DOCSLIB.ORG

Chaos Vs. Order: Aristotle and Linnaeus

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Chaos Vs. Order: Aristotle and Linnaeus Chaos vs. Order: Aristotle and Linnaeus Jonathan Bastian Phil 223: History of Science & Metaphysics with Dr. Griffith axonomy is man’s attempt to understand his method against modern methods and sci- Tthe organizational structure of living organ- ence. No one can fully understand another isms. It originates from the idea that there is a person’s thought process, and therefore, we supreme being who created everything and, cannot make assumptions regarding a phi- therefore, a perfect organization to living or- losopher’s methods. Yet, if there is a desire, ganisms must exist. With their own distinct whether out of necessity or pure casual inter- opinions on how organisms should be classi- est, to understand the development of mod- fied, philosophers and scientists alike have at- ern science, one must look at and analyze tempted to make the perfect arrangement the ideas and beliefs of the first scientists--phi- of organisms. These methods are all derived losophers or others--to the best of our ability. from previous methods; hence, we must look Whether modern science confirms it or dis- at Aristotle and Linnaeus for guidance and to putes it, all modern conclusions and scientific compare what they thought to what mod- philosophies have been influenced by those ern science appears to tell us regarding the earliest thinkers. relationship between organisms. Linnaeus’ An extensive component of a phi- simplistic system of organization is a clear ad- losopher’s thoughts is definition. Yet what is vancement from the hectic system of Aristo- definition but merely man’s attempt at us- tle. ing words to describe another word? This To formulate a conclusion of Aristotle’s creates an endless process of attempting taxonomy method is in some regards quite dif- to find the definition of a word and then the ficult. The philosopher died 2,331 years ago; definition of each word in the first definition. consequently, he cannot continue to defend However, Aristotle developed definitions of numerous words in an attempt to create an The logical arguments arise by following ba- organized structure or method of arranging sic logic. If a bird is a blooded animal and organisms into something called taxonomy. animals are egg laying or viviparous, then The modern definition of taxonomy is an or- birds are either egg laying or give birth to live derly classification of organisms. Aristotle felt young, but birds cannot be viviparous.1 Aris- that in order to classify something, it first had totle used the following example to defend to be defined. Based on his philosophy, de- his point: “Dichotomy splits natural kinds. If fining something required a two-step process. we divide animals into terrestrial and aquatic, First, a broad picture must be taken, mean- then we cannot go on to divide either side ing, “What kind is it?” This generalization de- into blooded/bloodless or polypod/footless, termines if it is a bird, fish, insect, etc. The sec- since there would have to be some of each ond step requires detailed information, such on each side.”2 The supporting example of as characteristics and properties, for the dif- his argument has validity to a certain degree. ferentia must be determined. The differen- It is true that dichotomy splits organisms, but tia is defined in the context of Aristotle as, “A the problem lies in the differentiae he uses to particular element or feature that defines one organize his taxonomy, such as blooded and entity from another.”1 An example of this defi- bloodless. Also, labyrinth-like organization nition would be limbs, whether they are wings, would be created if a system never split nat- fins, or forelegs. A definiendum is a set of char- ural kinds. The reason behind this statement acteristics or differentiae which defines an or- is the fact that living organisms have many ganism. Additionally, a definiendum must “re- similarities with other organisms. In defense of veal the object’s nature or substance.”1 The Aristotle’s method of organization, the knowl- final statement means that a definiendum is a edge which modern science has revealed to method of not only organizing and compar- us helps us better understand the design of ing organisms, but also defining or describing organisms, and therefore we can better orga- them. nize and categorize different organisms.2 According to the interpretation of Ar- Since Aristotle disagreed with the di- istotle’s writings, he believed the use of a di- chotomy system, he devised a system in which chotomy to organize organisms put limitations there are at least three differentiae simultane- on the system’s ability to distinguish organisms. ously. There were three rules which Aristotle The method of organization using dichotomy used to organize his taxonomy of organisms. is a process of using only one comparative First, a “Genus is in the category of substance, statement at a time. In other words, for every while differentiae are qualities.”1 The second division there are two options. Aristotle be- rule was “successive differentiation,” which is lieved there were severe logical consequenc- where each differentia is an addition to the es to utilizing such a method. As an example, previous one.1 The third rule goes back to the an animal can be divided into blooded and issue of a dichotomy where a genus must be bloodless. Blooded animals can be further di- divided multiple times simultaneously and not vided into egg laying and viviparous, mean- one at a time.1 Moreover, generic differentiae ing a bird is an egg laying, blooded animal. are used, which means that feathers, scales, Schemata | Spring 2010 and hair are all one differentiae based on anatomy of those organisms where they were the outer surface of the organism. By using his similar. Whether these groups of similar char- three rules, he determined that the best way acteristics were used in the organization of to compare organisms is by analyzing four dif- species, no one will know. The important prin- ferent classes of characteristics: body parts, ciple of his taxonomy structure is that he used life histories, actions, and disposition or psy- categories to organize and group organisms chology. By using those characteristics, an based on similarities. optimal scientific picture of an organism could Understandably thought provoking, be created. Once a complete definiendum the properties that Aristotle used to compare is determined for an organism, each living organisms are quite peculiar and for some, thing is placed into one of ten main groups rather ludicrous. In the History of Animals, Aris- or categories: man, viviparous quadrupeds, totle states, “Animals differ from one another oviparous quadrupeds, birds, fishes, ceta- in their modes of subsistence, in their actions, ceans, molluscs, crustaceans, testaceans, or in their habits, and in their parts.”3 When this insects.1 The first six are in the larger category statement is taken out of context, it is a valid of blooded and the last four are in the larger statement. However, by using an organism’s category of bloodless.1 Though vague, the habits as a method of comparative organiza- understanding of intermediate differentiae is tion, there are no definitive and unchanging that it encompasses many categories with- habits of a species of organisms. As individu- out direct order. Based on a comparative re- als and species adapt and evolve to live in view of numerous scholarly resources and the adverse conditions, their habits change. Ad- conclusions of the author, the organizational ditionally, the organizational pattern does not structure of Aristotle’s taxonomy includes a appear suited to organize millions of species genus and multiple differentiae. in one universal method. However, the primi- Multiple differentiae was Aristotle’s tive scientific knowledge of organisms greatly method of using categories to organize or- limited Aristotle in his ability to understand the ganisms. However, the issue of defining mul- relationship between organisms. tiple differentiae is difficult and subjective As years progressed and knowledge of according to a person’s conclusions on inter- the scientific field expanded, the methods of pretations. Within Aristotle’s works regarding organizing organisms became clearer and this subject, he makes mention of numerous easier. Additionally, the knowledge gained groups of organisms. However, what is not allowed the entire system to be greatly simpli- clear is whether these groups were meant to fied. A Swedish man, Carolus Linnaeus, was be a sub-genus classification. Moreover, it is born in 1707 as a poor man. He was a religious challenging to differentiate between notes man and one who strongly supported his cre- about organisms he dissected and notes per- ationist beliefs. These beliefs carried through taining to his method of taxonomy. Accord- into his development of a classification sys- ing to his records, he dissected hundreds of tem for organisms. He began his career as a organisms and recorded thousands of ob- medical doctor, but the love and fascination servations by investigating the comparative of plants caused him to become consumed Philosophy by the world of plants. He soon began to no- standards. Yet, in Linnaeus’ later writings he tice a hierarchy within organisms, especially discussed the issue of flexibility by declaring plants.4 that species have a lot of variation and there His system ignored slight variations within are many factors which cause this variation, species and instead used the “perfect speci- such as soil conditions. He also accepted men” to enable him to organize his system. the fact that hybridization between two dif- Linnaeus was influenced by John Ray, a natu- ferent species is possible. This long enduring ralist who died a few years before Linnaeus’ system has apparently been flexible enough birth. Carolus disagreed with Ray more than to withstand hundreds of years of tests against he agreed with him, but knowledge of the de- modern science.
Load more

Recommended publications
  • Ptolemeba N. Gen., a Novel Genus of Hartmannellid Amoebae (Tubulinea, Amoebozoa); with an Emphasis on the Taxonomy of Saccamoeba
    The Journal of Published by the International Society of Eukaryotic Microbiology Protistologists Journal of Eukaryotic Microbiology ISSN 1066-5234 ORIGINAL ARTICLE Ptolemeba n. gen., a Novel Genus of Hartmannellid Amoebae (Tubulinea, Amoebozoa); with an Emphasis on the Taxonomy of Saccamoeba Pamela M. Watsona, Stephanie C. Sorrella & Matthew W. Browna,b a Department of Biological Sciences, Mississippi State University, Mississippi State, Mississippi, 39762 b Institute for Genomics, Biocomputing & Biotechnology, Mississippi State University, Mississippi State, Mississippi, 39762 Keywords ABSTRACT 18S rRNA; amoeba; amoeboid; Cashia; cristae; freshwater amoebae; Hartmannella; Hartmannellid amoebae are an unnatural assemblage of amoeboid organisms mitochondrial morphology; SSU rDNA; SSU that are morphologically difficult to discern from one another. In molecular phy- rRNA; terrestrial amoebae; tubulinid. logenetic trees of the nuclear-encoded small subunit rDNA, they occupy at least five lineages within Tubulinea, a well-supported clade in Amoebozoa. The Correspondence polyphyletic nature of the hartmannellids has led to many taxonomic problems, M.W. Brown, Department of Biological in particular paraphyletic genera. Recent taxonomic revisions have alleviated Sciences, Mississippi State University, some of the problems. However, the genus Saccamoeba is paraphyletic and is Mississippi State, MS 39762, USA still in need of revision as it currently occupies two distinct lineages. Here, we Telephone number: +1 662-325-2406; report a new clade on the tree of Tubulinea, which we infer represents a novel FAX number: +1 662-325-7939; genus that we name Ptolemeba n. gen. This genus subsumes a clade of hart- e-mail: [email protected] mannellid amoebae that were previously considered in the genus Saccamoeba, but whose mitochondrial morphology is distinct from Saccamoeba.
    [Show full text]
  • A Revised Classification of Naked Lobose Amoebae (Amoebozoa
    Protist, Vol. 162, 545–570, October 2011 http://www.elsevier.de/protis Published online date 28 July 2011 PROTIST NEWS A Revised Classification of Naked Lobose Amoebae (Amoebozoa: Lobosa) Introduction together constitute the amoebozoan subphy- lum Lobosa, which never have cilia or flagella, Molecular evidence and an associated reevaluation whereas Variosea (as here revised) together with of morphology have recently considerably revised Mycetozoa and Archamoebea are now grouped our views on relationships among the higher-level as the subphylum Conosa, whose constituent groups of amoebae. First of all, establishing the lineages either have cilia or flagella or have lost phylum Amoebozoa grouped all lobose amoe- them secondarily (Cavalier-Smith 1998, 2009). boid protists, whether naked or testate, aerobic Figure 1 is a schematic tree showing amoebozoan or anaerobic, with the Mycetozoa and Archamoe- relationships deduced from both morphology and bea (Cavalier-Smith 1998), and separated them DNA sequences. from both the heterolobosean amoebae (Page and The first attempt to construct a congruent molec- Blanton 1985), now belonging in the phylum Per- ular and morphological system of Amoebozoa by colozoa - Cavalier-Smith and Nikolaev (2008), and Cavalier-Smith et al. (2004) was limited by the the filose amoebae that belong in other phyla lack of molecular data for many amoeboid taxa, (notably Cercozoa: Bass et al. 2009a; Howe et al. which were therefore classified solely on morpho- 2011). logical evidence. Smirnov et al. (2005) suggested The phylum Amoebozoa consists of naked and another system for naked lobose amoebae only; testate lobose amoebae (e.g. Amoeba, Vannella, this left taxa with no molecular data incertae sedis, Hartmannella, Acanthamoeba, Arcella, Difflugia), which limited its utility.
    [Show full text]
  • The Ameba Chaos Chaos
    A STUDY OF PHAGOCYTOSIS IN THE AMEBA CHAOS CHAOS RICHARD G. CHRISTIANSEN, M.D., and JOHNM. MARSHALL, M.D. From the Department of Anatomy, University of Pennsylvania School of Medicine, Philadelphia~ Pennsylvania ABSTRACT The process of phagocytosis was invcstigatcd by observing the interactions between the ameba Chaos chaos and its prey (Paramecium aurelia), by studying food cup formation in the living cell, and by studying the fine structure of the newly formed cup using electron microscopy of serial sections. The cytoplasm surrounding the food cup was found to contain structures not sccn clsewhere in the ameba. The results arc discussed in relation to the mechanisms which operate during food cup formation. INTRODUCTION One of the most familiar, yet dramatic events in formation of the food cup in response to an external introductory biology is the entrapment of a living stimulus may be related to the formation of pino- celiate by a fresh water ameba. Students of cell cytosis channels and to cytoplasmic streaming in physiology have long been interested in the process general, subjects already studied extensively in by which an ameba forms a food cup in response the ameba (Mast and Doyle, 1934; Holter and to an appropriate stimulus (Rhumbler, 1898, Marshall, 1954; Chapman-Andresen, 1962; Gold- 1910; Jennings, 1904; Schaeffer, 1912, 1916, acre, 1964; Wolpert et al, 1964; Ab6, 1964; Griffin, 1917; Mast and Root, 1916; Mast and Hahnert 1964; Wohlfarth-Bottermann, 1964). 1935), and also in the processes of digestion and During phagocytosis (as during pinocytosis) assimilation which follow once the cup closes to large amounts of the plasmalemma are consumed.
    [Show full text]
  • Studies on the Heavy Spherical (Refractive) Bodies of Freshwater Amoebae. I. Morphology and Regeneration of Hsbs in Chaos Carolinense
    STUDIES ON THE HEAVY SPHERICAL (REFRACTIVE) BODIES OF FRESHWATER AMOEBAE. I. MORPHOLOGY AND REGENERATION OF HSBS IN CHAOS CAROLINENSE. by CICILY CHAPMAN-ANDRESEN * Institute of General Zoology, University of Copenhagen. Universitetsparken 15, DK-2100 Copenhagen O *Supported by The Carlsberg Foundation The heavy spherical bodies of Amoeba and Chaos are refractive organelles, varying in size from ca. 10 ~tm in diameter, down to the limit of resolution of the light microscope. These inclusions have many characteristics in common with the phosphate-rich, Jvolutin~ granules of other unicellular organisms, but differ from the latter in being constantly present in healthy growing amoebae, while in other organisms they appear only under con- ditions of nutritional imbalance. The fine structure of the HSBs of Amoeba and Chaos show that the organelles are membrane-bound, with an electron translucent periphery, and an electron dense inner core which sublimes in the electron beam, but which is stabilized by lead staining. During centrifugation in vivo, the HSBs collect at the centrifugal pole of the amoebae; under favourable conditions, a HSB-sack is formed at the heavy pole, and can be excised, leaving amoebae, normal in other respects, but containing only ca. 5% of the normal complement of HSBs. Using this method for obtaining practically HSB-free amoebae, the regeneration of HSBs was studied in Chaos carolinense, by determining the number and size distribution of HSBs in a standard volume in fixed, whole mounts by phase contrast microscopy. It was found that although the number of HSBs per standard volume in both fed and starved amoebae returned to that found in control, unoperated, Chaos by 7 days after operation, the size distribution did not return to normal until ca.
    [Show full text]
  • High Resolution Time Series Reveals Cohesive but Short-Lived Communities in Coastal Plankton
    ARTICLE DOI: 10.1038/s41467-017-02571-4 OPEN High resolution time series reveals cohesive but short-lived communities in coastal plankton Antonio M. Martin-Platero1,6, Brian Cleary2,3, Kathryn Kauffman 1, Sarah P. Preheim1,7, Dennis J. McGillicuddy, Jr4, Eric J. Alm1,2,5 & Martin F. Polz1 Because microbial plankton in the ocean comprise diverse bacteria, algae, and protists that are subject to environmental forcing on multiple spatial and temporal scales, a fundamental 1234567890():,; open question is to what extent these organisms form ecologically cohesive communities. Here we show that although all taxa undergo large, near daily fluctuations in abundance, microbial plankton are organized into clearly defined communities whose turnover is rapid and sharp. We analyze a time series of 93 consecutive days of coastal plankton using a technique that allows inference of communities as modular units of interacting taxa by determining positive and negative correlations at different temporal frequencies. This approach shows both coordinated population expansions that demarcate community boundaries and high frequency of positive and negative associations among populations within communities. Our analysis thus highlights that the environmental variability of the coastal ocean is mirrored in sharp transitions of defined but ephemeral communities of organisms. 1 Department of Civil and Environmental Engineering, Massachusetts Institute of Technology, Cambridge, MA 02139, USA. 2 Broad Institute, Cambridge, MA 02139, USA. 3 Computational and Systems Biology Program, Massachusetts Institute of Technology, Cambridge, MA 02139, USA. 4 Department of Applied Ocean Physics and Engineering, Woods Hole Oceanographic Institution, Woods Hole, MA 02543, USA. 5 Department of Biological Engineering, Massachusetts Institute of Technology, Cambridge, MA 02139, USA.
    [Show full text]
  • Protistology Light-Microscopic Morphology and Ultrastructure Of
    Protistology 13 (1), 26–35 (2019) Protistology Light-microscopic morphology and ultrastructure of Polychaos annulatum (Penard, 1902) Smirnov et Goodkov, 1998 (Amoebozoa, Tubulinea, Euamo- ebida), re-isolated from the surroundings of St. Petersburg (Russia) Oksana Kamyshatskaya1,2, Yelisei Mesentsev1, Ludmila Chistyakova2 and Alexey Smirnov1 1 Department of Invertebrate Zoology, Faculty of Biology, St. Petersburg State University, Universitetskaya nab. 7/9, 199034 St. Petersburg, Russia 2 Core Facility Center “Culturing of microorganisms”, Research park of St. Petersburg State Univeristy, St. Petersburg State University, Botanicheskaya St., 17A, 198504, Peterhof, St. Petersburg, Russia | Submitted December 15, 2018 | Accepted January 21, 2019 | Summary We isolated the species Polychaos annulatum (Penard, 1902) Smirnov et Goodkov, 1998 from a freshwater habitat in the surrounding of Saint-Petersburg. The previous re-isolation of this species took place in 1998; at that time the studies of its light- microscopic morphology were limited with the phase contrast optics, and the electron- microscopic data were obtained using the traditional glutaraldehyde fixation, preceded with prefixation and followed by postfixation with osmium tetroxide. In the present paper, we provide modern DIC images of P. annulatum. Using the fixation protocol that includes a mixture of the glutaraldehyde and paraformaldehyde we were able to obtain better fixation quality for this species. We provide some novel details of its locomotive morphology, nuclear morphology, and ultrastructure. The present finding evidence that P. annulatum is a widely distributed species that could be isolated from a variety of freshwater habitats. Key words: amoebae, Polychaos, ultrastructure, Amoebozoa Introduction Amoeba proteus). These amoebae usually have a relatively large size, exceeding hundred of microns, The largest species of naked lobose amoebae they produce broad, thick pseudopodia with (gymnamoebae) – members of the family Amoe- smooth outlines (lobopodia).
    [Show full text]
  • Comprehensive Phylogenetic Reconstruction of Amoebozoa Based on Concatenated Analyses of SSU-Rdna and Actin Genes
    Smith ScholarWorks Biological Sciences: Faculty Publications Biological Sciences 8-2-2011 Comprehensive Phylogenetic Reconstruction of Amoebozoa Based on Concatenated Analyses of SSU-rDNA and Actin Genes Daniel J.G. Lahr University of Massachusetts Amherst Jessica Grant Smith College Truc Nguyen Smith College Jian Hua Lin Smith College Laura A. Katz Smith College, [email protected] Follow this and additional works at: https://scholarworks.smith.edu/bio_facpubs Part of the Biology Commons Recommended Citation Lahr, Daniel J.G.; Grant, Jessica; Nguyen, Truc; Lin, Jian Hua; and Katz, Laura A., "Comprehensive Phylogenetic Reconstruction of Amoebozoa Based on Concatenated Analyses of SSU-rDNA and Actin Genes" (2011). Biological Sciences: Faculty Publications, Smith College, Northampton, MA. https://scholarworks.smith.edu/bio_facpubs/121 This Article has been accepted for inclusion in Biological Sciences: Faculty Publications by an authorized administrator of Smith ScholarWorks. For more information, please contact [email protected] Comprehensive Phylogenetic Reconstruction of Amoebozoa Based on Concatenated Analyses of SSU- rDNA and Actin Genes Daniel J. G. Lahr1,2, Jessica Grant2, Truc Nguyen2, Jian Hua Lin2, Laura A. Katz1,2* 1 Graduate Program in Organismic and Evolutionary Biology, University of Massachusetts, Amherst, Massachusetts, United States of America, 2 Department of Biological Sciences, Smith College, Northampton, Massachusetts, United States of America Abstract Evolutionary relationships within Amoebozoa have been the subject
    [Show full text]
  • Marine Biological Laboratory) Data Are All from EST Analyses
    TABLE S1. Data characterized for this study. rDNA 3 - - Culture 3 - etK sp70cyt rc5 f1a f2 ps22a ps23a Lineage Taxon accession # Lab sec61 SSU 14 40S Actin Atub Btub E E G H Hsp90 M R R T SUM Cercomonadida Heteromita globosa 50780 Katz 1 1 Cercomonadida Bodomorpha minima 50339 Katz 1 1 Euglyphida Capsellina sp. 50039 Katz 1 1 1 1 4 Gymnophrea Gymnophrys sp. 50923 Katz 1 1 2 Cercomonadida Massisteria marina 50266 Katz 1 1 1 1 4 Foraminifera Ammonia sp. T7 Katz 1 1 2 Foraminifera Ovammina opaca Katz 1 1 1 1 4 Gromia Gromia sp. Antarctica Katz 1 1 Proleptomonas Proleptomonas faecicola 50735 Katz 1 1 1 1 4 Theratromyxa Theratromyxa weberi 50200 Katz 1 1 Ministeria Ministeria vibrans 50519 Katz 1 1 Fornicata Trepomonas agilis 50286 Katz 1 1 Soginia “Soginia anisocystis” 50646 Katz 1 1 1 1 1 5 Stephanopogon Stephanopogon apogon 50096 Katz 1 1 Carolina Tubulinea Arcella hemisphaerica 13-1310 Katz 1 1 2 Cercomonadida Heteromita sp. PRA-74 MBL 1 1 1 1 1 1 1 7 Rhizaria Corallomyxa tenera 50975 MBL 1 1 1 3 Euglenozoa Diplonema papillatum 50162 MBL 1 1 1 1 1 1 1 1 8 Euglenozoa Bodo saltans CCAP1907 MBL 1 1 1 1 1 5 Alveolates Chilodonella uncinata 50194 MBL 1 1 1 1 4 Amoebozoa Arachnula sp. 50593 MBL 1 1 2 Katz lab work based on genomic PCRs and MBL (Marine Biological Laboratory) data are all from EST analyses. Culture accession number is ATTC unless noted. GenBank accession numbers for new sequences (including paralogs) are GQ377645-GQ377715 and HM244866-HM244878.
    [Show full text]
  • Hymenoptera: Figitidae: Figitinae)
    Eur. J. Entomol. 105: 751–769, 2008 http://www.eje.cz/scripts/viewabstract.php?abstract=1392 ISSN 1210-5759 (print), 1802-8829 (online) Revision of Xyalophora Kieffer and description of Xyalophoroides gen. n. (Hymenoptera: Figitidae: Figitinae) MAURICIO JIMÉNEZ, JORDI PARETAS-MARTÍNEZ and JULI PUJADE-VILLAR Universitat de Barcelona, Facultat de Biología, Departament de Biología Animal, Avda. Diagonal 646, 08028-Barcelona, Spain; e-mail: [email protected] Key words. Hymenoptera, Figitidae, Xyalophora, Xyalophoroides, new genus Abstract. The genus Xyalophora (Giraud, 1860) is revised herein. The revision includes the type species of Xyalophora (Figites clavatus Giraud, 1860), the type material and the original descriptions of all the species of Xyalophora included in the Weld cata- logue, and long series of undetermined material. Xyalophora clavata (Giraud, 1860) and X. singularis (Ashmead, 1896) are the only currently recognized species that should be included in Xyalophora. Four new species are described: X. belizini sp. n., X. giraudi sp. n., X. provancheri sp. n. and X. zarazagai sp. n. The type species of Ceraspidia, Ceraspidia japonica Belizin, 1952, corresponds to males of a species within Xyalophora. Thus, Ceraspidia is a new synonymy of Xyalophora, which results in Xyalophora japonica comb. n. Xyalophora impatiens (Say, 1836) and Xyalophora picea (Spinola, 1853) being considered like incertae sedis, as the latter does not belong to the Figitinae but to the Eucoilinae and is probably a species within Acantheucoela Ashmead, 1900. Xyalophora aciculata Benoit, 1956 is transferred to the genus Figites Latreille, 1802: Figites aciculata comb. n. Xyalophora leviventris Kieffer, 1908 is a synonym of Xyalophora quinquelineata (Say, 1836), which is transferred to Xyalophoroides gen.
    [Show full text]
  • Differential Expression of Carrageenan-Related Genes Between the Gametophyte and Tetasporophyte Life Cycle
    To gel or not to gel: differential expression of carrageenan-related genes between the gametophyte and tetasporophyte life cycle stages of the red alga Chondrus crispus Agnieszka Lipinska, Jonas Collén, Stacy Krueger-Hadfield, Theo Mora, Elizabeth Ficko-Blean To cite this version: Agnieszka Lipinska, Jonas Collén, Stacy Krueger-Hadfield, Theo Mora, Elizabeth Ficko-Blean. To gel or not to gel: differential expression of carrageenan-related genes between the gametophyte and tetasporophyte life cycle stages of the red alga Chondrus crispus. Scientific Reports, Nature Publishing Group, 2020, 10 (1), 10.1038/s41598-020-67728-6. hal-02950550 HAL Id: hal-02950550 https://hal.archives-ouvertes.fr/hal-02950550 Submitted on 26 Nov 2020 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. www.nature.com/scientificreports OPEN To gel or not to gel: diferential expression of carrageenan‑related genes between the gametophyte and tetasporophyte life cycle stages of the red alga Chondrus crispus Agnieszka P. Lipinska1*, Jonas Collén1, Stacy A. Krueger‑Hadfeld2, Theo Mora1 & Elizabeth Ficko‑Blean1* Chondrus crispus is a marine red alga with sulfated galactans, called carrageenans, in its extracellular matrix. Chondrus has a complex haplodiplontic life cycle, alternating between male and female gametophytes (n) and tetrasporophytes (2n).
    [Show full text]
  • First Record of Potentially Pathogenic Amoeba Vermamoeba Vermiformis (Lobosea: Gymnamoebia) Isolated from a Freshwater of Dokdo Island in the East Sea, Korea
    Anim. Syst. Evol. Divers. Vol. 32, No. 1: 1-8, January 2016 http://dx.doi.org/10.5635/ASED.2016.32.1.001 First Record of Potentially Pathogenic Amoeba Vermamoeba vermiformis (Lobosea: Gymnamoebia) Isolated from a Freshwater of Dokdo Island in the East Sea, Korea Jong Soo Park* Department of Oceanography and Kyungpook Institute of Oceanography, School of Earth System Sciences, Kyungpook National University, Daegu 41566, Korea ABSTRACT Vermamoeba vermiformis is a very important free-living amoeba for human health in association with Legionnaires’ disease and keratitis. This interesting amoeba was firstly isolated from a freshwater of Dokdo (island), which was historically used for drinking water. Trophozoites and cyst forms of V. vermiformis strain MG1 are very similar to previous reported species. Trophozoites of V. vermiformis strain MG1 showed cylindrical shape with prominent anterior hyaline region. The average ratio of length and width was about 6.5. Typically, cysts of the strain MG1 showed a spherical or slightly ovoidal shape with smooth wall, and lacked cyst pores. Some cysts had crenulate- walled ectocyst, which was separated from endocyst wall. Further, 18S rRNA gene sequence of V. vermiformis strain MG1 showed very high similarity to other V. vermiformis species (99.4%-99.9% identity). Molecular phylogenetic analysis based on 18S rRNA gene sequences clearly confirmed that the isolate was one strain of V. vermiformis with maximum bootstrap value (maximum likelihood: 100%) and Bayesian posterior probability of 1. Thus, the freshwater of Dokdo in Korea could harbor potentially pathogenic amoeba that may cause diseases in humans. Keywords: ‌amoeba, amoebozoa, Dokdo, freshwater, Lobosea, protozoa, Vermamoeba INTRODUCTION morphologically diverse groups including flagellates, amoe- boflagellates, and amoebae (Patterson et al., 2002; Rogerson Of the most abundant protozoa, free-living amoebae (FLA) and Patterson, 2002; Park et al., 2007, 2009, 2012; Park and have been described from freshwater, marine, and soil habi- Simpson, 2011).
    [Show full text]
  • Bio-Sequence Signatures Using Chaos Game Representation
    Bio-sequence Signatures Using Chaos Game Representation Achuthsankar S. Nair, Vrinda V Nair, Arun K S Centre for Bioinformatics, University of Kerala Krishna Kant, Alpana Dey Department of Information Technology, Govt of India, New Delhi Introduction Computational Biology/Bioinformatics is the application of computer sciences and allied technologies to answer the questions of Biologists, about the mysteries of life. It looks as if Computational Biology and Bioinformatics are mainly concerned with problems involving data emerging from within cells of living beings. It might be appropriate to say that Computational Biology and Bioinformatics deal with application of computers in solving problems of molecular biology, in this context. What are these data emerging from a cell ? Four important data are: DNA, RNA and Protein sequences and Micro array images. Surprisingly, first 3 of them are mere text data (strings, more formally) that can be opened with a text editor. The last one is a digital image which is only indirectly a cellular data. See Fig 1. (a) DNA Data (4 letter strings) GTCCTGATAAGTCAGTGTCTCC TGAGTCTAGCTTCTGTCCATGCT GATCATGTCCATGTTCTAGTCAT GATAGTTGATTCTAGTGTCCTG (b) RNA Data (4 letter strings) ACAGAGGAGAGCUAGCUUCAG GCUAGCACGCCUAGUAAGCGCU GCAGUAAGUAGUUAGCCUGCUG AGUCAGGCUGAGUUCAAGCUAG (c) Protein Data (20 letter strings) TPPUQWRDCCLKSWCUWMFC ESPWYZWEGHILDDFPTCTWR DCCDTWCUWGHISTDTKKSUN RGHPPHHLDTWQESRNDCQEG (d) Micro Array Image Data (traditional Digital Images) Fig. 1: Four major kinds of data required to be analyzed in Bioinformatics Our interest is to discuss about deriving signatures for the first three kinds of data. It is well known that the gene regions of the DNA in the nucleus of the cell is copied (transcribed) into the RNA and RNA travels to protein production sites and is translated into proteins.
    [Show full text]