Page 1 of 46 Diabetes Title Page FNDC5 alleviates hepatosteatosis by restoring AMPK/mTOR-mediated autophagy, fatty acid oxidation and lipogenesis in mice Tong-Yan Liu1, Xiao-Qing Xiong1, Xing-Sheng Ren1, Ming-Xia Zhao1, Chang-Xiang Shi1, Jue-Jin Wang1, Ye-Bo Zhou1, Feng Zhang1, Ying Han1, Xing-Ya Gao1, Qi Chen2, Yue-Hua Li2,Yu-Ming Kang3, Guo-Qing Zhu1,2* 1Key Laboratory of Cardiovascular Disease and Molecular Intervention, Department of Physiology, Nanjing Medical University, Nanjing, Jiangsu 210029, China; 2Department of Pathophysiology, Nanjing Medical University, Nanjing, Jiangsu 210029, China; 3Department of Physiology and Pathophysiology, Cardiovascular Research Center, Xi'an Jiaotong University School of Medicine, Xi'an 710061, China Short running title: FNDC5 attenuates hepatic steatosis Word count: 3955 excluding title page, abstract, references, figure legends. Number of figures and tables: 8 figures and 0 table Online supplemental Data: 11 embedded figures and 1 table *Address for correspondence: Guo-Qing Zhu, M.D., Ph.D. Professor, Chair Key Laboratory of Cardiovascular Disease and Molecular Intervention, Department of Physiology, Nanjing Medical University, 140 Hanzhong Road, Nanjing 210029, China Tel: +86-25-86862885; Fax: +86-25-86862885; E-Mail: [email protected] 1 Diabetes Publish Ahead of Print, published online August 8, 2016 Diabetes Page 2 of 46 ABSTRACT Fibronectin type III domain-containing 5 (FNDC5) protein induces browning of subcutaneous fat, and mediates beneficial effects of exercise on metabolism. However, whether FNDC5 is associated with hepatic steatosis, autophagy, fatty acid oxidation (FAO) and lipogenesis remains unknown. Herein, we show the roles and mechanisms of FNDC5 in hepatic steatosis, autophagy and lipid metabolism. Fasted FNDC5-/- mice exhibited severe steatosis, reduced autophagy and FAO, and enhanced lipogenesis in liver compared with WT mice. Energy deprivation induced autophagy, FAO and AMPK activity were attenuated in FNDC5-/- hepatocytes, which were restored by activating AMPK with AICAR. Inhibition of mTORC1 with rapamycin enhanced autophagy and FAO, attenuated lipogenesis and steatosis in FNDC5-/- livers. FNDC5 deficiency exacerbated hyperlipemia, hepatic FAO and autophagy impairment, hepatic lipogenesis and lipid accumulation in obese mice. Exogenous FNDC5 stimulated autophagy and FAO gene expression in hepatocytes, and repaired the attenuated autophagy and palmitate-induced steatosis in FNDC5-/- hepatocytes. FNDC5 overexpression prevented hyperlipemia, hepatic FAO and autophagy impairment, hepatic lipogenesis and lipid accumulation in obese mice. These results indicate that FNDC5 deficiency impairs autophagy and FAO, and enhances lipogenesis via AMPK/mTOR pathway. FNDC5 deficiency aggravates while FNDC5 overexpression prevents the HFD-induced hyperlipemia, hepatic lipid accumulation, and impaired FAO and autophagy in liver. Keywords: hepatic steatosis; hepatocyte; lipid mentalism; obesity; signal transduction 2 Page 3 of 46 Diabetes Non-alcoholic fatty liver disease (NAFLD) is characterized by triacylglycerol (TG) accumulation within hepatocytes (1). Hepatosteatosis is strongly associated with obesity, and may progress to steatohepatitis and even to end-stage liver disease including liver cirrhosis and hepatocellular carcinoma (2,3). Fatty acid β-oxidation (FAO) in mitochondria is a process to shorten the fatty acids into acetyl-CoA, which can be converted into ketone bodies or incorporated into tricarboxylic acid cycle for full oxidation (4). Accumulation of lipid in liver can be traced by the impaired FAO and increased de novo lipogenesis (5). Autophagy is a mechanism involved in cellular homeostasis delivering cytoplasmic content to the lysosomes for degradation to macronutrients (6). Defects in autophagy play a major role in metabolic dysregulation (7). Although some studies showed the lipogenic role of autophagy, most experiments supported autophagy as a lipolytic mechanism (6). Reduced autophagic function promotes the initial development of hepatic steatosis and progression of steatosis to liver injury, and agents to augment hepatic autophagy may have therapeutic potential in nonalcoholic steatohepatitis (8-10). Fibronectin type III domain containing 5 (FNDC5) is a type I membrane protein that has 209 amino acid residues. FNDC5 induces browning of subcutaneous adipocytes, and mediates the beneficial effect of exercise on metabolism (11). Irisin, a cleaved and secreted fragment of FNDC5, acts on white adipose cells to induce a broad program of brown-fat-like development (11). Our recent studies have shown that FNDC5 overexpression ameliorates hyperlipemia and enhances lipolysis in 3 Diabetes Page 4 of 46 adipose tissues in obese mice (12), and that irisin inhibits hepatic gluconeogenesis and increases glycogen synthesis in type 2 diabetic mice and hepatocytes (13). However, whether FNDC5 could improve hepatosteatosis, autophagy and FAO remains unknown. It is known that nutrient deprivation activates adenosine monophosphate-activated protein kinase (AMPK), resulting in the inhibition of mammalian target of rapamycin complex 1 (mTORC1), which regulates lipid metabolism, cellular proliferation, and autophagy (14,15). The mTORC1 inhibits peroxisome proliferator-activated receptor (PPAR)α activity, which regulates mitochondrial functions and FAO (16). Interestingly, PPARα acts as the downstream of FNDC5 (11). The present study is designed to investigate the roles and underlying mechanisms of FNDC5 in hepatic steatosis, autophagy, FAO and lipogenesis in FNDC5-/- mice, high-fat diet (HFD)-induced obese mice, and primary hepatocytes. Moreover, the therapeutic effects of FNDC5 were investigated. RESEARCH DESIGN AND METHODS FNDC5-/- mice and HFD-induced obese mice Male C57BL/6 WT and FNDC5-/- mice on a C57BL/6 background (Nanjing BioMedical Research Institute, Nanjing University, Nanjing, China) were used in the experiments. In HFD-induced obesity models, mice at the age of 4 weeks began to receive HFD (21.8 kJ/g, 60% of energy as fat) for 12 weeks. Normal chow diet (14.7 kJ/g, 13% of energy as fat) was used as control (12,17). Procedures were approved by the Experimental Animal Care and Use Committee of Nanjing Medical University and conformed to the Guide for the Care and Use of Laboratory Animal (NIH 4 Page 5 of 46 Diabetes publication, 8th edition, 2011). Mice were caged in an environment under controlled temperature and humidity with free access to water and food under a 12-h light/dark cycle. At the end of experiments, mice were fasted overnight, and then euthanized with an overdose of pentobarbital sodium (150 mg/kg, i.v.). FNDC5 overexpression in mice Mice at the age of 4 weeks began to receive control diet or HFD for 12 weeks. A single intravenous injection of recombinant lentivirus (1×108 TU/ml, 100 µl) expressing FNDC5 or EGFP vector was carried out at the end of the 6th week after the diet application (12). Acute experiments were performed 6 weeks after the lentivirus introduction. Knockdown of AMPK or Atg5 by siRNA in hepatocytes Primary hepatocytes were transfected with small interfering RNA (siRNA) for knockdown of AMPK or autophagy protein 5 (Atg5). Scramble siRNA was used as control. The sequences of siRNA were listed as follows. AMPK: sense CGGGAUCCAUCAGCAACUATT, antisense UAGUUGCUGAUGGAUCCCGAT (18). Atg5: CCGGCCTTGGAACATCACAGTACATCTCGAGATGTACTGTGATGTTCCAAG GTTTTTG. Primary hepatocyte isolation and cell culture Primary hepatocytes were isolated and cultured as previously described (13,19). Briefly, mice were anesthetized with pentobarbital (50 mg/kg, i.p.). HEPES buffer containing collagenase II (0.66 mg/mL) was perfusion via portal vein. Livers were 5 Diabetes Page 6 of 46 removed and excised aseptically. Cells were dispersed and filtrated. Hepatocyte suspensions were purified by centrifugation in Percoll adjusted to a density of 1.065 g/ml for 10 min at 50 g to reduce the amount of non-parenchymal cells. With this method the non-parenchymal cells is less than 1% (20). Cell viability was determined with trypan blue dye. Plates with cell viability greater than 95% were used for experiments. The hepatocytes were maintained in low glucose DMEM containing 10% FBS with penicillin (100 units/mL) and streptomycin (100 µg/mL) at 37°C in a 5% CO2 atmosphere. Monitor of autophagy Cells were transfected with tandem green fluorescent protein (GFP)-red fluorescent protein (RFP)-LC3 adenovirus (Hanbio, Shanghai, China) for 24 h according to the instructions. Cells were treated with amino acid starvation, rapamycin or chloroquine for 2 h to observe the autophagy flux. When autophagy inducts, both GFP and RFP are expressed as yellow dots representing autophagosomes after the images emerged. When autophagosomes fuse with lysosomes and form autolysosomes, the GFP degrades in an acid environment, but RFP–LC3 maintains showing as red dots (21). Oil red O staining and immunohistochemistry Livers were fixed in 4% neutral buffered formalin phosphate and then were embedded in paraffin or OCT compound, respectively. The tissues were subsequently sliced into 5-µm sections. Oil Red O staining was used to detect the lipid content in liver. For immunohistochemistry evaluation, liver sections were incubated with anti-p62 antibody (Abcam Ltd, Cambridge, UK) or anti-LC3B antibody (Cell signaling 6 Page 7 of 46 Diabetes Technology, Danvers, MA, USA). The anti-LC3B antibody showed stronger reactivity with LC3BII according to the manufacturer's instructions. Western blot Protein extracts