FNDC5 Alleviates Hepatosteatosis by Restoring AMPK/Mtor-Mediated

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Page 1 of 46 Diabetes Title Page FNDC5 alleviates hepatosteatosis by restoring AMPK/mTOR-mediated autophagy, fatty acid oxidation and lipogenesis in mice Tong-Yan Liu1, Xiao-Qing Xiong1, Xing-Sheng Ren1, Ming-Xia Zhao1, Chang-Xiang Shi1, Jue-Jin Wang1, Ye-Bo Zhou1, Feng Zhang1, Ying Han1, Xing-Ya Gao1, Qi Chen2, Yue-Hua Li2,Yu-Ming Kang3, Guo-Qing Zhu1,2* 1Key Laboratory of Cardiovascular Disease and Molecular Intervention, Department of Physiology, Nanjing Medical University, Nanjing, Jiangsu 210029, China; 2Department of Pathophysiology, Nanjing Medical University, Nanjing, Jiangsu 210029, China; 3Department of Physiology and Pathophysiology, Cardiovascular Research Center, Xi'an Jiaotong University School of Medicine, Xi'an 710061, China Short running title: FNDC5 attenuates hepatic steatosis Word count: 3955 excluding title page, abstract, references, figure legends. Number of figures and tables: 8 figures and 0 table Online supplemental Data: 11 embedded figures and 1 table *Address for correspondence: Guo-Qing Zhu, M.D., Ph.D. Professor, Chair Key Laboratory of Cardiovascular Disease and Molecular Intervention, Department of Physiology, Nanjing Medical University, 140 Hanzhong Road, Nanjing 210029, China Tel: +86-25-86862885; Fax: +86-25-86862885; E-Mail: [email protected] 1 Diabetes Publish Ahead of Print, published online August 8, 2016 Diabetes Page 2 of 46 ABSTRACT Fibronectin type III domain-containing 5 (FNDC5) protein induces browning of subcutaneous fat, and mediates beneficial effects of exercise on metabolism. However, whether FNDC5 is associated with hepatic steatosis, autophagy, fatty acid oxidation (FAO) and lipogenesis remains unknown. Herein, we show the roles and mechanisms of FNDC5 in hepatic steatosis, autophagy and lipid metabolism. Fasted FNDC5-/- mice exhibited severe steatosis, reduced autophagy and FAO, and enhanced lipogenesis in liver compared with WT mice. Energy deprivation induced autophagy, FAO and AMPK activity were attenuated in FNDC5-/- hepatocytes, which were restored by activating AMPK with AICAR. Inhibition of mTORC1 with rapamycin enhanced autophagy and FAO, attenuated lipogenesis and steatosis in FNDC5-/- livers. FNDC5 deficiency exacerbated hyperlipemia, hepatic FAO and autophagy impairment, hepatic lipogenesis and lipid accumulation in obese mice. Exogenous FNDC5 stimulated autophagy and FAO gene expression in hepatocytes, and repaired the attenuated autophagy and palmitate-induced steatosis in FNDC5-/- hepatocytes. FNDC5 overexpression prevented hyperlipemia, hepatic FAO and autophagy impairment, hepatic lipogenesis and lipid accumulation in obese mice. These results indicate that FNDC5 deficiency impairs autophagy and FAO, and enhances lipogenesis via AMPK/mTOR pathway. FNDC5 deficiency aggravates while FNDC5 overexpression prevents the HFD-induced hyperlipemia, hepatic lipid accumulation, and impaired FAO and autophagy in liver. Keywords: hepatic steatosis; hepatocyte; lipid mentalism; obesity; signal transduction 2 Page 3 of 46 Diabetes Non-alcoholic fatty liver disease (NAFLD) is characterized by triacylglycerol (TG) accumulation within hepatocytes (1). Hepatosteatosis is strongly associated with obesity, and may progress to steatohepatitis and even to end-stage liver disease including liver cirrhosis and hepatocellular carcinoma (2,3). Fatty acid β-oxidation (FAO) in mitochondria is a process to shorten the fatty acids into acetyl-CoA, which can be converted into ketone bodies or incorporated into tricarboxylic acid cycle for full oxidation (4). Accumulation of lipid in liver can be traced by the impaired FAO and increased de novo lipogenesis (5). Autophagy is a mechanism involved in cellular homeostasis delivering cytoplasmic content to the lysosomes for degradation to macronutrients (6). Defects in autophagy play a major role in metabolic dysregulation (7). Although some studies showed the lipogenic role of autophagy, most experiments supported autophagy as a lipolytic mechanism (6). Reduced autophagic function promotes the initial development of hepatic steatosis and progression of steatosis to liver injury, and agents to augment hepatic autophagy may have therapeutic potential in nonalcoholic steatohepatitis (8-10). Fibronectin type III domain containing 5 (FNDC5) is a type I membrane protein that has 209 amino acid residues. FNDC5 induces browning of subcutaneous adipocytes, and mediates the beneficial effect of exercise on metabolism (11). Irisin, a cleaved and secreted fragment of FNDC5, acts on white adipose cells to induce a broad program of brown-fat-like development (11). Our recent studies have shown that FNDC5 overexpression ameliorates hyperlipemia and enhances lipolysis in 3 Diabetes Page 4 of 46 adipose tissues in obese mice (12), and that irisin inhibits hepatic gluconeogenesis and increases glycogen synthesis in type 2 diabetic mice and hepatocytes (13). However, whether FNDC5 could improve hepatosteatosis, autophagy and FAO remains unknown. It is known that nutrient deprivation activates adenosine monophosphate-activated protein kinase (AMPK), resulting in the inhibition of mammalian target of rapamycin complex 1 (mTORC1), which regulates lipid metabolism, cellular proliferation, and autophagy (14,15). The mTORC1 inhibits peroxisome proliferator-activated receptor (PPAR)α activity, which regulates mitochondrial functions and FAO (16). Interestingly, PPARα acts as the downstream of FNDC5 (11). The present study is designed to investigate the roles and underlying mechanisms of FNDC5 in hepatic steatosis, autophagy, FAO and lipogenesis in FNDC5-/- mice, high-fat diet (HFD)-induced obese mice, and primary hepatocytes. Moreover, the therapeutic effects of FNDC5 were investigated. RESEARCH DESIGN AND METHODS FNDC5-/- mice and HFD-induced obese mice Male C57BL/6 WT and FNDC5-/- mice on a C57BL/6 background (Nanjing BioMedical Research Institute, Nanjing University, Nanjing, China) were used in the experiments. In HFD-induced obesity models, mice at the age of 4 weeks began to receive HFD (21.8 kJ/g, 60% of energy as fat) for 12 weeks. Normal chow diet (14.7 kJ/g, 13% of energy as fat) was used as control (12,17). Procedures were approved by the Experimental Animal Care and Use Committee of Nanjing Medical University and conformed to the Guide for the Care and Use of Laboratory Animal (NIH 4 Page 5 of 46 Diabetes publication, 8th edition, 2011). Mice were caged in an environment under controlled temperature and humidity with free access to water and food under a 12-h light/dark cycle. At the end of experiments, mice were fasted overnight, and then euthanized with an overdose of pentobarbital sodium (150 mg/kg, i.v.). FNDC5 overexpression in mice Mice at the age of 4 weeks began to receive control diet or HFD for 12 weeks. A single intravenous injection of recombinant lentivirus (1×108 TU/ml, 100 µl) expressing FNDC5 or EGFP vector was carried out at the end of the 6th week after the diet application (12). Acute experiments were performed 6 weeks after the lentivirus introduction. Knockdown of AMPK or Atg5 by siRNA in hepatocytes Primary hepatocytes were transfected with small interfering RNA (siRNA) for knockdown of AMPK or autophagy protein 5 (Atg5). Scramble siRNA was used as control. The sequences of siRNA were listed as follows. AMPK: sense CGGGAUCCAUCAGCAACUATT, antisense UAGUUGCUGAUGGAUCCCGAT (18). Atg5: CCGGCCTTGGAACATCACAGTACATCTCGAGATGTACTGTGATGTTCCAAG GTTTTTG. Primary hepatocyte isolation and cell culture Primary hepatocytes were isolated and cultured as previously described (13,19). Briefly, mice were anesthetized with pentobarbital (50 mg/kg, i.p.). HEPES buffer containing collagenase II (0.66 mg/mL) was perfusion via portal vein. Livers were 5 Diabetes Page 6 of 46 removed and excised aseptically. Cells were dispersed and filtrated. Hepatocyte suspensions were purified by centrifugation in Percoll adjusted to a density of 1.065 g/ml for 10 min at 50 g to reduce the amount of non-parenchymal cells. With this method the non-parenchymal cells is less than 1% (20). Cell viability was determined with trypan blue dye. Plates with cell viability greater than 95% were used for experiments. The hepatocytes were maintained in low glucose DMEM containing 10% FBS with penicillin (100 units/mL) and streptomycin (100 µg/mL) at 37°C in a 5% CO2 atmosphere. Monitor of autophagy Cells were transfected with tandem green fluorescent protein (GFP)-red fluorescent protein (RFP)-LC3 adenovirus (Hanbio, Shanghai, China) for 24 h according to the instructions. Cells were treated with amino acid starvation, rapamycin or chloroquine for 2 h to observe the autophagy flux. When autophagy inducts, both GFP and RFP are expressed as yellow dots representing autophagosomes after the images emerged. When autophagosomes fuse with lysosomes and form autolysosomes, the GFP degrades in an acid environment, but RFP–LC3 maintains showing as red dots (21). Oil red O staining and immunohistochemistry Livers were fixed in 4% neutral buffered formalin phosphate and then were embedded in paraffin or OCT compound, respectively. The tissues were subsequently sliced into 5-µm sections. Oil Red O staining was used to detect the lipid content in liver. For immunohistochemistry evaluation, liver sections were incubated with anti-p62 antibody (Abcam Ltd, Cambridge, UK) or anti-LC3B antibody (Cell signaling 6 Page 7 of 46 Diabetes Technology, Danvers, MA, USA). The anti-LC3B antibody showed stronger reactivity with LC3BII according to the manufacturer's instructions. Western blot Protein extracts
Recommended publications
  • Molecular Mechanisms Underlying the Beneficial Effects of Exercise On

    Molecular Mechanisms Underlying the Beneficial Effects of Exercise On

    International Journal of Molecular Sciences Review Molecular Mechanisms Underlying the Beneficial Effects of Exercise on Brain Function and Neurological Disorders Kévin Nay 1,2, William J. Smiles 1 , Jacqueline Kaiser 1, Luke M. McAloon 1,2, Kim Loh 1,3, Sandra Galic 1, Jonathan S. Oakhill 1,2, Andrew L. Gundlach 3,4 and John W. Scott 1,2,4,* 1 St Vincent’s Institute of Medical Research, Fitzroy, Victoria 3065, Australia; [email protected] (K.N.); [email protected] (W.J.S.); [email protected] (J.K.); [email protected] (L.M.M.); [email protected] (K.L.); [email protected] (S.G.); [email protected] (J.S.O.) 2 Exercise and Nutrition Research Program, Mary MacKillop Institute for Health Research, Australian Catholic University, Melbourne, Victoria 3000, Australia 3 Department of Medicine, University of Melbourne, Parkville, Victoria 3010, Australia; andrew.gundlach@florey.edu.au 4 The Florey Institute of Neuroscience and Mental Health, Parkville, Victoria 3052, Australia * Correspondence: [email protected]; Tel.: +61-3-9288-3632 Abstract: As life expectancy has increased, particularly in developed countries, due to medical advances and increased prosperity, age-related neurological diseases and mental health disorders have become more prevalent health issues, reducing the well-being and quality of life of sufferers and their families. In recent decades, due to reduced work-related levels of physical activity, and key research insights, prescribing adequate exercise has become an innovative strategy to prevent or delay the onset of these pathologies and has been demonstrated to have therapeutic benefits when used Citation: Nay, K.; Smiles, W.J.; as a sole or combination treatment.
  • Current Evidence of the Role of the Myokine Irisin in Cancer

    Current Evidence of the Role of the Myokine Irisin in Cancer

    cancers Review Current Evidence of the Role of the Myokine Irisin in Cancer Evangelia Tsiani 1,2,*, Nicole Tsakiridis 1, Rozalia Kouvelioti 1,3, Alina Jaglanian 1 and Panagiota Klentrou 2,3 1 Department of Health Sciences, Brock University, St. Catharines, ON L2S 3A1, Canada; [email protected] (N.T.); [email protected] (R.K.); [email protected] (A.J.) 2 Centre for Bone and Muscle Health, Brock University, St. Catharines, ON L2S 3A1, Canada; [email protected] 3 Department of Kinesiology, Brock University, St. Catharines, ON L2S 3A1, Canada * Correspondence: [email protected] Simple Summary: Regular exercise/physical activity is beneficial for the health of an individual and lowers the risk of getting different diseases, including cancer. How exactly exercise results in these health benefits is not known. Recent studies suggest that the molecule irisin released by muscles into the blood stream after exercise may be responsible for these effects. This review summarizes all the available in vitro/cell culture, animal and human studies that have investigated the relationship between cancer and irisin with the aim to shed light and understand the possible role of irisin in cancer. The majority of the in vitro studies indicate anticancer properties of irisin, but more animal and human studies are required to better understand the exact role of irisin in cancer. Abstract: Cancer is a disease associated with extreme human suffering, a huge economic cost to health systems, and is the second leading cause of death worldwide. Regular physical activity is associated with many health benefits, including reduced cancer risk. In the past two decades, exercising/contracting skeletal muscles have been found to secrete a wide range of biologically active proteins, named myokines.
  • FNDC5 Gene Interactions with Candidate Genes FOXOA3 and AP

    FNDC5 Gene Interactions with Candidate Genes FOXOA3 and AP

    The Author(s) BMC Genomics 2017, 18(Suppl 8):803 DOI 10.1186/s12864-017-4194-4 RESEARCH Open Access Epistasis, physical capacity-related genes and exceptional longevity: FNDC5 gene interactions with candidate genes FOXOA3 and APOE Noriyuki Fuku1*†, Roberto Díaz-Peña2,3†, Yasumichi Arai4, Yukiko Abe4, Hirofumi Zempo1, Hisashi Naito1, Haruka Murakami5, Motohiko Miyachi5, Carlos Spuch6, José A. Serra-Rexach8, Enzo Emanuele7, Nobuyoshi Hirose1 and Alejandro Lucia9 From 34th FIMS World Sports Medicine Congress Ljubljana, Slovenia. 29th September – 2nd October 2016 Abstract Background: Forkhead box O3A (FOXOA3) and apolipoprotein E (APOE) are arguably the strongest gene candidates to influence human exceptional longevity (EL, i.e., being a centenarian), but inconsistency exists among cohorts. Epistasis, defined as the effect of one locus being dependent on the presence of ‘modifier genes’,maycontributeto explain the missing heritability of complex phenotypes such as EL. We assessed the potential association of epistasis among candidate polymorphisms related to physical capacity, as well as antioxidant defense and cardiometabolic traits, and EL in the Japanese population. A total of 1565 individuals were studied, subdivided into 822 middle-aged controls and 743 centenarians. Results: We found a FOXOA3 rs2802292 T-allele-dependent association of fibronectin type III domain-containing 5 (FDNC5) rs16835198 with EL: the frequency of carriers of the FOXOA3 rs2802292 T-allele among individuals with the rs16835198 GG genotype was significantly higher in cases than in controls (P < 0.05). On the other hand, among non- carriers of the APOE ‘risk’ ε4-allele, the frequency of the FDNC5 rs16835198 G-allele was higher in cases than in controls (48.4% vs.
  • NIH Public Access Author Manuscript Nature

    NIH Public Access Author Manuscript Nature

    NIH Public Access Author Manuscript Nature. Author manuscript; available in PMC 2012 December 14. Published in final edited form as: Nature. ; 481(7382): 463–468. doi:10.1038/nature10777. A PGC1α-dependent myokine that drives browning of white fat and thermogenesis $watermark-text $watermark-text $watermark-text Pontus Boström1, Jun Wu1, Mark P. Jedrychowski2, Anisha Korde1, Li Ye1, James C. Lo1, Kyle A. Rasbach1, Elisabeth Almer Boström3, Jang Hyun Choi1, Jonathan Z. Long1, Shingo Kajimura4, Maria Cristina Zingaretti5, Birgitte F. Vind6, Hua Tu7, Saverio Cinti5, Kurt Højlund6, Steven P. Gygi2, and Bruce M. Spiegelman1,* 1Dana-Farber Cancer Institute and Harvard Medical School, 3 Blackfan Circle, CLS Building, floor 11, Boston, MA, 02115, USA 2Department of Cell Biology, Harvard Medical School, Boston, MA, 02115, USA 3Renal Division, Brigham and Women’s Hospital, Harvard Medical School 4UCSF Diabetes Center and Department of Cell and Tissue Biology, University of California, San Francisco 5Department of Experimental and Clinical Medicine, Università Politecnica delle Marche, Electron Microscopy Unit-Azienda Ospedali Riuniti, Ancona 60020, Italy 6Diabetes Research Center, Department of Endocrinology, Odense University Hospital, Denmark 7LakePharma, Inc. 530 Harbor Blvd, Belmont CA 94002 Abstract Exercise benefits a variety of organ systems in mammals, and some of the best-recognized effects of exercise on muscle are mediated by the transcriptional coactivator PGC1α Here we show that PGC1α expression in muscle stimulates an increase in expression of Fndc5, a membrane protein that is cleaved and secreted as a new hormone, irisin. Irisin acts on white adipose cells in culture and in vivo to stimulate UCP1 expression and a broad program of brown fat-like development.
  • The Acute Effects of Swimming Exercise on PGC-1-FNDC5/Irisin

    The Acute Effects of Swimming Exercise on PGC-1-FNDC5/Irisin

    H OH metabolites OH Article The Acute Effects of Swimming Exercise on PGC-1α-FNDC5/Irisin-UCP1 Expression in Male C57BL/6J Mice Eunhee Cho 1, Da Yeon Jeong 2, Jae Geun Kim 2,3 and Sewon Lee 4,5,6,* 1 Department of Human Movement Science, Graduate School, Incheon National University, Incheon 22012, Korea; [email protected] 2 Division of Life Sciences, College of Life Sciences and Bioengineering, Incheon National University, Incheon 22012, Korea; [email protected] (D.Y.J.); [email protected] (J.G.K.) 3 Institute for New Drug Development, Division of Life Sciences, Incheon National University, Incheon 22012, Korea 4 Division of Sport Science, College of Arts & Physical Education, Incheon National University, Incheon 22012, Korea 5 Sport Science Institute, College of Arts & Physical Education, Incheon National University, Incheon 22012, Korea 6 Health Promotion Center, College of Arts & Physical Education, Incheon National University, Incheon 22012, Korea * Correspondence: [email protected]; Tel.:+82-32-835-8572 Abstract: Irisin is a myokine primarily secreted by skeletal muscles and is known as an exercise- induced hormone. The purpose of this study was to determine whether the PGC-1α -FNDC5 /Irisin- UCP1 expression which is an irisin-related signaling pathway, is activated by an acute swimming exercise. Fourteen to sixteen weeks old male C57BL/6J mice (n = 20) were divided into control (CON, n n = 10) and swimming exercise groups (SEG, = 10). The SEG mice performed 90 min of acute swimming exercise, while control (non-exercised) mice were exposed to shallow water (2 cm of depth) for 90 min.
  • Irisin – a Myth Rather Than An

    Irisin – a Myth Rather Than An

    OPEN Irisin – a myth rather than an SUBJECT AREAS: exercise-inducible myokine TRANSCRIPTION Elke Albrecht1*, Frode Norheim2*, Bernd Thiede3, Torgeir Holen2, Tomoo Ohashi4, Lisa Schering1, FAT METABOLISM Sindre Lee2, Julia Brenmoehl5, Selina Thomas6, Christian A. Drevon2, Harold P. Erickson4 & Steffen Maak1 Received 1Institute for Muscle Biology and Growth, Leibniz Institute for Farm Animal Biology, D-18196 Dummerstorf, Germany, 2Department 8 December 2014 of Nutrition, Institute of Basic Medical Sciences, University of Oslo, 0317 Oslo, Norway, 3The Biotechnology Centre of Oslo, University of Oslo, 0317 Oslo, Norway, 4Department of Cell Biology, Duke University, Durham, NC 27710, USA, 5Institute of Accepted Genome Biology, Leibniz Institute for Farm Animal Biology, D-18196 Dummerstorf, Germany, 6Swiss Institute of Equine Medicine 9 February 2015 (ISME), Vetsuisse Faculty, University of Berne, 1580 Avenches, Switzerland. Published 9 March 2015 The myokine irisin is supposed to be cleaved from a transmembrane precursor, FNDC5 (fibronectin type III domain containing 5), and to mediate beneficial effects of exercise on human metabolism. However, evidence for irisin circulating in blood is largely based on commercial ELISA kits which are based on Correspondence and polyclonal antibodies (pAbs) not previously tested for cross-reacting serum proteins. We have analyzed four commercial pAbs by Western blotting, which revealed prominent cross-reactivity with non-specific requests for materials proteins in human and animal sera. Using recombinant glycosylated and non-glycosylated irisin as positive should be addressed to controls, we found no immune-reactive bands of the expected size in any biological samples. A FNDC5 S.M. (maak@fbn- signature was identified at ,20 kDa by mass spectrometry in human serum but was not detected by the dummerstorf.de) commercial pAbs tested.
  • Irisin As a Multifunctional Protein: Implications for Health and Certain Diseases

    Irisin As a Multifunctional Protein: Implications for Health and Certain Diseases

    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Jagiellonian Univeristy Repository medicina Review Irisin as a Multifunctional Protein: Implications for Health and Certain Diseases Paulina Korta 1 , Ewa Poche´c 1,* and Agnieszka Mazur-Biały 2 1 Department of Glycoconjugate Biochemistry, Institute of Zoology and Biomedical Research, Faculty of Biology, Jagiellonian University, Gronostajowa 9, 30-387 Krakow, Poland 2 Department of Ergonomics and Exercise Physiology, Faculty of Health Sciences, Jagiellonian University, Medical College, Grzegorzecka 20, 31-531 Krakow, Poland * Correspondence: [email protected]; Tel.: +48-12-664-64-67 Received: 29 June 2019; Accepted: 12 August 2019; Published: 15 August 2019 Abstract: Sedentary life style is considered to be an independent risk factor for many disorders, including development of type 2 diabetes, obesity, immune dysfunction, asthma, and neurological or coronary heart disease. Irisin is released from myocytes during physical activity, and acts as a link between muscles and other tissues and organs. This myokine is produced as a result of proteolytic cleavage of FNDC5 protein present in the membrane of myocytes. Secretion of irisin is regulated by N-linked oligosaccharides attached to the protein molecule. The two N-glycan molecules, which constitute a significant part of the irisin glycoprotein, regulate the browning of adipocytes, which is the most important function of irisin. A receptor specific for irisin has still not been discovered. In some tissues irisin probably acts via integrins, which are widely expressed transmembrane receptors. Many studies have confirmed the multifunctional role of irisin and the beneficial effects of this molecule on body homeostasis.
  • View a Copy of This Licence, Visit

    View a Copy of This Licence, Visit

    Zhang et al. Journal of Ovarian Research (2021) 14:107 https://doi.org/10.1186/s13048-021-00851-8 RESEARCH Open Access Long-term intermittent cold exposure affects peri-ovarian adipose tissue and ovarian microenvironment in rats Li Zhang†, Gaihong An†, Shuai Wu, Jing Wang, Danfeng Yang, Yongqiang Zhang* and Xi Li* Introduction contents gradually increase as follicles develop. These Cold is a significant environmental stress factor. Studies steroids, non-steroid hormones, and growth factors act have shown that exposure to cold environments can as regulatory factors and constitute the microenviron- cause local or whole-body temperatures to decrease, ment that determines follicle growth and development. posing a severe threat to overall health [1–3]. Cold The ovarian microenvironment plays a vital role in ovar- exposure has adverse effects on the female reproductive ian function and follicle development. However, the ef- system [4–6], affecting ovarian [7] and uterine [4] func- fects of cold exposure on ovarian function and the tions and hormone secretion [8]. Possible reasons in- ovarian microenvironment have not been well- clude: imbalance of ET-1 and its receptor expression elucidated. leads to local tissue microvascular circulatory distur- Studies have shown that the development and matur- bances [9]; affects follicular development by activating ation of follicles prior to ovulation are primarily regu- sympathetic nerve activity in the ovary [10, 11]; Cold lated by the central neuroendocrine system and growth stress can also cause reproductive hormone disorders, factors and hormones found in the local ovarian micro- causing uterine arteries to contract, resulting in reduced environment [13, 14]. Peri-ovarian adipose tissue blood flow [12].
  • The Role of Irisin in Cancer Disease

    The Role of Irisin in Cancer Disease

    cells Review The Role of Irisin in Cancer Disease Agnieszka Pinkowska 1 , Marzenna Podhorska-Okołów 2, Piotr Dzi˛egiel 3,4 and Katarzyna Nowi ´nska 3,* 1 Department of Anatomy, Department of Human Morphology and Embryology, Wroclaw Medical University, 50-368 Wroclaw, Poland; [email protected] 2 Department of Ultrastructure Research, Wroclaw Medical University, 50-368 Wroclaw, Poland; [email protected] 3 Department of Histology and Embryology, Department of Human Morphology and Embryology, Wroclaw Medical University, 50-368 Wroclaw, Poland; [email protected] 4 Department of Physiotherapy, University School of Physical Education, 51-612 Wroclaw, Poland * Correspondence: [email protected]; Tel.: +48-71-784-1354; Fax: +48-71-784-0082 Abstract: Irisin (Ir) is an adipomyokine that is involved in the regulation of metabolic processes. It also influences processes related to inflammation, including cancer. Initially, Ir was considered a hormone secreted by skeletal muscles in response to physical exercise. Further studies showed that Ir is also present in other healthy tissues, organs, and plasma. It influences the change in phenotype of white adipose tissue (WAT) into brown adipose tissue (BAT). It increases mitochondrial biogenesis and affects the expression of thermogenin (UCP1). This adipomyokine has also been found in many tumor tissues and in the serum of cancer patients. Studies are underway to determine the association between Ir and carcinogenesis. It has been confirmed that Ir inhibits in vitro proliferation, migration, and invasion. It is involved in the inhibition of epithelial–mesenchymal transition (EMT). Additionally, Ir affects the expression of the transcription factor Snail, which is involved in EMT, and inhibits transcription of the gene encoding E-cadherin, which is characteristic of epithelial-derived cells.
  • Theranostics NAD+-Boosting Therapy Alleviates Nonalcoholic Fatty Liver

    Theranostics NAD+-Boosting Therapy Alleviates Nonalcoholic Fatty Liver

    Theranostics 2021, Vol. 11, Issue 9 4381 Ivyspring International Publisher Theranostics 2021; 11(9): 4381-4402. doi: 10.7150/thno.53652 Research Paper NAD+-boosting therapy alleviates nonalcoholic fatty liver disease via stimulating a novel exerkine Fndc5/irisin Dong-Jie Li1,2,3*, Si-Jia Sun2,3*, Jiang-Tao Fu1*, Shen-Xi Ouyang2,3*, Qin-Jie Zhao,4 Li Su,5 Qing-Xi Ji,2,3 Di-Ynag Sun1, Jia-Hui Zhu2,3, Guo-Yan Zhang2,3, Jia-Wei Ma2,3, Xiu-Ting Lan,2,3 Yi Zhao,2,3 Jie Tong2,3, Guo-Qiang Li,1,6 Fu-Ming Shen2,3, Pei Wang1,2,3 1. Department of Pharmacology, School of Pharmacy, Second Military Medical University/Naval Medical University, Shanghai, China. 2. Department of Pharmacy, School of Medicine, Shanghai Tenth People's Hospital, Tongji University School of Medicine, Shanghai, China. 3. Tongji University School of Medicine, Shanghai, China. 4. Department of Organic Chemistry, School of Pharmacy, Second Military Medical University/Naval Medical University, Shanghai, China. 5. Institute of Translational Medicine, Shanghai University, Shanghai, China. 6. School of Life Science, East China Normal University, Shanghai, China. *These authors contributed equally to this work. Corresponding author: Prof. Pei Wang, Ph.D, MD, Department of Pharmacology, School of Pharmacy, Second Military Medical University/Naval Medical University, Shanghai, China. Tel: 86-21-81871276; E-mail: [email protected]. © The author(s). This is an open access article distributed under the terms of the Creative Commons Attribution License (https://creativecommons.org/licenses/by/4.0/). See http://ivyspring.com/terms for full terms and conditions.
  • Centre for Arab Genomic Studies a Division of Sheikh Hamdan Award for Medical Sciences

    Centre for Arab Genomic Studies a Division of Sheikh Hamdan Award for Medical Sciences

    Centre for Arab Genomic Studies A Division of Sheikh Hamdan Award for Medical Sciences The atalogue for ransmission enetics in rabs C T G A CTGA Database CDKN2B Antisense RNA Alternative Names including vascular endothelial cells and smooth CDKN2BAS coronary muscle cells. Antisense Noncoding RNA in the INK4 Locus ANRIL Epidemiology in the Arab World Record Category Saudi Arabia Gene locus Abdulazeez et al., (2016) performed a case-control study in order to investigate the association of 12 WHO-ICD risk variants located at 9p21.3 with myocardial N.B.:Classification not applicable to gene loci. infarction (MI) in Saudi Arabian population. The study included 250 Saudi patients with CAD who Incidence per 100,000 Live Births had experienced an MI and 252 age matched N/A to gene loci healthy controls with no history of CAD. Results showed a significant difference in the genotypic OMIM Number distribution of four SNPs (rs564398, rs4977574, 613149 rs2891168, and rs1333042) in the CDKN2B-AS1 gene between cases and controls. The study Mode of Inheritance identified three protective haplotypes (TAAG, N/A AGTA and GGGCC) and a risk haplotype (TGGA) for the development of CAD. This study was in Gene Map Locus line with previous studies conducted worldwide 9p21.3 indicating that the SNPs located in the intronic region of the CDKN2B-AS1 gene were associated Description with CAD. The CDKN2BAS gene is located near the CDKN2A-CDKN2B gene and codes for an References antisense non-coding RNA. Although the exact AbdulAzeez S, Al-Nafie AN, Al-Shehri A, Borgio function of this gene and the ncRNA it codes for is JF, Baranova EV, Al-Madan MS, Al-Ali RA, Al- unknown, there is evidence pointing to the fact that Muhanna F, Al-Ali A, Al-Mansori M, Ibrahim MF, it may regulate the expression of nearby protein Asselbergs FW, Keating B, Koeleman BP, Al-Ali coding genes, including CDKN2A, CDKN2B, and AK.
  • Assessment of Pep, Fndc5, C2c12, Pgc1α Pattern of Genes Expression

    Assessment of Pep, Fndc5, C2c12, Pgc1α Pattern of Genes Expression

    ndrom Sy es tic & e G n Asadi et al., J Genet Syndr Gene Ther 2016, 7:6 e e n G e f T o Journal of Genetic Syndromes & DOI: 10.4172/2157-7412.1000314 h l e a r n a r p u y o J ISSN: 2157-7412 Gene Therapy Research Article Open Access Assessment of Pep, Fndc5, C2c12, Pgc1α Pattern of Genes Expression during Differentiation of Human Embryonic Stem Cells into Heart Cells Shahin Asadi1*, Zahra Gholizadeh1, Mahsa Sadat Mir Jamali2 and Mina Niknia2 1Research Center for Stem Cell and Drug Applied Research Center, Tabriz University of Medical Sciences in modern biology, Iran 2Young Researchers and Elite Club, Tabriz Branch, Islamic Azad University, Tabriz, Iran Abstract FNDC5 gene with another protein called Xuemei Proxy (PEP) is a 209 amino acid protein coding. These genes mainly in heart tissue, skeletal muscle and brain expressed. This study aimed to clarify the pattern of expression of this gene in mouse embryonic cells Heart cells taken. The mouse embryonic stem cells as a model for cardiac differentiation induced by ascorbic acid used and the pattern of expression of PEP at certain stages of differentiation were analyzed by Real-Time PCR technique. The results show a dramatic increase in PEP gene expression in the adult cardiomyocytes. PEP increased expression of genes may have a role in later stages cardiogenesis is possible that further studies are needed to identify it. Keywords: Protein proxy xuemei; Cardiac differentiation; Embryonic The ectodomain was proposed to be cleaved to give a soluble stem cells and mice; Real-time PCR peptide hormone named irisin.