays, decreased dose dependently to approximately 50% and 25%, respectively (see Fig 4-1c). Moreover, visual examination of the effect of rotenone on gross cell morphology using phase-contrast microscopy demonstrated that 15 nM rotenone caused reductions in the density of neuronal projections; at 30 nM there was apparent loss of some cell bodies and all neuronal projections (Fig 4-1e). Similar dose dependent changes in viability and morphology to those observed with rotenone were also evident after chronic paraquat exposure. Therefore, concentrations of 15 and 30 nM rotenone and

1 and 2 µM paraquat were chosen for use in subsequent chronic experiments with rat primary cultured neurons.

Figure 3-1 Effects of rotenone and paraquat exposure on HO-1 expression, cell viability and morphology of rat cortical neurons a,b) Relative quantitative RT-PCR was used to measure HO-1 mRNA levels in rat cortical neurons after 24 h and 4 day treatment with (a) rotenone (vehicle, 15, and 30 nM) and (b) paraquat (vehicle, 1, and 2 µM). HO-1 gene specific primers were: sense 5’ GCCTGCTAGCCTGGTTCAAG 3’, antisense 5’ AGCGGTGTCTGGGATGAACTA. Repeated measures ANOVA revealed that HO-1 mRNA levels after stress treatment for 4 days are significantly higher at 30 nM rotenone and 2 µM paraquat in comparison with their respective vehicle control, 15 nM and 1 µM (n=7-9). c,d) Cell viability was measured every 24 hours

66 during rotenone (n=11) (c) and paraquat (n=3) (d) treatment using PI (50 µM). e) Visual inspection of phase contrast images of rat cortical neurons that were collected on the 4th day of rotenone treatment show dose dependent loss of neuronal projections and cell body integrity. The scale bar represents 100 µM. Data are expressed as mean ±SD. *p<0.05

3.4.2 Changes in TRPM2/TRPC3 channel expression after acute and chronic rotenone treatment in rat cortical neurons

To investigate the effects of acute and chronic elevations in oxidative stress on TRPC3/TRPM2 channel expression, rat cortical neurons were treated with rotenone followed by quantification of protein and mRNA levels. The mRNA expression levels of TRPC1 were also quantified as a negative control, as this TRPC subtype was not thought to be gated by ROS (Graham et al.

2007). Acute (24 h) exposure of primary rat cortical neurons to rotenone (15-30 nM) did not alter the mRNA and protein levels of TRPC3 [mRNA: F(2,1)=3.295, p=0.143, protein: Friedman statistic=0.000, p=1.000, n=3], and the mRNA levels of TRPC1 [F(2,1)=3.315, p=0.152] (see

Fig 4-2a). An independent trial during preliminary experiments using 8-24 nM rotenone treatment for both 4 and 24 hours also showed no change in TRPC3 and TRPC1 mRNA levels

(n=3, data not shown). In contrast, a significant main effect of stressor concentration

[F(2,1)=10.29, p=0.026] on TRPM2 mRNA levels (i.e., increased) was observed after 24 h (Fig

4-2a). Upon chronic (4 day) rotenone treatment, there were dose dependent and statistically significant decreases in TRPC3 mRNA [31% ±12, F(2,7)=25.18, p<0.001] and protein levels

(60% ±28, Friedman statistic=16.22, p<0.001, n=9) (see Fig 4-2b). In comparison, TRPM2 mRNA but not protein levels increased after 4 days of rotenone treatment [47% ±49,

F(2,7)=5.30, p=0.017], although the variation in this measure was high among individual primary cultures. Of note, reference proteins and negative controls, TRPC1, GAPDH (mRNA) and β-actin (protein), were not affected by rotenone treatment at any time point. It was also

67 determined that direct application of a classical oxidative stressor, hydrogen peroxide (12.5-100

µM, 4 and 24 h), acutely had no effect on TRPC3/TRPM2 mRNA expression (n=4, data not shown).

Figure 3-2 Rotenone-induced alterations in TRPC3/TRPM2 mRNA and protein expression

(a) Total RNA and whole cell lysates were collected from primary rat cortical neurons after treatment with rotenone (0, 15, and 30 nM) for 24 h. The relative amounts of TRPC1, TRPC3, and TRPM2 mRNA expression (expressed as percent of control, mean ± SD) was determined using relative quantitative RT-PCR with GAPDH as the reference control gene. (TRPC1: sense 5’ GAACAGCAAAGCAACGACACC 3’, antisense 5’ CCACATGCGCTAAGGAGAAGA 3’; TRPC3: sense 5’ CTGGATTGCACCTTGTACCAGG 3’, antisense 5’ GCAGACCCAGGAAGATGATGAA 3’; TRPM2: sense 5’ AAGTTGCCTCAATCCGAGCA 3’, antisense 5’ CAAGGTCTCAAAGGTCACCCA 3’; 3’; GAPDH: sense 5’

GACTCTACCCACGGCAAGTTCA 3’, antisense 5’ TCGCTCCTGGAAGATGGTGAT 3’). The effect of rotenone treatment on protein levels was examined by Western blot. Representative immunoblots and box-plots of signal intensity (arbitrary units) are shown (n=3). (b) The effects of 4 day rotenone treatment on TRPC1, TRPC3, and TRPM2 mRNA and protein levels was conducted in the same manner as described for 24 h rotenone exposure (n=9). *p<0.05

3.4.3 Chronic rotenone treatment also reduces activator-stimulated TRPC3 channel gating

To determine whether rotenone-induced changes in TRPC3 channel expression also affects Ca2+ flux mediated by this channel, the Ca2+ response to OAG, a TRPC3 activator, was determined in the absence and presence of the specific TRPC3 inhibitor, Pyr3 (Kiyonaka et al. 2009). In preliminary experiments Pyr3 (2.5 µM) inhibited OAG-induced Ca2+ flux in rat cortical neurons maximally by 62% (see Fig 4-3). The Ca2+ response to OAG (100 µM) stimulation in primary rat cortical neurons exposed to rotenone (15-30 nM) chronically showed a significant dose- dependent decrease in the mean maximum intensity [F(2,6)=31.79, p=0.001], percentage of responding ROIs [F(2,6)=47.90, p=0.011], rate of rise [F(2,6)=31.65, p=0.001], and area under the curve [F(2,6)=16.40, p=0.004] relative to vehicle treated samples (Fig 4-4). Post-hoc analysis demonstrated that both 15 nM and 30 nM of rotenone significantly decreased all of the aforementioned measured parameters of Ca2+ flux (p<0.05).

Figure 3-3 Inhibition of OAG-induced calcium flux by Pyr3 Pre-treatment (10 min) with the TRPC3 channel inhibitor, Pyr3 (2.5 µM), significantly reduced OAG (100 µM)-activated Ca2+ fluxes in primary rat cortical neurons loaded with fura-2 (1 µM). DMSO (0.5%), the OAG vehicle, did not elicit a Ca2+ response. Inhibition with Pyr3 resulted in statistically significant decreases in the mean maximum signal intensity [F(4,12)=3.90, p=0.029], the rate of response [F(4,12)=4.13, p=0.024], and the area under the curve [F(4,12)=6.12, p=0.006]. Data are expressed as mean + SD (dotted line), n=4 independent replications.

Figure 3-4 Chronic rotenone treatment reduces OAG-induced calcium responses in primary rat cortical neurons TRPC3 function was measured using OAG (100 μM) and the Ca2+ sensitive dye, Fura-2 (1 μM). (a) The mean response curves are shown after OAG addition in rat primary cortical neurons treated with rotenone (0, 15, and 30 nM) for 4 days. The arrow denotes OAG addition. The bar graphs depict the effect of chronic rotenone treatments on the (b) mean normalised maximal intensity, (c) the percentage of responding neuronal somae (ROIs), (d) the rate of Ca2+ influx and (e) area under the curve upon OAG stimulation. Data are presented as mean + SD (n=4).*p<0.05

3.4.4 Paraquat treatment causes similar alterations in TRPM2/TRPC3 expression

To ensure that the oxidative stress-induced changes described above are the result of elevations in intracellular ROS levels rather than a rotenone specific effect, another stressor that produces superoxide at the level of mitochondrial complex I, namely paraquat, was used (Cocheme et al.

2008). It was shown that paraquat (1-2 µM) treatment in rat cortical neurons for 4 days, but not

24 hours, caused significant decreases in TRPC3 expression (Fig 4-5) [mRNA: 41% ±19,

F(2,5)=10.23, p=0.003; protein: 61% ±26, Friedman statistic=14.00, p<0.001, n=7], supporting the relevance of these findings with respect to oxidative stress regulation of TRPC3 expression.

For TRPM2, oxidative stress-induced alterations in mRNA and protein levels were also observed, albeit with high variability between cultures of primary rat cortical neurons. Paraquat treatment for 24 h resulted in an increase in TRPM2 protein level greatest at 1 µM (24% ±23,

Friedman statistic=8.0, p=0.005, n=4) with no change in mRNA, while after 4 days an increase in mRNA was detected only at 1 µM paraquat [36% ±19, F(2,5)=6.62, p=0.012]. Interestingly,

TRPC1 mRNA expression, which was unaffected by rotenone treatment at both acute and chronic time points, was significantly decreased, but only after 4 days paraquat exposure (Fig 4-

5b) [F(2,5)=22.178, p<0.001].

Figure 3-5 Paraquat-induced alterations in TRPC3/TRPM2 mRNA and protein expression

(a) Total RNA and whole cell lysates were collected from primary rat cortical neurons after treatment with paraquat (0, 1, and 2 µM) for 24 h. The relative amounts of TRPC1, TRPC3, and TRPM2 mRNA expression (expressed as percent of control, mean ± SD) was determined using relative quantitative RT-PCR with GAPDH as the reference control gene. The effect of paraquat treatment on protein levels was examined by Western blot and signal intensities (arbitrary units) were quantified. Box-plots of signal intensity are shown (n=4). (b) The effects of 4 day paraquat treatment on TRPC1, TRPC3, and TRPM2 mRNA and protein expression was conducted in the same manner as described for 24 h paraquat exposure (n=7). *p<0.05

3.4.5 TRPC3 channel expression is not modulated by ROS levels in rat cortical astrocytes

The findings of increased TRPM2 mRNA expression in astroglial cells after acute exposure to tert-butyl hydroperoxide (Bond et al. 2007) and observations of altered sensitivity of astrocytes to stressor insults in comparison to neurons (Schmuck et al. 2002) suggest that TRPC3/TRPM2 channel expression may also be regulated by oxidative stress in astrocytes. Due to different growth conditions (media containing serum and thus antioxidants) and perhaps an increased resiliency of astrocytes, the concentration of rotenone (600-1200 nM) necessary to decrease cell viability, as measured using MTT and LDH, to the same degree as that observed in neurons and to up-regulate HO-1 mRNA expression levels, was much higher. In contrast to neurons, astrocyte

TRPC3 protein levels remained unchanged following either 24 h (Friedman statistic=2.7, p=0.264, n=3) or 4 days (Friedman statistic=3.5, p=0.174, n=4) of rotenone treatment (Fig 4-6).

Due to the low abundance of TRPM2 protein in these cells, its levels could not be reliably quantified. Similarly, detection of TRPC3 and TRPM2 mRNA was also problematic due to low transcript levels (Ct values ~34-35, 5 ng cDNA template).

Figure 3-6 Acute and chronic rotenone treatment does not induce changes in TRPC3 protein expression in rat astroglial cells Whole cell lysates were collected from primary rat astroglial cells after treatment with rotenone (0, 600, and 1200 nM) for 24 h (a) and 4 days (b). Protein levels of TRPC3 were examined by Western blot and signal intensities (arbitrary units) were quantified using densitometry. Representative immunoblots and box-plots of signal intensity are shown (n=3-4).

3.5 Discussion

Our results show for the first time that chronic, but not acute exposure to elevated oxidative stress levels results in significant reductions in TRPC3 channel expression (60%) and function

(55%) in rat cortical neurons. Also of note, TRPM2 expression was increased at both acute and chronic time points. Collectively, these results indicate that the expression and/or function of

TRPC3 and TRPM2 channels are sensitive to the redox status of the cell.

Most striking was the large reduction of TRPC3 mRNA and protein levels accompanied by a substantial decrease in TRPC3-mediated Ca2+ influx in rat cortical neurons after chronic exposure to heightened oxidative stress levels. The decrease in channel expression was observed with two different stressors that produce ROS in the mitochondria, suggesting that chemical specific effects were not the cause for the observed changes. Moreover, the stressor-induced

75 increases in HO-1 mRNA levels, TRPM2 mRNA and/or protein levels, and the stability of

GAPDH mRNA and β-actin protein levels argue against the possibility that the reductions in

TRPC3 expression following chronic exposure to elevated levels of ROS resulted from a general dampening of gene transcription and/or protein translation. Though these findings diverge from observations of ROS effects on TRPC3 induced by chronic exposure to high glucose in human mesangial cells (Graham et al. 2007) and human monocytes (Wuensch et al. 2010), differences related to the mode of elevation of ROS (high glucose versus rotenone/paraquat exposure) used in the latter studies and cell type dependent responses are equally plausible explanations for differential TRPC3 channel regulation reported among these studies.

In concert with reduced expression, chronic elevations in intracellular ROS levels also significantly decreased TRPC3 channel functionality, as indicated by reduced activator- stimulated Ca2+ influx. In light of our previous findings of altered Ca2+ homeostasis and agonist- stimulated responses in BD patients, evidence of a link between the intracellular redox status,

Ca2+ signalling and TRPC3 channels is particularly interesting (Emamghoreishi et al. 1997;

Perova et al. 2008). Is the decrease in TRPC3 channel expression and the resultant blunting of

TRPC3-mediated Ca2+ signalling a compensatory neuroprotective change or detrimental consequences of prolonged exposure to oxidative stress? Evidence that tert-butyl hydroperoxide results in large TRPC3 conductances in porcine aortic endothelial cells suggests that downregulation of this protein may be cytoprotective through reductions of the magnitude of these oxidative stress-induced currents (Balzer et al. 1999). It has also been shown that TRPC3 channel knockdown or inhibition of these channels using Pyr3 in a mouse model of acute pancreatitis protects the pancreas and salivary glands from Ca2+-mediated cell toxicity (Kim et al. 2011). In addition, the neuroprotective mechanism of α-tocopherol treatment in hippocampal

76 neurons has been linked to inhibition of Ca2+ entry mediated by TRP-like channels (Crouzin et al. 2007). In striking contrast, it has been shown that TRPC3 expression in cerebellar granule neurons is necessary for BDNF-mediated neuroprotection (Jia et al. 2007). While some evidence suggests that reduced TRPC3 expression may be neuro/cytoprotective, further investigation is needed into the physiological role of TRPC3 channels in order to understand the consequences of altered expression levels in these varied cell/tissue-type specific contexts.

Though not investigated in this study, some possible mechanisms that may account for the observed differences in TRPC3 channel levels include alteration(s) in the activity of regulatory transcription factors such as the calcineurin/nuclear factor of activated T-cells (NFAT) and calmodulin-dependent protein kinase (CaMK)/CREB pathways in response to stress-induced disruptions of intracellular Ca2+ signalling (Ermak et al. 2002). Both of these regulatory pathways have been implicated in the transcriptional regulation of TRPC3 expression in previous studies (Pigozzi et al. 2006; Morales et al. 2007; Poteser et al. 2011). It has also been suggested that direct activation of TRPC3 channels is linked to the regulation of its expression levels through calcineurin in atrial myocytes and extracellular signal-regulated protein kinase, c-Jun

NH2 terminal-kinase and nuclear factor-ΚB (NF-ΚB) in cortical astrocytes (Shirakawa et al.

2010; Poteser et al. 2011). Functionally, oxidative stress-induced reductions in TRPC3-mediated

Ca2+ influx may result from disruptions in accessory proteins involved in the TRPC3 signalling complex such as scaffolding proteins and enzymes (Groschner et al. 2005; van Rossum et al.

2005), transcription factors (Caraveo et al. 2006), direct oxidative modifications of TRPC3 channel residues (Yamamoto et al. 2010), or simply the decrease in protein levels as described here. Some of these disruptions may also affect TRPC3 channel protein translocation and turnover (van Rossum et al. 2005; Caraveo et al. 2006).

Examination of the effects of heightened ROS levels on TRPM2 expression was less conclusive than that of TRPC3. This was in part due to the larger variance observed in mRNA and protein levels for this gene after stressor treatment among individual primary cultures. However, there was a general trend of increases in TRPM2 mRNA and/or protein levels with both rotenone and paraquat treatment (see summary Table 3-1). There was also a discrepancy between the elevations of TRPM2 mRNA levels following rotenone treatment and the lack of significant changes in channel expression upon H2O2 exposure after 24 hours. The most likely reason for this inconsistency is the difference in duration of ROS exposure given the disparity in half-lives between the two stressors; H2O2 has a short half-life of approximately 15 minutes in cell culture whereas rotenone can persist in soil for 1-3 days (Link et al. 1988; de Lima et al. 2005).

Moreover, it is interesting to note that TRPM2 expression levels appear to be elevated after treatment at the lower (15 nM rotenone; 1 µM paraquat) in contrast to higher (30 nM rotenone; 2

µM paraquat) stressor concentrations where no appreciable changes were evident, suggesting a window of sensitivity to the magnitude of the oxidative stress response. A recent study examining TRPM2 expression levels in rats after traumatic brain injury, thought to elevate oxidative stress levels, amongst other biochemical changes, showed significant increases in both

TRPM2 mRNA and protein levels in the cerebral cortex and hippocampus of injured animals

(Cook et al. 2010). This direction of change concurs with that found here, suggesting that the results of our in vitro study support those observed in vivo. Of note, the changes in TRPM2 protein levels induced by traumatic brain injury were also not observed until three days post- injury (Cook et al. 2010).

Table 3-1 Summary of TRPC3 and TRPM2 expression levels after oxidative stressor treatment.

The expression of TRPC1 mRNA was used as a negative control, as this channel was not thought to be regulated by ROS (Graham et al. 2007). However, chronic, but not acute, treatment with paraquat resulted in decreased TRPC1 mRNA levels. Both rotenone and paraquat are thought to increase superoxide production at the mitochondrial level and result in ATP depletion (Schmuck et al. 2002; Cocheme et al. 2008). However, differences in compartmentalization of the oxidative stress response between paraquat, which increases oxidation of thioredoxin, a regulator of redox balance, in the cytoplasm, and rotenone, which elevates levels of oxidation of mitochondrial thioredoxin (Ramachandiran et al. 2007), could conceivably explain the differences observed in

TRPC1 mRNA expression.

The lack of oxidative stressor effect on TRPC3 expression in astrocytes also suggests that there are cell type-dependent factors involved in the regulation of TRPC3 in the brain as noted above.

While similar effects of chronic rotenone exposure to reduce TRPC3 expression levels were observed in BLCLs as found here in rat cortical neurons (Roedding et al. 2012), this mode of

TRPC3 regulation may not be shared by all cell types. Furthermore, different subtypes of TRPC channels may be affected by oxidative stress in astrocytes, as functional redundancies within this subfamily have been postulated (Desai et al. 2005). In addition, differences in the TRPC subtypes and accessory proteins expressed in astrocytes could lead to alternate heterotetramer channel formation and altered downstream signalling (Kiselyov et al. 2007), perhaps diminishing the sensitivity of these channels to the redox status of the cell.

In interpreting the results it is important to consider the limitations of the study. One limitation is that the oxidative stress elicited by the toxins used in the study is likely supraphysiological. This is supported by the degree of cell death observed after toxin treatment. In the study design, this was mitigated somewhat by the inclusion of two different stressor concentrations; one that represents a milder stress and one that is more severe. Future studies using inhibitors of the endogenous antioxidant defense system, such as an inhibitor of glutathione production

(buthionine sulphoximine), may better represent physiologically relevant intrinsic ROS elevations. Another limitation of this study is that only TRPM2 channel expression levels were measured and not the effect of oxidative stress upon the function of these channels. Moreover, the data presented here were all gleaned from rat cell models and the extent to which the findings can be extrapolated to humans remains to be demonstrated. Interestingly, preliminary findings in human BLCLs show functional effects of chronic oxidative stress on TRPC3 channels that correlate with decreased protein levels (Roedding et al. 2012). These findings from human

BLCLs suggest that the changes observed in rat may be translated to humans.

We have clearly shown that chronic, but not acute, exposure to elevated oxidative stress levels results in decreases in TRPC3 channel expression in rat cortical neurons as well as a reduction in

TRPC3-mediated Ca2+ influx. The time-dependence of these changes is significant physiologically as it suggests that acute disruption in redox homeostasis within neurons does not affect TRPC3 channel expression whereas sustained disruption of this homeostatic balance leads to marked changes in channel expression and function. Thus, cortical neurons responding to acute “fight or flight” stresses will show no change in TRPC3 channel expression, while chronic life and/or environmental stresses that increase allostatic load, as is implicated in mood

(McEwen 2003) and neurodegenerative disorders (Liu et al. 1999), could alter TRPC3 channel expression and function putatively through the effects of cortisol on mitochondrial dynamics.

With respect to the latter, increases in glucocorticoid levels that are associated with stressful life events can lead to altered mitochondrial dynamics such as mitochondrial oxidation, potential and

Ca2+ holding capacity (Du et al. 2009). As elevated markers of oxidative stress have been noted in brains of BD patients and neurodegenerative diseases (Lin et al. 2006; Andreazza et al. 2010), it is possible that these increases lead to altered TRPC3 and TRPM2 channel expression and/or function in these disorders. These changes may be a compensatory form of adaptation to the increased allostatic load or a failure of the cell to maintain normal cellular homeostasis.

In summary, we have shown that TRPC3 and TRPM2 channel expression and/or function is sensitive to the redox status of rat primary neurons and that oxidative stress-induced changes in expression are time dependent. Considered together with our previous findings in BLCLs, it appears that oxidative stress regulation of these channels occurs in both non-excitable and excitable cell models as well as different species. Given substantial evidence for a role of oxidative stress in BD, further research examining the impact of oxidative stress-induced

81 alterations on TRPC3 and TRPM2 channel expression and intracellular Ca2+ signaling dynamics and downstream targets in this serious neuropsychiatric disorder is warranted.

3.6 Acknowledgements

This research was funded by an operating grant from the Ontario Mental Health Foundation.

ASR was the recipient of a doctoral trainee award from the Ontario Mental Health Foundation.

The assistance of Clarissa Pasiliao in maintaining primary rat cultures and assay development was much appreciated. Marty Green was also invaluable for her knowledge of RT-PCR and day to day laboratory management.

4 Effect of Oxidative Stress on TRPM2 and TRPC3 Channels in B Lymphoblast Cells in Bipolar Disorder

This chapter has been published in Bipolar Disorders (Roedding et al., 2012).

Authorization to reproduce this work has been obtained from the publisher and co-authors.

4.1 Abstract

Objectives: Recent findings implicate the Ca2+-permeable nonselective ion channels transient receptor potential (TRP) melastatin subtype 2 (TRPM2) and canonical subtype 3 (TRPC3) in the pathogenesis of bipolar disorder (BD). These channels are involved in Ca2+ and oxidative stress signalling, both of which are disrupted in BD. Thus, we sought to determine if these channels are differentially affected by oxidative stress in cell lines of BD patient origin. Methods: B lymphoblast cell lines from bipolar I disorder (BD-I) patients (n=6) and healthy controls (n=5) were challenged with the oxidative stressor rotenone (2.5 µM and 10 µM) or vehicle for acute

(24 hours) and chronic (four days) intervals. Cell viability was measured using propidium iodide, while TRPM2- and TRPC3-mediated Ca2+ fluxes were measured in the presence of their respective activators (H2O2 and 1-oleoyl-2-acetyl-sn-glycerol) using Fluo-4. Changes in TRPM2 and TRPC3 expression levels were determined by quantitative reverse transcriptase polymerase chain reaction (qRT-PCR) and Western blotting.

Results: Cell viability decreased with increasing dose and duration of rotenone treatment, with

BD-I patient BLCLs more susceptible than controls acutely (p<0.001). A dose-dependent decrease in TRPC3 protein expression occurred after chronic (24%, p=0.008) but not acute

2+ rotenone treatment. Interestingly, H2O2-provoked TRPM2- dependent Ca fluxes revealed an interaction between the effects of stressor addition and diagnostic subject group (p=0.003).

Conclusions: These data support an important role for TRPM2 and TRPC3 in sensing and responding to oxidative stress and in transducing oxidative stress signalling to intracellular Ca2+ homeostasis and cellular stress responses, all of which have been implicated in the pathophysiology of BD.

4.2 Introduction

Recent advances in the study of BD have highlighted the potential role of oxidative stress, mitochondrial dysfunction, impaired ER stress response, and disrupted intracellular Ca2+ homeostasis in the pathogenesis of this disorder (Warsh et al. 2004; So et al. 2006; Kato 2008;

Ng et al. 2008). It is therefore not unexpected that alterations in intracellular redox measures and

Ca2+ signalling parameters have been noted in conjunction with one another, as both of these systems share functional regulatory elements such as the ER and mitochondria (Brookes et al.

2004; Görlach et al. 2006). Oxidative damage has been observed directly through modifications of lipid and protein in post-mortem brain of BD subjects (Wang et al. 2009; Andreazza et al.

2010). Furthermore, indirect evidence of elevated ROS activity has been noted based on serum and plasma measures in BD patients (Kuloglu et al. 2002; Savas et al. 2006; Andreazza et al.

2009). Other lines of evidence have implicated disturbances in Ca2+ signalling dynamics and homeostasis in the pathophysiology of BD (reviewed by Warsh et al. 2004). Moreover, a novel family of Ca2+ permeable ion channels has been identified, the TRP family, several members of which are sensitive to the redox status of the cell. Among these, both TRPC3 and TRPM2 channels have been implicated in the pathophysiology of BD-I (Andreopoulos et al. 2004; Xu et al. 2006; Perova et al. 2008; Xu et al. 2009).

The TRP superfamily of channels exhibit varying cation selectivity and its members are expressed ubiquitously throughout the body (Venkatachalam et al. 2007). The TRPC3 and

TRPM2 channel proteins respond to a diverse range of stimuli and propagate these signals through modulation of Ca2+ dynamics (Clapham 2003). In lymphocytes, TRPC3 channels are important for cell activation through amplification of Ca2+ signals and scaffolding of signalling proteins (Numaga et al. 2010). Relevant to BD, TRPC3 channels play critical roles in neurons,

85 such as in growth cone guidance (Wang et al. 2005) and dendritic growth and spine formation

(Amaral et al. 2007; Tai et al. 2008), whereas TRPM2 channels direct a molecular convergence between ROS and Ca2+ signalling responses (Heiner et al. 2006). Among findings supporting the involvement of these TRP channels in BD, we first demonstrated that TRPM2 expression is altered in conjunction with elevated intracellular Ca2+ levels, an indicator of altered intracellular

Ca2+ homeostasis, in BLCLs from BD-I patients (Yoon et al. 2001), and later reported significant genetic association between several intronic (Xu et al. 2006) and exonic (McQuillin et al. 2006; Xu et al. 2009) SNPs in TRPM2 and BD. With respect to TRPC3, chronic lithium treatment of BLCLs from BD-I patients results in significant decreases in TRPC3 protein in comparison to healthy controls treated similarly (Andreopoulos et al. 2004). Furthermore, hyperactive TRPC3-mediated Ca2+ responses have been detected in BD-I subject cell lines

(Wasserman et al. 2004; Perova et al. 2008).

The impact of acute ROS treatment on TRPM2 and TRPC3 channel gating function has been examined in several earlier studies (Balzer et al. 1999; Hara et al. 2002). However, little is known about the role of prolonged elevations in cellular ROS levels, as implicated in BD, on

TRPC3/TRPM2 channel expression and function. The aims of this study were to determine whether TRPC3 and TRPM2 channel expression in human cell lines that are derived from healthy subjects and BD-I patients are modulated by the effects of acute or chronic stressor treatment and differentially regulated in response to oxidative stress. We report here chronic, but not acute exposure to oxidative stress decreases TRPC3 protein expression and blunts TRPM2- mediated Ca2+ entry in BLCLs. Moreover, BLCLs from BD-I patients exhibit greater susceptibility to cell death and differential sensitivity of TRPM2-mediated Ca2+ flux to acute

86 oxidative stress compared with healthy subjects, further supporting reduced cellular resilience in

BD-I.

4.3 Methods

4.3.1 Preparation of B Lymphoblast cultures

B lymphoblast cell lines were regrown from frozen stocks prepared from BD-I patients and healthy controls participating in our studies of signal transduction disturbances in mood disorders and cultured as previously described (Yoon et al. 2001; Andreopoulos et al. 2004; Wasserman et al. 2004). Patients had a DSM-IV diagnosis of BD-I as established by the Structured Clinical

Interview for DSM-IV (SCID) (American Psychiatric Association 1994), were physically healthy, and had no recent (within the previous 3 months) drug or alcohol abuse. Healthy subjects had no past or current psychiatric illness as determined by SCID-I (non-patient version) and were physically healthy as determined by systems review and physical examination. Subject demographics are listed in Table 3-1. All subjects provided informed written consent. This study was approved by the Human Subjects Review Board at the Centre for Addiction and Mental

Health.

BLCLs were treated with the oxidative stressor rotenone (2.5 µM and 10 µM, Sigma, Oakville), acutely (24 hours) and chronically (4 days), or with respective vehicle (0.01% DMSO) controls.

To maintain constant stressor concentration in the chronically treated cell lines, BLCL media and rotenone was replaced after 48 h of drug exposure. Cells were counted using a hemocytometer and viability determined by trypan blue exclusion (Emamghoreishi et al. 1997) and propidium iodide (see below). All cell culture materials were obtained from Invitrogen (Burlington, ON) unless otherwise specified.

4.3.2 Determination of cell viability using propidium iodide

Cell viability, a measure of resilience to cell stressors, was estimated using propidium iodide as previously described (Sattler et al. 1997). Briefly, BLCLs were suspended in Hank’s buffered saline solution (HBSS), transferred onto 96-well plates (1.0 x 105 cells/well) and incubated at

37oC for 1 h. Propidium iodide solution (50 µM) was then added followed by an additional incubation of 15 min at 37oC. Endpoint fluorescence measurements were then performed at room temperature on a fluorescent microplate reader (Fluoroskan Ascent FL, Thermo Scientific,

Nepean, ON, Canada) with excitation/emission at 544 nm/590 nm. Percent change in viability was calculated using a maximum signal intensity (Fmax) measurement taken from cells exposed to a lethal dose (300 mM) of H2O2 for 15 min [100-((Fstress treatment)/(Fmax) x100)].

4.3.3 Measurement of intracellular Ca2+ levels

TRPM2- and TRPC3-mediated Ca2+ fluxes after acute and chronic treatment with rotenone were measured using the Fluo-4 No-Wash Ca2+ assay (Invitrogen) in the presence of their respective activators: H2O2 (500 µM; HBSS vehicle) and 1-oleoyl-2-acetyl-sn-glycerol (OAG [Cedarlane,

Burlington, ON]) (100 µM; 0.75% DMSO vehicle). After removal of media, BLCLs were resuspended in assay buffer, transferred onto a 96-well plate (1.0 x 105 cells/well), and incubated at 37oC for 1 h. Per manufacturer’s instructions, an equal volume of 2X dye loading solution was

o added, followed by incubation for 45 min at 37 C. Baseline fluorescence measurements (Fo) were taken for 20 s followed by activator addition and additional measurements (F) every 5 s for

5 min performed at 37oC with excitation/emission at 485/518 nm. Relative fluorescence values

2+ (F/Fo) were used to quantify the peak height, rate of Ca rise, area under the curve, and magnitude of the post-peak plateau following OAG and H2O2 stimulation. Experiments were also conducted after pre-incubation (10 min) with flufenamic acid (100 µM, Sigma) and

88 clotrimazole (20 µM, Sigma) dissolved in DMSO (final concentration of 1% DMSO per well), inhibitors of TRPM2 Ca2+ fluxes (Nazıroğlu et al. 2007; Olah et al. 2009), to confirm TRPM2 mediation (Figure 4-1).

2+ Figure 4-1 TRPM2 inhibitors significantly decreased H2O2-mediated Ca entry

2+ H2O2-stimulated Ca influx in BLCLs is markedly reduced by TRPM2 inhibitors, flufenamic acid (A, 100 µM) and clotrimazole (B, 20 µM). Representative Ca2+ curves are shown.

4.3.4 RT-PCR detection of TRPC3, TRPM2 and HO-1 transcripts

Real-time quantitative PCR was performed using an ABI 7300 cycler (Applied Biosystems,

Foster City, CA, USA) to assess transcript abundance of TRPC3, TRPM2, heme oxygenase 1

(HO-1), and glyceraldehyde 3-phosphate dehydrogenase (GAPDH, the comparator gene) after acute and chronic treatment of BLCLs with rotenone and vehicle controls. Total RNA was extracted from 1.0 x 107 cells using an RNeasy® kit (QIAGEN, Mississauga, ON) with on- column DNase digestion following the manufacturer’s instructions. First-strand cDNA synthesis was performed using random hexamers and SuperScript III® reverse transcriptase. Gene-specific primer pairs (TRPC3: sense 5’ GGCCGCACGACTATTTCT 3’, antisense 5’

AGCCCCTTGTAGGCATTG 3’; TRPM2: sense 5’ CTACCTCGGAAGCTGAAGCG 3’, antisense 5’ TCCTGGGAGACTCGGACGTAC 3’; HO-1: sense 5’

CCACCAAGTTCAAGCAGCTC 3’, antisense 5’ CTGACTGCGGGAGTCATCTC 3’;

GAPDH: sense 5’ CGCTCTCTGCTCCTCCTGTT 3’, antisense 5’

CCATGGTGTCTGAGCGATGT 3’ [primers synthesized by ACGT, Toronto, ON]) were designed using Primer Express® v2.0 (Applied Biosystems, Foster City, CA, USA). The RT-

PCR conditions were as follows: 50°C for 2 min then 95°C for 10 min followed by 40 cycles of

95°C for 15 s and 60°C for 1 min. Measurements of ΔCt [Ct (gene of interest)-Ct (GAPDH)] and

ΔΔCt [ΔCt rotenone-treated - ΔCt vehicle-treated] (Livak et al. 2001) were made in triplicate for each sample with Sybr Green PCR Master Mix (Applied Biosystems) following the manufacturer’s guidelines. All PCR materials, except those noted, were from Invitrogen.

4.3.5 Western blotting

Quantification of the TRPC3 present in BLCL lysates was performed using standard immunoblotting protocols and commercially available antibodies, as previously described

(Roedding et al. 2009). To prepare the cells for Western immunoblotting experiments, 1% SDS

(100oC) was added to a pellet of 1.0 x 107 cells for 3 min followed by sonication (Vibra-Cell

Sonicator, Sonics & Materials, Inc., Newton, CT, USA) for 30 s at 30% intensity. Lysates were then loaded onto 7.5% polyacrylamide gels, and TRPC3 and α-tubulin (loading control) were resolved electrophoretically as detailed in Roedding et al. (Roedding et al. 2009). After transfer to PVDF membranes, proteins were immunolabelled with primary and secondary antibodies as previously described (Roedding et al. 2009) and visualized with enhanced chemiluminescence reagents (Amersham Pharmacia, Baie d'Urfe, QC), with chemifluorescence quantified on a

Molecular Dynamics™ Storm™ phosphorimaging system using ImageQuant 5.2 software

(Amersham Pharmacia). The results are displayed as signal intensity using arbitrary units.

Samples from individual cell lines were run in triplicate on the same gel including vehicle and both stress conditions to avoid confounding effects of interblot variability. Immunoreactive signals were normalized against their loading control, α-tubulin, and then to a reference standard

(a pool created from multiple BLCLs from different subjects) included on all blots.

4.3.6 Statistics

Statistical analyses were performed with the SPSS statistical software, v18 (IBM, Armonk, NY,

USA). The data are presented as means ± SD. Repeated measures ANOVA was used to analyze the effect of stressor concentration (within factor) on cell viability, and mRNA and protein expression of the various genes of interest, with pair-wise comparisons corrected for multiple testing (Bonferonni correction). Calcium fluxes were also analyzed using repeated measures

ANOVA and t-tests were used to compare means between BD-I patient and healthy control groups at the various stressor concentrations. Differences with two-tailed probability values of p≤0.05 were considered significant.

4.4 Results

4.4.1 Subject demographics

Table 4-1 details the demographics of the BD-I patients and healthy subjects whose cell lines were selected for this study to examine the effects of oxidative stress on TRPC3 and TRPM2 channel expression in BLCLs. The mean age of BD-I patients was not statistically different from that of the healthy controls used (t=0.039, p=0.97) and no difference was detected in gender distribution amongst groups (X2=0.091, p=0.763). All BD-I patients included in the study had a family history of mood disorder.

Table 4-1 Demographic characteristics of bipolar I disorder patients and comparison subjects

aCharacteristic not applicable for the healthy comparison group. bThese categories are nonexclusive; an individual may meet more than one criterion. cIncludes bipolar, major depressive, seasonal affective, and schizoaffective disorders.

4.4.2 Effects of rotenone on cell viability and ROS levels

Given the possible role of mitochondrial dysfunction in the pathophysiology of BD, we used rotenone as a tool to generate intracellular ROS at the mitochondrial level. Rotenone is known to generate superoxide radicals through complex I inhibition and ATP depletion in the mitochondrial electron transport chain (Li et al. 2003). Preliminary experiments were conducted to establish the rotenone concentrations that resulted in sustained elevations in ROS levels in

BLCLs with limited cell death for up to 4 days of stressor treatment. Exposure of BLCLs to rotenone (2.5 and 10 µM) for 4 days resulted in dose-dependent increases [F(2,9)=20.64, p=0.001] in HO-1 mRNA levels, a sensitive index of oxidative stress (Keyse et al. 1990) (Fig 4-

2B). In addition, the viability of BLCLs both from BD-I subjects and healthy controls after 4 days of treatment with 2.5 and 10 µM rotenone (n≥11), as measured using propidium iodide and trypan blue assays, decreased dose dependently from 70% to approximately 56% and 40%, respectively (see Fig 4-2D). There was also a significant effect of rotenone treatment on cell viability after acute treatment [F(2,9)=20.309, p<0.001]. BLCLs from BD-I patients displayed a small but statistically significant lower cell viability compared with healthy subject BLCLs in the absence of acute rotenone exposure. Despite this, an interaction between diagnosis and the effect of rotenone on viability was still apparent [F(2,9)=5.483, p=0.014] (Fig 4-2C). BD-I patient

BLCLs showed a modest though statistically significant increase in cell death in response to rotenone as compared to healthy controls (2.5 µM: 14%, 10 µM: 11%) that was greater than that observed in the absence of rotenone (0 µM: 6%). No such effect was observed in BLCLs from healthy subjects treated acutely with rotenone. However, this differential effect on cell viability between comparison groups was no longer evident after chronic rotenone treatment

[F(2,9)=0.666, p=0.526].

Figure 4-2 Oxidative stress increases HO-1 mRNA levels, differentially affects viability in

BLCLs from BD-I subjects versus healthy controls, and decreases TRPC3 protein levels with chronic exposure.

Figure 4-2 (A, B) Relative quantitative RT-PCR was used to measure HO-1 mRNA levels after

24-hour and four-day rotenone (vehicle, 2.5 µM, 10 µM) treatment. Data are represented as fold change with respect to the vehicle condition. (C, D) The effect of stressor treatment on the percent viability of BLCLs was measured using propidium iodide (50 µM). (E, F) Protein levels of TRPC3 were quantified in BLCLs using standard immunoblotting procedures after 24-hour and four-day treatment with rotenone (vehicle, 2.5 µM, 10 µM). Representative immunoblots and box-plots of tubulin-normalized signal intensity (arbitrary units) are shown. Data (A–D) are presented as the mean ± standard deviation (SD) of separate experiments on BLCLs from BD-I patients (n = 6, white bars) and healthy controls (n = 5, gray bars). ap < 0.05; bp < 0.001; cp <

0.005.

4.4.3 Changes in TRPM2/TRPC3 channel expression after acute and chronic rotenone treatment of BLCLs

Acute (24 h) exposure of BLCLs to rotenone (2.5 and 10 µM) did not alter TRPC3 protein levels in BLCLs [F(2,9)=0.231, p=0.796] in either subject comparison group (Fig 4-2E). In contrast, there was a dose-dependent and statistically significant decrease in TRPC3 protein levels at 4 days of rotenone treatment [F(2,9)=6.356, p=0.008], with no interaction with diagnosis observed

[F(2,9)=0.433, p=0.655] (Fig 4-2F). The TRPC3 mRNA levels in BLCLs were too low to reliably quantify (Ct values ~34-36, 3 ng cDNA template). In addition, there was no difference in

TRPM2 mRNA levels after either 24 h or 4 day rotenone treatment (see Fig 4-3A,B). No stress- induced changes were evident in the mRNA or protein levels of the internal references, GAPDH

(mRNA) and α-tubulin (protein), used.

Figure 4-3 No significant difference in TRPM2 mRNA expression was noted in BLCLs.

TRPM2 mRNA levels were quantified by RT-PCR after 24 h (A) and 4 day (B) rotenone treatment. Data is represented as the mean fold change with respect to the vehicle condition ± SD of separate experiments on BLCLs from BD-I patients (N=6, white bars) and healthy controls

(N=5, dark bars).

4.4.4 Functional impact of oxidative stress on TRPC3/TRPM2 channels

To determine whether reductions in TRPC3 protein levels were accompanied by reduced

2+ functionality, activation of TRPC3 mediated Ca influx was estimated using the diacylglycerol analog OAG (100 µM), which directly gates Ca2+ entry via this channel (Hofmann et al. 1999) in

BLCLs (Roedding et al. 2006). Stimulation with OAG caused a steady increase in intracellular

Ca2+ levels followed by a period of restitution to resting Ca2+ levels, as quantified using relative fluorescence units (Fig 4-4A). To compare channel activity between durations of stress treatment and diagnostic groups, the peak height, rate of Ca2+ influx and the relative fluorescence value five minutes after activator addition (decay phase) were quantified. Chronic rotenone treatment resulted in significant blunting of the Ca2+ response in both BD-I and control groups elicited by

OAG in comparison to acute treatment. Reductions in peak height (29%, t=5.06, p<0.001, n=11) and Ca2+ level of the decay phase (7%, t=3.06, p=0.012, n=11, data not shown) were observed upon 10 µM rotenone treatment for 4 days (Fig 4-4B). Furthermore, after both acute and chronic stressor treatment there was a significant effect of rotenone dose on channel activity (Fig 4-4D-

G) with peak height [24 h: F(2,9)=4.89, p=0.020, 4 d: F(2,9)=59.98, p<0.001] and rate of Ca2+ entry [24 h: F(2,9)=4.08, p=0.035, 4 d: F(2,9)=12.42, p<0.001] showing decreases whereas the decay phase was reversed with significant intracellular Ca2+ accumulation [24 h: F(2,9)=6.21, p=0.009] at higher stressor concentrations (data not shown). There was no diagnostic difference detected in the OAG-activated TRPC3 signalling parameters measured in BLCLs from BD-I patients as compared to healthy subjects.

Figure 4-4 Chronic oxidative stress treatment decreases TRPC3 channel responsivity.

(A) TRPC3 function was measured using OAG (a TRPC3 activator) and the intracellular Ca2+- sensitive dye, Fluo-4. A representative Ca2+ response profile is shown after OAG (100 µM) addition in BLCLs treated chronically with rotenone (vehicle, 2.5 µM, 10 µM). The (B) peak height and (C) rate of Ca2+ influx are shown after both 24-hour (gray bars) and four-day (white bars) rotenone treatment. Bar graphs illustrating peak height (D, E) and rate of Ca2+ influx (F, G) in response to OAG addition show BD-I patient (white bars) responses versus healthy controls

(gray bars) at different rotenone doses (vehicle, 2.5 µM, 10 µM) and treatment durations (24- hour, four-day). Data are presented as the mean ± standard deviation of separate experiments on

BLCLs from BD-I patients (n = 6) and healthy controls (n = 5). ap ≤ 0.05; bp < 0.001.

2+ TRPM2 channel activity was measured as the Ca response to 500 µM H2O2 challenge (Hara et al. 2002; Fonfria et al. 2005). However, as H2O2 does not selectively activate TRPM2 channel gating we first confirmed that this response is largely TRPM2 mediated by assaying representative subject samples in the presence and absence of flufenamic acid and clotrimazole,

2+ 2+ inhibitors of TRPM2 Ca influx (Hill et al. 2006; Olah et al. 2009). The H2O2-activated Ca responses in BLCLs were largely attenuated by flufenamic acid (88% ± 12, Fig 4-1A) and

2+ clotrimazole (90% ± 8, Fig 4-1B). The Ca response generated by H2O2 is characterized by a slow gradual increase in intracellular Ca2+ levels (Fig 4-5A) (Naziroglu et al. 2011). For this

2+ reason, the AUC and rate of Ca influx were used to quantify and compare the H2O2-induced

Ca2+ response among treatment concentrations and between subject comparison groups. Similar to TRPC3 responses, a significant decrease in the measured parameters of TRPM2 channel response was observed at both 2.5 and 10 µM rotenone after chronic treatment compared with acute (2.5 µM: AUC, 4%, t=5.00, p=0.001; rate, 7%, t=4.18, p=0.002; 10 µM: AUC, 4%, t=2.97, p=0.014; rate, 7%, t=3.35, p=0.007, n=11) (Fig 4-5B,C). There was no detectable effect of acute rotenone treatment on the AUC [F(2,9)=2.91, p=0.080] or the rate of Ca2+ influx [F(2,9)=1.25, p=0.311] in BLCLs. However, there was a significant interaction between subject group and rotenone concentration on the TRPM2 Ca2+ responses [AUC: F(2,9)=8.29, p=0.003, rate:

F(2,9)=10.43, p=0.001] (Fig 4-5D,F). Post hoc comparisons of AUC and rate using paired t- tests within subject group showed that TRPM2-mediated Ca2+ responses in BLCLs from healthy controls decreased upon rotenone treatment (2.5 µM: rate, 3.6%, t=3.53, p=0.024; 10 µM: AUC,

5.3%, t=3.24, p=0.032; rate, 5.0%, t=4.35, p=0.012), whereas BD-I subject responses increased

(10 µM: AUC, 2.4%, t=3.32, p=0.021) or showed no difference. Interestingly, chronic treatment resulted in significant effects of rotenone concentration on TRPM2 channel activity [AUC:

100

F(2,9)=22.86, p<0.001, rate: F(2,9)=17.4, p=0.001] but no differences were observed between subject comparison groups at this treatment duration (Fig 4-5E,G).

Figure 4-5 TRPM2-dependent Ca2+ fluxes are reduced in bipolar I disorder (BD-I) patient cell lines in comparison to healthy controls.

101

Figure 4-5 TRPM2 function was measured using H2O2 (a TRPM2 activator) and the intracellular

2+ 2+ Ca -sensitive dye, Fluo-4. (A) A representative Ca response profile is shown after H2O2 (500

µM) addition in BLCLs treated chronically with rotenone (vehicle, 2.5 µM, 10 µM). The area under the curve [(AUC) arbitrary fluorescence units] (B) and rate of Ca2+ influx (C) are shown after both 24-hour (gray bars) and four-day (white bars) rotenone treatment. Bar graphs

2+ illustrating AUC (D, E) and rate of Ca influx (F, G) in response to H2O2 addition show BD patient (white bars) responses versus healthy controls (gray bars) at different rotenone doses

(vehicle, 2.5 µM, 10 µM) and treatment durations (24-hour, four-day). Data are presented as the mean ± standard deviation of separate experiments on BLCLs from BD-I patients (n = 6) and healthy controls (n = 5). ap < 0.05; bp < 0.001.

4.5 Discussion

Among the principal findings in this study, chronic, but not acute exposure to mitochondrial generated oxidative stress was found to decrease TRPC3 channel protein expression in human

BLCLs. Moreover, this effect was associated with a reduction in channel functionality. To our knowledge, this is the first demonstration of such an effect of chronic stress of mitochondrial origin. Second, challenge with H2O2 revealed a significant differential reduction in TRPM2 channel function in BLCLs from BD-I patients in comparison to cells from healthy subjects.

Third, cell lines from BD-I subjects were found to be more vulnerable to the effects of rotenone- induced mitochondrial stress, showing reduced cell viability acutely compared with cells from age- and sex-matched healthy subjects. These latter two findings add further support to the notion that cells from BD-I patients exhibit reduced resilience to stressor insults (Schloesser et al. 2007).

102

The observed decreases in TRPC3 protein levels induced by chronic rotenone treatment led us to examine the effects of prolonged ROS elevation on channel function. As expected, the magnitude of OAG-induced activation of TRPC3 mediated Ca2+ fluxes was diminished after chronic stressor treatment in comparison with acute. This decrease in functionality corresponded with the reduction in protein levels of TRPC3. Interestingly, acute rotenone exposure resulted in higher Ca2+ levels in the post OAG-stimulation decay phase, a period in which Ca2+ is restored to resting levels. This prolonged decay phase may reflect cellular adaptation to maintain Ca2+ homeostasis upon stress exposure. Though not examined in this study, the changes in TRPC3 channel levels and function observed may be due to stress-induced alterations in intracellular

Ca2+ signalling affecting the activity of regulatory transcription factors such as the calcineurin ⁄ nuclear factor of activated T-cells and Ca2+⁄calmodulin-dependent protein kinase ⁄cAMP response element binding protein pathways (Ermak et al. 2002). Both of these pathways have been implicated in the transcriptional regulation of TRPC3 expression in previous studies

(Pigozzi et al. 2006; Morales et al. 2007). It is also possible that oxidative stress exposure resulted in post-translational protein modifications and/or instability that lead to the observed changes in channel expression rather than modulation of TRPC3 transcription levels, as mRNA levels could not be quantified in this study. Functionally, rotenone-induced changes in TRPC3 responses may result from disruptions in scaffolding proteins involved in the TRPC3 signal complex (Groschner et al. 2005), direct oxidative modifications of TRPC3 channel residues

(Yamamoto et al. 2010), or simply the decrease in protein levels as described here.

The reduction in TRPC3 protein levels in BLCLs after chronic but not acute oxidative stress exposure is not a general response of the cells to stress as the housekeeping gene, α-tubulin, which was used as a reference protein, was unaffected by stressor treatment. Moreover,

103 expression of HO-1, which is known to be highly sensitive to oxidative stress responses, was upregulated by chronic but not acute rotenone treatment. One other study has examined oxidative stress induced by the effects of high glucose on TRPC3 levels, in this case in human monocytes

(Wuensch et al. 2010). Increases in TRPC3 expression amongst other TRP channels was observed after only 4 hours of treatment, in contrast to our findings. This discrepancy may be due to differences in the site and type of ROS generation between that induced by high glucose as compared to rotenone exposure, and/or cell-type dependent differences in the regulation of

TRPC3 expression.

In contrast to the apparent resistance of TRPM2 expression to oxidative stress, TRPM2 channel function was significantly reduced in both magnitude and rate of TRPM2-mediated Ca2+ influx after chronic rotenone treatment in comparison to acute (Fig. 4-5 B,C). These changes in channel response may be due to oxidative stress-induced depletion of second-messengers such as ADP- ribose and NAD+ involved in TRPM2 activation (see section 1.5.2) and/or a shift in the ratio of the full-length form of TRPM2 protein to the short form, which is known to inhibit ROS-induced

Ca2+ fluxes through the full-length TRPM2 channel (Yamamoto et al. 2010). Alternatively, direct oxidative modifications of TRPM2 channel residues, such as cysteines located in the pore region, may occur, albeit this has not been reported to date as a mechanism of TRPM2 regulation.

An interesting interactive effect of subject group on TRPM2-mediated Ca2+ flux also merits comment as this demonstrates an inherent difference in TRPM2 responsivity in BD-I subject cell lines in comparison with healthy controls. Genetic association of TRPM2 variants with BD has been reported although a specific functional effect of any of the associated variants has yet to be demonstrated (Xu et al. 2006; Xu et al. 2009). However, the diagnostic interaction observed

104 acutely was not seen chronically. This is possibly the result of a mild stressor effect that chronic treatment with the vehicle, DMSO (0.01%) has on the cell (Santos et al. 2003),

“preconditioning” the cells in a way that alters TRPM2 functionality, thereby masking or abrogating the subject group difference that is observed in the vehicle condition acutely. It is also important to note that DMSO itself has antioxidant properties (Sanmartín-Suárez et al. 2011).

Of additional note, measures of oxidative stress effects on cell viability demonstrated that

BLCLs from BD-I subjects display significantly lower cell viability in comparison to healthy controls with and without acute rotenone treatment. Evidence of increased cell death has also been noted in unstressed olfactory neuroepithelium explant cultures derived from BD-I subjects in comparison to healthy controls and individuals with schizophrenia (McCurdy et al. 2006).

These findings concur well with the current hypothesis of altered resilience and plasticity in the pathophysiology of BD (reviewed in Schloesser et al. 2007). It is thought that mitochondrial dysfunction and/or impaired ER stress responses compromise the ability of BD subject cell lines to adapt to stressor insults (So et al. 2006; Schloesser et al. 2007). Since the subject group difference observed in BLCL viability was not evident after chronic stressor exposure, this suggests that the more robust cellular resilience of healthy controls is eventually compromised with prolonged treatment at these stressor concentrations.

As mentioned above, lithium treatment of BLCLs from BD-I patients decreases TRPC3 protein levels (Andreopoulos et al. 2004). As lithium is thought to induce antioxidant mechanisms within the cell (Allagui et al. 2009), based on the results reported here, it would be expected that lithium would increase rather than decrease TRPC3 protein levels. In fact, lithium treatment of neuronal cells derived from rat brain was found to increase TRPC3 protein levels in contrast to the BLCL findings (unpublished data). These discrepancies may be attributed to cell type-

105 dependent differences in the molecular effects of lithium as this prototypical mood stabilizer has many intracellular targets and may alter TRPC3 protein levels through pathways unrelated to

ROS attenuation (Quiroz et al. 2010). Furthermore, the ability of lithium to decrease TRPC3 protein levels was observed in BLCLs that were not rotenone treated.

In consideration of the potential limitations of the study, the sample size reported on is small, limiting the power of the statistical analyses. The protein levels of TRPM2 were not quantified due to the variability and insensitivity observed with the commercially available antibodies.

Moreover, the specificity of the activators used to examine TRPM2 functional responses is also an important consideration. Both flufenamic acid and clotrimazole, agents that inhibit TRPM2 channel gating as determined electrophysiologically (Olah et al. 2009), substantially inhibited

TRPM2 Ca2+ fluxes. Additionally, the use of BLCLs in this work allowed for the examination of dynamic cellular processes in living cells from healthy controls and BD subjects in a reporter cell model (Sie et al. 2009). The limitation of this cell model lies in the extent to which findings garnered from this non-excitable reporter cell type, which is of hemopoietic provenance, can be extrapolated to relevant brain cell types thought to be involved in the pathophysiology of BD.

2+ However, the gradual increase in intracellular Ca concentration that was induced by H2O2 addition in BLCLs has also been observed in dorsal root ganglion neurons (Naziroglu et al.

2011), suggesting that TRPM2 signalling may be similar in both cell types.

In summary, our research demonstrates that TRPC3 and TRPM2, two cation channels that act as signal integrators in the modulation of Ca2+ and oxidative stress signalling, are affected by chronic exposure to oxidative stress. TRPC3 protein expression and function are attenuated by chronic but not acute oxidative stress in BLCLs from both healthy controls and BD-I subjects. In contrast, TRPM2 channel function but not expression was decreased by chronic elevations in

106 oxidative stress levels in both subject groups. Therefore, elevations in cellular ROS levels that have been reported in BD would likely result in downstream effects through decreases in TRPC3 and TRPM2 channel function. These changes may compromise adaptive and/or protective responses mediated by these channels, thus contributing to the development of BD. Moreover,

BD-I subject cell lines show a remarkable increase in vulnerability to stressor effects on cell viability in comparison to healthy controls. This finding lends support to the hypothesis of altered cellular resilience as a core component of the pathophysiology of BD. Finally, this work has highlighted an inherent difference in TRPM2 channel functionality in BD-I subjects in comparison to controls, adding functional evidence to the genetic and differential expression findings implicating TRPM2 dysfunction in BD.

4.5.1 Acknowledgements

The assistance of Marty Green and Dharshini Ganeshan in growing and maintaining BLCL cultures was much appreciated. This research was supported by an operating grant from the

Ontario Mental Health Foundation. ASR was the recipient of a doctoral trainee award from the

Ontario Mental Health Foundation. AFG was the recipient of a CREMS summer research studentship supported by the Mach-Gaensslen Foundation of Canada. JJW and PPL acknowledge income received from our primary employer CAMH. All authors declare that, except for income received from the primary employer or trainee award, no financial support or compensation has been received from any individual or corporate entity for research or professional service and there are no personal financial holdings that could be perceived as constituting a potential conflict of interest.

107

5 Conclusions and Future Work

108

5.1 Summary of results

The primary objectives of this work were two-fold. The first objective was to investigate whether exposure to oxidative stress alters the expression and function of TRPC3 and TRPM2 channels in neuronal and/or astroglial cell contexts. Second, I wanted to determine whether disease relevant disturbances in expression and function of these channels are displayed in reporter cell lines from patients with bipolar I disorder, an illness in which mitochondrial derived oxidative stress has been implicated. I found that chronic (4 day), but not acute (24 hour) exposure to mitochondrially-generated oxidative stress resulted in significant decreases in TRPC3 protein levels in both human BLCLs and rat cortical neurons, and TRPC3 mRNA expression in rat cortical neurons (see Table 5-1 for a summary). This downregulation was also observed functionally; agonist-activated responses were significantly blunted in response to stressor treatment. In contrast, no change in TRPC3 channel expression was observed in rat astrocyte cultures.

The effects of oxidative stress on TRPM2 channels were less consistent although significant increases in channel expression were observed after both rotenone and paraquat treatment in rat cortical neurons. In human BLCLs, no change in TRPM2 mRNA expression was observed after either acute or chronic stress exposure. Nonetheless, agonist-stimulated Ca2+ responses were diminished in rotenone treated BLCLs. Therefore, this thesis work describes a novel mode of

TRP channel regulation in which prolonged exposure to elevated levels of oxidative stress affects both TRPC3 and TRPM2 channel expression and function.

Another important finding observed during the course of the study was the increased vulnerability of BLCLs from BD subjects to stressor induced cell death in comparison to healthy

109 controls. This difference further supports the notion that cellular resilience mechanisms are compromised in individuals with BD. Finally, this work has established the presence of TRPC3 protein in human frontal cortex and cerebellum throughout the lifespan. Confirming the expression pattern of TRPC3 in human brain was vital to the continued study of its physiological role in the brain and to the possible pathophysiology of BD.

Table 5-1 Summary of findings showing direction of change in TRPC3 and TRPM2 mRNA and protein levels after oxidative stressor treatment.

110

5.2 What are the possible mechanisms underlying ROS effects on TRPC3/TRPM2 channels?

Taken together, this thesis work has shown that acute oxidative stress exposure alters TRPM2 expression levels and TRPC3/TRPM2 channel function whilst chronic stressor treatment is necessary for downregulation of TRPC3 channel expression. Thus, it is interesting to consider the possible mechanisms underlying these changes and how they could lead to the different time profiles observed for these responses. The extended time course of treatment necessary to elicit changes in TRPC3 channel expression suggests this effect depends on downregulation at the transcriptional level, such as decreased activation of transcription factors and binding activity.

Moreover, both TRPC3 mRNA and protein levels were affected. Of particular interest, a rat model of cerebral ischemia-reperfusion, which is known to induce ROS levels, resulted in alterations of CREB, specificity protein 1 (Sp-1) and NF-ΚB transcription factor binding activity

5 days after the insult, but not after 24 hours (Salminen et al. 1995). However, this study reported increases in binding activity in contrast to the decreases noted in other studies of oxidative stress effects on transcription, likely due to different mechanisms underlying ischemia-reperfusion injury.

Transcription factors that have been implicated in TRPC3 gene expression are NFAT and CREB.

The TRPC3 promoter region contains response elements for both CREB and NFAT and inhibitors of these transcription factors or their effectors have been shown to decrease TRPC3 expression (Pigozzi et al. 2006; Morales et al. 2007; Poteser et al. 2011). Strikingly, the binding activities of NFAT and CREB and/or the activity of their effectors are decreased by exposure to oxidative stress (Wang et al. 1996; Iwata et al. 1997; Furuke et al. 1999; Reiter et al. 1999; Zou et al. 2006). This direction of change agrees with that observed for TRPC3 channel expression

111 after chronic ROS exposure in this study. Not only was calcineurin activity, an effector of

NFAT, diminished by oxidative stress, it has been shown that cellular stress in the form of H2O2 exposure or increased intracellular Ca2+ concentrations results in calcineurin inhibition through the binding of an inhibitory protein called RCAN1 (regulator of calcineurin, also known as

DSCR1/adapt78/calcipressin1) (Ermak et al. 2002; Lin et al. 2003). This inhibitory action of

RCAN1 on calcineurin appears to protect cells from stressor insults in the short term but chronic elevations of this protein have been linked to Alzheimer’s disease and Down’s syndrome (Ermak et al. 2001; Baek et al. 2009). Reactive oxygen species and Ca2+ signalling are intimately linked in many aspects of cellular functions. Therefore, it is possible that ROS-induced intracellular

Ca2+ signalling is in part responsible for the observed TRPC3/TRPM2 channel expression changes observed here. Not surprisingly the transcription factors mentioned above that are responsive to the redox status of the cell are also known to be modulated by Ca2+ levels through its effects on protein kinases and phosphatases (Sheng et al. 1990; Ermak et al. 2002; West et al.

2002). In fact, TRPC3-mediated Ca2+ influx has been shown to upregulate its own expression in a feed-forward loop in activated astrocytes (Shirakawa et al. 2010). In contrast to rat neurons, it has also been reported that the binding activity of CREB is upregulated in rat astrocytes upon

ROS exposure (Iwata et al. 1997). Perhaps this explains the discrepancy in my findings between rat cortical neurons and astrocytes. It is important to consider that astroglia and neurons subserve distinct physiological functions within the nervous system and therefore are likely to differ in their repertoire of responses to noxious stimuli (Raps et al. 1989; Desagher et al. 1996; Dringen et al. 1999; Pentreath et al. 2000; Almeida et al. 2001). Indeed, astrocytes are known to be more robust in their ability to withstand stressor insults whereas neurons are highly susceptible to injury (Schmuck et al. 2002). This difference was quite dramatic in my thesis work given that

112 astrocytes required approximately forty-times more rotenone to produce the same amount of cell death as in neurons (see section 3.4.5).

What accounts for the differences in expression of TRPC3 in comparison to TRPM2 after oxidative stress treatment? It is possible that the time course of ROS-induced increases in

TRPM2 expression is different due to the nature of the transcription factors required for its gene expression. TRPM2 has been tied to a different group of transcription factors than TRPC3, namely AP-1, myeloid zinc finger 1 (MZF-1), GATA-1, and 2 (Uemura et al. 2005). For instance, AP-1 is understood to be an immediate early gene family that can be activated by a variety of signals including noxious stimuli in the nervous system (Hunt et al. 1987; Perez-

Cadahia et al. 2011). This possible induction of transcription factors mediating TRPM2 gene expression after oxidative stress exposure rather than the inhibition of those that regulate TRPC3 expression may also explain the differential direction of change between these TRP channel subtypes upon ROS treatment. Further research is needed to fully understand the effects of elevated ROS levels on TRPM2 gene regulation; however it is clear from this work that oxidative stress exposure stimulates an increase in TRPM2 channel expression in rat cortical neurons.

How are elevated levels of ROS leading to decreased TRPC3 and TRPM2 activator-stimulated

Ca2+ responses both acutely and chronically? For TRPC3, the effect of acute oxidative stress exposure on channel functionality in BLCLs (Fig. 4-4) is not the result of alterations in channel expression given that mRNA and protein levels were unchanged at this time point. It is more likely that direct oxidative modifications of susceptible channel residues are occurring (as outlined in section 1.5.3). TRPC5, as well as several other NO-responsive TRPC and TRPV proteins, contain two cysteine residues (Cys553 and Cys558) in the pore forming region that play

113 a role in channel activation via S-nitrosylation (Yoshida et al. 2006). While TRPC3 and TRPM2 channels lack this structural motif in the pore-forming region, it is possible that a similar activation gate is present in a different location. Further characterization of TRPC3 channel gating and structure is needed to identify putative channel residues that are responsive to oxidative stress. After 4 days of stressor treatment, TRPC3 mRNA, protein and activator- stimulated Ca2+ influx were all decreased in both rat cortical neurons and BLCLs upon oxidative stress treatment. The observed attenuation of channel functionality can therefore likely be explained by the decrease in the number of channels present in addition to any direct ROS effects on function that were noted acutely. Furthermore, both TRPC3 and TRPM2 channels reside in a complex signalling environment in which other second messengers and cation fluxes are produced through the cooperation of many intracellular systems, including various organelles, plasma membrane channels, and accessory proteins (Berridge, Lipp et al. 2000). One such protein, the transcription factor TFII-I, has been shown to compete with TRPC3 channels for

PLC-γ binding (Caraveo et al. 2006). As the TRPC3 interaction with PLC-γ is important for its translocation to the membrane, the mutually exclusive binding of TFII-I has been shown to decrease membrane surface expression of TRPC3 leading to attenuated agonist-activated Ca2+ entry (van Rossum et al. 2005; Caraveo et al. 2006). Interestingly, it has been shown that PLC-γ

2+ mediates intracellular Ca oscillations upon exposure to low doses of H2O2 (10-30 µM) in rat cortical astrocytes (Hong et al. 2006). Cellular Ca2+ oscillations represent a physiological mechanism that is used to transmit high fidelity signals encoded within the frequency of these oscillations to effectors in response to stimuli (Berridge 1997; Berridge et al. 1998). The signalling environment of TRPM2 also has to be taken into consideration. In human cell types, such as BLCLs, it is possible that TRPM2-S (short) is acting as an inhibitor of TRPM2-L (long)

114

(Zhang et al. 2003). Thus, changes in the ratio of TRPM2-S to TRPM2-L could alter channel gating upon activator addition.

5.3 Limitations

5.3.1 Statistical

It is important to consider the limitations of the research methodology when interpreting the findings. One such limitation is the small sample size used in the investigation of TRPC3 and

TRPM2 in BLCLs (Chapter 4). The work-intensive cell culture growth, expansion, and treatment of the BLCLs were limiting factors in the number of samples included in this part of my research program. However, the results of this thesis work did yield statistically significant differences between treatment groups and controls. Based on the results of my study and the recent acquisition of a more capable analytic platform that requires much fewer cells (a high content screening device: BD Pathway™ 855), a more extensive investigation in a larger sample size with comparison and validation with other patient derived cell types is justified. The high content screening device will not only allow for an expansion in the sample size but will also facilitate more accurate determinations of cell viability. In addition, the BD-I subjects used were selected for greater homogeneity based on clinical and diagnostic criteria and the healthy subjects were matched for age and gender. These would be expected to reduce the sample variances attributable to such factors thereby enhancing the possibility of detection of meaningful differences even with this small sample size and reducing the probability of type I errors.

Nonetheless important potential differences may have been missed due to the limited statistical power of the study sample analyzed here. Therefore, replication of this work with a larger sample size is suggested to confirm that the significant findings reported here are not a type I error. Research in the areas of mood disorders and neuropsychiatric conditions in general would

115 likely benefit from an increased accessibility to data through “open science” initiatives allowing increases in sample size through the pooling of data sets from different laboratories.

5.3.2 Research Design

Despite the novel findings this thesis work has uncovered, admittedly investigation of the mechanistic basis responsible for the changes that I observed would have been enlightening (see section 5.4.1 for suggestions of some potential strategies). However, it was essential to first establish that there was a relationship between chronic, and not acute, elevations of ROS and changes in TRPC3 expression and function. A thorough examination of this relationship through the use of multiple stressors and cell types was conducted. The results of this work have demonstrated that exposure to mitochondrial stressors leads to intracellular Ca2+ regulation due to alterations in TRPC3 and TRPM2 expression and/or function, and that the duration of stressor treatment matters.

Do the reductions in TRPC3 expression levels occur before the stress-induced cell death processes begin or afterwards as part of a generalized dampening of transcription and translation? It is my hypothesis that the observed reduction in TRPC3 expression levels occurs prior to activation of cell death cascades. Firstly, this is supported by clear reductions in OAG- stimulated TRPC3 channel activation in rotenone treated neurons and BLCLs, an assay that is measuring responses in live cells. Secondly, the fact that TRPC1 and TRPC5 (Tong 2012) mRNA expression levels were unchanged after chronic rotenone treatment supports that the observed reduction in TRPC3 levels is not related to general effects of cell death but is rather a targeted downregulation of TRPC3 (and TRPC6, Tong 2012) channels.

116

What is the identity of the non-specific bands in the TRPM2 immunoblot observed using rat cortical neuron protein lysates (Fig. 3-2)? A clear and distinct band was observed at the expected molecular weight for TRPM2 at 170 kDa in protein lysates from rat cortical neurons. Additional bands at approximately 90 and 130 kDa were also present and seemed to decrease in signal intensity upon stressor exposure. It is possible that these bands represent shorter splice variants of TRPM2 as these are present in humans (Zhang et al. 2003). However, no such variants have been noted in mouse and rat to date. I was unsuccessful in my attempts to identify the bands at

90 and 130 kDa using mass spectrometry and co-immunoprecipitation. Thus, further investigation is warranted to determine the identity of these bands and whether the expression of these proteins is indeed responsive to oxidative stress exposure.

5.3.3 Definition of acute and chronic stress treatment

It can be difficult to define what constitutes acute and chronic stressor treatments. For the purposes of my work, acute stressor treatment represented a duration of 24 hours and chronic stress was defined as 4 days. The terms “acute” and “chronic” are used somewhat arbitrarily to represent a wide range of time periods for treatments/interventions across the literature. In neuronal cell culture experiments, application of stressors such as H2O2, ethanol, and buthionine sulfoximine (BSO; γ-glutamylcysteine synthetase inhibitor) have been used “chronically” anywhere from 1-14 days (Carvour et al. 2008; Alberdi et al. 2010; Marín et al. 2010; Su et al.

2010). One particularly interesting study applied amyloid β oligomers to rat cortical neurons for

4 days, which resulted in increased intracellular Ca2+ concentrations and mitochondrial dysfunction (Alberdi et al. 2010). In animal models, chronic stress paradigms, in the form of restraint or corticosterone exposure, have been defined as 10-40 days (Watanabe et al. 1992;

Magariños et al. 1997; Wellman 2001; Radley et al. 2008; Hains et al. 2009; Lucca et al. 2009;

117

Liston et al. 2011). However, it has been shown that 7 days of brief restraint stress (10 minute each day) was sufficient to induce changes in dendritic morphology of the prefrontal cortex of male rats similar to that found in longer treatment paradigms (21 days) (Brown et al. 2005), whereas 1 day was insufficient to produce these changes in rat hippocampus and amygdala

(Magariños et al. 1997; Mitra et al. 2005). For the purposes of my thesis work the treatment durations were selected to allow comparisons between a “short” stressor challenge with an

“extended” time point in which changes at the transcriptional and/or post-translational level could be observed. The amount of time that primary cortical neurons could be treated with oxidative stressors in cell culture was limited by the capacity of the neurons to maintain viability under these conditions, as well as the relatively short lifespan of primary neuronal cultures in general (untreated). The stressor treatment paradigm developed for use with the neurons was then applied to my investigation of these oxidative stress-induced processes in BLCLs so direct comparisons could be made.

5.4 Future Work

5.4.1 Examine the mechanism of ROS effects on TRPM2/TRPC3

The next logical set of experiments that could further expand the impact and significance of this thesis work involve the investigation of the mechanism(s) underlying the ROS regulation of

TRPC3 and TRPM2 channel expression and function. There are several strategies that could be used to explore this mechanism(s).

a) To determine if the rate of transcription is affected by ROS treatments, a standard nuclear

run on assay could be performed (Cheadle et al. 2005; Cantin et al. 2006; Smale 2009). To

examine mRNA stability post-transcriptionally, effects of the different treatment

conditions on transcript abundance could be measured over time using RT-PCR following

118

actinomycin D treatment, which blocks further transcription. Protein turnover could also be

assessed after treatment with cycloheximide (blocks further protein translation so protein

half-life can be determined).

b) Rather than relying on the more general approaches listed above in (a), it would be useful

to study the effects of acute and chronic ROS exposure on transcription factors known to

be involved in TRPC3 and TRPM2 gene expression. For TRPC3, activity levels of NFAT

and CREB through examination of their phosphorylation states and translocation to the

nucleus using electrophoretic mobility-shift assays and standard western blotting

procedures could be conducted (Pigozzi et al. 2006; Morales et al. 2007; Poteser et al.

2011). It would also be interesting to inhibit elements of these signalling pathways such as

CaMK and calcineurin using KN-93 and cyclosporine A, respectively. These experiments

would help determine if ROS-induced downregulation in TRPC3 gene expression can be

reproduced through inhibition of these Ca2+-modulated transcription factors and their

effectors. For TRPM2, transcription factor binding sites for AP-1, MZF-1, GATA-1, and 2

have been identified (Uemura et al. 2005). Given the effect of H2O2 addition on AP-1

activity as described above (section 5.2.1), particular attention on the role of this

transcription factor in ROS-mediated effects on TRPM2 gene expression is warranted.

Finally, the measurement of a large number of transcription factor and microRNA levels

using microarrays could also help to determine whether levels of these regulatory elements

are altered by oxidative stress treatment in the cell models used here.

c) To investigate whether direct oxidative modifications of TRPC3/TRPM2 channel proteins

alter their functionality, strong oxidizing and reducing agents such as cholesterol oxidase

can be used to mimic post-translational oxidative stress effects in a membrane-delimited

manner (Poteser et al. 2006). This enzyme is a robust oxidizing agent that has previously

119

been used to activate TRPC3 currents through its oxidative effects (Groschner et al. 2004;

Poteser et al. 2006). Cell permeable and impermeable oxidizing agents (diamide versus

5,5’-dithio-bis-(2-nitrobenzoic acid) [DTNB], respectively) could be applied to determine

which domains of the proteins are functionally affected by oxidation and to confirm

possible findings obtained with cholesterol oxidase. One could determine whether these

agents are able to produce Ca2+ fluxes alone or whether they sensitize/inhibit subsequent

channel activation upon addition of TRPM2/TRPC3 activators. Diamide is a membrane

permeable thiol oxidant that rapidly oxidizes glutathione, and perturbs redox balance

(Susankova et al. 2006). DTNB, on the other hand, is membrane impermeable (Susankova

et al. 2006; Yoshida et al. 2006). If it is determined that Ca2+ fluxes are altered by these

treatments, then measures of sulfenic acid, a product of oxidation of the thiol in cysteine

residues, could be performed to quantify the extent of cysteine oxidation of

TRPC3/TRPM2 and to correlate this with the observed functional changes, thus

demonstrating that protein oxidation state affects channel functionality. Finally, the ability

of reducing agents, such as ascorbate and dithiothreitol, to reverse the observed functional

effects induced by treatment with oxidative stressors could be examined.

d) It is also possible that TRPC3 and TRPM2 protein translocation to the plasma membrane is

affected by exposure to ROS (Graham et al. 2010). Recent findings have highlighted the

important role protein translocation plays in TRP channel signalling (Cerny et al. 2011;

Richter et al. 2011). Therefore, approaches such as standard immunohistochemistry with

specific antibodies for TRPC3 and TRPM2 could be used to determine the cellular location

of these channel proteins before and after oxidative stress exposure. These experiments

could also be conducted using cells that have been transfected with fluorescently-tagged

expression constructs of TRPC3 and TRPM2. This would likely improve the visualization

120

of the target proteins within the cell but may alter the physiological responses of these

proteins (eg. trafficking) due to the addition of the tag and the altered stoichiometry of

channel subunits with other components of the signalling complex required for normal

function (Vazquez et al. 2003).

5.4.2 Investigate elevated levels of cell death in BD cells versus controls

As mentioned above (section 4.4.2), this thesis work uncovered an important diagnostic difference in the vulnerability of BLCLs from BD subjects to stressor-induced cell death. It is essential to explore this finding further in order to better understand the apparent difference in cellular resilience and what this could mean for the pathophysiology and potential treatment strategies for BD. To extend the findings of this study directly, this protocol could be repeated with a larger sample size that includes diagnostic comparison groups such as MDD, BD-II and/or schizophrenic individuals. It would also be compelling to determine whether treatment with an antioxidant, such as N-acetyl cysteine would be sufficient to rescue BD subject cell lines from stress-induced cell death. This would be particularly relevant given the recent interest in the use of N-acetyl cysteine as an effective adjunctive treatment for BD (Berk et al. 2011; Dean et al.

2011). In addition, repeating this study with endogenous stress hormones and milder stressors, such as cortisol, BSO, and/or mercaptosuccinate (glutathione peroxidase inhibitor) could confirm the physiological relevance of the results obtained here. Lastly, it would be intriguing to repeat the stressor paradigm used here in a neuronal cell line model derived from BD-I subjects and comparison healthy subjects, such as can be derived from olfactory neuroepithelial stem cells or induced-pluripotent stem cells. Previous studies have shown that olfactory epithelium derived primary neurons exhibit a greater degree of cell death in cells from BD subjects in comparison to

121 healthy controls and subjects with schizophrenia, in the absence of stressor treatment (McCurdy et al. 2006). My observations in the BLCLs used in this thesis work concur with the latter findings in implicating reduced cellular resilience in BD.

5.4.3 Investigate TRPM2 functional difference and expression changes

2+ Given the intriguing finding of an interaction between H2O2-induced Ca fluxes and diagnostic subject group, further experiments to investigate this relationship are warranted. Inclusion of other diagnostic comparison groups, such as MDD and schizophrenia would help determine whether the observed interaction is specific to BD. It would also be interesting to increase the sample size of the study as well as to stratify BD subjects based on the TRPM2 genotypes that have been found associated with BD in previous work from this laboratory (eg. rs1556314 in exon 11 and rs1612472 in intron 19, section 1.5.2). With regards to experimental methods, the use of a high content screening device (e.g. BD Pathway™ 855) to measure intracellular Ca2+ fluxes instead of the fluorescent plate reader (Fluoroskan Ascent FL) used here would increase the sensitivity of these measurements through acquisition of fluorescence images from single cells (or specific cellular compartments) rather than the composite value of a large number of cells within a microplate well. This change in methodology should increase the signal to noise ratio allowing better detection and characterisation of smaller differences. Furthermore, this technology allows for the differentiation between responding and non-responding cells within the field of detection, an important variable as this distribution appears to be dependent upon the agonist and the application conditions. Finally, electrophysiological examination and characterization of whole-cell TRPM2 channel currents in BLCLs from BD subjects and healthy controls after oxidative stress treatment could be used to further investigate the diagnostic

122 interaction noted in this thesis work. Patch-clamp experiments would allow for the addition of intracellular ADPR, a more specific TRPM2 channel activator, rather than the extracellular H2O2 addition used here (Perraud et al. 2001). Moreover, using a protocol similar to Kuhn et al. 2004, the effects of the BD-associated TRPM2 SNPs on channel function could be examined (Kühn et al. 2004). It is important to note that Kuhn et al. did not observe any functional effect of the SNP at marker rs1556314 (exon 11) in transfected Chinese ovary hamster cells. However, this finding was obtained at room temperature and subsequent to these experiments it has been shown that

TRPM2 activation is thermosensitive (Togashi et al. 2006). Togashi et al. demonstrated that

ADPR activation of TRPM2 channel currents was significantly potentiated by heat with the highest open probability for the channel at body temperature. Therefore, it is important to examine the functionality of the BD-associated SNPs at 37oC. Of note, all of the experiments examining channel function reported here were conducted at 37oC.

Due to the inhibitory effect of TRPM2-S on Ca2+ influx through TRPM2-L (Zhang et al. 2003), measuring the ratio of these variants may give further insight into the effect of ROS on TRPM2 channels. Therefore, it would be useful to quantify the mRNA of both the short and long TRPM2 variants in oxidatively stressed BLCLs rather than just the total mRNA levels that were measured here. In addition, improvements in the specificity of commercially available human

TRPM2 antibody should allow for the quantification of TRPM2 protein in BLCLs, contributing further useful information about the effect of acute and prolonged ROS exposure on TRPM2 channels. In fact, recent studies in our laboratory have had some success in optimizing TRPM2 protein detection in human samples (Uemura, unpublished data).

123

5.5 Significance: Unveiling the role of TRPC3/TRPM2 in the pathophysiology of BD

5.5.1 TRPC3 channels are present throughout the lifespan

The TRPC3 channel was first implicated as a potential pathophysiological candidate in the study of BD by our laboratory in an attempt to understand the dysregulation of intracellular Ca2+ homeostasis in non-excitable cells from BD patients. It was shown that chronic lithium treatment decreases TRPC3 channel protein expression in BLCLs and that hyperactive agonist-stimulated

Ca2+ responses are in part due to TRPC3-gated influx (Andreopoulos et al. 2004; Perova et al.

2008). In order to continue the study of TRPC3 as a possible component of a dysfunctional Ca2+ signalling network underlying the pathophysiology of BD, it was necessary to establish that this

Ca2+ channel protein is present in human adult brain. This was critical as there are reports that indicate TRPC3 protein is absent in adult rat and human brain (Li et al. 1999; Strubing et al.

2003; Fusco et al. 2004). The results presented here clearly indicate that TRPC3 channel protein is present in human frontal cortex and cerebellum throughout the lifespan from as early as 8 days to 83 years (Chapter 2, Roedding et al. 2009). This piece of work justifies the further investigation of TRPC3 channels and their role as signal transducers capable of integrating intracellular Ca2+ regulation and redox signals in a circuit that may be involved in the development of BD in adult human brain.

5.5.2 Are decreases in TRPC3 neuroprotective or detrimental to cells?

Given the significant decreases in TRPC3 expression levels noted in both human BLCLs and rat cortical neurons in response to chronic oxidative stress, it raises the question of whether these changes reflect a mode of adaptation that is protective or detrimental to cell function and survival. The answer is likely not straightforward and will depend on the cell type affected. For

124 example, the macrophages of TRPC3-deficient mice were more susceptible to apoptosis and exhibited decreased efferocytosis (Tano et al. 2011). Similarly, knockdown or inhibition of

TRPC3 in cortical pyramidal neurons and cerebellar granule cells diminished BDNF-induced signalling resulting in decreased cell viability, dendritic spine density and growth cone turning

(Li et al. 2005; Amaral et al. 2007; Jia et al. 2007). As BDNF is known to enhance cellular resilience and drive neuronal growth cone extension as well as turning, it suggests that decreases in TRPC3 channel expression would attenuate these neuroprotective BDNF-mediated responses

(Li et al. 2005). Moreover, BDNF-induced cellular resilience is linked to CREB activation through TRPC3-mediated Ca2+ influx (Jia et al. 2007). CREB is known to control the expression of pro-survival genes as well as long-term adaptive processes in the nervous system (Lonze et al.

2002; Sakamoto et al. 2011; Tan et al. 2012). Loss of CREB function results in neurodegeneration in postnatal mice in vivo (Mantamadiotis et al. 2002). A TRPC channel with significant homology to TRPC3, namely TRPC6, has also been linked to neuroprotection through CREB activation (Jia et al. 2007; Yao et al. 2009; Du et al. 2010). Of note, recent work in our laboratory has demonstrated that TRPC6 protein levels are decreased after chronic ROS treatment in rat cortical neurons in a similar manner to TRPC3 (Tong 2012). If indeed CREB function is modulated by TRPC3/6-dependent Ca2+ influx, then ROS induced decreases in the expression levels of TRPC3 protein, as observed in this study, would have deleterious effects on cellular resilience.

Conversely, inhibition of TRPC3-mediated Ca2+ signalling has been shown to protect cells from cell death and Ca2+ overload in several cell types. Using TRPC3 knock-out mice, it was shown that salivary and pancreatic acini were protected from Ca2+-mediated cell toxicity (Kim et al.

2009; Kim et al. 2011). Findings in mouse cardiomyocytes overexpressing TRPC3 displayed a

125 similar trend in which increased levels of apoptosis and enhanced sensitivity to Ca2+ overload was observed in cells after ischemia followed by reperfusion (Shan et al. 2008). Moreover, activation of rat cardiomyocytes using OAG or mechanical stretch generates an increase in intracellular superoxide that is inhibited by Pyr3 (TRPC3 inhibitor) and TRPC3 knock-down

(Kitajima et al. 2011). Recent findings have shown that TRPC3-mediated Ca2+ influx plays a role in activation of the NFAT pathway, likely through the interaction of TRPC3 channels, protein kinase C and calcineurin (Bush et al. 2006; Onohara et al. 2006; Poteser et al. 2011). However, elevated levels of calcineurin activation have been shown to increase the vulnerability of neurons to cell death induced by cellular stress, such as serum deprivation (Asai et al. 1999). In agreement with this finding, the endogenous inhibitor of calcineurin activity, RCAN1 is capable of protecting cells against short term oxidative or Ca2+ stresses (Ermak et al. 2002; Lin et al.

2003). However, chronic elevation of RCAN1 expression has been linked to Alzheimer’s disease and Down’s syndrome (Ermak et al. 2001). This dichotomy of RCAN1 actions represents an intriguing model in which acute stresses are mitigated by inherent response mechanisms whereas chronic elevation leads to subsequent dysfunction (Ermak et al. 2011). Taken together, some findings suggest that a decrease in TRPC3 levels can be protective for the cell by reducing

TRPC3-mediated Ca2+ entry and thereby preventing the activation of downstream signalling cascades which can lead to cell death and/or ROS production, while others implicate TRPC3 channel activation in neuroprotective signalling cascades including BDNF and CREB upregulation. One possible explanation for this discrepancy is that the delicate homeostatic balance maintained within different cell types and even different signalling microdomains varies in the sensitivity to changes in TRPC3 expression. Interesting implications for TRPC channels in cancer cell tumorigenesis have developed given the ability of these channels to transduce signals

126 leading to either apoptotic or cell proliferative cascades depending on their level of expression

(Shapovalov et al. 2011).

5.5.3 TRPM2 channel responsivity is altered in BD

TRPM2 integrates oxidative stress signals from the mitochondria and nucleus with basal Ca2+ levels and oxidant defenses. Earlier reports observed altered expression of TRPM2 in BD-I patients with Ca2+ dyshomeostasis and genetic association of specific TRPM2 variants with BD-I

(see section 1.5.2, Yoon et al. 2001; McQuillin et al. 2006; Xu et al. 2006; Xu et al. 2009). To date, no functional significance has yet been ascribed to these variants (Kühn et al. 2009). The novel findings presented here, although modest, show a significant interaction between TRPM2 activator-stimulated Ca2+ influx and diagnostic subject group. Thus, TRPM2 channels demonstrate increased responsivity in BD-I patients in comparison to healthy controls upon oxidative stress treatment. It is premature to link this observed functional difference with any specific variant in the TRPM2 gene, nonetheless this finding supports the notion of impaired

TRPM2 function in individuals with BD. This dysfunction, whether genetic or acquired is therefore likely to be a key node in the pathophysiological matrix of the subgroup of BD-I patients characterized by intracellular Ca2+ dyshomeostasis.

5.5.4 Support for decreased cellular resilience in BD

Converging lines of evidence from pathomorphological examination to evidence of mitochondrial abnormalities and elevated levels of oxidative stress suggest that cellular resilience is likely compromised in individuals with BD (see section 1.2 and 1.3 for more details). The results presented in Chapter 4 support that notion with the finding of decreased cellular viability in BLCLs from BD subjects in comparison to controls (Roedding et al. 2012).

Strikingly, increased levels of cell death were also observed in the absence of stressor treatment

127 in BLCLs from BD subjects after 24 hours vehicle (i.e. 0.01% DMSO) treatment. These differences were lost upon chronic stressor exposure which suggests that the heightened resilience of cells from healthy controls can only adapt to maintain cellular viability over the short term, at least under the supraphysiological stressor conditions used here. Therefore, this work supports the notion that dysfunction of cellular resilience mechanisms is a central component of BD pathophysiology through a direct demonstration of higher levels of cell death detected in an assay of living and diagnostically relevant cell lines. However, it is still unknown whether these cellular abnormalities are present in individuals prior to development of the disorder, thereby precipitating the progression to illness, or whether they manifest as a result of irregular cellular adaptation following a separate causal event.

5.5.5 Hypothetical model that links TRPC3, TRPM2, ROS and BD

The effects of mitochondrially-generated ROS exposure on TRPC3 and TRPM2 channel expression and function links together these important signal transducers with elements of cellular physiology that have been implicated in the pathophysiology of BD previously, namely mitochondrial dysfunction, irregular intracellular Ca2+ regulation and elevated ROS levels. It appears that all of these elements are connected in a type of matrix in which disturbances in one facet will affect the others (Figure 5-2). Recent findings from our laboratory have also shown downregulation of TRPC5 and 6 protein levels after chronic but not acute stressor treatment

(Tong 2012). Increases in endogenously produced ROS levels may stem from underlying mitochondrial dysfunction but also through the effect of elevated levels of stress hormones, such as glucocorticoids, on the mitochondria. This is of particular interest given the association between stressful life events and the pathogenesis of BD (reviewed in McEwen 2005). High levels of corticosterone or dexamethasone have been shown to induce mitochondrial dysfunction

128 and ROS production, while low levels are neuroprotective (Iuchi et al. 2003; Du et al. 2009; Seo et al. 2011). Therefore, prolonged elevations of ROS within the cell, whether it is from intrinsic mitochondrial dysfunction or the effects of glucocorticoids, would likely decrease the expression of TRPC3 channels and increase TRPM2 levels in neurons, according to the findings presented here. These changes would affect the maintenance of intracellular Ca2+ homeostasis, channel gating and downstream signal transduction mediated through these proteins. It is possible that neurons and/or glia from individuals with inherited vulnerability to BD would not be able to adapt appropriately to the new homeostatic set-point and a permanent change may occur in the disease matrix leading to progression of the disorder. Alternatively, inherent abnormalities in either the Ca2+ homeostatic regulation or the redox status in individuals predisposed to BD could result in sustained alterations of TRPC3/TRPM2 expression and function thereby rendering the cell more susceptible to additional sources of stress (eg. glucocorticoids). This hypothesis is particularly relevant given the findings of altered cellular resilience noted in BD. It is also possible that TRPC3/TRPM2 channels themselves are abnormal and that they are directly involved in the pathophysiology of BD. There is some evidence supporting this contention for

TRPM2 given the identification of genetic TRPM2 variants that are associated with BD. For

TRPC3, on the other hand, there is little evidence to date supporting its direct involvement.

129

Figure 5-2 Interplay between ROS, Ca2+ and TRP channels

It is important to consider this hypothetical model of the pathogenesis of BD in the context of other relevant findings. Of note, my work and those of Andreopoulos et al. (2004) and Yoon et al. (2001) found no evidence of TRPC3 or TRPM2 expression changes in unstressed BLCLs from BD subjects compared with healthy controls which does not support the hypothesis of a sustained downregulation of TRPC3 expression in BD subjects (Andreopoulos et al. 2004;

Roedding et al. 2012). Also, no differences in OAG-induced Ca2+ fluxes were detected between subject groups. However, the BLCLs used in both studies were grown and maintained in a standard medium that does not contain extraneous factors such as stress hormones that may be circulating in vivo. Another interesting series of experiments that are relevant to the interpretation of this work examined the effect of lithium on TRPC3 channel expression in

BLCLs and rat cortical neurons. As mentioned above, chronic lithium treatment of BLCLs resulted in decreased TRPC3 channel expression in cells from BD-I subjects (Andreopoulos et al. 2004). It was hypothesized that lithium was acting to correct hyperactive intracellular Ca2+ signalling observed in BD. In contrast, preliminary data from our laboratory has shown that lithium prevents the ROS-induced decreases in TRPC3 expression in rat cortical neurons (Tong

130

2012), likely through the effects of this drug on the antioxidant response mechanisms within the cell (Quiroz et al. 2010). This disparity in the effect of lithium on TRPC3 channel expression may be due to differences in the cell models used as well as the stressor treatment paradigm that was applied to the cells of neuronal origin.

In conclusion, the findings of this thesis work support an important role for TRPM2 and TRPC3 in sensing and responding to mitochondrially-generated oxidative stress, and in transducing oxidative stress signalling to intracellular Ca2+ homeostatic and cellular stress responses. This work is not only interesting in regards to BD pathophysiology but also other CNS disorders in which oxidative stress and Ca2+ homeostatic irregularities have been identified, such as

Alzheimer’s, Parkinson’s and Huntington’s diseases (reviewed in Beal 1995; Lin et al. 2006).

Further investigation of TRPC3 and TRPM2 channels may set the stage for rational development of novel mood stabilizers that target these proteins or the impaired processes in which they are involved. Additionally, knowledge of the role of TRPM2 and TRPC3 in BD pathogenesis could provide a basis for the development of biomarker based diagnostic tests that will be able to detect risk and/or progression of the disorder. As TRPM2 and TRPC3 play important roles in cardiovascular, pancreatic, and vascular smooth muscle function, the findings of this study may offer insights into ROS-induced signalling in the physiology of these tissues as well. Finally, this work has highlighted an inherent difference in TRPM2 channel functionality in BD-I subjects in comparison to controls, adding functional evidence to the genetic and differential expression findings implicating TRPM2 dysfunction in BD.

131

6 References

Adams, J.M. and Cory, S. (1998). The Bcl-2 protein family: Arbiters of cell survival. Science 281(5381): 1322-1326.

Aita, V.M., Liu, J., Knowles, J.A., Terwilliger, J.D., Baltazar, R., et al. (1999). A comprehensive linkage analysis of chromosome 21q22 supports prior evidence for a putative bipolar affective disorder locus. American Journal of Human Genetics 64(1): 210-217.

Alberdi, E., Sánchez-Gómez, M.V., Cavaliere, F., Pérez-Samartín, A., Zugaza, J.L., et al. (2010). Amyloid β oligomers induce Ca2+ dysregulation and neuronal death through activation of ionotropic glutamate receptors. Cell Calcium 47(3): 264-272.

Allagui, M., Nciri, R., Rouhaud, M., Murat, J., El Feki, A., et al. (2009). Long-term exposure to low lithium concentrations stimulates proliferation, modifies stress protein expression pattern and enhances resistance to oxidative stress in SH-SY5Y cells. Neurochemical Research 34(3): 453-462.

Almeida, A., Almeida, J., Bolaños, J.P. and Moncada, S. (2001). Different responses of astrocytes and neurons to nitric oxide: The role of glycolytically generated ATP in astrocyte protection. Proceedings of the National Academy of Sciences 98(26): 15294-15299.

Alonso, R., Griebel, G., Pavone, G., Stemmelin, J., Le Fur, G., et al. (2003). Blockade of CRF1 or V1b receptors reverses stress-induced suppression of neurogenesis in a mouse model of depression. Molecular Psychiatry 9(3): 278-286.

Amaral, M.D. and Pozzo-Miller, L. (2007). TRPC3 channels are necessary for brain-derived neurotrophic factor to activate a nonselective cationic current and to induce dendritic spine formation. Journal of Neuroscience 27(19): 5179-5189.

Ambudkar, I.S., Bandyopadhyay, B.C., Liu, X., Lockwich, T.P., Paria, B., et al. (2006). Functional organization of TRPC-Ca2+ channels and regulation of calcium microdomains. Cell Calcium 40(5–6): 495-504.

American Psychiatric Association (1994). Diagnostic and Statistical Manual of Mental Disorders (4th ed., text rev.). Washington, DC.

Andreazza, A.C., Kapczinski, F., Kauer-Sant'Anna, M., Walz, J.C., Bond, D.J., et al. (2009). 3- Nitrotyrosine and glutathione antioxidant system in patients in the early and late stages of bipolar disorder. Journal of Psychiatry & Neuroscience 34(4): 263-271.

Andreazza, A.C., Kauer-Sant'anna, M., Frey, B.N., Bond, D.J., Kapczinski, F., et al. (2008). Oxidative stress markers in bipolar disorder: a meta-analysis. Journal of Affective Disorders 111(2-3): 135-144.

132

Andreazza, A.C., Shao, L., Wang, J.-F. and Young, L.T. (2010). Mitochondrial complex I activity and oxidative damage to mitochondrial proteins in the prefrontal cortex of patients with bipolar disorder. Archives of General Psychiatry 67(4): 360-368.

Andreopoulos, S., Wasserman, M.J., Woo, K.K., Li, P.P. and Warsh, J.J. (2004). Chronic lithium treatment of B lymphoblasts from bipolar disorder patients reduces transient receptor potential channel 3 levels. The Pharmacogenomics Journal 4: 365-373.

Angst, F., Stassen, H.H., Clayton, P.J. and Angst, J. (2002). Mortality of patients with mood disorders: follow-up over 34-38 years. Journal of Affective Disorders 68: 167-181.

Antila, M., Tuulio-Henriksson, A., Kieseppa, T., Eerola, M., Partonen, T., et al. (2007). Cognitive functioning in patients with familial bipolar I disorder and their unaffected relatives. Psychological Medicine 37(05): 679-687.

Asai, A., Qiu, J.-h., Narita, Y., Chi, S., Saito, N., et al. (1999). High level calcineurin activity predisposes neuronal cells to apoptosis. Journal of Biological Chemistry 274(48): 34450-34458.

Asghari, V., Wang, J.F., Reiach, J.S. and Young, L.T. (1998). Differential effects of mood stabilizers on Fos/Jun proteins and AP-1 DNA binding activity in human neuroblastoma SH- SY5Y cells. Brain Research. Molecular Brain Research 58(1-2): 95-102.

Audo, I., Kohl, S., Leroy, B.P., Munier, F.L., Guillonneau, X., et al. (2009). TRPM1 is mutated in patients with autosomal-recessive complete congenital stationary night blindness. The American Journal of Human Genetics 85(5): 720-729.

Auer-Grumbach, M., Olschewski, A., Papic, L., Kremer, H., McEntagart, M.E., et al. (2010). Alterations in the ankyrin domain of TRPV4 cause congenital distal SMA, scapuloperoneal SMA and HMSN2C. Nature Genetics 42(2): 160-164.

Babcock, D.F. and Hille, B. (1998). Mitochondrial oversight of cellular Ca2+ signaling. Current Opinion in Neurobiology 8: 398-404.

Bach, G. (2001). Mucolipidosis type IV. Molecular Genetics and Metabolism 73(3): 197-203.

Bachmann, R.F., Schloesser, R.J., Gould, T.D. and Manji, H.K. (2005). Mood stabilizers target cellular plasticity and resilience cascades: implications for the development of novel therapeutics. Molecular Neurobiology 32(2): 173-202.

Bachmann, R.F., Wang, Y., Yuan, P., Zhou, R., Li, X., et al. (2009). Common effects of lithium and valproate on mitochondrial functions: protection against methamphetamine-induced mitochondrial damage. The International Journal of Neuropsychopharmacology 12(06): 805- 822.

Badner, J.A. and Gershon, E.S. (2002). Meta-analysis of whole-genome linkage scans of bipolar disorder and schizophrenia. Molecular Psychiatry 7(4): 405-411.

133

Baek, K.-H., Zaslavsky, A., Lynch, R.C., Britt, C., Okada, Y., et al. (2009). Down's syndrome suppression of tumour growth and the role of the calcineurin inhibitor DSCR1. Nature 459(7250): 1126-1130.

Baldessarini, R.J. and Tondo, L. (2003). Suicide risk and treatments for patients with bipolar disorder. Journal of the American Medical Association 290(11): 1517-1519.

Balzer, M., Lintschinger, B. and Groschner, K. (1999). Evidence for a role of Trp proteins in the oxidative stress-induced membrane conductances of porcine aortic endothelial cells. Cardiovascular Research 42(2): 543-549.

Beal, M.F. (1995). Aging, energy, and oxidative stress in neurodegenerative diseases. Annals of Neurology 38(3): 357-366.

Becker, E.B., Oliver, P.L., Glitsch, M.D., Banks, G.T., Achilli, F., et al. (2009). A point mutation in TRPC3 causes abnormal Purkinje cell development and cerebellar ataxia in moonwalker mice. Proceedings of the National Academy of Science, United States of America 106(16): 6706-6711.

Belrose, J., Xie, Y.-F., Gierszewski, L., MacDonald, J. and Jackson, M. (2012). Loss of glutathione homeostasis associated with neuronal senescence facilitates TRPM2 channel activation in cultured hippocampal pyramidal neurons. Molecular Brain 5(1): 11.

Ben-Shachar, D. and Karry, R. (2008). Neuroanatomical pattern of mitochondrial complex I pathology varies between schizophrenia, bipolar disorder and major depression. PLoS One 3(11): e3676.

Benes, F.M., Matzilevich, D., Burke, R.E. and Walsh, J. (2005). The expression of proapoptosis genes is increased in bipolar disorder, but not in schizophrenia. Molecular Psychiatry 11(3): 241- 251.

Berk, M., Bodemer, W., Van Oudenhove, T. and Butkow, N. (1995). The platelet intracellular calcium response to serotonin is augmented in bipolar manic and depressed patients. Human Psychopharmacology 10(3): 189-193.

Berk, M., Dean, O., Cotton, S.M., Gama, C.S., Kapczinski, F., et al. (2011). The efficacy of N- acetylcysteine as an adjunctive treatment in bipolar depression: An open label trial. Journal of Affective Disorders 135(1–3): 389-394.

Berridge, M.J. (1997). The AM and FM of calcium signalling. Nature 386: 759-760.

Berridge, M.J., Bootman, M.D. and Lipp, P. (1998). Calcium - a life and death signal. Nature 395(6703): 645-648.

Berridge, M.J., Bootman, M.D. and Roderick, H.L. (2003). Calcium signalling: dynamics, homeostasis and remodelling. Nature Reviews. Molecular Cell Biology 4(7): 517-529.

Berridge, M.J., Lipp, P. and Bootman, M.D. (2000). The versatility and universality of calcium signalling. Nature Reviews 1: 11-21.

134

Bertolino, A., Frye, M., Callicott, J.H., Mattay, V.S., Rakow, R., et al. (2003). Neuronal pathology in the hippocampal area of patients with bipolar disorder: a study with proton magnetic resonance spectroscopic imaging. Biological Psychiatry 53(10): 906-913.

Bianchi, K., Rimessi, A., Prandini, A., Szabadkai, G. and Rizzuto, R. (2004). Calcium and mitochondria: mechanisms and functions of a troubled relationship. Biochimica et Biophysica Acta 1742(1-3): 119-131.

Bollimuntha, S., Selvaraj, S. and Singh, B.B. (2011). Emerging roles of canonical TRP channels in neuronal function transient receptor potential channels. Advances in Experimental Biology and Medicine 704: 573-593.

Bond, C.E. and Greenfield, S.A. (2007). Multiple cascade effects of oxidative stress on astroglia. Glia 55(13): 1348-1361.

Bora, E., Fornito, A., Yücel, M. and Pantelis, C. (2010). Voxelwise meta-analysis of gray matter abnormalities in bipolar disorder. Biological Psychiatry 67(11): 1097-1105.

Bowden, C., Huang, L., Javors, M., Johnson, J., Seleshi, E., et al. (1988). Calcium function in affective disorders and healthy controls. Biological Psychiatry 23: 367-376.

Brini, M. (2003). Ca2+ signalling in mitochondria: mechanism and role in physiology and pathology. Cell Calcium 34: 399-405.

Brookes, P.S., Yoon, Y., Robotham, J.L., Anders, M.W. and Sheu, S.-S. (2004). Calcium, ATP, and ROS: a mitochondrial love-hate triangle. American Journal of Physiology - Cell Physiology 287(4): C817-833.

Brown, A., Mallinger, A. and Renbaum, L. (1993). Elevated platelet membrane phosphatidylinositol-4,5-bisphosphate in bipolar mania. American Journal of Psychiatry 150(8): 1252-1254.

Brown, S.M., Henning, S. and Wellman, C.L. (2005). Mild, short-term stress alters dendritic morphology in rat medial prefrontal cortex. Cerebral Cortex 15(11): 1714-1722.

Bush, E.W., Hood, D.B., Papst, P.J., Chapo, J.A., Minobe, W., et al. (2006). Canonical transient receptor potential channels promote cardiomyocyte hypertrophy through activation of calcineurin signaling. Journal of Biological Chemistry 281(44): 33487-33496.

Cannella, M., Maglione, V., Martino, T., Simonelli, M., Ragona, G., et al. (2005). New Huntington disease mutation arising from a paternal CAG34 allele showing somatic length variation in serially passaged lymphoblasts. American Journal of Medical Genetics B: Neuropsychiatric Genetics 133(1): 127-130.

Cantin, A.M., Bilodeau, G., Ouellet, C., Liao, J. and Hanrahan, J.W. (2006). Oxidant stress suppresses CFTR expression. American Journal of Physiology - Cell Physiology 290(1): C262- C270.

135

Carafoli, E. (2002). Calcium signalling: A tale for all seasons. Proceedings of the National Academy of Sciences of the United States of America 99(3): 1115-1122.

Carafoli, E., Santella, L., Branca, D. and Brini, M. (2001). Generation, control, and processing of cellular calcium signals. Critical Reviews in Biochemistry and Molecular Biology 36(2): 107- 260.

Caraveo, G., van Rossum, D.B., Patterson, R.L., Snyder, S.H. and Desiderio, S. (2006). Action of TFII-I outside the nucleus as an inhibitor of agonist-induced calcium entry. Science 314(5796): 122-125.

Carreras, M.C., Franco, M.C., Peralta, J.G. and Poderoso, J.J. (2004). Nitric oxide, complex I, and the modulation of mitochondrial reactive species in biology and disease. Molecular Aspects of Medicine 25(1-2): 125-139.

Carvour, M., Song, C., Kaul, S., Anantharam, V., Kanthasamy, A., et al. (2008). Chronic low- dose oxidative stress induces caspase-3-dependent PKCδ proteolytic activation and apoptosis in a cell culture model of dopaminergic neurodegeneration. Annals of the New York Academy of Sciences 1139(1): 197-205.

Cataldo, A.M., McPhie, D.L., Lange, N.T., Punzell, S., Elmiligy, S., et al. (2010). Abnormalities in mitochondrial structure in cells from patients with bipolar disorder. The American Journal of Pathology 177(2): 575-585.

Cecil, K.M., DelBello, M.P., Morey, R. and Strakowski, S.M. (2002). Frontal lobe differences in bipolar disorder as determined by proton MR spectroscopy. Bipolar Disorders 4(6): 357-365.

Cerny, A.C. and Huber, A. (2011). Regulation of TRP signalling by ion channel translocation between cell compartments transient receptor potential channels. Advances in Experimental Biology and Medicine 704: 545-572.

Chang, K., Adleman, N., Dienes, K., Barnea-Goraly, N., Reiss, A., et al. (2003). Decreased N- Acetylaspartate in children with familial bipolar disorder. Biological Psychiatry 53(11): 1059- 1065.

Charney, D.S. and Manji, H.K. (2004). Life stress, genes, and depression: multiple pathways lead to increased risk and new opportunities for intervention. Science's STKE 2004(225).

Cheadle, C., Fan, J., Cho-Chung, Y.S., Werner, T., Ray, J., et al. (2005). Stability regulation of mRNA and the control of gene expression. Annals of the New York Academy of Sciences 1058(1): 196-204.

Chen, G., Hasanat, K.A., Bebchuk, J.M., Moore, G.J., Glitz, D., et al. (1999). Regulation of signal transduction pathways and gene expression by mood stabilizers and antidepressants. Psychosomatic Medicine 61: 599-617.

Chen, G., Rajkowska, G., Du, F., Seraji-Bozorgzad, N. and Manji, H.K. (2000). Enhancement of hippocampal neurogenesis by lithium. Journal of Neurochemistry 75(4): 1729-1734.

136

Chen, G., Yuan, P.X., Jiang, Y.M., Huang, L.D. and Manji, H.K. (1999). Valproate robustly enhances AP-1 mediated gene expression. Brain Research. Molecular Brain Research 64(1): 52- 58.

Cherry, L. and Swann, A. (1994). Cation transport mediated by Na+,K(+)-adenosine triphosphatase in lymphoblastoma cells from patients with bipolar I disorder, their relatives, and unrelated control subjects. Psychiatry Research 53(2): 111-118.

Christensen, M.V., Kyvik, K.O. and Kessing, L.V. (2006). Cognitive function in unaffected twins discordant for affective disorder. Psychological Medicine 36(08): 1119-1129.

Chuang, D.M. (2005). The antiapoptotic actions of mood stabilizers: molecular mechanisms and therapeutic potentials. Annals of the New York Academy of Sciences 1053: 195-204.

Chuang, H.-h. and Lin, S. (2009). Oxidative challenges sensitize the capsaicin receptor by covalent cysteine modification. Proceedings of the National Academy of Sciences 106(47): 20097-20102.

Chubanov, V., Gudermann, T. and Schlingmann, K. (2005). Essential role for TRPM6 in epithelial magnesium transport and body magnesium homeostasis. Pflugers Archiv European Journal of Physiology 451(1): 228-234.

Chung, K.K.H., Freestone, P.S. and Lipski, J. (2011). Expression and functional properties of TRPM2 channels in dopaminergic neurons of the substantia nigra of the rat. Journal of Neurophysiology 106(6): 2865-2875.

Chung, Y.H., Kim, D., Moon, N.J., Oh, C.S., Lee, E., et al. (2007). Immunohistochemical study on the distribution of canonical transient receptor potential channels in rat basal ganglia. Neuroscience Letters 422(1): 18-23.

Clapham, D.E. (2003). TRP channels as cellular sensors. Nature 426(6966): 517-524.

Clapham, D.E., Runnels, L.W. and Strubing, C. (2001). The TRP ion channel family. Nature Reviews. Neuroscience 2(6): 387-396.

Cocheme, H.M. and Murphy, M.P. (2008). Complex I is the major site of mitochondrial superoxide production by paraquat. Journal of Biological Chemistry 283(4): 1786-1798.

Cochrane, C.G. (1991). Mechanisms of oxidant injury of cells. Molecular Aspects of Medicine 12(2): 137-147.

Cook, N.L., Vink, R., Helps, S.C., Manavis, J. and van den Heuvel, C. (2010). Transient receptor potential melastatin 2 expression is increased following experimental traumatic brain injury in rats. Journal of Molecular Neuroscience 42(2): 192-199.

Corson, T.W., Woo, K.K., Li, P.P. and Warsh, J.J. (2004). Cell-type specific regulation of calreticulin and Bcl-2 expression by mood stabilizer drugs. European Neuropsychopharmacology 14(2): 143-150.

137

Coyle, J.T. and Duman, R.S. (2003). Finding the intracellular signaling pathways affected by mood disorder treatments. Neuron 38: 157-160.

Crouzin, N., de Jesus Ferreira, M.-C., Cohen-Solal, C., Aimar, R.-F., Vignes, M., et al. (2007). Alpha-tocopherol-mediated long-lasting protection against oxidative damage involves an attenuation of calcium entry through TRP-like channels in cultured hippocampal neurons. Free Radical Biology and Medicine 42(9): 1326-1337.

Cushley, W. and Harnett, M. (1993). Cellular signalling mechanisms in B lymphocytes. Biochemical Journal 292: 313-332.

D'Autreaux, B. and Toledano, M.B. (2007). ROS as signalling molecules: mechanisms that generate specificity in ROS homeostasis. Nature Reviews. Molecular Cell Biology 8(10): 813- 824.

Daban, C., Mathieu, F., Raust, A., Cochet, B., Scott, J., et al. (2012). Is processing speed a valid cognitive endophenotype for bipolar disorder? Journal of Affective Disorders 139(1): 98-101. de Lima, P., Yamada, E., da Costa, E., Pessoa, C.O., Rabenhorst, S., et al. (2005). Genotoxic effects of rotenone on cultured lymphocytes. Genetics and Molecular Research 4(4): 822-831.

Dean, O., Giorlando, F. and Berk, M. (2011). N-acetylcysteine in psychiatry: current therapeutic evidence and potential mechanisms of action. Journal of Psychiatry and Neuroscience 36(2): 78- 86.

DeHaven, W.I., Jones, B.F., Petranka, J.G., Smyth, J.T., Tomita, T., et al. (2009). TRPC channels function independently of STIM1 and Orai1. The Journal of Physiology 587(10): 2275- 2298.

Deicken, R., Fein, G. and Weiner, M. (1995). Abnormal frontal lobe phosphorous metabolism in bipolar disorder. American Journal of Psychiatry 152(6): 915-918.

Deicken, R.F., Pegues, M.P., Anzalone, S., Feiwell, R. and Soher, B. (2003). Lower concentration of hippocampal N-acetylaspartate in familial bipolar I disorder. American Journal of Psychiatry 160(5): 873-882.

Deng, H.X., Klein, C.J., Yan, J., Shi, Y., Wu, Y., et al. (2010). Scapuloperoneal spinal muscular atrophy and CMT2C are allelic disorders caused by alterations in TRPV4. Nature Genetics 42(2): 165-169.

Desagher, S., Glowinski, J. and Premont, J. (1996). Astrocytes protect neurons from hydrogen peroxide toxicity. Journal of Neuroscience 16(8): 2553-2562.

Desai, B.N. and Clapham, D.E. (2005). TRP channels and mice deficient in TRP channels. Pflugers Archiv European Journal of Physiology 451(1): 11-18.

138

Detera-Wadleigh, S.D., Badner, J.A., Yoshikawa, T., Sanders, A.R., Goldin, L.R., et al. (1997). Initial genome scan of the NIMH genetics initiative bipolar pedigrees: chromosomes 4, 7, 9, 18, 19, 20, and 21q. American Journal of Medical Genetics 74(3): 254-262.

Dhir, A., Padi, S.S., Naidu, P.S. and Kulkarni, S.K. (2006). Protective effect of naproxen (non- selective COX-inhibitor) or rofecoxib (selective COX-2 inhibitor) on immobilization stress- induced behavioral and biochemical alterations in mice. European Journal of Pharmacology 535(1-3): 192-198.

Dietrich, A., Chubanov, V. and Gudermann, T. (2010). Renal TRPathies. Journal of the American Society of Nephrology 21(5): 736-744.

Dietrich, A., Chubanov, V., Kalwa, H., Rost, B.R. and Gudermann, T. (2006). Cation channels of the transient receptor potential superfamily: Their role in physiological and pathophysiological processes of smooth muscle cells. Pharmacology and Therapeutics 112(3): 744-760.

Dietrich, A. and Gudermann, T. (2011). TRP channels in the cardiopulmonary vasculature transient receptor potential channels. Advances in Experimental Biology and Medicine 704: 781- 810.

Drevets, W.C., Price, J.L., Simpson, J.R., Jr., Todd, R.D., Reich, T., et al. (1997). Subgenual prefrontal cortex abnormalities in mood disorders. Nature 386(6627): 824-827.

Drevets, W.C., Savitz, J. and Trimble, M. (2008). The subgenual anterior cingulate cortex in mood disorders. CNS Spectrums 13(8): 663-681.

Dringen, R., Kussmaul, L., Gutterer, J.M., Hirrlinger, J. and Hamprecht, B. (1999). The glutathione system of peroxide detoxification is less efficient in neurons than in astroglial cells. Journal of Neurochemistry 72(6): 2523-2530.

Du, J., Wang, Y., Hunter, R., Wei, Y., Blumenthal, R., et al. (2009). Dynamic regulation of mitochondrial function by glucocorticoids. Proceedings of the National Academy of Science, United States of America 106(9): 3543-3548.

Du, J., Xie, J. and Yue, L. (2009). Intracellular calcium activates TRPM2 and its alternative spliced isoforms. Proceedings of the National Academy of Sciences 106(17): 7239-7244.

Du, W., Huang, J., Yao, H., Zhou, K., Duan, B., et al. (2010). Inhibition of TRPC6 degradation suppresses ischemic brain damage in rats. The Journal of Clinical Investigation 120(10): 3480- 3492.

Dubovsky, S.L., Christiano, J., Daniell, L.C., Franks, R.D., Murphy, J., et al. (1989). Increased platelet intracellular calcium concentration in patients with bipolar affective disorders. Archives of General Psychiatry 46: 632-638.

Dubovsky, S.L., Lee, C., Christiano, J. and Murphy, J. (1991). Elevated platelet intracellular calcium concentration in bipolar depression. Biological Psychiatry 29: 441-450.

139

Dubovsky, S.L., Murphy, J., Thomas, M. and Rademacher, J. (1992). Abnormal intracellular calcium ion conentration in platelets and lymphocytes of bipolar patients. American Journal of Psychiatry 149: 118-120.

Dubovsky, S.L., Thomas, M., Hijazi, A. and Murphy, J. (1994). Intracellular calcium signalling in peripheral cells of patients with bipolar affective disorder. European Archives of Psychiatry and Clinical Neuroscience 243: 229-234.

Duman, R.S. (2002). Pathophysiology of depression: the concept of synaptic plasticity. European Psychiatry 17 Suppl 3: 306-310.

Eder, P., Poteser, M. and Groschner, K. (2007). TRPC3: a multifunctional, pore-forming signalling molecule. Handbook of Experimental Pharmacology(179): 77-92.

Elg, S., Marmigere, F., Mattsson, J.P. and Ernfors, P. (2007). Cellular subtype distribution and developmental regulation of TRPC channel members in the mouse dorsal root ganglion. Journal of Comparative Neurology 503(1): 35-46.

Emamghoreishi, M., Li, P.P., Schlichter, L., Parikh, S.V., Cooke, R., et al. (2000). Associated disturbances in calcium homeostasis and G protein-mediated cAMP signaling in bipolar I disorder. Biological Psychiatry 48(7): 665-673.

Emamghoreishi, M., Schlichter, L., Li, P.P., Parikh, S., Sen, J., et al. (1997). High intracellular calcium concentrations in transformed lymphoblasts from subjects with bipolar I disorder. American Journal of Psychiatry 154: 976-982.

Ermak, G. and Davies, K.J.A. (2002). Calcium and oxidative stress: from cell signaling to cell death. Molecular Immunology 38(10): 713-721.

Ermak, G., Harris, C.D. and Davies, K.J.A. (2002). The DSCR1 (Adapt78) isoform 1 protein calcipressin 1 inhibits calcineurin and protects against acute calcium-mediated stress damage, including transient oxidative stress. The FASEB Journal 16(8): 814-824.

Ermak, G., Morgan, T.E. and Davies, K.J.A. (2001). Chronic overexpression of the calcineurin inhibitory gene DSCR1 (Adapt78) is associated with Alzheimer's disease. Journal of Biological Chemistry 276(42): 38787-38794.

Ermak, G., Pritchard, M.A., Dronjak, S., Niu, B. and Davies, K.J.A. (2011). Do RCAN1 proteins link chronic stress with neurodegeneration? The FASEB Journal 25(10): 3306-3311.

Everett, K.V. (2011). Transient receptor potential genes and human inherited disease. Advances in Experimental Biology and Medicine 704: 1011-1032.

Ewald, H., Kruse, T.A. and Mors, O. (2003). Genome wide scan using homozygosity mapping and linkage analyses of a single pedigree with affective disorder suggests oligogenic inheritance. American Journal of Medical Genetics B: Neuropsychiatric Genetics 120(1): 63-71.

140

Fagiolini, A., Frank, E., Rucci, P., Cassano, G.B., Turkin, S., et al. (2007). Mood and anxiety spectrum as a means to identify clinically relevant subtypes of bipolar I disorder1. Bipolar Disorders 9(5): 462-467.

Farooqi, A., Javeed, M., Javed, Z., Riaz, A., Mukhtar, S., et al. (2011). TRPM channels: same ballpark, different players, and different rules in immunogenetics. Immunogenetics 63(12): 773- 787.

Feeney, C.J., Frantseva, M.V., Carlen, P.L., Pennefather, P.S., Shulyakova, N., et al. (2008). Vulnerability of glial cells to hydrogen peroxide in cultured hippocampal slices. Brain Research 1198: 1-15.

Ferreira, M.A.R., O'Donovan, M.C., Meng, Y.A., Jones, I.R., Ruderfer, D.M., et al. (2008). Collaborative genome-wide association analysis supports a role for ANK3 and CACNA1C in bipolar disorder. Nature Genetics 40(9): 1056-1058.

First, M. (1994). Diagnostic and Statistical Manual of Mental Disorders. Washington, DC, American Psychiatric Association.

Fleig, A. and Penner, R. (2004). The TRPM ion channel subfamily: molecular, biophysical and functional features. Trends in Pharmacological Sciences 25(12): 633-639.

Floyd, R.A. (1999). Antioxidants, oxidative stress, and degenerative neurological disorders. Proceedings of the Society for Experimental Biology and Medicine 222(3): 236-245.

Fonfria, E., Marshall, I.C.B., Boyfield, I., Skaper, S.D., Hughes, J.P., et al. (2005). Amyloid B- peptide(1-42) and hydrogen peroxide-induced toxicity are mediated by TRPM2 in rat primary striatal cultures. Journal of Neurochemistry 95(3): 715-723.

Fonfria, E., Murdock, P.R., Cusdin, F.S., Benham, C.D., Kelsell, R.E., et al. (2006). Tissue distribution profiles of the human TRPM cation channel family. Journal of Receptors and Signal Transduction 26(3): 159-178.

Fontella, F.U., Siqueira, I.R., Vasconcellos, A.P., Tabajara, A.S., Netto, C.A., et al. (2005). Repeated restraint stress induces oxidative damage in rat hippocampus. Neurochemical Research 30(1): 105-111.

Frey, B.N., Fonseca, M.M., Machado-Vieira, R., Soares, J.C. and Kapczinski, F. (2004). Neuropathological and neurochemical abnormalities in bipolar disorder. Revista de Brasileira Psiquiatria 26(3): 180-188.

Frey, B.N., Stanley, J.A., Nery, F.G., Serap Monkul, E., Nicoletti, M.A., et al. (2007). Abnormal cellular energy and phospholipid metabolism in the left dorsolateral prefrontal cortex of medication-free individuals with bipolar disorder: an in vivo1H MRS study. Bipolar Disorders 9: 119-127.

141

Frey, B.N., Zunta-Soares, G.B., Caetano, S.C., Nicoletti, M.A., Hatch, J.P., et al. (2008). Illness duration and total brain gray matter in bipolar disorder: Evidence for neurodegeneration? European Neuropsychopharmacology 18(10): 717-722.

Fukumoto, T., Morinobu, S., Okamoto, Y., Kagaya, A. and Yamawaki, S. (2001). Chronic lithium treatment increases the expression of brain-derived neurotrophic factor in the rat brain. Psychopharmacology (Berl) 158(1): 100-106.

Furuke, K., Shiraishi, M., Mostowski, H.S. and Bloom, E.T. (1999). Fas ligand induction in human NK cells is regulated by redox through a calcineurin-nuclear factors of activated T cell- dependent pathway. The Journal of Immunology 162(4): 1988-1993.

Fusco, F.R., Martorana, A., Giampa, C., De March, Z., Vacca, F., et al. (2004). Cellular localization of TRPC3 channel in rat brain: preferential distribution to oligodendrocytes. Neuroscience Letters 365(2): 137-142.

Gawryluk, J.W., Wang, J.-F., Andreazza, A.C., Shao, L. and Young, L.T. (2011). Decreased levels of glutathione, the major brain antioxidant, in post-mortem prefrontal cortex from patients with psychiatric disorders. The International Journal of Neuropsychopharmacology 14(01): 123- 130.

Gellerich, F.N., Gizatullina, Z., Trumbekaite, S., Korzeniewski, B., Gaynutdinov, T., et al. (2012). Cytosolic Ca2+ regulates the energization of isolated brain mitochondria by formation of pyruvate through the malate-aspartate shuttle. Biochemical Journal 443(3): 747-755.

Gianaros, P.J., Jennings, J.R., Sheu, L.K., Greer, P.J., Kuller, L.H., et al. (2007). Prospective reports of chronic life stress predict decreased grey matter volume in the hippocampus. Neuroimage 35(2): 795-803.

Gianfrancesco, F.D., Wang, R.-h. and Yu, E. (2005). Effects of patients with bipolar, schizophrenic, and major depressive disorders on the mental and other healthcare expenses of family members. Social Science & Medicine 61: 305-311.

Gibson, G.E., Starkov, A., Blass, J.P., Ratan, R.R. and Beal, M.F. (2010). Cause and consequence: Mitochondrial dysfunction initiates and propagates neuronal dysfunction, neuronal death and behavioral abnormalities in age-associated neurodegenerative diseases. BBA- Molecular Basis of Disease 1802(1): 122-134.

Glazebrook, P.A., Schilling, W.P. and Kunze, D.L. (2005). TRPC channels as signal transducers. Pflugers Archiv European Journal of Physiology 451(1): 125-130.

Goel, M., Sinkins, W.G. and Schilling, W.P. (2002). Selective association of TRPC channel subunits in rat brain synaptosomes. Journal of Biological Chemistry 277: 48303-48310.

Goel, M., Sinkins, W.G., Zuo, C.D., Estacion, M. and Schilling, W.P. (2006). Identification and localization of TRPC channels in the rat kidney. American Journal of Physiology: Renal Physiology 290(5): F1241-1252.

142

Goel, M., Zuo, C.D., Sinkins, W.G. and Schilling, W.P. (2007). TRPC3 channels colocalize with Na+/Ca2+ exchanger and Na+ pump in axial component of transverse-axial tubular system of rat ventricle. American Journal of Physiology: Heart Circulation Physiology 292(2): H874-883.

Gonzalez-Cobos, J.C. and Trebak, M. (2010). TRPC channels in smooth muscle cells. Frontiers in Bioscience 15: 1023-1039.

Goodwin, F.K. and Jamison, K.R. (1990). Manic-Despressive Illness. New York, Oxford University Press.

Görlach, A., Klappa, P. and Kietzmann, D.T. (2006). The endoplasmic reticulum: Folding, calcium homeostasis, signaling, and redox control. Antioxidants & Redox Signaling 8(9-10): 1391-1418.

Gould, T.D. and Manji, H.K. (2002). Signaling networks in the pathophysiology and treatment of mood disorders. Journal of Psychosomatic Research 53: 687-697.

Graham, S., Ding, M., Ding, Y., Sours-Brothers, S., Luchowski, R., et al. (2010). Canonical transient receptor potential 6 (TRPC6), a redox-regulated cation channel. Journal of Biological Chemistry 285(30): 23466-23476.

Graham, S., Ding, M., Sours-Brothers, S., Yorio, T., Ma, J.-X., et al. (2007). Downregulation of TRPC6 protein expression by high glucose, a possible mechanism for the impaired Ca2+ signaling in glomerular mesangial cells in diabetes. American Journal of Physiology - Renal Physiology 293(4): F1381-1390.

Graziani, A., Rosker, C., Kohlwein, S.D., Zhu, M.X., Romanin, C., et al. (2006). Cellular cholesterol controls TRPC3 function: evidence from a novel dominant-negative knockdown strategy. Biochemical Journal 396(1): 147-155.

Greka, A. and Mundel, P. (2011). Balancing calcium signals through TRPC5 and TRPC6 in podocytes. Journal of the American Society of Nephrology 22(11): 1969-1980.

Groschner, K. (2010). Polymodal TRPC signaling: Emerging role in phenotype switching and tissue remodeling. Communicative & Integrative Biology 3(5): 393-395.

Groschner, K. and Rosker, C. (2005). TRPC3: a versatile transducer molecule that serves integration and diversification of cellular signals. Naunyn-Schmiedeberg's Archives of Pharmacology 371: 251-256.

Groschner, K., Rosker, C. and Lukas, M. (2004). Role of TRP channels in oxidative stress. Novartis Foundation Symposium 258: 222-230; discussion 231-225, 263-226.

Hains, A.B., Vu, M.A.T., Maciejewski, P.K., van Dyck, C.H., Gottron, M., et al. (2009). Inhibition of protein kinase C signaling protects prefrontal cortex dendritic spines and cognition from the effects of chronic stress. Proceedings of the National Academy of Sciences 106(42): 17957-17962.

143

Hamakawa, H., Murashita, J.U.N., Yamada, N., Inubushi, T., Kato, N., et al. (2004). Reduced intracellular pH in the basal ganglia and whole brain measured by 31P-MRS in bipolar disorder. Psychiatry and Clinical Neurosciences 58(1): 82-88.

Hammonds, M.D. and Shim, S.S. (2009). Effects of 4-week treatment with lithium and olanzapine on levels of brain-derived neurotrophic factor, B-cell CLL/lymphoma 2 and phosphorylated cyclic adenosine monophosphate response element-binding protein in the sub- regions of the hippocampus. Basic & Clinical Pharmacology & Toxicology 105(2): 113-119.

Hao, Y., Creson, T., Zhang, L., Li, P., Du, F., et al. (2004). Mood stabilizer valproate promotes ERK pathway-dependent cortical neuronal growth and neurogenesis. Journal of Neuroscience 24(29): 6590-6599.

Hara, Y., Wakamori, M., Ishii, M., Maeno, E., Nishida, M., et al. (2002). LTRPC2 Ca2+- permeable channel activated by changes in redox status confers susceptibility to cell death. Molecular Cell 9(1): 163-173.

Hardingham, G.E. and Bading, H. (1999). Calcium as a versatile second messenger in the control of gene expression. Microscopy Research and Technique 46(6): 348-355.

Harris, E.C. and Barraclough, B. (1997). Suicide as an outcome for mental disorders. A meta- analysis. The British Journal of Psychiatry 170(3): 205-228.

Hartmann, J., Dragicevic, E., Adelsberger, H., Henning, H.A., Sumser, M., et al. (2008). TRPC3 channels are required for synaptic transmission and motor coordination. Neuron 59(3): 392-398.

Hashimoto, R., Fujimaki, K., Jeong, M.R., Christ, L. and Chuang, D.M. (2003). Lithium-induced inhibition of Src tyrosine kinase in rat cerebral cortical neurons: a role in neuroprotection against N-methyl-D-aspartate receptor-mediated excitotoxicity. FEBS Letters 538(1-3): 145-148.

Hashimoto, R., Senatorov, V., Kanai, H., Leeds, P. and Chuang, D.M. (2003). Lithium stimulates progenitor proliferation in cultured brain neurons. Neuroscience 117(1): 55-61.

He, H., Lam, M., McCormick, T.S. and Distelhorst, C.W. (1997). Maintenance of calcium homeostasis in the endoplasmic reticulum by Bcl-2. Journal of Cell Biology 138(6): 1219-1228.

Hecquet, C.M., Ahmmed, G.U. and Malik, A.B. (2010). TRPM2 channel regulates endothelial barrier function. Membrane receptors, channels and transporters in pulmonary circulation. J. X. J. Yuan and J. P. T. Ward, Humana Press. 661: 155-167.

Heiner, I., Eisfeld, J., Warnstedt, M., Radukina, N., Jungling, E., et al. (2006). Endogenous ADP-ribose enables calcium-regulated cation currents through TRPM2 channels in neutrophil granulocytes. Biochemical Journal 398(2): 225-232.

Hill, K., Tigue, N.J., Kelsell, R.E., Benham, C.D., McNulty, S., et al. (2006). Characterisation of recombinant rat TRPM2 and a TRPM2-like conductance in cultured rat striatal neurones. Neuropharmacology 50(1): 89-97.

144

Hill, S.M. (1998). Receptor crosstalk: communication through cell signaling pathways. Anatomical Record 253(2): 42-48.

Hockenbery, D.M., Oltvai, Z.N., Yin, X.-M., Milliman, C.L. and Korsmeyer, S.J. (1993). Bcl-2 functions in an antioxidant pathway to prevent apoptosis. Cell 75(2): 241-251.

Hofmann, T., Chubanov, V., Gudermann, T. and Montell, C. (2003). TRPM5 is a voltage- modulated and Ca2+-activated monovalent selective cation channel. Current Biology 13(13): 1153-1158.

Hofmann, T., Obukhov, A.G., Schaefer, M., Harteneck, C., Gudermann, T., et al. (1999). Direct activation of human TRPC6 and TRPC3 channels by diacylglycerol. Nature 397(6716): 259-263.

Hofmann, T., Schaefer, M., Schultz, G. and Gudermann, T. (2000). Transient receptor potential channels as molecular substrates of receptor-mediated cation entry. Journal of Molecular Medicine 78: 14-25.

Hong, J.H., Moon, S.J., Byun, H.M., Kim, M.S., Jo, H., et al. (2006). Critical role of 2+ phospholipase Cγ1 in the generation of H2O2-evoked [Ca ]i oscillations in cultured rat cortical astrocytes. Journal of Biological Chemistry 281(19): 13057-13067.

Horesh, N. and Iancu, I. (2010). A comparison of life events in patients with unipolar disorder or bipolar disorder and controls. Comprehensive Psychiatry 51(2): 157-164.

Hough, C., Lu, S.-J., Davis, C.L., Chuang, D.-M. and Post, R. (1999). Elevated basal and thapsigargin-stimulated intracellular calcium of platelets and lymphocytes from bipolar affective disorder patients measured by a fluorometric microassay. Biological Psychiatry 46: 247-255.

Huang, W.C., Young, J.S. and Glitsch, M.D. (2007). Changes in TRPC channel expression during postnatal development of cerebellar neurons. Cell Calcium 42(1): 1-10.

Hudson, C.J., Young, L.T., Li, P.P. and Warsh, J.J. (1993). CNS signal transduction in the pathophysiology and pharmacotherapy of affective disorders and schizophrenia. Synapse 13(3): 278-293.

Hunsberger, J.G., Austin, D.R., Chen, G. and Manji, H.K. (2009). Cellular mechanisms underlying affective resiliency: The role of glucocorticoid receptor- and mitochondrially- mediated plasticity. Brain Research 1293: 76-84.

Hunt, S.P., Pini, A. and Evan, G. (1987). Induction of c-fos-like protein in spinal cord neurons following sensory stimulation. Nature 328(6131): 632-634.

Inoue, R., Jensen, L.J., Shi, J., Morita, H., Nishida, M., et al. (2006). Transient receptor potential channels in cardiovascular function and disease. Circulation Research 99(2): 119-131.

Iuchi, T., Akaike, M., Mitsui, T., Ohshima, Y., Shintani, Y., et al. (2003). Glucocorticoid excess induces superoxide production in vascular endothelial cells and elicits vascular endothelial dysfunction. Circulation Research 92(1): 81-87.

145

Iwamoto, K., Bundo, M. and Kato, T. (2005). Altered expression of mitochondria-related genes in postmortem brains of patients with bipolar disorder or schizophrenia, as revealed by large- scale DNA microarray analysis. Human Molecular Genetics 14(2): 241-253.

Iwamoto, K., Bundo, M., Washizuka, S., Kakiuchi, C. and Kato, T. (2004). Expression of HSPF1 and LIM in the lymphoblastoid cells derived from patients with bipolar disorder and schizophrenia. Journal of Human Genetics 49(5): 227-231.

Iwata, E., Asanuma, M., Nishibayashi, S., Kondo, Y. and Ogawa, N. (1997). Different effects of oxidative stress on activation of transcription factors in primary cultured rat neuronal and glial cells. Brain Research. Molecular Brain Research 50(1-2): 213-220.

Jia, Y., Zhou, J., Tai, Y. and Wang, Y. (2007). TRPC channels promote cerebellar granule neuron survival. Nature Neuroscience 10(5): 559-567.

Johnson, S.A., Wang, J.F., Sun, X., McEwen, B.S., Chattarji, S., et al. (2009). Lithium treatment prevents stress-induced dendritic remodeling in the rodent amygdala. Neuroscience 163(1): 34- 39.

Johnson, S.L. (2005). Life events in bipolar disorder: towards more specific models. Clinical Psychology Review 25(8): 1008-1027.

Jope, R., S, Song, L., Li, P.P., Young, L.T., Kish, S.J., et al. (1996). The phosphoinositide signal transduction system is imparied in bipolar affective disorder brain. Journal of Neurochemistry 66: 2402-2409.

Kakiuchi, C., Iwamoto, K., Ishiwata, M., Bundo, M., Kasahara, T., et al. (2003). Impaired feedback regulation of XBP1 as a genetic risk factor for bipolar disorder. Nature Genetics 35(2): 171-175.

Kanai, H., Sawa, A., Chen, R.W., Leeds, P. and Chuang, D.M. (2004). Valproic acid inhibits histone deacetylase activity and suppresses excitotoxicity-induced GAPDH nuclear accumulation and apoptotic death in neurons. Pharmacogenomics Journal 4(5): 336-344.

Kaneko, S., Kawakami, S., Hara, Y., Wakamori, M., Itoh, E., et al. (2006). A critical role of TRPM2 in neuronal cell death by hydrogen peroxide. Journal of Pharmacological Sciences 101(1): 66-76.

Kaneva, R.P., Chorbov, V.M., Milanova, V.K., Kostov, C.S., Nickolov, K.I., et al. (2004). Linkage analysis in bipolar pedigrees adds support for a susceptibility locus on 21q22. Psychiatric Genetics 14(2): 101-106.

Kapczinski, F., Dal-Pizzol, F., Teixeira, A.L., Magalhaes, P.V.S., Kauer-Sant’Anna, M., et al. (2011). Peripheral biomarkers and illness activity in bipolar disorder. Journal of Psychiatric Research 45(2): 156-161.

146

Kapczinski, F., Frey, B.N., Kauer-Sant'Anna, M. and Grassi-Oliveira, R. (2008). Brain-derived neurotrophic factor and neuroplasticity in bipolar disorder. Expert Review of Neurotherapeutics 8(7): 1101-1113.

Karege, F., Schwald, M., Papadimitriou, P., Lachausse, C. and Cissé, M. (2004). The cAMP- dependent protein kinase A and brain-derived neurotrophic factor expression in lymphoblast cells of bipolar affective disorder. Journal of Affective Disorders 79: 187-192.

Karry, R., Klein, E. and Ben Shachar, D. (2004). Mitochondrial complex I subunits expression is altered in schizophrenia: a postmortem study. Biological Psychiatry 55(7): 676-684.

Kashio, M., Sokabe, T., Shintaku, K., Uematsu, T., Fukuta, N., et al. (2012). Redox signal- mediated sensitization of transient receptor potential melastatin 2 (TRPM2) to temperature affects macrophage functions. Proceedings of the National Academy of Sciences 109(17): 6745- 6750.

Kato, T. (2008). Role of mitochondrial DNA in calcium signaling abnormality in bipolar disorder. Cell Calcium 44(1): 92-102.

Kato, T., Inubushi, T. and Kato, N. (1998). Magnetic resonance spectroscopy in affective disorders. Journal of Neuropsychiatry and Clinical Neurosciences 10(2): 133-147.

Kato, T., Ishiwata, M., Mori, K., Washizuka, S., Tajima, O., et al. (2003). Mechanisms of altered Ca2+ signalling in transformed lymphoblastoid cells from patients with bipolar disorder. International Journal of Neuropsychopharmacology 6: 379-389.

Kato, T. and Kato, N. (2000). Mitochondrial dysfunction in bipolar disorder. Bipolar Disorders 2: 180-190.

Kato, T., Kunugi, H., Nanko, S. and Kato, N. (2001). Mitochondrial DNA polymorphisms in bipolar disorder. Journal of Affective Disorders 62(3): 151-164.

Kato, T., Murashita, J., Kamiya, A., Shioiri, T., Kato, N., et al. (1998). Decreased brain intracellular pH measured by 31P-MRS in bipolar disorder: a confirmation in drug-free patients and correlation with white matter hyperintensity. European Archives of Psychiatry and Clinical Neuroscience 248(6): 301-306.

Kato, T., Shioiri, T., Murashita, J., Hamakawa, H., Takahashi, Y., et al. (1995). Lateralized abnormality of high energy phosphate metabolism in the frontal lobes of patients with bipolar disorder detected by phase-encoded 31P-MRS. Psychological Medicine 25(03): 557-566.

Kato, T., Stine, O.C., McMahon, F.J. and Crowe, R.R. (1997). Increased levels of a mitochondrial DNA deletion in the brain of patients with bipolar disorder. Biological Psychiatry 42(10): 871-875.

Kelsoe, J.R., Spence, M.A., Loetscher, E., Foguet, M., Sadovnick, A.D., et al. (2001). A genome survey indicates a possible susceptibility locus for bipolar disorder on chromosome 22. Proceedings of the National Academy of Science, USA 98(2): 585-590.

147

Kemp, D.E., Gao, K., Chan, P.K., Ganocy, S.J., Findling, R.L., et al. (2010). Medical comorbidity in bipolar disorder: relationship between illnesses of the endocrine/metabolic system and treatment outcome. Bipolar Disorders 12(4): 404-413.

Kendler, K.S., Thornton, L.M. and Gardner, C.O. (2001). Genetic risk, number of previous depressive episodes, and stressful life events in predicting onset of major depression. American Journal of Psychiatry 158(4): 582-586.

Keyse, S.M., Applegate, L.A., Tromvoukis, Y. and Tyrrell, R.M. (1990). Oxidant stress leads to transcriptional activation of the human heme oxygenase gene in cultured skin fibroblasts. Molecular and Cellular Biology 10(9): 4967-4969.

Kilbourne, A., Cornelius, J., Han, X., Pincus, H., Shad, M., et al. (2004). Burden of general medical conditions among individuals with bipolar disorder. Bipolar Disorders 6: 368-373.

Kim, M.S., Hong, J.H., Li, Q., Shin, D.M., Abramowitz, J., et al. (2009). Deletion of TRPC3 in mice reduces store-operated Ca2+ influx and the severity of acute pancreatitis. Gastroenterology 137(4): 1509-1517.

Kim, M.S., Lee, K.P., Yang, D., Shin, D.M., Abramowitz, J., et al. (2011). Genetic and pharmacologic inhibition of the Ca2+ influx channel TRPC3 protects secretory epithelia from Ca2+-dependent toxicity. Gastroenterology 140(7): 2107-2115.e2104.

King, T.D. and Jope, R.S. (2005). Inhibition of glycogen synthase kinase-3 protects cells from intrinsic but not extrinsic oxidative stress. Neuroreport 16(6): 597-601.

Kiselyov, K., Kim, J.Y., Zeng, W. and Muallem, S. (2005). Protein-protein interaction and function TRPC channels. Pflugers Archiv European Journal of Physiology 451(1): 116-124.

Kiselyov, K., Shin, D.M., Kim, J.Y., Yuan, J.P. and Muallem, S. (2007). TRPC channels: interacting proteins. Handbook Experimental Pharmacology(179): 559-574.

Kish, S.J., Shannak, K. and Hornykiewicz, O. (1988). Uneven pattern of dopamine loss in the striatum of patients with idiopathic Parkinson's disease. Pathophysiologic and clinical implications. New England Journal of Medicine 318(14): 876-880.

Kitajima, N., Watanabe, K., Morimoto, S., Sato, Y., Kiyonaka, S., et al. (2011). TRPC3- mediated Ca2+ influx contributes to Rac1-mediated production of reactive oxygen species in MLP-deficient mouse hearts. Biochemical and Biophysical Research Communications 409(1): 108-113.

Kiyonaka, S., Kato, K., Nishida, M., Mio, K., Numaga, T., et al. (2009). Selective and direct inhibition of TRPC3 channels underlies biological activities of a pyrazole compound. Proceedings of the National Academy of Science, United States of America 106(13): 5400-5405.

Kleinman, L.S., Lowin, A., Flood, E., Gandhi, G., Edgell, E., et al. (2003). Costs of bipolar disorder. PharmacoEconomics 21(9): 601-622.

148

Konradi, C., Eaton, M., MacDonald, M.L., Walsh, J., Benes, F.M., et al. (2004). Molecular evidence for mitochondrial dysfunction in bipolar disorder. Archives of General Psychiatry 61(3): 300-308.

Konradi, C., Zimmerman, E.I., Yang, C.K., Lohmann, K.M., Gresch, P., et al. (2010). Hippocampal interneurons in bipolar disorder. Archives of General Psychiatry 68(4): 340-350.

Kraft, R., Grimm, C., Grosse, K., Hoffmann, A., Sauerbruch, S., et al. (2004). Hydrogen peroxide and ADP-ribose induce TRPM2-mediated calcium influx and cation currents in microglia. American Journal of Physiology. Cell Physiology 286(1): C129-137.

Krakow, D., Vriens, J., Camacho, N., Luong, P., Deixler, H., et al. (2009). Mutations in the gene encoding the calcium-permeable ion channel TRPV4 produce spondylometaphyseal dysplasia, Kozlowski type and metatropic dysplasia. American Journal of Human Genetics 84(3): 307-315.

Krishnan, K. (2005). Psychiatric and medical comorbidities of bipoar disorder. Psychosomatic Medicine 67(1): 1-8.

Kruse, M., Schulze-Bahr, E., Corfield, V., Beckmann, A., Stallmeyer, B., et al. (2009). Impaired endocytosis of the ion channel TRPM4 is associated with human progressive familial heart block type I. Journal of Clinical Investigation 119(9): 2737-2744.

Kühn, F., Kühn, C., Naziroglu, M. and Lückhoff, A. (2009). Role of an N-terminal splice segment in the activation of the cation channel TRPM2 by ADP-ribose and hydrogen peroxide. Neurochemical Research 34(2): 227-233.

Kühn, F.J.P. and Lückhoff, A. (2004). Sites of the NUDT9-H domain critical for ADP-ribose activation of the cation channel TRPM2. Journal of Biological Chemistry 279(45): 46431-46437.

Kuhn, F.J.P., Heiner, I. and Luckhoff, A. (2005). TRPM2: a calcium influx pathway regulated by oxidative stress and the novel second messenger ADP-ribose. Pflugers Archiv European Journal of Physiology 451(1): 212-219.

Kuloglu, M., Ustundag, B., Atmaca, M., Canatan, H., Tezcan, A.E., et al. (2002). Lipid peroxidation and antioxidant enzyme levels in patients with schizophrenia and bipolar disorder. Cell Biochemistry and Function 20(2): 171-175.

Kunert-Keil, C., Bisping, F., Kruger, J. and Brinkmeier, H. (2006). Tissue-specific expression of TRP channel genes in the mouse and its variation in three different mouse strains. BMC Genomics 7(1): 159.

Kupfer, D.J. (2005). The increasing medical burden in bipolar disorder. Journal of the American Medical Association 293(20): 2528-2530.

Kweon, G.R., Marks, J.D., Krencik, R., Leung, E.H., Schumacker, P.T., et al. (2004). Distinct mechanisms of neurodegeneration induced by chronic complex I inhibition in dopaminergic and non-dopaminergic cells. Journal of Biological Chemistry 279(50): 51783-51792.

149

Kwok, J.B., Adams, L.J., Salmon, J.A., Donald, J.A., Mitchell, P.B., et al. (1999). Nonparametric simulation-based statistical analyses for bipolar affective disorder locus on chromosome 21q22.3. American Journal of Medical Genetics 88(1): 99-102.

Lai, J.S., Zhao, C., Warsh, J.J. and Li, P.P. (2006). Cytoprotection by lithium and valproate varies between cell types and cellular stresses. European Journal of Pharmacology 539(1-2): 18- 26.

Launay, P., Fleig, A., Perraud, A.-L., Scharenberg, A.M., Penner, R., et al. (2002). TRPM4 is a Ca2+-activated nonselective cation channel mediating cell membrane depolarization. Cell 109(3): 397-407.

Li, H.-S. and Montell, C. (2000). TRP and the PDZ protein, INAD, form the core complex required for retention of the signalplex in drosophila photoreceptor cells. Journal of Cell Biology 150(6): 1411-1422.

Li, H.S., Xu, X.Z. and Montell, C. (1999). Activation of a TRPC3-dependent cation current through the neurotrophin BDNF. Neuron 24(1): 261-273.

Li, N., Ragheb, K., Lawler, G., Sturgis, J., Rajwa, B., et al. (2003). Mitochondrial complex I inhibitor rotenone induces apoptosis through enhancing mitochondrial reactive oxygen species production. Journal of Biological Chemistry 278(10): 8516-8525.

Li, P., Andreopoulos, S. and Warsh, J. (2000). Signal transduction abnormalities in bipolar affective disorder. Cerebral Signal Transduction: From First to Fourth Messengers. M. E. A. Reith. Totowa, NJ, Humana Press: 283-309.

Li, P.P., Sibony, D., Green, M.A. and Warsh, J.J. (1993). Lithium modulation of phosphoinositide signaling system in rat cortex: selective effect on phorbol ester binding. Journal of Neurochemistry 61(5): 1722-1730.

Li, Y., Jia, Y.C., Cui, K., Li, N., Zheng, Z.Y., et al. (2005). Essential role of TRPC channels in the guidance of nerve growth cones by brain-derived neurotrophic factor. Nature 434(7035): 894-898.

Lin, H.Y., Michtalik, H.J., Zhang, S., Andersen, T.T., Van Riper, D.A., et al. (2003). Oxidative and calcium stress regulate DSCR1 (Adapt78/MCIP1) protein. Free Radical Biology and Medicine 35(5): 528-539.

Lin, M.T. and Beal, M.F. (2006). Mitochondrial dysfunction and oxidative stress in neurodegenerative diseases. Nature 443(7113): 787-795.

Link, E.M. and Riley, P.A. (1988). Role of hydrogen peroxide in the cytotoxicity of the xanthine/xanthine oxidase system. Biochemical Journal 249(2): 391-399.

Liston, C. and Gan, W.-B. (2011). Glucocorticoids are critical regulators of dendritic spine development and plasticity in vivo. Proceedings of the National Academy of Sciences 108(38): 16074-16079.

150

Liu, J., Juo, S.H., Terwilliger, J.D., Grunn, A., Tong, X., et al. (2001). A follow-up linkage study supports evidence for a bipolar affective disorder locus on chromosome 21q22. American Journal of Medical Genetics 105(2): 189-194.

Liu, J. and Mori, A. (1999). Stress, aging, and brain oxidative damage. Neurochemical Research 24(11): 1479-1497.

Livak, K.J. and Schmittgen, T.D. (2001). Analysis of relative gene expression data using real- time quantitative PCR and the 2-[Delta][Delta]CT method. Methods 25(4): 402-408.

Lockwich, T., Pant, J., Makusky, A., Jankowska-Stephens, E., Kowalak, J.A., et al. (2008). Analysis of TRPC3-interacting proteins by tandem mass spectrometry. Journal of Proteome Research 7(3): 979-989.

Lonze, B.E. and Ginty, D.D. (2002). Function and regulation of CREB family transcription factors in the nervous system. Neuron 35(4): 605-623.

Lopez, A.D. and Murray, C.C.J.L. (1998). The global burden of disease, 1990-2020. Nature Medicine 4(11): 1241-1243.

Lucca, G., Comim, C.M., Valvassori, S.S., Réus, G.Z., Vuolo, F., et al. (2009). Increased oxidative stress in submitochondrial particles into the brain of rats submitted to the chronic mild stress paradigm. Journal of Psychiatric Research 43(9): 864-869.

MacKinnon, D.F., Zandi, P.P., Gershon, E.S., Nurnberger, J.I., Jr. and DePaulo, J.R., Jr. (2003). Association of rapid mood switching with panic disorder and familial panic risk in familial bipolar disorder. American Journal of Psychiatry 160(9): 1696-1698.

Magariños, A.M., Verdugo, J.M.G. and McEwen, B.S. (1997). Chronic stress alters synaptic terminal structure in hippocampus. Proceedings of the National Academy of Sciences 94(25): 14002-14008.

Manji, H., Moore, G., Rajkowska, G. and Chen, G. (2000). Neuroplasticity and cellular resilience in mood disorders. Molecular Psychiatry 5: 578-593.

Manji, H.K., Drevets, W.C. and Charney, D.S. (2001). The cellular neurobiology of depression. Nature Medicine 7(5): 541-547.

Manji, H.K. and Lenox, R.H. (2000). Signaling: cellular insights into the pathophysiology of bipolar disorder. Biological Psychiatry 48(6): 518-530.

Manji, H.K., Potter, W.Z. and Lenox, R.H. (1995). Signal transduction pathways. Molecular targets for lithium's actions. Archives of General Psychiatry 52(7): 531-543.

Manji, H.K., Quiroz, J.A., Sporn, J., Payne, J.L., Denicoff, K., et al. (2003). Enhancing neuronal plasticity and cellular resilience to develop novel, improved therapeutics for difficult-to-treat depression. Biological Psychiatry 53(8): 707-742.

151

Mantamadiotis, T., Lemberger, T., Bleckmann, S.C., Kern, H., Kretz, O., et al. (2002). Disruption of CREB function in brain leads to neurodegeneration. Nature Genetics 31(1): 47-54.

Marchini, J., Cardon, L.R., Phillips, M.S. and Donnelly, P. (2004). The effects of human population structure on large genetic association studies 21. Nature Genetics 36(5): 512-517.

Marín, M.P., Esteban-Pretel, G., Ponsoda, X., Romero, A.M., Ballestín, R., et al. (2010). Endocytosis in cultured neurons is altered by chronic alcohol exposure. Toxicological Sciences 115(1): 202-213.

Maruyama, Y., Ogura, T., Mio, K., Kiyonaka, S., Kato, K., et al. (2007). Three-dimensional reconstruction using transmission electron microscopy reveals a swollen, bell-shaped structure of transient receptor potential melastatin type 2 cation channel. Journal of Biological Chemistry 282(51): 36961-36970.

Mathews, R., Li, P.P., Young, L.T., Kish, S.J. and Warsh, J.J. (1997). Increased Gq/11 immunoreactivity in postmortem occipital cortex from patients with bipolar affective disorder. Biological Psychiatry 41: 649-656.

Mattson, M.P. (2007). Mitochondrial regulation of neuronal plasticity. Neurochemical Research 32(4-5): 707-715.

Mattson, M.P., LaFerla, F.M., Chan, S.L., Leissring, M.A., Shepel, P.N., et al. (2000). Calcium signaling in the ER: its role in neuronal plasticity and neurodegenerative disorders. Trends in Neuroscience 23: 222-229.

Maziade, M., Roy, M.A., Rouillard, E., Bissonnette, L., Fournier, J.P., et al. (2001). A search for specific and common susceptibility loci for schizophrenia and bipolar disorder: a linkage study in 13 target chromosomes. Molecular Psychiatry 6(6): 684-693.

McCurdy, R.D., Féron, F., Perry, C., Chant, D.C., McLean, D., et al. (2006). Cell cycle alterations in biopsied olfactory neuroepithelium in schizophrenia and bipolar I disorder using cell culture and gene expression analyses. Schizophrenia Research 82(2-3): 163-173.

McEwen, B.S. (2003). Mood disorders and allostatic load. Biological Psychiatry 54(3): 200-207.

McEwen, B.S. (2004). Protection and damage from acute and chronic stress: allostasis and allostatic overload and relevance to the pathophysiology of psychiatric disorders. Annals of the New York Academy of Sciences 1032: 1-7.

McEwen, B.S. (2005). Glucocorticoids, depression, and mood disorders: structural remodeling in the brain. Metabolism 54(5 Suppl 1): 20-23.

McEwen, B.S. and Gianaros, P.J. (2011). Stress- and Allostasis-Induced Brain Plasticity. Annual Review of Medicine 62(1): 431-445.

152

McHugh, D., Flemming, R., Xu, S.Z., Perraud, A.L. and Beech, D.J. (2003). Critical intracellular Ca2+ dependence of transient receptor potential melastatin 2 (TRPM2) cation channel activation. Journal of Biological Chemistry 278(13): 11002-11006.

McNulty, S. and Fonfria, E. (2005). The role of TRPM channels in cell death. Pflugers Archiv European Journal of Physiology 451(1): 235-242.

McQueen, M.B., Devlin, B., Faraone, S.V., Nimgaonkar, V.L., Sklar, P., et al. (2005). Combined analysis from eleven linkage studies of bipolar disorder provides strong evidence of susceptibility loci on chromosomes 6q and 8q 1. American Journal of Human Genetics 77(4): 582-585.

McQuillin, A., Bass, N.J., Choudhury, K., Puri, V., Kosmin, M., et al. (2008). Case-control studies show that a non-conservative amino-acid change from a glutamine to arginine in the P2RX7 purinergic receptor protein is associated with both bipolar- and unipolar-affective disorders. Molecular Psychiatry 14(6): 614-620.

McQuillin, A., Bass, N.J., Kalsi, G., Lawrence, J., Puri, V., et al. (2006). Fine mapping of a susceptibility locus for bipolar and genetically related unipolar affective disorders, to a region containing the C21ORF29 and TRPM2 genes on chromosome 21q22.3. Molecular Psychiatry 11(2): 134-142.

Meltzer, H., Kassir, S., Goodnick, P., Fieve, R., Chrisomalis, L., et al. (1988). Calmodulin- activated calcium ATPase in bipolar illness. Neuropsychobiology 20: 169-173.

Merikangas, K.R., Jin, R., He, J.-P., Kessler, R.C., Lee, S., et al. (2011). Prevalence and correlates of bipolar spectrum disorder in the world mental health survey initiative. Archives of General Psychiatry 68(3): 241-251.

Miller, B.A. (2006). The role of TRP channels in oxidative stress-induced cell death. Journal of Membrane Biology 209(1): 31-41.

Miller, B.A. and Zhang, W. (2011). TRP channels as mediators of oxidative stress. Advances in Experimental Biology and Medicine 704: 531-544.

Miller, J.C., Jiménez, P. and Mathé, A.A. (2007). Restraint stress influences AP-1 and CREB DNA-binding activity induced by chronic lithium treatment in the rat frontal cortex and hippocampus. The International Journal of Neuropsychopharmacology 10(05): 609-619.

Mitra, R., Jadhav, S., McEwen, B.S., Vyas, A. and Chattarji, S. (2005). Stress duration modulates the spatiotemporal patterns of spine formation in the basolateral amygdala. Proceedings of the National Academy of Sciences of the United States of America 102(26): 9371- 9376.

Montell, C., Birnbaumer, L. and Flockerzi, V. (2002). The TRP channels, a remarkably functional family. Cell 108(5): 595-598.

153

Moore, G.J., Bebchuk, J.M., Wilds, I.B., Chen, G. and Menji, H.K. (2000). Lithium-induced increase in human brain grey matter. The Lancet 356(9237): 1241-1242.

Moore, G.J., Cortese, B.M., Glitz, D.A., Zajac-Benitez, C., Quiroz, J.A., et al. (2009). A longitudinal study of the effects of lithium treatment on prefrontal and subgenual prefrontal gray matter volume in treatment-responsive bipolar disorder patients. Journal of Clinical Psychiatry 70(5): 699-705.

Morales, S., Diez, A., Puyet, A., Camello, P.J., Camello-Almaraz, C., et al. (2007). Calcium controls smooth muscle TRPC gene transcription via the CaMK/calcineurin-dependent pathways. American Journal of Physiology - Cell Physiology 292(1): C553-563.

Moran, M.M., Xu, H. and Clapham, D.E. (2004). TRP ion channels in the nervous system. Current Opinion in Neurobiology 14(3): 362-369.

Motulsky, H. and Christopoulos, A. (2004). Fitting Models to Biological Data Using Linear and Nonlinear Regression: A Practical Guide to Curve Fitting, Oxford University Press US.

Muller, M., Holsboer, F. and Keck, M.E. (2002). Genetic modification of corticosteroid receptor signalling: novel insights into pathophysiology and treatment strategies of human affective disorders. Neuropeptides 36(2-3): 117-131.

Munakata, K., Tanaka, M., Mori, K., Washizuka, S., Yoneda, M., et al. (2004). Mitochondrial DNA 3644T→C mutation associated with bipolar disorder. Genomics 84(6): 1041-1050.

Murphy, A.N., Bredesen, D.E., Cortopassi, G., Wang, E. and Fiskum, G. (1996). Bcl-2 potentiates the maximal calcium uptake capacity of neural cell mitochondria. Proceedings of the National Academy of Sciences of the United States of America 93(18): 9893-9898.

Nagamine, K., Kudoh, J., Minoshima, S., Kawasaki, K., Asakawa, S., et al. (1998). Molecular cloning of a novel putative Ca2+ channel protein (TRPC7) highly expressed in brain. Genomics 54(1): 124-131.

Nakao, K., Shirakawa, H., Sugishita, A., Matsutani, I., Niidome, T., et al. (2008). Ca2+ mobilization mediated by transient receptor potential canonical 3 is associated with thrombin- induced morphological changes in 1321N1 human astrocytoma cells. Journal of Neuroscience Research 86(12): 2722-2732.

Naziroglu, M. (2011). TRPM2 channel membrane currents in primary rat megakaryocytes were activated by the agonist ADP-ribose but not oxidative stress. Journal of Membrane Biology 241(2): 51-57.

Nazıroğlu, M., Lückhoff, A. and Jüngling, E. (2007). Antagonist effect of flufenamic acid on TRPM2 cation channels activated by hydrogen peroxide. Cell Biochemistry and Function 25(4): 383-387.

154

Naziroglu, M., Ozgul, C., Cig, B., Dogan, S. and Uguz, A.C. (2011). Glutathione modulates Ca2+ influx and oxidative toxicity through TRPM2 channel in rat dorsal root ganglion neurons. Journal of Membrane Biology.

Ng, F., Berk, M., Dean, O. and Bush, A.I. (2008). Oxidative stress in psychiatric disorders: evidence base and therapeutic implications. International Journal of Neuropsychopharmacology 11(6): 851-876.

Nilius, B., Voets, T. and Peters, J. (2005). TRP channels in disease. Science's stke 2005(295): re8.

Nonaka, S., Hough, C.J. and Chuang, D.M. (1998). Chronic lithium treatment robustly protects neurons in the central nervous system against excitotoxicity by inhibiting N-methyl-D-aspartate receptor-mediated calcium influx. Proceedings of the National Academy of Sciences of the United States of America 95(5): 2642-2647.

Numaga, T., Nishida, M., Kiyonaka, S., Kato, K., Katano, M., et al. (2010). Ca2+ influx and protein scaffolding via TRPC3 sustain PKC and ERK activation in B cells. Journal of Cell Science 123(6): 927-938.

Olah, M.E., Jackson, M.F., Li, H., Perez, Y., Sun, H.-S., et al. (2009). Ca2+-dependent induction of TRPM2 currents in hippocampal neurons. The Journal of Physiology 587(5): 965-979.

Ongur, D., Drevets, W.C. and Price, J.L. (1998). Glial reduction in the subgenual prefrontal cortex in mood disorders. Proceedings of the National Academy of Science, United States of America 95: 13290-13295.

Onohara, N., Nishida, M., Inoue, R., Kobayashi, H., Sumimoto, H., et al. (2006). TRPC3 and TRPC6 are essential for angiotensin II-induced cardiac hypertrophy. EMBO Journal 25(22): 5305-5316.

Ozaki, N. and Chuang, D.M. (1997). Lithium increases transcription factor binding to AP-1 and cyclic AMP-responsive element in cultured neurons and rat brain. Journal of Neurochemistry 69(6): 2336-2344.

Pantazopoulos, H., Lange, N., Baldessarini, R.J. and Berretta, S. (2007). Parvalbumin neurons in the entorhinal cortex of subjects diagnosed with bipolar disorder or schizophrenia. Biological Psychiatry 61(5): 640-652.

Papagni, S.A., Benetti, S., Arulanantham, S., McCrory, E., McGuire, P., et al. (2011). Effects of stressful life events on human brain structure: A longitudinal voxel-based morphometry study. Stress 14(2): 227-232.

Parekh, A.B. and Putney, J.W., Jr. (2005). Store-Operated Calcium Channels. Physiological Reviews 85(2): 757-810.

Paykel, E.S. (2003). Life events and affective disorders. Acta Psychiatrica Scandinavica(418): 61-66.

155

Pedersen, S.F., Owsianik, G. and Nilius, B. (2005). TRP channels: An overview. Cell Calcium 38: 233-252.

Pentreath, V.W. and Slamon, N.D. (2000). Astrocyte phenotype and prevention against oxidative damage in neurotoxicity. Human & Experimental Toxicology 19(11): 641-649.

Perez-Cadahia, B., Drobic, B. and Davie, J.R. (2011). Activation and function of immediate- early genes in the nervous system. Biochemistry and Cell Biology 89(1): 61-73.

Perova, T., Kwan, M., Li, P.P. and Warsh, J.J. (2009). Differential modulation of intracellular Ca2+ responses in B lymphoblasts by mood stabilizers. International Journal of Neuropsychopharmacology: 1-10.

Perova, T., Wasserman, M.J., Li, P.P. and Warsh, J.J. (2008). Hyperactive intracellular calcium dynamics in B lymphoblasts from patients with bipolar I disorder. International Journal of Neuropsychopharmacology 11(2): 185-196.

Perraud, A.L., Fleig, A., Dunn, C.A., Bagley, L.A., Launay, P., et al. (2001). ADP-ribose gating of the calcium-permeable LTRPC2 channel revealed by Nudix motif homology. Nature 411(6837): 595-599.

Perraud, A.L., Schmitz, C. and Scharenberg, A.M. (2003). TRPM2 Ca2+ permeable cation channels: from gene to biological function. Cell Calcium 33(5-6): 519-531.

Perrier, E., Pompei, F., Ruberto, G., Vassos, E., Collier, D., et al. (2011). Initial evidence for the role of CACNA1C on subcortical brain morphology in patients with bipolar disorder. European Psychiatry 26(3): 135-137.

Pham, K., Nacher, J., Hof, P.R. and McEwen, B.S. (2003). Repeated restraint stress suppresses neurogenesis and induces biphasic PSA-NCAM expression in the adult rat dentate gyrus. European Journal of Neuroscience 17(4): 879-886.

Phillips, M.L., Ladouceur, C.D. and Drevets, W.C. (2008). A neural model of voluntary and automatic emotion regulation: implications for understanding the pathophysiology and neurodevelopment of bipolar disorder. Molecular Psychiatry 13(9): 829, 833-857.

Pietruck, F., Moritz, A., Montemurro, M., Sell, A., Busch, S., et al. (1996). Selectively enhanced cellular signaling by Gi proteins in essential hypertension: Gi2, Gi3, G1, and G2 are not mutated. Ciculation Research 79(5): 974-983.

Pigozzi, D., Ducret, T., Tajeddine, N., Gala, J.L., Tombal, B., et al. (2006). Calcium store contents control the expression of TRPC1, TRPC3 and TRPV6 proteins in LNCaP prostate cancer cell line. Cell Calcium 39(5): 401-415.

Polymeropoulos, M., Lavedan, C., Leroy, E., Ide, S., Dehejia, A., et al. (1997). Mutation in the -synuclein gene identified in families with Parkinson's disease. Science 276: 2045-2047.

156

Post, R. (1992). Transduction of psychosocial stress into the neurobiology of recurrent affective disorder. American Journal of Psychiatry 149(8): 999-1010.

Poteser, M., Graziani, A., Rosker, C., Eder, P., Derler, I., et al. (2006). TRPC3 and TRPC4 associate to form a redox-sensitive cation channel: evidence for expression of native TRPC3- TRPC4 heteromeric channels in endothelial cells. Journal of Biological Chemistry 281(19): 13588-13595.

Poteser, M., Schleifer, H., Lichtenegger, M., Schernthaner, M., Stockner, T., et al. (2011). PKC- dependent coupling of calcium permeation through transient receptor potential canonical 3 (TRPC3) to calcineurin signaling in HL-1 myocytes. Proceedings of the National Academy of Sciences 108(26): 10556-10561.

Przedborski, S. and Ischiropoulos, H. (2005). Reactive oxygen and nitrogen species: weapons of neuronal destruction in models of Parkinson's disease. Antioxidants & Redox Signaling 7(5-6): 685-693.

Putney, J. (2005). Physiological mechanisms of TRPC activation. Pflugers Archiv European Journal of Physiology 451(1): 29-34.

Putney, J.W., Jr. (2003). Capacitative calcium entry in the nervous system. Cell Calcium 34(4-5): 339-344.

Quiroz, J.A., Machado-Vieira, R., Zarate, J.C.A. and Manji, H.K. (2010). Novel insights into lithium’s mechanism of action: neurotrophic and neuroprotective effects. Neuropsychobiology 62(1): 50-60.

Radley, J.J., Rocher, A.B., Miller, M., Janssen, W.G.M., Liston, C., et al. (2006). Repeated stress induces dendritic spine loss in the rat medial prefrontal cortex. Cerebral Cortex 16(3): 313-320.

Radley, J.J., Rocher, A.B., Rodriguez, A., Ehlenberger, D.B., Dammann, M., et al. (2008). Repeated stress alters dendritic spine morphology in the rat medial prefrontal cortex. The Journal of Comparative Neurology 507(1): 1141-1150.

Radley, J.J., Sisti, H.M., Hao, J., Rocher, A.B., McCall, T., et al. (2004). Chronic behavioral stress induces apical dendritic reorganization in pyramidal neurons of the medial prefrontal cortex. Neuroscience 125(1): 1-6.

Rajkowska, G. (2002). Cell pathology in bipolar disorder. Bipolar Disorders 4: 105-116.

Rajkowska, G., Halaris, A. and Selemon, L.D. (2001). Reductions in neuronal and glial density characterize the dorsolateral prefrontal cortex in mood disorders. Biological Psychiatry 49: 741- 752.

Ramachandiran, S., Hansen, J.M., Jones, D.P., Richardson, J.R. and Miller, G.W. (2007). Divergent mechanisms of paraquat, MPP+, and rotenone toxicity: Oxidation of thioredoxin and caspase-3 activation. Toxicological Sciences 95(1): 163-171.

157

Raps, S.P., Lai, J.C.K., Hertz, L. and Cooper, A.J.L. (1989). Glutathione is present in high concentrations in cultured astrocytes but not in cultured neurons. Brain Research 493(2): 398- 401.

Reiter, T.A., Abraham, R.T., Choi, M. and Rusnak, F. (1999). Redox regulation of calcineurin in T-lymphocytes. Journal of Biological Inorganic Chemistry 4(5): 632-644.

Reynolds, L.M. and Reynolds, G.P. (2011). Differential regional N-acetylaspartate deficits in postmortem brain in schizophrenia, bipolar disorder and major depressive disorder. Journal of Psychiatric Research 45(1): 54-59.

Riccio, A., Medhurst, A.D., Mattei, C., Kelsell, R.E., Calver, A.R., et al. (2002). mRNA distribution analysis of human TRPC family in CNS and peripheral tissues. Brain Research. Molecular Brain Research 109(1-2): 95-104.

Richter, D., Katz, B., Oberacker, T., Tzarfaty, V., Belusic, G., et al. (2011). Translocation of the drosophila transient receptor potential-like (TRPL) channel requires both the N- and C-terminal regions together with sustained Ca2+ entry. Journal of Biological Chemistry 286(39): 34234- 34243.

Rock, M.J., Prenen, J., Funari, V.A., Funari, T.L., Merriman, B., et al. (2008). Gain-of-function mutations in TRPV4 cause autosomal dominant brachyolmia. Nature Genetics 40(8): 999-1003.

Roedding, A. (2006). Characterization of the transient receptor potential channels mediating lysophosphatidic acid-stimulated calcium mobilization in B lymphoblasts. Pharmacology. Toronto, University of Toronto.

Roedding, A.S., Gao, A.F., Au-Yeung, W., Scarcelli, T., Li, P.P., et al. (2012). Effect of oxidative stress on TRPM2 and TRPC3 channels in B lymphoblast cells in bipolar disorder. Bipolar Disorders 14(2): 151-161.

Roedding, A.S., Gao, A.F., Wu, A.M., Li, P.P., Kish, S.J., et al. (2009). TRPC3 protein is expressed across the lifespan in human prefrontal cortex and cerebellum. Brain Research 1260: 1-6.

Roedding, A.S., Li, P.P. and Warsh, J.J. (2006). Characterization of the transient receptor potential channels mediating lysophosphatidic acid-stimulated calcium mobilization in B lymphoblasts. Life Sciences 80(2): 89-97.

Rosker, C., Graziani, A., Lukas, M., Eder, P., Zhu, M.X., et al. (2004). Ca2+ signaling by TRPC3 involves Na+ entry and local coupling to the Na+/Ca2+ exchanger. Journal of Biological Chemistry 279(14): 13696-13704.

Rosskopf, D., Daelman, W., Busch, S., Schurks, M., Hartung, K., et al. (1998). Growth factor- like action of lysophospatidic acid on human B lymphoblasts. American Journal of Physiology 274: C1573-1582.

158

Ryazanova, L.V., Rondon, L.J., Zierler, S., Hu, Z., Galli, J., et al. (2010). TRPM7 is essential for Mg2+ homeostasis in mammals. Nature Communications 1: 109.

Sakamoto, K., Karelina, K. and Obrietan, K. (2011). CREB: a multifaceted regulator of neuronal plasticity and protection. Journal of Neurochemistry 116(1): 1-9.

Salminen, A., Liu, P.K. and Hsu, C.Y. (1995). Alteration of transcription factor binding activities in the ischemic rat-brain. Biochemical and Biophysical Research Communications 212(3): 939- 944.

Sanmartín-Suárez, C., Soto-Otero, R., Sánchez-Sellero, I. and Méndez-Álvarez, E. (2011). Antioxidant properties of dimethyl sulfoxide and its viability as a solvent in the evaluation of neuroprotective antioxidants. Journal of Pharmacological and Toxicological Methods 63(2): 209-215.

Santos, N.C., Figueira-Coelho, J., Martins-Silva, J. and Saldanha, C. (2003). Multidisciplinary utilization of dimethyl sulfoxide: pharmacological, cellular, and molecular aspects. Biochemical Pharmacology 65(7): 1035-1041.

Sassi, R.B., Nicoletti, M., Brambilla, P., Mallinger, A.G., Frank, E., et al. (2002). Increased gray matter volume in lithium-treated bipolar disorder patients. Neuroscience Letters 329(2): 243-245.

Sattler, R., Charlton, M.P., Hafner, M. and Tymianski, M. (1997). Determination of the time course and extent of neurotoxicity at defined temperatures in cultured neurons using a modified multiwell plate fluorescence scanner. Journal of Cerebral Blood Flow and Metabolism 17(4): 455-463.

Savas, H.A., Gergerlioglu, H.S., Armutcu, F., Herken, H., Yilmaz, H.R., et al. (2006). Elevated serum nitric oxide and superoxide dismutase in euthymic bipolar patients: impact of past episodes. World Journal of Biological Psychiatry 7(1): 51-55.

Sawa, A., Wiegand, G.W., Cooper, J., Margolis, R.L., Sharp, A.H., et al. (1999). Increased apoptosis of Huntington disease lymphoblasts associated with repeat length-dependent mitochondrial depolarization. Nature Medicine 5(10): 1194-1198.

Sayre, L.M., Moreira, P.I., Smith, M.A. and Perry, G. (2005). Metal ions and oxidative protein modification in neurological disease. Ann Ist Super Sanita 41(2): 143-164.

Schaefer, M. (2005). Homo- and heteromeric assembly of TRP channel subunits. Pflugers Archiv European Journal of Physiology 451(1): 35-42.

Scherzer, C., Offe, K., Gearing, M., Rees, H., Fang, G., et al. (2004). Loss of apolipoprotein E receptor LR11 in Alzheimer disease. Archives of Neurology 61(8): 1200-1205.

Schlingmann, K.P., Weber, S., Peters, M., Niemann Nejsum, L., Vitzthum, H., et al. (2002). Hypomagnesemia with secondary hypocalcemia is caused by mutations in TRPM6, a new member of the TRPM gene family. Nature Genetics 31(2): 166-170.

159

Schloesser, R.J., Huang, J., Klein, P.S. and Manji, H.K. (2007). Cellular plasticity cascades in the pathophysiology and treatment of bipolar disorder. Neuropsychopharmacology 33(1): 110- 133.

Schmuck, G., Rohrdanz, E., Tran-Thi, Q.H., Kahl, R. and Schluter, G. (2002). Oxidative stress in rat cortical neurons and astrocytes induced by paraquat in vitro. Neurotoxicity Research 4(1): 1- 13.

Segurado, R., Detera-Wadleigh, S.D., Levinson, D.F., Lewis, C.M., Gill, M., et al. (2003). Genome scan meta-analysis of schizophrenia and bipolar Disorder, part III: bipolar disorder. American Journal of Human Genetics 73(1): 49-62.

Seib, L.M. and Wellman, C.L. (2003). Daily injections alter spine density in rat medial prefrontal cortex. Neuroscience Letters 337(1): 29-32.

Selvaraj, S., Sun, Y. and Singh, B.B. (2010). TRPC channels and their implication in neurological diseases. CNS Neurological Disorders- Drug Targets 9(1): 94-104.

Seo, J.-S., Lee, K.-W., Kim, T.-K., Baek, I.-S., Im, J.-Y., et al. (2011). Behavioral stress causes mitochondrial dysfunction via ABAD up-regulation and aggravates plaque pathology in the brain of a mouse model of Alzheimer disease. Free Radical Biology and Medicine 50(11): 1526-1535.

Shahar, A., de Vellis, J., Vernadakis, A. and Haber, B. (1989). A Dissection and Tissue Culture Manual of the Nervous System. New York, Alan R. Liss.

Shaltiel, G., Chen, G. and Manji, H.K. (2007). Neurotrophic signaling cascades in the pathophysiology and treatment of bipolar disorder. Current Opinion in Pharmacology 7(1): 22- 26.

Shan, D., Marchase, R.B. and Chatham, J.C. (2008). Overexpression of TRPC3 increases apoptosis but not necrosis in response to ischemia-reperfusion in adult mouse cardiomyocytes. American Journal of Physiology - Cell Physiology 294(3): C833-C841.

Shapovalov, G., Lehen’kyi, V.y., Skryma, R. and Prevarskaya, N. (2011). TRP channels in cell survival and cell death in normal and transformed cells. Cell Calcium 50(3): 295-302.

Sheng, M., McFadden, G. and Greenberg, M.E. (1990). Membrane depolarization and calcium induce c-fos transcription via phosphorylation of transcription factor CREB. Neuron 4(4): 571- 582.

Shirakawa, H., Sakimoto, S., Nakao, K., Sugishita, A., Konno, M., et al. (2010). Transient receptor potential canonical 3 (TRPC3) mediates thrombin-induced astrocyte activation and upregulates its own expression in cortical astrocytes. The Journal of Neuroscience 30(39): 13116-13129.

Sie, L., Loong, S. and Tan, E. (2009). Utility of lymphoblastoid cell lines. Journal of Neuroscience Research 87: 1953-1959.

160

Sivonova, M., Zitnanova, I., Hlincikova, L., Skodacek, I., Trebaticka, J., et al. (2004). Oxidative stress in university students during examinations. Stress 7(3): 183-188.

Smale, S.T. (2009). Nuclear run-on assay. Cold Spring Harbor Protocols 2009(11): pdb.prot5329.

Smith, P.K., Krohn, R.I., Hermanson, G.T., Mallia, A.K., Gartner, F.H., et al. (1985). Measurement of protein using bicinchoninic acid. Analytical Biochemistry 150(1): 76-85.

Smyth, C., Kalsi, G., Curtis, D., Brynjolfsson, J., O'Neill, J., et al. (1997). Two-locus admixture linkage analysis of bipolar and unipolar affective disorder supports the presence of susceptibility loci on chromosomes 11p15 and 21q22. Genomics 39(3): 271-278.

So, J., Warsh, J.J. and Li, P.P. (2007). Impaired endoplasmic reticulum stress response in B- lymphoblasts from patients with bipolar-I disorder. Biological Psychiatry 62(2): 141-147.

So, J., Xu, C., Warsh, J. and Peter, P. (2006). Changes in endoplasmic reticulum stress responsivity in bipolar disorder. Biological Psychiatry 59(8, Supplement): 227S.

Soares, J.C., Dippold, C.S., Wells, K.F., Frank, E., Kupfer, D.J., et al. (2001). Increased platelet membrane phosphatidylinositol-4,5-bisphosphate in drug-free depressed bipolar patients. Neuroscience Letters 299: 150-152.

Son, H., Yu, I.T., Hwang, S.-J., Kim, J.S., Lee, S.-H., et al. (2003). Lithium enhances long-term potentiation independently of hippocampal neurogenesis in the rat dentate gyrus. Journal of Neurochemistry 85(4): 872-881.

Soreca, I., Frank, E. and Kupfer, D.J. (2009). The phenomenology of bipolar disorder: what drives the high rate of medical burden and determines long-term prognosis? Depression and Anxiety 26(1): 73-82.

Starkman, M.N., Gebarski, S.S., Berent, S. and Schteingart, D.E. (1992). Hippocampal formation volume, memory dysfunction, and cortisol levels in patients with Cushing's syndrome. Biological Psychiatry 32(9): 756-765.

Starkman, M.N., Giordani, B., Gebarski, S.S., Berent, S., Schork, M.A., et al. (1999). Decrease in cortisol reverses human hippocampal atrophy following treatment of Cushing's disease. Biological Psychiatry 46(12): 1595-1602.

Stork, C. and Renshaw, P.F. (2005). Mitochondrial dysfunction in bipolar disorder: evidence from magnetic resonance spectroscopy research. Molecular Psychiatry 10(10): 900-919.

Straub, R.E., Lehner, T., Luo, Y., Loth, J.E., Shao, W., et al. (1994). A possible vulnerability locus for bipolar affective disorder on chromosome 21q22.3. Nature Genetics 8(3): 291-296.

Strubing, C., Krapivinsky, G., Krapivinsky, L. and Clapham, D.E. (2003). Formation of novel TRPC channels by complex subunit interactions in embryonic brain. Journal of Biological Chemistry 278(40): 39014-39019.

161

Su, B., Wang, X., Lee, H.-g., Tabaton, M., Perry, G., et al. (2010). Chronic oxidative stress causes increased tau phosphorylation in M17 neuroblastoma cells. Neuroscience Letters 468(3): 267-271.

Sumoza-Toledo, A. and Penner, R. (2011). TRPM2: a multifunctional ion channel for calcium signalling. The Journal of Physiology 589(7): 1515-1525.

Sun, X., Wang, J.F., Tseng, M. and Young, L.T. (2006). Downregulation in components of the mitochondrial electron transport chain in the postmortem frontal cortex of subjects with bipolar disorder. Journal of Psychiatry and Neuroscience 31(3): 189-196.

Susankova, K., Tousova, K., Vyklicky, L., Teisinger, J. and Vlachova, V. (2006). Reducing and oxidizing agents sensitize heat-activated vanilloid receptor (TRPV1) current. Molecular Pharmacology 70(1): 383-394.

Suzuki, K., Kusumi, I., Akimoto, T., Sasaki, Y. and Koyama, T. (2004). Effects of lithium and valproate on agonist-induced platelet intracellular calcium mobilization: relevance to myosin light chain kinase. Progress Neuro-Psychopharmacology Biological Psychiatry 28: 67-72.

Szöke, A., Schürhoff, F., Golmard, J.-L., Alter, C., Roy, I., et al. (2006). Familial resemblance for executive functions in families of schizophrenic and bipolar patients. Psychiatry Research 144(2–3): 131-138.

Tai, Y., Feng, S., Du, W. and Wang, Y. (2009). Functional roles of TRPC channels in the developing brain. Pflugers Archiv European Journal of Physiology 458(2): 283-289.

Tai, Y., Feng, S., Ge, R., Du, W., Zhang, X., et al. (2008). TRPC6 channels promote dendritic growth via the CaMKIV-CREB pathway. Journal of Cell Science 121(Pt 14): 2301-2307.

Takahashi, K., Sakamoto, K. and Kimura, J. (2012). Hypoxic stress induces transient receptor potential melastatin 2 (TRPM2) channel expression in adult rat cardiac fibroblasts. Journal of Pharmacological Sciences 118(2): 186-197.

Takahashi, N., Kozai, D., Kobayashi, R., Ebert, M. and Mori, Y. (2011). Roles of TRPM2 in oxidative stress. Cell Calcium 50(3): 279-287.

Takahashi, N. and Mori, Y. (2011). TRP channels as sensors and signal integrators of redox status changes. Frontiers in Pharmacology 2(58).

Takayama, S., Sato, T., Krajewski, S., Kochel, K., Irie, S., et al. (1995). Cloning and functional analysis of BAG-1: a novel Bcl-2-binding protein with anti-cell death activity. Cell 80(2): 279- 284.

Talavera, K., Nilius, B. and Voets, T. (2008). Neuronal TRP channels: thermometers, pathfinders and life-savers. Trends in Neurosciences 31(6): 287-295.

162

Tan, C., Javors, M., Seleshi, E., Lowrimore, P. and Bowden, C. (1990). Effects of lithium on platelet ionic intracellular calcium concentration in patients with bipolar (manic-depressive) disorder and healthy controls. Life Sciences 46: 1175-1180.

Tan, Y.W., Zhang, S.J., Hoffmann, T. and Bading, H. (2012). Increasing levels of wild-type CREB up-regulates several activity-regulated inhibitor of death (AID) genes and promotes neuronal survival. BMC Neuroscience 13(1): 48.

Tano, J.-Y., Smedlund, K., Lee, R., Abramowitz, J., Birnbaumer, L., et al. (2011). Impairment of survival signaling and efferocytosis in TRPC3-deficient macrophages. Biochemical and Biophysical Research Communications 410(3): 643-647.

Togashi, K., Hara, Y., Tominaga, T., Higashi, T., Konishi, Y., et al. (2006). TRPM2 activation by cyclic ADP-ribose at body temperature is involved in insulin secretion. EMBO Journal 25(9): 1804-1815.

Toneff, T., Mende-Mueller, L., Wu, Y., Hwang, S., Bundey, R., et al. (2002). Comparison of huntingtin proteolytic fragments in human lymphoblast cell lines and human brain. Journal of Neurochemistry 82(1): 84-92.

Tong, Q., Zhang, W., Conrad, K., Mostoller, K., Cheung, J.Y., et al. (2006). Regulation of the transient receptor potential channel TRPM2 by the Ca2+ sensor calmodulin. Journal of Biological Chemistry 281(14): 9076-9085.

Tong, S. (2012). The role of oxidative stress on neural TRPC3, TRPC5, TRPC6 expression and/or function and relevance to bipolar disorder. Pharmacology and Toxicology. Toronto, University of Toronto: 131.

Tsai, G. and Coyle, J.T. (1995). N-acetylaspartate in neuropsychiatric disorders. Progress in Neurobiology 46(5): 531-540.

Tseng, W.P. and Lin-Shiau, S.Y. (2003). Neuronal death signaling by beta-bungarotoxin through the activation of the N-methyl-D-aspartate (NMDA) receptor and L-type calcium channel. Biochemical Pharmacology 65(1): 131-142.

Turecki, G., Grof, P., Grof, E., D'Souza, V., Lebuis, L., et al. (2001). Mapping susceptibility genes for bipolar disorder: a pharmacogenetic approach based on excellent response to lithium. Molecular Psychiatry 6(5): 570-578.

Uemura, T., Kudoh, J., Noda, S., Kanba, S. and Shimizu, N. (2005). Characterization of human and mouse TRPM2 genes: Identification of a novel N-terminal truncated protein specifically expressed in human striatum. Biochemical and Biophysical Research Communications 328(4): 1232-1243.

Urcelay, E., Ibarreta, D., Parrila, R., Ayuso, M. and Martin-Requero, A. (2001). Enhanced proliferation of lymphoblasts from patients with Alzheimer dementia associated with calmodulin-dependent activation of the Na+/H+ exchanger. Neurobiological Disorders 8(2): 289-298.

163

Valko, M., Leibfritz, D., Moncol, J., Cronin, M.T.D., Mazur, M., et al. (2007). Free radicals and antioxidants in normal physiological functions and human disease. The International Journal of Biochemistry & Cell Biology 39(1): 44-84. van Rossum, D.B., Patterson, R.L., Sharma, S., Barrow, R.K., Kornberg, M., et al. (2005). Phospholipase C1 controls surface expression of TRPC3 through an intermolecular PH domain. Nature 434(7029): 99-104.

Vawter, M.P., Freed, W.J. and Kleinman, J.E. (2000). Neuropathology of bipolar disorder. Biological Psychiatry 48(6): 486-504.

Vazquez, G., Wedel, B.J., Aziz, O., Trebak, M. and James W. Putney, J. (2004). The mammalian TRPC cation channels. Biochimica et Biophysica Acta 1742: 21-36.

Vazquez, G., Wedel, B.J., Trebak, M., St. John Bird, G. and Putney, J.W., Jr. (2003). Expression level of the canonical transient receptor potential 3 (TRPC3) channel determines its mechanism of activation. Journal of Biological Chemistry 278(24): 21649-21654.

Venkatachalam, K. and Montell, C. (2007). TRP channels. Annual Review of Biochemistry 76: 387-417.

Vennekens, R., Voets, T., Bindels, R.J.M., Droogmans, G. and Nilius, B. (2002). Current understanding of mammalian TRP homologues. Cell Calcium 31(6): 253-264.

Voets, T., Talavera, K., Owsianik, G. and Nilius, B. (2005). Sensing with TRP channels. Nature Chemical Biology 1(2): 85-92.

Wang, G.X. and Poo, M.-m. (2005). Requirement of TRPC channels in netrin-1-induced chemotropic turning of nerve growth cones. Nature 434(7035): 898-904.

Wang, J.-F., Shao, L., Sun, X. and Young, L.T. (2009). Increased oxidative stress in the anterior cingulate cortex of subjects with bipolar disorder and schizophrenia. Bipolar Disorders 11(5): 523-529.

Wang, J.F., Azzam, J.E. and Young, L.T. (2003). Valproate inhibits oxidative damage to lipid and protein in primary cultured rat cerebrocortical cells. Neuroscience 116(2): 485-489.

Wang, X., Culotta, V.C. and Klee, C.B. (1996). Superoxide dismutase protects calcineurin from inactivation. Nature 383(6599): 434-437.

Warsh, J.J., Andreopoulos, S. and Li, P.P. (2004). Role of intracellular calcium signaling in the pathophysiology and pharmacotherapy of bipolar disorder: current status. Clinical Neuroscience Research 4: 201-213.

Warsh, J.J., Emamghoreishi, M. and P.P., L. (1999). Elevated B lymphoblast resting intracellular calcium is a trait-dependent abnormality specific to bipolar-I disorder. Bipolar Disorders 1(Suppl. 1): 57.

164

Warsh, J.J. and Li, P.P. (1996). Second messenger systems and mood disorders. Current Opinion in Psychiatry 9(1): 23-29.

Washizuka, S., Kakiuchi, C., Mori, K., Kunugi, H., Tajima, O., et al. (2003). Association of mitochondrial complex I subunit gene NDUFV2 at 18p11 with bipolar disorder. American Journal of Medical Genetics 120B(1): 72-78.

Washizuka, S., Kakiuchi, C., Mori, K., Tajima, O., Akiyama, T., et al. (2005). Expression of mitochondria-related genes in lymphoblastoid cells from patients with bipolar disorder. Bipolar Disorders 7(2): 146-152.

Washizuka, S., Kametani, M., Sasaki, T., Tochigi, M., Umekage, T., et al. (2006). Association of mitochondrial complex I subunit gene NDUFV2 at 18p11 with schizophrenia in the Japanese population. American Journal of Medical Genetics Part B: Neuropsychiatric Genetics 141B(3): 301-304.

Wasserman, M. (2003). Abnormal intracellular calcium mobilization and modulation by chronic lithium treatment in patients with bipolar disorder. A thesis of the Department of Pharmacology. Toronto, University of Toronto: 101-102.

Wasserman, M., Warsh, J., Li, P., Pennefather, P. and Sibony, D. (2003a). Hyperactive intracellular calcium mobilization in B lymphoblasts from patients with bipolar I disorder. Biological Psychiatry 53(Suppl): 79S.

Wasserman, M.J., Corson, T.W., Sibony, D., Cooke, R.G., Parikh, S.V., et al. (2004). Chronic lithium treatment attenuates intracellular calcium mobilization. Neuropsychopharmacology 29: 759-769.

Watanabe, Y., Gould, E. and McEwen, B.S. (1992). Stress induces atrophy of apical dendrites of hippocampal CA3 pyramidal neurons. Brain Research 588(2): 341-345.

Wehage, E., Eisfeld, J., Heiner, I., Jungling, E., Zitt, C., et al. (2002). Activation of the cation channel long transient receptor potential channel 2 (LTRPC2) by hydrogen peroxide. A splice variant reveals a mode of activation independent of ADP-ribose. Journal of Biological Chemistry 277(26): 23150-23156.

Wellman, C.L. (2001). Dendritic reorganization in pyramidal neurons in medial prefrontal cortex after chronic corticosterone administration. Journal of Neurobiology 49(3): 245-253.

West, A.E., Griffith, E.C. and Greenberg, M.E. (2002). Regulation of transcription factors by neuronal activity. Nature Reviews Neuroscience 3(12): 921-931.

Wexler, E.M., Geschwind, D.H. and Palmer, T.D. (2007). Lithium regulates adult hippocampal progenitor development through canonical Wnt pathway activation. Molecular Psychiatry 13(3): 285-292.

165

Winn, M.P., Conlon, P.J., Lynn, K.L., Farrington, M.K., Creazzo, T., et al. (2005). A mutation in the TRPC6 cation channel causes familial focal segmental glomerulosclerosis. Science 308(5729): 1801-1804.

Winsberg, M.E., Sachs, N., Tate, D.L., Adalsteinsson, E., Spielman, D., et al. (2000). Decreased dorsolateral prefrontal N-acetyl aspartate in bipolar disorder. Biological Psychiatry 47(6): 475- 481.

Wood, G.E., Young, L.T., Reagan, L.P., Chen, B. and McEwen, B.S. (2004). Stress-induced structural remodeling in hippocampus: prevention by lithium treatment. Proceedings of the National Academy of Sciences of the United States of America 101(11): 3973-3978.

Woolley, C.S., Gould, E. and McEwen, B.S. (1990). Exposure to excess glucocorticoids alters dendritic morphology of adult hippocampal pyramidal neurons. Brain Research 531(1-2): 225- 231.

Wu, G. and Somlo, S. (2000). Molecular genetics and mechanism of autosomal dominant polycystic kidney disease. Molecular Genetics and Metabolism 69(1): 1-15.

Wu, X., Zagranichnaya, T.K., Gurda, G.T., Eves, E.M. and Villereal, M.L. (2004). A TRPC1/TRPC3 mediated increase in store-operated calcium entry is required for differentiation of H19-7 hippocampal neuronal cells. Journal of Biological Chemistry 279(42).

Wuensch, T., Thilo, F., Krueger, K., Scholze, A., Ristow, M., et al. (2010). High glucose– induced oxidative stress increases transient receptor potential channel expression in human monocytes. Diabetes 59(4): 844-849.

Xu, C., Li, P.P., Cooke, R.G., Parikh, S.V., Wang, K., et al. (2009). TRPM2 variants and bipolar disorder risk: confirmation in a family-based association study. Bipolar Disorders 11(1): 1-10.

Xu, C., Li, P.P., Kennedy, J.L., Green, M., Hughes, B., et al. (2008). Further support for association of the mitochondrial complex I subunit gene NDUFV2 with bipolar disorder. Bipolar Disorders 10(1): 105-110.

Xu, C., Macciardi, F., Li, P.P., Yoon, I.-S., Cooke, R., et al. (2006). Association of the putative susceptability gene, transient receptor potential protein melastatin type 2, with bipolar disorder. American Journal of Medical Genetics B: Neuropsychiatric Genetics 141(1): 36-43.

Xu, S.-Z., Sukumar, P., Zeng, F., Li, J., Jairaman, A., et al. (2008). TRPC channel activation by extracellular thioredoxin. Nature 451(7174): 69-72.

Yamamoto, S., Takahashi, N. and Mori, Y. (2010). Chemical physiology of oxidative stress- activated TRPM2 and TRPC5 channels. Progress in Biophysics and Molecular Biology 103(1): 18-27.

Yamamoto, S., Wajima, T., Hara, Y., Nishida, M. and Mori, Y. (2007). Transient receptor potential channels in Alzheimer's disease. Biochimica et Biophysica Acta 1772(8): 958-967.

166

Yang, K.T., Chang, W.L., Yang, P.C., Chien, C.L., Lai, M.S., et al. (2005). Activation of the transient receptor potential M2 channel and poly(ADP-ribose) polymerase is involved in oxidative stress-induced cardiomyocyte death. Cell Death and Differentiation 13(10): 1815- 1826.

Yao, H., Peng, F., Fan, Y., Zhu, X., Hu, G., et al. (2009). TRPC channel-mediated neuroprotection by PDGF involves Pyk2/ERK/CREB pathway. Cell Death and Differentiation 16(12): 1681-1693.

Yildiz-Yesiloglu, A. and Ankerst, D.P. (2006). Neurochemical alterations of the brain in bipolar disorder and their implications for pathophysiology: A systematic review of the in vivo proton magnetic resonance spectroscopy findings. Progress in Neuro-Psychopharmacology and Biological Psychiatry 30(6): 969-995.

Yoon, I.-S., Li, P., Siu, K.-P., Kennedy, J., Cooke, R., et al. (2001). Altered IMPA2 gene expression and calcium homeostasis in bipolar disorder. Molecular Psychiatry 6: 678-683.

Yoon, I.S., Li, P.P., Siu, K.P., Kennedy, J.L., Macciardi, F., et al. (2001). Altered TRPC7 gene expression in bipolar-I disorder. Biological Psychiatry 50(8): 620-626.

Yoshida, T., Inoue, R., Morii, T., Takahashi, N., Yamamoto, S., et al. (2006). Nitric oxide activates TRP channels by cysteine S-nitrosylation. Nature Chemical Biology 2(11): 596-607.

Yuan, J.P., Kim, M.S., Zeng, W., Shin, D.M., Huang, G., et al. (2009). TRPC channels as STIM1-regulated SOCs. Channels (Austin) 3(4).

Yuan, J.P., Zeng, W., Huang, G.N., Worley, P.F. and Muallem, S. (2007). STIM1 heteromultimerizes TRPC channels to determine their function as store-operated channels. Nature Cell Biology 9(6): 636-645.

Yuan, P.X., Chen, G., Huang, L.D. and Manji, H.K. (1998). Lithium stimulates gene expression through the AP-1 transcription factor pathway. Brain Research. Molecular Brain Research 58(1- 2): 225-230.

Yuan, P.X., Huang, L.D., Jiang, Y.M., Gutkind, J.S., Manji, H.K., et al. (2001). The mood stabilizer valproic acid activates mitogen-activated protein kinases and promotes neurite growth. Journal of Biological Chemistry 276(34): 31674-31683.

Zhang, W., Chu, X., Tong, Q., Cheung, J.Y., Conrad, K., et al. (2003). A novel TRPM2 isoform inhibits calcium influx and susceptibility to cell death. Journal of Biological Chemistry 278(18): 16222-16229.

Zhang, W., Hirschler-Laszkiewicz, I., Tong, Q., Conrad, K., Sun, S.-C., et al. (2006). TRPM2 is an ion channel that modulates hematopoietic cell death through activation of caspases and PARP cleavage. American Journal of Physiology - Cell Physiology 290(4): C1146-C1159.

Zhou, F.W., Matta, S.G. and Zhou, F.M. (2008). Constitutively active TRPC3 channels regulate basal ganglia output neurons. J Neurosci 28(2): 473-482.

167

Zhou, R., Gray, N.A., Yuan, P., Li, X., Chen, J., et al. (2005). The anti-apoptotic, glucocorticoid receptor cochaperone protein BAG-1 is a long-term target for the actions of mood stabilizers. Journal of Neuroscience 25(18): 4493-4502.

Zhu, X., Jiang, M., Peyton, M., Boulay, G., Hurst, R., et al. (1996). TRP, a novel mammalian gene family essential for agonist-activated capacitative Ca2+ entry. Cell 85(5): 661-671.

Zou, J. and Crews, F. (2006). CREB and NF-κB transcription factors regulate sensitivity to excitotoxic and oxidative stress induced neuronal cell death. Cellular and Molecular Neurobiology 26(4): 383-403.

Zundorf, G. and Reiser, G. (2011). Calcium dysregulation and homeostasis of neural calcium in the molecular mechanisms of neurodegenerative diseases provide multiple targets for neuroprotection. Antioxidants & Redox Signaling 14(7): 1275-1288.

168

7 Appendices

7.1 Mechanisms of action for rotenone and paraquat

Rotenone and paraquat (Figure 7-1) were selected for use as oxidative stressors in this study as these toxins produce ROS at the mitochondria in which dysfunction has been suggested in the pathophysiology of BD (see section 1.3). Rotenone irreversibly inhibits complex I of the mitochondrial electron transport chain resulting in increased superoxide production and decreased ATP generation (Li et al. 2003). Paraquat, otherwise known as N,N-dimethyl-4-4- bipyridinium ion, is a redox cycling compound that is reduced by mitochondrial complex I to a reactive intermediate that then reacts with oxygen to produce superoxide (Cocheme et al. 2008).

Figure 7-1 Chemical structures of rotenone and paraquat

A) Depiction of the chemical structure of rotenone. B) The redox cycling of paraquat (PQ) is shown including the reduction potential and rate constant for superoxide production.

169

Rotenone and paraquat have been used previously in the modelling of Parkinson’s disease

(Przedborski et al. 2005). These neurotoxins have been shown to cause neurodegeneration of striatal dopaminergic neurons in animal models at similar concentrations as used in this work of

2-3 mg/kg/day which is equivalent to 20-30 nM in brain (Kweon et al. 2004). It is not my intent to suggest that such models are also of use in the study of BD. Rather, I set out to use rotenone and paraquat as tools to increase intrinsic ROS levels at the mitochondrial level in order to investigate the effects this would have on TRP channel expression and function. It is not my contention that treatment with these toxins would manifest as morphological or symptomatic presentations of BD in animal models.

7.2 Tables containing data from figure 3-1

Table 7.2.1 HO-1 mRNA levels (2ΔΔCt) after 1 day rotenone treatment in rat cortical neurons

Replication 0 nM rotenone 15 nM rotenone 30 nM rotenone 1 0.00083 0.00881 0.02160 2 0.00061 0.03040 0.04537 3 0.00022 0.00068 0.00652

170

Table 7.2.2 HO-1 mRNA levels (2ΔΔCt) after 4 day rotenone treatment in rat cortical neurons

Replication 0 nM rotenone 15 nM rotenone 30 nM rotenone 1 0.00148 0.00364 0.00877 2 0.00166 0.00173 0.00877 3 0.02958 0.02898 0.07818 4 0.00255 0.00504 0.02828 5 0.00089 0.00134 0.01370 6 0.00158 0.00201 0.00955 7 0.00167 0.00390 0.04213 8 0.00221 0.03805 0.06151 9 0.00089 0.00376 0.03099

Table 7.2.3 HO-1 mRNA levels (2ΔΔCt) after 1 day paraquat treatment in rat cortical neurons

Replication 0 µM paraquat 1 µM paraquat 2 µM paraquat 1 0.00127 0.00180 0.00126 2 0.00072 0.00116 0.00122 3 0.00129 0.00123 0.00134 4 0.00066 0.00369 0.00068

171

Table 7.2.4 HO-1 mRNA levels (2ΔΔCt) after 4 day paraquat treatment in rat cortical neurons

Replication 0 µM paraquat 1 µM paraquat 2 µM paraquat 1 0.00182 0.00569 0.07791 2 0.00106 0.00667 0.09773 3 0.00055 0.00797 0.05532 4 0.00160 0.00373 0.02253 5 0.00086 0.00335 0.06302 6 0.00120 0.00108 0.00779 7 0.00080 0.00145 0.00132

Table 7.2.5 Viability of rat cortical neurons after 1-4 days of rotenone treatment

Replication Day of Treatment 15 nM rotenone 30 nM rotenone 1 1 93 47 2 88 55 3 76 20 4 83 54 2 1 78 56 2

3 55 13 4 61 12 3 1 91 19 2 91 45 3

4 78 41 4 1 75 8 2 57 22 3 44 15 4 71 5 5 1 90 82 2 85 75 3 70 79 4 81 69

172

6 1 76 48 2 42 42 3 40 12 4 49 9

7 1 43 10

2 32 -7

3 23 14

4 44 19

8 1 40 -12

2 87 30

3 41 7

4 5 -10 9 1 60 37 2 122 -5 3 11 15 4 -11 84 10 1 62 23 2 67 14 3 57 12 4 71 7 11 1 74 29 2 61 19 3 62 8 4 59 6 12 1 96 80 2 87 90 3 86 74 4 77 49

173

Table 7.2.6 Viability of rat cortical neurons after 1-4 days of paraquat treatment

Replication Day of Treatment 15 nM rotenone 30 nM rotenone 1 1 125 110 2 88 57 3 84 22 4 68 7 2 1 105 91 2 90 51 3 91 0 4 67 0 3 1 95 89 2 96 94 3 101 79 4 103 89

7.3 Tables containing data from figure 4-1

Table 7.3.1 HO-1 mRNA levels (fold-change) after 1 day rotenone treatment in BLCLs

BD-I Healthy Control [Rotenone] µM Mean SD N Mean SD N 0 1.00 0.00 6 1.00 0.00 4 2.5 0.97 0.35 6 0.99 0.41 4 10 1.74 1.02 6 1.35 0.55 4

174

Table 7.3.2 HO-1 mRNA levels (fold-change) after 4 day rotenone treatment in BLCLs

BD-I Healthy Control [Rotenone] µM Mean SD N Mean SD N

0 1.00 0.00 6 1.00 0.00 5 2.5 2.15 2.40 6 1.63 1.27 5 10 23.78 29.87 6 18.71 23.18 5

Table 7.3.3 Viability of BLCLs after 1 day of rotenone treatment

BD-I Healthy Control [Rotenone] µM Mean SD N Mean SD N 0 70.86 2.85 6 77.05 5.90 5 2.5 60.90 5.20 6 74.53 4.68 5 10 62.39 4.77 6 73.14 6.26 5

Table 7.3.4 Viability of BLCLs after 4 days of rotenone treatment

BD-I Healthy Control [Rotenone] µM Mean SD N Mean SD N 0 69.32 1.44 6 69.37 3.77 5 2.5 58.12 8.75 6 53.49 5.99 5 10 42.94 9.17 6 37.14 6.14 5

175

Figure 1-1 is reproduced from Nature Reviews Molecular Cell Biology (D'Autreaux et al. 2007).

Authorization to reproduce this figure has been obtained from the publisher (license number

2902070499821).

Figure 1-2 is reproduced from Nature Reviews Molecular Cell Biology (Berridge et al. 2003).

Authorization to reproduce this figure has been obtained from the publisher (license number

2900271410018).

Figure 1-3 is reproduced from Cell Calcium (Pedersen et al. 2005). Authorization to reproduce this figure has been obtained from the publisher (license number 2926181228352).

Figure 1-4, 1-5, 1-6 is adapted from Cell Calcium (Vennekens et al. 2002). Authorization to reproduce this figure has been obtained from the publisher (license number 2932160969246).

Figure 1-7 is reproduced from Journal of Cell Physiology (Sumoza-Toledo et al. 2011).

Authorization to reproduce this figure has been obtained from the publisher (license number

2931050263954).

Chapter 2 has been published in Brain Research (Roedding et al. 2009). Authorization to reproduce this work has been obtained from the publisher (license number 2523710329886) and co-authors.

Chapter 4 has been published in Bipolar Disorders (Roedding et al. 2012). Authorization to reproduce this work has been obtained from the publisher (license number 2871980661611) and co-authors.