Overlapping Functions of Cdx1, Cdx2, and Cdx4 in the Development of the Amphibian Xenopus Tropicalis

DEVELOPMENTAL DYNAMICS 238:835–852, 2009

RESEARCH ARTICLE

Overlapping Functions of Cdx1, Cdx2, and Cdx4 in the Development of the Amphibian Xenopus tropicalis

Laura Faas and Harry V. Isaacs*

Using Xenopus tropicalis, we present the first analysis of the developmental effects that result from knocking down the function of the three Cdx genes present in the typical vertebrate genome. Knockdowns of individual Cdx genes lead to a similar range of posterior defects; compound Cdx knockdowns result in increasingly severe posterior truncations, accompanied by posterior shifts and reduction of 5؅ Hox gene expression. We provide evidence that Cdx and Wnt3A genes are components of a positive feedback loop operating in the posterior axis. We show that Cdx function is required during later, but not early stages of development, for correct regional specification of the endoderm and morphogenesis of the gut. Our results support the hypothesis that during amphibian development the overall landscape of Cdx activity in the embryo is more important than the specific function of individual Cdx proteins. Developmental Dynamics 238:835–852, 2009. © 2009 Wiley-Liss, Inc.

Key words: Cdx; Xenopus; Hox; caudal; mesoderm; endoderm; morphogenesis; wnt

Accepted 14 January 2009

INTRODUCTION (Brooke et al., 1998). In the vertebrate three germ layers in dynamic patterns lineage sequential genome duplication in the posterior of the developing body The Cdx family of homedomain tran- has led to cluster expansion and sub- axis (Gamer and Wright, 1993; Meyer scription factors has conserved func- sequent degeneration, such that the and Gruss, 1993; Marom et al., 1997; tions in the development of several typical vertebrate genome contains Pillemer et al., 1998; Reece-Hoyes et animal groups. The prototype of the Cdx family is the caudal gene, which the remains of four ParaHox gene al., 2002; Gaunt et al., 2003; Lohnes, is required for normal posterior devel- clusters but only three Cdx genes 2003). The expression patterns of the opment of Drosophila (MacDonald (Cdx1, Cdx2, and Cdx4). Only Cdx2 Cdx genes resemble that of the Hox and Struhl, 1986; Mlodzik and Ge- remains clustered with members of genes, in that all Cdx genes are typi- hring, 1987; Mlodzik et al., 1987). The the Pdx and Gsx classes (Ferrier et al., cally expressed in the posterior of the Cdx class, together with the Gsx and 2005; Illes et al., 2009). embryo but each individual Cdx gene Pdx classes, comprise the ParaHox Analysis of Cdx gene expression in exhibits a different anterior boundary family of homeobox genes. In the several vertebrate species, including of expression. This produces a nested cephalochordate amphioxus, the sin- mouse, chick, ﬁsh, and frog shows that set of Cdx gene expression, establish- gle representatives of each ParaHox Cdx genes are initially expressed during a gradient of Cdx activity along class are clustered, having a similar ing gastrula stages in overlapping do- the posterior axis (Marom et al., 1997; genomic organization to that of the mains in the mesoderm; subse- Pillemer et al., 1998). closely related Hox gene family quently, they are expressed in all Gene inhibition and overexpression

Additional Supporting information may be found in the online version of this article. Department of Biology, University of York, York, United Kingdom Grant sponsor: Wellcome Trust. *Correspondence to: Harry V. Isaacs, Area 11, Department of Biology, University of York, York, YO10 5YW, UK. E-mail: [email protected] DOI 10.1002/dvdy.21901 Published online 13 March 2009 in Wiley InterScience (www.interscience.wiley.com).

© 2009 Wiley-Liss, Inc. 836 FAAS AND ISAACS studies in several chordates including ascidians, fish, frogs, chick, and mouse have shown that the role of Cdx genes in posterior development has been conserved during evolution (Sub- ramanian et al., 1995; Pownall et al., 1996; Epstein et al., 1997; Katsuyama et al., 1999; Bel-Vialar et al., 2002; van den Akker et al., 2002; Davidson et al., 2003; Lohnes, 2003; Chaweng- saksophak et al., 2004; Shimizu et al., Fig. 1. Inhibition of Cdx protein translation by morpholino oligos (MOs). A–C: Western blots 2005; van Nes et al., 2006). Cumula- showing that the Cdx1, Cdx2, and Cdx2 MOs but not the standard control MO or the corresponding tive evidence suggests that Cdx fac- five base mismatch control MOs block the translation of myc-epitope tagged Cdx target proteins tors act as transducers of positional in embryos. Early cleavage stage embryos were injected with 10 pg of Cdx-myc mRNA or ϩ information by regulating the bound- co-injected with 10 pg of Cdx-myc mRNA 10 ng of standard control morpholino (cMO) or 10 ng of the corresponding translation blocking MOs (Cdx1 MO, Cdx2 MO, or Cdx4) or 10 ng of the aries of Hox gene expression domains corresponding five mismatch MOs (Cdx1-mmMO, Cdx2-mmMO, or Cdx4-mmMO). Data are pre- (Charite et al., 1998; van den Akker et sented for the set-1 morpholinos. al., 2002; Gaunt et al., 2004, 2008). In keeping with their regulatory role during axis development, Cdx logue of amniote Cdx2, and Xcad2, stages of development. Data in this proteins are crucial factors involved in and Xcad3 are the orthologues of Cdx1 study support the hypothesis that, anteroposterior patterning of the di- and Cdx4, respectively. during early amphibian development, gestive tract. The regulation of gene In the present study, we have un- individual Cdx genes have overlap- expression in the digestive tract by dertaken a systematic analysis of the ping function and that in a given re- Cdx proteins in vertebrates is well developmental effects resulting from gion of the embryo, it is the overall documented (Beck, 2004; Guo et al., single and compound knockdown of level of Cdx activity that is relevant, 2004). Furthermore, Cdx2 misexpres- the three Cdx family members in the rather than the specific function of in- sion has been implicated in homeotic frog Xenopus tropicalis using transla- dividual Cdx proteins. anterior to posterior transformation tion blocking antisense morpholino in the gut epithelium (Mutoh et al., oligos (MOs). Our study is the first to RESULTS 2002; Silberg et al., 2002), indicating a present data on the developmental ef- role for Cdx genes in establishing re- fects that result from knocking down Antisense Morpholino Oligos gional identity. the activity of the three Cdx genes That Block Cdx Translation Single and double gene knockout present in the typical vertebrate ge- Antisense morpholino oligos (AMOs) and knockdown experiments in vari- nome. targeted to the initiating AUG ous species support roles for Cdx gene Data in this investigation show that and/or the 5Ј UTR of the Xenopus function in anteroposterior patterning compound knockdown of the three Xe- tropicalis Cdx1, Cdx2, and Cdx4 mR- of the main body axis. However, estab- nopus Cdx genes gives rise to a highly NAs were tested for their ability to lishing a clear picture of the overall penetrant, severe truncation of the block translation of myc-epitope role of the Cdx family in these pro- posterior axis. Similar ranges of devel- tagged Cdx proteins (Fig. 1). A stan- cesses is difficult because individual opmental abnormalities are seen dard control MO (cMO) has little ef- Cdx genes exhibit significant overlap when each individual Cdx gene is fect on the efficiency of Cdx protein of expression during early develop- knocked down, indicating that the translation in whole embryos. In ment. It is, therefore, likely that there Cdx genes have overlapping functions contrast, the Cdx1, Cdx2, and Cdx4 is some functional redundancy among in posterior axial development. How- MOs (set-1 in the Experimental Pro- the Cdx genes and that some degree of ever, the increased severity of the phe- cedures section) efficiently block compensation may occur in the event notypes in the compound knockdowns translation from the corresponding of single and double gene deficiencies. argue in favor of a cooperative effect of target mRNA, whereas MOs with se- This underlines the importance of un- Cdx genes on posterior patterning. quences differing from the transla- dertaking studies involving inhibition We present data indicating that the tion blocking MOs by five bases of the activity of the full complement amphibian Cdx genes are components (mmMOs) have relatively little effect of Cdx genes present in model verte- of gene regulatory pathways, involv- on translation from the target mR- brate organisms. ing Wnt ligands and 5Ј Hox genes, NAs. A second set of translation In Xenopus the three Cdx genes that are required for morphogenesis blocking Cdx MOs (set-2 in the Ex- were originally designated Xcad1, and patterning in the posterior of the perimental Procedures section) also Xcad2, and Xcad3 (Pillemer et al., main body axis during postgastrula inhibit translation of their respec- 1998). However, for the sake of consis- stages. In addition, we find a require- tive targets but less efficiently (data tency, we have adopted the human ment for Cdx function in the normal not shown). Unless stated otherwise and mouse nomenclature for the frog morphogenesis and regional specifica- the set-1 Cdx morpholinos were used Cdx genes. Thus, Xcad1 is the ortho- tion of the amphibian gut during later in all subsequent experiments. Cdx KNOCKDOWN IN Xenopus tropicalis 837

Analysis of the Cdx similar profiles of phenotypes; how- Cdx activity plays a critical role in Knockdown Phenotype ever, the triple Cdx knockdown re- regulating axial development. sults in a much higher proportion of As another test of the specificity of Injection of the set-1 Cdx1, Cdx2, and the more severe type 3 phenotype. Tri- the knockdown effects, five base mis- Cdx4 MOs, individually or collec- ple Cdx knockdown using the set-2 match MOs were injected into em- tively, in the range of 10 ng to 20 MOs produced similar effects on axial bryos. At a given concentration, five ng/embryo, results in highly pene- development but with reduced num- mismatch MOs give far lower num- trant effects on posterior axial devel- ber of type 3 embryos (Fig. 2C), con- bers of abnormal embryos than do the opment (Fig. 2A–C, and data not sistent with their reduced efficiency at translation blocking MOs. Co-inject- shown). In contrast developmental ab- blocking target Cdx protein transla- ing a combination Cdx1, Cdx2, and normalities occur at low frequency in tion (Fig. 1, and data not shown). Cdx4 MOs results in 67% (n ϭ 87) uninjected embryos or embryos in- abnormal embryos, compared to 5% jected with the standard control MO Specificity of the Cdx abnormal for uninjected stage control (5% and 10%, respectively, in a typical embryos (n ϭ 137). In contrast, co- experiment). Consistently, the triple Knockdown Phenotype injecting the same amounts of the cor- knockdown using the second set of As an important test of the specificity of responding mismatch MOs results in Cdx MOs (set-2), results in a similar knockdown MOs, we show that the mu- just 12% (n ϭ 128) abnormally devel- range of posterior abnormalities (Fig. tant Cdx protein Xcad-VP16 rescues the oping embryos. This is similar to the 2D, and data not shown). effects on axial development resulting approximately 10% of abnormal em- Injection of more than 20 ng of the from Cdx knockdown. XcadVP16 con- bryos typically observed after injec- triple Cdx knockdown MO combina- sists of an amino-terminal fusion of the tion of the standard control MO (Fig. tion results in embryos with highly transcriptional activation domain from 2C, and data not shown). truncated posterior structures by tail the viral VP16 protein to the DNA bind- bud stages (Supp. Fig. S1, which is ing domain of Xenopus laevis Cdx4 pro- Tissue Organization in Cdx available online). However, high con- tein (Isaacs et al., 1998). Xcad-VP16 Knockdown Embryos centrations of the Cdx MOs results in mimics the activity of native Cdx pro- reduced survival of embryos into later tein but the 5Ј end of the Xcad-VP16 Our data indicate that injection of the tail bud stages, accompanied by de- mRNA is not targeted by the Cdx trans- triple Cdx knockdown MO combina- generation of the endodermal mass. lation blocking MOs. tion in the range 20 to 40 ng per em- Figure 2A shows the phenotypes of Figure 2D shows that injection of 5 bryo produces a highly penetrant phe- control embryos and embryos injected pg of XcadVP16 mRNA produces an notype. Based upon these findings, in with Cdx MOs at larval stage 41. Of anterior truncation phenotype, simi- subsequent experiments, we used in- interest, all single or compound lar to that previously reported for over- jection of these amounts or pro rata knockdown embryos showed a similar expression of Xenopus laevis Cdx4 amounts for injection into individual spectrum of posterior truncations. In (Isaacs et al., 1998). Injection of cells. Due to the endodermal degener- each case the total amount of MO in- XcadVP16 mRNA in the 10- to 15-pg ation observed in tail bud embryos injected is the same, with equal contri- range produces a very strong phenotype jected with 40 ng of the triple Cdx bution from each constituent MO. To characterized by a vestigial dorsal axis knockdown MO cocktail, injections in facilitate comparison between experi- (data not shown). Injecting a combina- experiments requiring culture to later ments, we have classified the range of tion of Cdx1, Cdx2, and Cdx4 MOs re- tail bud stages were limited to 20 ng. knockdown phenotypes at swimming sults in the typical, highly penetrant To control for nonspecific effects that larval stage 41 into types 1, 2, and 3 posterior truncation phenotype (100%, might arise from the injection of a (Fig. 2B). Type 1 embryos display a n ϭ 32). However, co-injection of Xcad- given mass of MO, in experiments mild shortening of the axis and a “pi- VP16 mRNA, in the 5- to 10-pg range, comparing the effects of single, dou- geon chested” appearance; develop- with the Cdx MOs rescues axial abnor- ble, or triple knockdowns, the total ment of the head is relatively normal. malities in a dose dependent manner amount of MO injected was divided Type 2 embryos exhibit a shortened, (85%, n ϭ 72). The phenotype of em- equally between the constituent MOs. curved, or kinky axis and mild ante- bryos co-injected with the Cdx MOs and We undertook histology on type 2 rior defects, including foreshortened 15 pg of XcadVP16 mRNA exhibit mild and type 3 embryos to analyze the ef- head and reduction of the eye size. anterior truncations, similar to that fects resulting from triple Cdx knock- Type 3 embryos show a very short, produced by the injection of low doses of down on the differentiation and pat- curved axis, severe reduction of tail XcadVP16 mRNA alone. terning of the major tissues. The outgrowth, and anterior defects. Of interest, this anterior truncation length of the main body axis is se- Figure 2C shows the proportions of phenotype is mild compared with that verely reduced in the knockdown em- type 1, 2, and 3 phenotypes at larval resulting from injection of 15 pg of bryos; despite this, within the remain- stage 41 in control uninjected em- XcadVP16 mRNA alone (data not ing vestigial axis the organization of bryos, control MO injected embryos shown). These data indicate that the the major axial tissues (notochord and and embryos injected with the Cdx observed effects in this rescue experi- neural tube) is relatively normal (Fig. MOs used in this study. As mentioned ment result from integration of Cdx 3). Paraxial tissues, such as the earlier, single and double Cdx knock- activity present within the embryo somites, are present and exhibit seg- downs using the set-1 MOs result in and suggest that the overall level of mentation similar to that seen in con- 838 FAAS AND ISAACS

Fig. 2. The phenotype of Cdx knockdown embryos. A: Single and triple knockdowns of Cdx1, Cdx2, and Cdx4 give rise to a similar range of phenotypes. Single knockdown embryos were injected with 20 ng each of Cdx1-A morpholino oligo (MO), Cdx2-A MO, or Cdx4-A MOs. Triple knockdown embryos were injected with a 20 ng total of the set-1 Cdx1, Cdx2, Cdx4 MOs. B: The phenotypes of larval stage 41 control embryos and embryos exhibiting type 1, 2, and 3 axial defects produced by the knockdown of Cdx function. C: A bar chart showing the proportions of type1, 2, and 3 axial defect embryos in control uninjected embryos, standard control morpholino injected embryos and embryos injected with combined or single set-1 Cdx or set-2 Cdx translation blocking morpholinos. In each case, the total mass injected is made up of equal quantities of each contributing MO. Total injected quantities and n values for each group are indicated on the chart. D: XcadVP16 mRNA rescues the compound Cdx1, Cdx2, and Cdx4 knockdown phenotype. Embryos were injected with a 20 ng of total of the Cdx1, Cdx2, and Cdx4 MO, together with the indicated quantities of XcadVP16 mRNA and cultured until larval stage 41. Cdx KNOCKDOWN IN Xenopus tropicalis 839 trols (Fig. 3A–C). However, we note (Pownall et al., 1996; Epstein et al., Pillemer et al., 1998; Reece-Hoyes et that the typical three ventricle organi- 1997; Isaacs et al., 1998). Complemen- al., 2002). The nested expression pat- zation of forebrain, midbrain, and hind- tary experiments using antisense terns of HoxC genes from paralogue brain of the anterior nervous system is RNA mediated Cdx1 knockdown or groups 8, 10, and 11 are illustrated in lost and is reduced to a single enlarged overexpression of an antimorphic Figure 5B, where HoxC8 has the most ventricle in the high grade type 3 em- Cdx4 protein result in reduced poste- anterior and HoxC11 the most poste- bryos (Fig. 3C). Another striking fea- rior Hox gene expression (Epstein et rior boundary of expression. ture apparent in type 3 embryos is gross al., 1997). However, the effects on Hox Analysis of posterior Hox gene ex- enlargement of the gut cavity relative to expression resulting from compound pression at the late neurula stage re- control embryos (Fig. 3Ci). Cdx inhibition, as well as the role of veals that bilateral, compound knock- each Cdx protein, remains unclear. down of Cdx1, 2, and 4 leads to down- The present study addresses this is- regulation in the expression levels Overlapping Cdx Function sue by examining the effects on the and/or a posterior shift in the bound- expression of several posterior Hox There is good evidence that the overlap- aries of expression in the neural tube ping expression and activity of Cdx pro- genes (paralogue groups 7 to 11) in and mesoderm. For example, distinct teins means that some redundancy in single and compound Cdx knockdown posterior shifts in expression bound- function exists between Cdx family embryos (Fig. 5). aries in the posterior mesoderm and members (Davidson and Zon, 2006; van neural tube are apparent with HoxC8, den Akker et al., 2002). We investigated this by undertaking the phenotypic res- Effects of Cdx Knockdown HoxC10, and HoxC11 in Cdx knock- cue of double knockdown embryos by on the Initial Expression of down embryos (Fig. 5B). In the case of the third nontarget Cdx protein. Posterior Hox Genes HoxA11, both the expression levels Figure 4 shows the typical anterior and the anterior boundary of expres- The onset of expression from paral- truncation phenotype caused by over- sion in mesoderm and neural tube are ogue group 7 and 9 Hox genes com- expressing X. laevis Cdx4 (Isaacs et dramatically affected by compound mences in the late gastrula in the al., 1998). Rescue of the Cdx1ϩ2MO Cdx knockdown (Fig. 5B). blastopore region and posterior neural phenotype with X. laevis Cdx4 mRNA plate, regions that overlap with Cdx increases the number of normal em- expression (Pillemer et al., 1998; Re- bryos from 25% (n ϭ 29) to 43% (n ϭ Cdx Inhibition and the Four ece-Hoyes et al, 2002). Preliminary ex- 28). Similar effects were observed in Hox Gene Clusters periments indicated that standard the double Cdx2ϩ4 knockdown res- control MO injections have no effect To determine whether Cdx function is cued with X. laevis Cdx1 mRNA. In- on Hox gene expression (data not required for the expression of paralo- jection of Cdx2 and Cdx4 MOs results shown). In contrast, bilateral, com- gous genes in the four different Hox in a mild but penetrant effect on pos- pound knockdown of Cdx1, Cdx2, and clusters we examined the effects of terior axial development. However, Cdx4 greatly down-regulates HoxA9 Cdx inhibition on the expression of co-injection of Cdx1 mRNA increases expression levels, as well as its lateral paralogue group 9 genes from the the number of normal embryos from and anterior boundaries in both the 5% (n ϭ 37) to 40% (n ϭ 40). These HoxA, HoxB, HoxC, and HoxD clus- neural plate and posterior mesoderm ϩ ϩ experiments demonstrate that raising ters. Figure 5C shows that Cdx1 2 4 at the late gastrula stage (Fig. 5A). the level of a single Cdx protein can knockdown causes an overall reduc- Similarly, the size of the HoxB9 ex- compensate for knockdown in the tion in the expression domains of all pression domain in the neural plate is function of two other Cdx genes. Cdx four Hox9 paralogue genes. The poste- reduced, in Cdx triple-knockdown em- Regulation of Hox Gene Expression rior shift of HoxA9, HoxC9, and bryos (Fig. 5A). In the case of HoxB9, Functional studies in several verte- HoxD9 expression boundaries is evi- the most obvious change is a reduction brate models, including chick, mouse, dent in the neural tube and meso- in the lateral extent of its expression and ﬁsh, indicate that Hox genes are derm. In contrast to the changes ob- boundary. These data indicate that the targets of Cdx regulation and interfer- served in the late gastrula (Fig. 5A), normal expression of posterior Hox ence with normal Hox gene expres- we do not see reduction in the lateral genes in late gastrula/early neurula sion, in part, accounts for the observed extent of HoxB9 expression in the stage embryos requires Cdx function. derangement of posterior develop- neural tube at this stage. However, as ment resulting from Cdx inhibition with HoxA9, HoxC9, and HoxD9, (Subramanian et al., 1995; Bel-Vialar Effects of Cdx Knockdown there is a posterior shift in the HoxB9 et al., 2002; van den Akker et al., on Hox Expression in the neural tube expression boundary. 2002; Davidson et al., 2003). Late Neurula Previous studies in Xenopus laevis support a role for Cdx regulation of At late neurula stages both Cdx and Hox Gene Expression in Hox genes. Cdx overexpression up- posterior Hox genes are expressed Single and Double Cdx regulates the expression of posterior with distinct anterior boundaries Knockdown Embryos Hox genes (paralogue groups 6 to 9) within the trunk region of the main and results in anterior shifts in limits body axis in both the mesoderm and Having seen that triple Cdx knock- of expression along the main body axis the neural tube (Godsave et al., 1994; down alters 5Ј Hox gene expression, 840 FAAS AND ISAACS

Fig. 3. Histology of Cdx phenotype embryos. Despite shortening of the body axis the main axial and paraxial tissues are present. A–C: Sagittal sections of control, type 2, and type 3 embryos at larval stage 41, respectively. The insets Ai, Bi, and Ci are transverse sections at the indicated axial level. Note the disorganized structure of the anterior central nervous system and enlarged gut cavity in Type 3 embryos. fb, forebrain; gc, gut cavity; hb, hindbrain; mb, midbrain; nt, neural tube; ntc, notochord; sm, somite. Red asterisk indicates enlarged brain ventricle.

Fig. 4. Overlapping Cdx function. The phenotype of double Cdx knockdown embryos at larval stage 41 can be rescued with a third non- targeted Cdx protein, indicating overlapping function between amphibian Cdx family members. Cdx1ϩ2 knockdown embryos (20 ng of MO total dose) were rescued with the indicated amounts of Cdx4 mRNA. Cdx2ϩ4 double knockdown embryos (20 ng of MO total dose) were rescued with Cdx1 mRNA.

Fig. 3.

Fig. 4. Cdx KNOCKDOWN IN Xenopus tropicalis 841 we were interested to compare the ef- Analysis of Gastrulation in rounded, nonelongated appearance at fects on Hox expression resulting from Cdx Compound Knockdown late neurula stage 18. Treatment with single and double Cdx knockdowns. Embryos activin or FGF leads to elongation of Expression of HoxA7 and HoxD10, the animal caps explants. However, which preliminary data indicated are Our data and previous studies indi- MO-mediated knockdown of Cdx func- strongly affected by Cdx inhibition, cate widespread effects on posterior tion in the animal caps does not in- were analyzed in embryos injected Hox gene expression in response to hibit the mild elongation induced by unilaterally with Cdx MOs. For this Cdx gene inhibition. However, at FGF or the more dramatic elongation type of analysis, unilateral injections present it is unclear whether the ob- behavior induced by activin treat- were performed to facilitate visualiza- served posterior truncation pheno- ment. We note that the extrusion of tion of boundary shifts resulting from types resulting from Cdx inhibition in yolky cells from one end of the highly Cdx knockdown relative to the control vertebrate embryos can be attributed polarized structures induced by ac- uninjected contralateral side. to effects on Hox expression or indi- tivin treatment is reduced by Cdx Figure 5D shows that triple Cdx cates an independent role for Cdx knockdown suggesting that there are knockdown markedly reduces HoxA7 function in posterior morphogenesis some effects on morphogenetic activity. expression in the posterior neural tube (for discussion, see van den Akker et However, our data indicate that inhibi- and results in a posterior shift in the al., 2002). Given that Xenopus Cdx tion of Cdx activity does not have major boundary of HoxD10 in the neural tube. genes are expressed within the meso- effects on the convergent extension Cdx knockdown also leads to down-reg- derm during gastrulation, it is possi- movements that drive the elongation of ulation and posterior shifts in the ex- ble that they might be involved in reg- dorsal mesodermal tissues during gas- pression boundaries of HoxA7 and ulating germ layer specification and trula and neurula stages. gastrulation movements (Pillemer et HoxD10 within the posterior mesoderm. al., 1998; Reece-Hoyes et al., 2002). We find that knockdown of individ- Germ Layer Specification in We analyzed late gastrula knock- ual Cdx genes has less effect on the Cdx Knockdown Embryos down embryos to investigate whether expression of these genes than does the axial defects observed in Cdx We then investigated the effect of Cdx the triple knockdown (Fig. 5D). Uni- knockdowns are related to defects in knockdown on the specification of the lateral Cdx4 knockdown has the movements of the germ layers during germ layers by analyzing the expres- strongest effects, causing a posterior gastrulation. Figure 6A shows that sion several germ layer markers. The shift of HoxA7 expression in the neu- the anterior extent of the archenteron T-box gene brachyury is a key regula- ral tube and inhibition of HoxD10 in is similar in control and Cdx knock- tor of mesoderm specification in verte- the posterior mesoderm, relative to down embryos after closure of the brates (Showell et al., 2004). The eve- the uninjected contralateral side. Cdx2 blastopore at the end of gastrulation. related homeobox gene Xhox3 is knockdown results in a slight posterior This indicates that, at the end of gas- expressed in ventrolateral mesoderm shift of HoxA7 in the neural tube but trula stages, no major abnormalities and has been implicated in the speci- little effect on HoxD10 expression, in the cell movements that drive invo- fication of ventroposterior mesoderm whereas Cdx1 knockdown has little ef- lution and elongation of dorsal axial in Xenopus (Ruiz i Altaba and Melton, fect on the expression of either HoxA7 tissues are apparent. In the specimens 1989). The HMG-box transcription or HoxD10 expression. We note that the presented, the blastocoel is somewhat factor Sox17b is a key regulator of severity of the effect resulting from in- smaller in the knockdown embryo, endoderm specification (Hudson et al., dividual Cdx knockdown is related to which perhaps suggests that morpho- 1997). Figure 6C shows that Cdx the anterior boundary of expression for genetic activity is not completely nor- knockdown does not interfere with the that gene. Thus knockdown of Cdx4, mal in Cdx knockdown embryos. How- early expression of these genes in gas- which has the most anterior boundary ever, we note that, even in control trula stage embryos and, therefore, in- of expression, has the most effect on embryos, the timing of blastocoel dis- hibition of Cdx function does not block Hox expression, whereas Cdx1 has the placement and the size of the arch- the initial specification of the meso- most posterior boundary of expression enteron varies considerably at the end derm or endoderm. and its knockdown has least effect on of gastrulation. It is important to note that our anal- Hox expression. The typical convergent extension ysis has focused on gene expression and As is the case with HoxD10, individ- movements that occur during the cell movements in the mid-to-late gas- ual knockdown of either Cdx1 or Cdx2 elongation of axial mesoderm in gastrula phase and we cannot exclude the has little effect on HoxA9 expression trula and neurula stages can be mim- possibility of effects on cell movements (Fig. 5E). However, the double Cdx1 icked by animal cap explants treated and gene expression during earlier gas- and Cdx2 knockdown leads to some with mesoderm inducing growth fac- trula stages following Cdx knockdown. down regulation of HoxA9 expression in tors such activin and fibroblast the posterior neural tube (Fig. 5E), but growth factors (FGFs). Axial and Paraxial less dramatically than the triple Cdx We investigated whether Cdx Mesoderm in Neurula Stage knockdown (Fig. 5A,C). Taken together, knockdown interferes with growth Cdx Knockdown Embryos these data suggest that the overall level factor-induced convergent extension of Cdx gene function is critical for pos- movements (Fig. 6B). Untreated ani- As we have seen a major aspect of the terior Hox gene expression. mal cap explants show the typical Cdx knockdown phenotype is the fail- 842 FAAS AND ISAACS

Fig. 5. Cdx KNOCKDOWN IN Xenopus tropicalis 843

derm. Figure 7A shows that in embryos unilaterally injected with the Cdx1, Cdx2, and Cdx4 MO combination expression of MyoD and brachyury is unaffected relative to the contralateral uninjected side, indicating that the reduced posterior axial extension of the posterior mesoderm is not sim- ply due to inhibition of paraxial and axial mesoderm formation during neurula stages. Expression of markers of ventral and ventrolateral mesoderm was also examined in Cdx knockdown embryos (Fig. 7B). Scl, which codes for a basic helix–loop–helix (bHLH) transcription factor, is a marker of the haemangioblast lineage in the ventral mesoderm (Mead et al., 1998). Vent2 codes for a homeoprotein and is a marker of ventroposterior mesoderm (Onichtchouk et al., 1998). We ﬁnd that Cdx inhibition results in a considerable reduction of both markers. Scl expression is down-regulated in the region giving rise to the ventrally lo- cated blood islands, and Vent2 expression is also reduced in the lateral and posterior mesoderm around the closed blastopore by Cdx knockdown.

Fig. 6. Effect of Cdx knockdown during gastrulation. A: The major morphogentic movements of gastrulation are not affected in Cdx knockdown embryos. Sagittal sections are shown of a control Cdx Regulation of Wnt Gene embryo and an embryo injected with a total dose of 40 ng of the triple Cdx1ϩ2ϩ4 MO combination at late gastrula stage 13 (anterior to the left, dorsal to the top). ar, archaenteron; ntc, prospective Expression notochord; blc, blastocoel; bp, blastopore; end, endoderm. B: Growth factors induce elongation in Canonical Wnt signaling by ligands animal cap explants from Cdx knockdown embryos. Animal hemisphere explants were taken at mid-blastula stage 8 from uninjected embryos and embryos injected with 40 ng of Cdx1, Cdx2, and such as Wnt3A play key roles in spec- Cdx4 MOs and cultured to neurula stage 18. Growth factor treatment was with 10 U/ml recombi- iﬁcation and patterning the verte- nant FGF4 or 50 U/ml recombinant activin-A (act). C: The expression of early germ layer markers brate posterior axis (Takada et al., is unaffected in Cdx knockdown embryos. Expression is shown of the endodermal marker Xsox17b 1994). Noncanonical Wnt signaling is and the mesodermal markers Xhox3 and brachyury (Xbra) in triple Cdx knockdown embryos (40-ng total dose) and controls (posterior views, dorsal to the top). Xbra, Xhox3, and Xsox17b embryos are also required for axial development; at gastrula stages 11.5, 12.5, and 11, respectively. ligands such as Wnt11 and Wnt5A are involved in regulating axial morphogenesis through the planar cell polar- ure of posterior axis extension, to- tion of these tissues types in postgas- ity signaling pathway (Wallingford, gether with the loss of posterior tissue trula stages, using brachyury as a 2004). Therefore, interference with ca- types, including paraxial (somites) marker of posterior and axial meso- nonical or noncanonical Wnt signaling and axial mesoderm (notochord). We derm during neurula stages and pathways provides a conceivable mech- have investigated the early speciﬁca- MyoD as a marker of paraxial meso- anism that might underlie the derangement of posterior axial development that results from Cdx inhibition. Our results show that the expres- Fig. 5. Effects of Cdx knockdown on Hox gene expression. Cdx function is required for the normal sion domains of Wnt11 in the dorsal expression of multiple posterior Hox genes. A–E: Whole-mount in situ hybridizations of the midline, ventral region, or posterior indicated Hox genes. A: Late gastrula stage 13 embryos, and B–E show late neurula stage 20 axis remain unaffected (Fig. 7C) in embryos. A–C: Embryos were injected bilaterally with 20 ng of Cdx1, Cdx2, and Cdx4 MOs. A: early neurula stage embryos. In con- Panels with HoxA9 shows posterior views with dorsal to the top. Panels with HoxB9 show dorsal views with anterior to the top. Black bars indicate lateral extent of expression domain in neural tube. trast, normal Wnt3A expression in the B: Lateral views with anterior to the left. C: Dorsal views, anterior to the left. D: Representative posterior paraxial mesoderm is mark- control embryos and embryos injected unilaterally with 10 ng of Cdx1, Cdx2, Cdx4 MOs, or the edly down-regulated in Cdx knock- triple Cdx MO combination; injected side is indicated with a red asterisk (left panels are dorsal down embryos and the size of the views with anterior to the left, and right panels are posterior views with anterior to the top. E: A control uninjected embryo and embryos injected bilaterally with 20 ng of Cdx1, Cdx2, or the Cdx1 Wnt5A domain is also considerably re- and Cdx2 combination (dorsal views with anterior to the left). Black arrows indicate anterior duced (Fig. 7D). Conversely, increas- boundary of expression within the neural tube on injected and contralateral uninjected sides. ing Cdx activity by overexpression of 844 FAAS AND ISAACS

Fig. 7. Cdx KNOCKDOWN IN Xenopus tropicalis 845

XcadVP16 massively up-regulates the bryo. However, it has been reported ification. Therefore, we investigated the expression of both Wnt3A and Wnt5A that cell re-arrangements in ventral tis- effects of Cdx knockdown on endoder- in both whole embryos and animal cap sues also contribute to axial elongation mal gene expression during later devel- explants relative to controls (Figures in postneurula embryos (Larkin and opment. To discriminate the effect of 7E and F, respectively). Danilchik, 1999). We investigated the Cdx knockdown on endoderm develop- It has been reported that Wnt3A effect of Cdx knockdown on the elonga- ment from dorsal axial patterning, Cdx regulates the expression of both Cdx1 tion of dorsal and ventral explants pre- knockdown MOs were targeted to the and Cdx4 during zebrafish and mouse pared at mid-neurula stage 16 and then presumptive endoderm by injecting into development (Ikeya and Takada, cultured to early tail bud stage 27. We vegetal pole region. 2001; Prinos et al., 2001; Shimizu et find that Cdx knockdown significantly The expression of darmin, vito, and al., 2005; Pilon et al., 2006). Our data inhibits post-neurula elongation in both Xsox17b was analyzed at different neu- show that increasing Cdx activity in dorsal and ventral explants (two exper- rula and tail bud stages. Vito encodes a the embryo up-regulates Wnt3A ex- iments, dorsal P Ͻ 0.0001 and ventral sodium solute transporter protein expression, raising the possibility that P Ͻ 0.0001; Fig. 8A,B). Elongation of pressed in the ventral midgut at tail Wnt3A and Cdx genes are components these explants is a distinct phenomenon bud stages (Costa et al., 2003), whereas of a positive feedback loop operating from tail bud extension, which does not darmin/endocut encodes a secreted during the development of the posterior commence until after stage 27 (Larkin metalloproteinase expressed in the axis. Further support for this hypothe- and Danilchik, 1999). It is important to endoderm and early midgut (Costa et sis is provided by Figure 7G,H, which note that tail bud growth is also abnor- al., 2003; Pera et al., 2003). At early shows that Cdx1 overexpression up-reg- mal in Cdx knockdown embryos; thus, neurula stages, the expression of these ulates Wnt3A expression and overex- the axial reduction that characterizes endodermal markers was not affected pression of Wnt3A up-regulates Cdx1 the Cdx knockdown phenotype results in triple Cdx knockdown embryos (Fig. expression in animal cap explants. from effects on both morphogenesis in 9A). The expression patterns of all three the neurula to tail bud stage, and sub- markers are also little affected at late neurula stages (Fig. 9B). Together, our Cdx Knockdown Inhibits sequent tail bud outgrowth. findings show that expression of the Ventral and Dorsal early regulator of endoderm specifica- Elongation in the Neurula to Effects of Cdx Knockdown on tion Xsox17b is unaffected in Cdx Tail Bud Period Endoderm Gene Expression knockdown embryos from early gastrula through late neurula stages, and As previously discussed, the severe ax- The development of the endoderm de- that regional markers, such as darmin ial truncations resulting from Cdx rived structures is clearly abnormal in and vito, are also unaffected, indicating knockdown are unlikely to result from Cdx knockdown embryos. However, the that the early endoderm is specified and effects on morphogenetic activity dur- expression of the early endodermal regionalized. In contrast, by late tail ing gastrula stages. During gastrula marker Sox17b is unaltered in gastrula bud/larval stages the expression of and neurula stages, the dorsal axial tis- stage Cdx knockdown embryos, sug- darmin is down-regulated indicating sues are the main drivers of morphoge- gesting that the observed abnormalities that at these later stages the develop- netic movements in the amphibian em- are not due to deficient endoderm spec- ment of the endoderm is abnormal (Fig. 9C). These findings are in keeping with the reported Cdx expression in the gut; Cdx1 and Cdx2 are not detected at high Fig. 7. Effects of Cdx knockdown during post-gastrula stages. All samples are Xenopus tropicalis levels in the posterior endoderm until except (F–H) which are Xenopus laevis explants, which were used because their bigger size allowed tail bud stages (Pillemer et al., 1998; easier of processing for in situ hybridization. A: Expression of the trunk/posterior mesodermal Chalmers et al., 2000; Reece-Hoyes et markers MyoD and brachyury (Xbra) is unaffected in Cdx knockdown embryos at late neurula stage al., 2002). 20. Embryos were injected unilaterally with 10 ng of combined Cdx1, Cdx2, and Cdx4 morpholino oligos (MOs); red asterisk indicates injected side. Left and middle panels are dorsal views with Both Cdx1 and Cdx2 have been im- anterior to the left; right panel is a posterior view with dorsal to the top. B: Expression of the ventral plicated in regulating regional iden- mesodermal markers Scl and Vent2 is down-regulated in Cdx MO knockdown embryos at stage 20. tity along the anteroposterior axis of Embryos were injected bilaterally (Scl) or unilaterally (Vent2) with 10 ng per blastomere of the triple the developing gut (Guo et al., 2004). Cdx MO combination at the two-cell stage. Left panels are ventral views with anterior to the left; To address the role of these Cdx genes middle panels are dorsal views with anterior to the left and right panels are posterior views with dorsal to the top. Red asterisk indicates the injected side. C: Wnt11 expression is unaffected in in regional specification of the am- triple Cdx knockdown embryos (40-ng total dose) at the early neurula stage 14. Top panels are phibian gut during later development, dorsal views with anterior to the left, and bottom panels are ventral views with anterior to the left. we analyzed the effects of single and D: Posterior expression of Wnt5A and Wnt3A is down-regulated in triple Cdx knockdown embryos compound Cdx1 and Cdx2 knock- (40-ng total dose) at early neurula stage 14. Dorsal and posterior views are indicated. Dorsal views with anterior to the left and posterior views with dorsal to the top. Black arrows indicate posterior downs on the expression of two gut paraxial mesoderm. E: Increasing Cdx activity in embryos up-regulates Wnt3A and Wn5A expres- regional markers, intestinal fatty acid sion. Embryos were injected with15 pg Xcad-VP16 mRNA. Dorsal views anterior to the left. F: binding protein (IFABP) and Sox2. IF- Increasing Cdx function in animal caps up-regulates Wnt3A and Wnt5A expression. Animal cap ABP is expressed in the small intes- explants from embryos injected with 50 pg of Xcad-VP16 mRNA were cultured until early neurula stage 14. G: Wnt3A expression is upregulated in animal caps from embryos injected with 250 pg tine, whereas Sox2 is expressed in a of Cdx1 mRNA. (H) Cdx1 expression is up-regulated in animal caps from embryos injected with 50 region of the anterior gut including pg of Wnt3A mRNA. the esophagus and stomach (Chalm- 846 FAAS AND ISAACS

Fig. 8. Effects of Cdx knockdown on neurula stage explants. A: Cdx knockdown inhibits the elongation of dorsal and ventral explants at control stage 27. Explants were taken at neurula stage 16 from uninjected embryos and embryos injected with a total 40 ng of combined Cdx1, Cdx2, and Cdx4 morpholino oligos (MOs). B: A bar chart showing the average length of dorsal and ventral explants of Cdx knockdown and control embryos at control stage 28 (mean Ϯ SE; n values per group are indicated on the chart).

Fig. 9. Effect of Cdx knockdown on endoderm development. A–C: ers et al., 2000). Injection of control Whole-mount in situ hybridizations to the indicated endodermal markers MO has no effect on IFABP or Sox2 from neurula to tadpole stages. A,B: Show that expression of the expression. Figure 10A–H shows IF- endodermal marker genes Darmin, Vito, and Sox17b is unaffected in (A) early neurula stage 14 embryos (ventral views, anterior to the left and (B) ABP and Sox2 expression patterns in late neurula stage 20 embryos (lateral view, anterior to the left) injected control and Cdx knockdown, larval with a total of 20 ng of Cdx1, Cdx2 and Cdx4 MOs into the four vegetal stage 41 embryos. As normal coiling of hemisphere cells at the eight cell stage. C: Darmin expression is down- the gut results in distinct, asymmetric regulated in Cdx knockdown embryos at later stages of development. gut morphology, including displace- Lateral views of tail bud stage 32 (left panels) and tadpole stage 42 (right panels) embryos (anterior to the left) are shown. ment of the stomach to the left side of the embryo both left and right lateral views of embryos are shown. the single knockdowns, despite obvi- have little effect on the expression of Both single and compound knock- ous effects on posterior axial exten- Sox2 (Fig. 10E–H). downs of Cdx1 and Cdx2 result in sion (Fig. 10B,C). However, com- clear axial shortening and, even as bined Cdx1ϩCdx2 knockdown Gut Morphology in Cdx1 and early as larval stage 41, effects on results in a dramatic down-regula- Cdx2 Knockdown Larval gut coiling are apparent (compare tion of IFABP expression throughout Stage Embryos the appearance of the anterior gut in its normal expression domain (Fig. Figure 10E vs. 10G). The expression 10D). In contrast, either single or To analyze the effect of Cdx1/Cdx2 of IFABP is not affected in either of compound Cdx1ϩCdx2 knockdowns knockdown on the morphology of the Cdx KNOCKDOWN IN Xenopus tropicalis 847

into the four vegetal hemisphere cells at the eight cell stage exhibit rather normal axial development. However, severe disruption of gut coiling is still observed, with embryos either exhibiting a simple, linear, or an S-shaped gut (51% and 20%, respectively, n ϭ 45).

DISCUSSION The presence of multiple Cdx genes in vertebrate genomes with overlapping expression and upstream regulators raises questions with regard to redundancy in Cdx gene function (Lohnes, 2003; Keenan et al., 2006). This issue is addressed in the present study, where for the first time we report the developmental effects of knocking down the function all three Cdx genes in a vertebrate genome. In common with many gene knockdown studies, we are unable to determine the amount of residual Cdx activity present in knockdown embryos and the degree to which this remaining activity ameliorates the observed effects. Despite this caveat, several con- clusions can be drawn from our study. Overlapping Cdx Function During Axial Elongation Our data show that single knock- Fig. 10. Effects of Cdx knockdown on gut development. A–H: Knockdown of Cdx1 and Cdx2 downs of amphibian Cdx1, Cdx2, or results in down-regulation of the posterior endodermal marker Intestinal Fatty Acid Binding Protein Cdx4 result in a broadly similar spec- (IFABP). Exp (E–H). Expression of the anterior gut marker Sox2 is unaffected by Cdx1 and Cdx2 trum of effects on posterior axial de- knockdown. Both right lateral and left lateral views are presented of larval stage 41 embryos velopment, indicating that individual injected with 20 ng of either Cdx1 morpholino oligo (MO), Cdx2 MO, or their combination. Black arrows indicate anterior gut. I–M: Knockdown of Cdx1 or Cdx2 results in abnormal gut morpho- amphibian Cdx genes have overlap- genesis. Embryos shown are at larval stage 45 and were injected with 20 ng of total of either Cdx1 ping roles in posterior development. MO, Cdx2 MO, or their combination. Main images are lateral views with anterior to the left. Insets The triple knockdown gives rise to a are ventral views of the gut region showing details of gut coiling. M: Shows lateral view of embryos marked increase in severity of the pos- injected into the vegetal cells at the eight-cell stage with 10 ng of total of combined Cdx1 and Cdx2 terior defects. These observations ar- MOs. Note that targeting the MOs to the presumptive endoderm results in embryos with abnormal gut morphology but normal development of the dorsal axis. gue for a model in which it is the overall level of Cdx activity in the posterior, rather the distinct function late differentiated gut, embryos were with the majority of the embryos dis- of individual Cdx genes which is re- injected with Cdx1, Cdx2,orCdx1 and playing an almost linear, tubular gut quired for posterior axial extension. Cdx2 MOs and the resulting pheno- structure (66%, n ϭ 30; Figure 10L Support for this hypothesis comes types were analyzed at larval stage and insert). from our observation that the poste- 45. At this stage, the larval gut exhib- It could be argued that such effects rior truncation phenotype can be res- its complex, stereotypical coiling on gut development might be second- cued by expression of a single mutant (Chalmers and Slack, 2000; Fig. 10I ary to the primary effects on axial de- Cdx protein (Xcad-VP16). Further- and insert). Gut coiling was markedly velopment. As a way to discriminate more, we show that double Cdx com- disrupted in both single Cdx1 or Cdx2 the effect of Cdx knockdown in gut bination knockdowns can be rescued knockdown embryos, resulting in a development from axial patterning, by overexpressing the third nontar- much simpler, U-shaped or S-shaped combined Cdx1 and Cdx2 knockdown geted wild-type Cdx protein. We note structure (65%, n ϭ 23 and 78%, n ϭ MOs were targeted to the presump- that rescue with the wild-type pro- 23, respectively; Fig. 10J,K and in- tive endoderm of the vegetal hemi- teins is somewhat less efficient than serts). Double Cdx1ϩ2 knockdowns sphere. Figure 10M shows that em- that achieved with the mutant Cdx produced a more severe phenotype, bryos injected with Cdx1ϩCdx2 MOs protein and might indicate that the 848 FAAS AND ISAACS wild-type Cdx proteins are subject to Cdx1ϩ2 knockdown compared to the ways than those required for the initial regulatory interactions that are not single Cdx1 or Cdx2 knockdown shown specification these tissues. apparent with the mutant protein. in this study also support this view. Canonical and noncanonical Wnt Further evidence of overlapping func- These data are in keeping with previous signaling pathways play key roles in tion is provided by the additive effects studies indicating that a gradient of the patterning and morphogenesis of of knockdown on the expression of Cdx activity in the posterior axis is re- the vertebrate posterior axis (Takada genes in Cdx regulated pathways, such quired for establishing the boundaries et al., 1994; Wallingford, 2004). Cdx as the 5Ј Hox genes, and on the devel- of posterior Hox gene expression regulation of these pathways provides opment of the digestive tract, both of (Marom et al., 1997; van den Akker et a possible mechanism that underlies which are discussed in detail below. al., 2002; Gaunt et al., 2004, 2008). the observed Cdx knockdown pheno- Although we provide evidence that A previous study from our labora- type of reduced axial elongation and the amphibian Cdx proteins have sim- tory used an antimorphic Cdx protein subsequent inhibition of tail bud out- ilar biological activities in the pro- (XcadEnR) containing the DNA bind- growth. Our data support this hypoth- cesses analyzed in this study, we can- ing domain form Cdx4 to investigate esis; we show that expression of the not exclude that, in a given context, Cdx function in Xenopus laevis (Isaacs Wnt3A and Wnt5A ligand genes are individual Cdx proteins have different et al., 1998). This mutant acts as con- downregulated in response to Cdx biological activities. Further studies stitutive repressor of transcription knockdown. Furthermore, we show that involving the analysis of global from Cdx target genes. The inhibition increasing Cdx activity upregulates ex- changes in gene transcription, in re- of posterior elongation resulting from pression of Wnt3A and Wnt5A in both sponse to knockdown of individual Cdx knockdown reported here is whole embryos and tissue explants. Cdx proteins, will be required to ad- broadly in keeping with the pheno- However, our data do not indicate if the dress this issue. types that result from overexpression regulation of Wnt genes is direct or re- of XcadEnR. However, high level ex- quires the activation of intermediate Cdx Regulation of Posterior pression of the antimorphic protein pathway components by Cdx proteins. Wnt5a is a regulator of morphogen- Hox Genes gives rise to a much stronger phenotype of extreme posterior truncation esis acting through a noncanonical There is ample evidence from both Xe- than is seen with the knockdown pathway (Wallingford et al., 2001). nopus and other vertebrate models strategy. This is to be expected given Consistent with our findings with Cdx that Cdx function is linked to poste- that overexpression of the antimor- knockdown embryos, it has been rior Hox gene regulation (Subrama- phic protein represents gain of func- shown that zebrafish wnt5 (pipetail) nian et al., 1995; Chawengsaksophak tion rather than loss of function. Sim- mutants gastrulate normally but sub- et al., 1997; Epstein et al., 1997; ilar phenotypic effects have also been sequently exhibit abnormal posterior Isaacs et al., 1998; van den Akker et reported for another antimorphic Cdx morphogenesis (Kilian et al., 2003). It al., 2002). However, the relationship protein derived from the Cdx1 protein appears that, in pipetail mutant fish, between Cdx levels and posterior Hox (Levy et al., 2002). In keeping with the Wnt11 is able to compensate for the expression remains unclear. Some present study, overexpression of Xca- lack of Wnt5 activity during gastrula general principles can be drawn form dEnR inhibits Hox gene expression stages, allowing normal gastrulation the present study. through gastrula and neurula stages movements. Subsequently, there is in- In Cdx knockdown embryos, we see and has little effect on the expression creasing reliance on Wnt5 function to effects on Hox genes from the onset of of the mesodermal marker brachyury. regulate posterior morphogenesis. In their expression (late gastrula stages) keeping with such a model, our data through neurula stages, indicating show that in contrast to Wnt5a, Wnt11 that Cdx function is required from Other Cdx Regulated expression is unaffected by Cdx early stages of development to estab- Pathways in the Early knockdown and morphogenetic activ- lish and then maintain correct do- Embryo ity associated with gastrulation move- mains of 5Ј Hox gene expression. Our ments are normal. As with the pipetail data provide some evidence that We did not detect effects on the early mutant, subsequent posterior mor- knockdown of amphibian Cdx4 has expression of the key germ layer reg- phogenesis is inhibited by Cdx knock- somewhat stronger effects on Hox ulators brachyury or Sox17b in Cdx down. It has also been noted that the gene expression than does the single knockdown embryos. This indicates phenotype of the Wnt5a null mouse is knockdown of Cdx1 or Cdx2. However, that mesoderm and endoderm are very similar to that reported for the picture that emerges is that a specified, although at present we can- Cdx1Ϫ/Ϫ/ϩ/Ϫ mice (Yamaguchi et al., given Cdx gene does not regulate a not exclude the possibility that Cdx 1999; van den Akker et al., 2002). subset of target 5Ј Hox genes, but knockdown has other effects on the pat- It is possible that the reduced elon- rather it is the overall level of Cdx terning of early mesodermal tissues. gation of isolated dorsal and ventral activity in the embryo that is critical Similarly, we find that, despite the ob- half explants during the neurula to for normal posterior Hox gene expres- vious deficit of posterior dorsal axial tail bud stage is in part due to inhibi- sion. The increased effect of the triple and paraxial tissue in later develop- tion of Wnt5a signaling. However, at Cdx knockdowns over the single ment, early markers of these tissues are present, there is no direct evidence to knockdowns on Hox gene expression, unaffected by Cdx knockdown, suggest- support a role for noncanonical Wnt and the increased effect of the double ing that Cdx genes regulate other path- signaling in regulating the cell rear- Cdx KNOCKDOWN IN Xenopus tropicalis 849 rangements involved in dorsal or ven- (Mutoh et al., 2002; Silberg et al., 2002), tion in the gut in knockdown embryos tral elongation during these stages. indicate that the Cdx genes act as ho- at these later stages are directly due The canonical Wnt ligand Wnt3A is meotic genes to define the identity of to effects on Cdx function in endoder- another important regulator of poste- the intestinal territory. mal cells. However, a previous study rior development in vertebrates. It has also been shown that Cdx fac- indicates that the mesoderm sur- Wnt3a null mice embryos lack poste- tors are required for differentiation of rounding the gut plays a key role in its rior somites and fail to form a tail bud the intestinal epithelium. Several stud- regional specification (Horb and (Takada et al., 1994). In addition, ies indicate that Cdx factors directly Slack, 2001). It is possible that Cdx Wnt3A has been implicated as a sig- regulate the expression from several in- knockdown compromises the meso- nal involved in the out growth of the testine specific differentiation genes, in- derm’s role in regional specification of tail bud during amphibian develop- cluding sucrose isomaltase, MUC2, and the gut. In this regard, we note the ment (Beck and Slack, 1999). It has KLF4 (Guo et al., 2004). down-regulation of Vent2 expression been proposed the Wnt3A is a key reg- In common with other vertebrates, in the ventrolateral mesoderm in re- ulator of Cdx gene expression in the Xenopus Cdx1 and Cdx2 are expressed sponse to Cdx knockdown, indicating mouse and zebrafish (Shimizu et al., in the endoderm of the small and large that Cdx knockdown affects the prop- 2005). Our data indicate that Cdx intestine (Chalmers et al., 2000; Re- erties of the ventrolateral mesoderm function is itself required for normal ece-Hoyes et al., 2002). We show that involved in regional specification of Wnt3A expression in the postgastrula loss of Cdx activity in the early em- the gut. The ventrally expressed me- embryo, suggesting that Wnt3A and bryo does not alter the expression of sodermal marker and hematopoietic Cdx factors are components of a regu- the endodermal markers Xsox17b, regulator Scl is also down-regulated latory loop necessary for normal pos- darmin, and vito, indicating that ini- in Cdx knockdown embryos, which is terior development. tial endodermal specification is not af- in keeping with the proposed role of Wnt3A and Cdx2 knockout mice ex- fected by Cdx knockdown. Regional Cdx factors in regulating vertebrate hibit similar phenotypes (Chaweng- specification of the endoderm occurs blood formation (Davidson et al., saksophak et al., 2004). Early Wnt3A rather late in Xenopus development, 2003) and provides further evidence expression in the primitive streak is between tail bud and tadpole stages for abnormal ventrolateral mesoderm normal in Cdx2 null mice but by the 25 and 35 (Horb and Slack, 2001). At development in Cdx knockdowns. nine somite stage its expression is re- these stages, our data demonstrate It has been proposed that radial induced relative to control embryos that regional specification is impaired tercalation of endodermal cells drive (Chawengsaksophak et al., 2004). Re- in Cdx-deficient embryos. Thus, the elongation and later coiling of the duced Wnt3A expression at this stage whereas the expression patterns of gut. This process occurs from stage 30 was interpreted as resulting from an the endodermal markers analyzed in onward, accompanying cell differenti- overall reduction in posterior develop- this study show little or no difference ation (Horb and Slack, 2001). Our re- ment. This is unlikely to be the case in between early neurula and tail bud sults show that the knockdown of ei- Xenopus because we detect reduced stages, from tail bud stages onward, ther Cdx1 or Cdx2 gene function Wnt3A expression in a region of the down-regulation of posterior gut dramatically reduces the normal com- embryo where expression of other markers like darmin and IFABP indi- plex coiling of the gut, and in com- markers such as MyoD, Wnt11, and cates that regional specification is per- pound Cdx1ϩCdx2 knockdown em- brachyury are unaffected. turbed as a result of Cdx deficiency. bryos the gut resembles a simple Our results show that expression of linear tube. It is interesting to specu- Cdx Function in the intestinal marker IFABP is almost late that the requirement for Cdx ϩ Development of the absent in double Cdx1 Cdx2 embryos function in elongation of the posterior but is relatively normal in the single body axis and the elongation of the gut Amphibian Gut knockdowns, indicating that amphib- during gut coiling demonstrate a gen- Due to its complex, developmentally ian Cdx1 and Cdx2 have essential eral role for Cdx factors in regulating structured architecture, the verte- roles in specifying regional identity tissue morphogenesis and cell move- brate gut provides an excellent system within the gut, and that their func- ments during postneurula stages. Fur- to study the effect of factors involved tions are partially overlapping. How- ther studies will be necessary to deter- in the anteroposterior patterning. In ever, the loss of IFABP expression is mine the molecular pathways involved this regard, there is evidence showing not accompanied by ectopic expression in regulating posterior identity and that Cdx genes are involved in the of the anterior gut marker Sox2. Thus morphogenesis in the amphibian gut. regional specification of the gut. Het- our experiments do not indicate that erozygote Cdx2 knockout mice develop loss of Cdx function in the amphibian Cdx Genes as Conserved polyp-like lesions in the caecum (Cha- gut leads to posterior to anterior trans- Regulators of Posterior wengsaksophak et al., 1997; Beck et formation, as has been noted in the gut Development al., 1999). The presence of anterior-type epithelium of mice heterozygote for a epithelial morphology in these lesions, null allele of Cdx2 (Beck et al., 1999). There is a wealth of functional data and the finding that ectopic Cdx2 gene Given the Cdx1 and Cdx2 expres- demonstrating that a requirement for expression in the stomach results in a sion in the endoderm from tail bud Cdx gene function in posterior axial de- transformation of the gastric mucosa to stages, it seems likely that at least velopment has been conserved during a more posterior intestinal phenotype some of effects on regional specifica- animal evolution. However, there is in- 850 FAAS AND ISAACS creasing evidence that the requirement similar range of effects on elongation obtained by inducing females with 100 for individual Cdx genes varies between of the posterior axis. units of human chorionic gonadotro- animal groups. The evolution of the ver- Despite differences in the require- phin (Intervet) and fertilized as previ- tebrates was accompanied by an expan- ment for individual Cdx genes be- ously described (Khokha et al., 2005). sion in the number of Cdx genes. Thus tween species, a common theme that Staging of Xenopus tropicalis embryos in amphibians and amniotes three Cdx emerges from this and previous stud- was according to Nieuwkoop and genes are present (Cdx1, Cdx2, and ies is that the overall level of Cdx Faber (1967). Cdx4). The orthology of the amphibian function in the embryo is critical in Xenopus laevis embryos were in- Cdx genes with the amniote Cdx genes regulating posterior development. For jected at two- or four-cell stage with is confirmed by analysis of their genomic example, the compound knockdown of 10 or 5 nl of solution/cell, respectively context. In both amphibians and am- zebrafish Cdx4 and Cdx1a results in (20 nl total volume/embryo). Xenopus niotes Cdx2 is contained in the single synergistic reduction in posterior ax- tropicalis embryos were injected at intact ParaHox A gene cluster and ial development (Shimizu et al., 2005; two- or four-cell stage with 2.5 or 1.25 Cdx1 and Cdx4 are contained within Davidson and Zon, 2006). Heterozy- nl of solution/cell, respectively (5-nl the degenerate ParaHox D and B clus- gote Cdx2 null mice exhibit mild de- total volume/embryo). Embryos for ters (Ferrier et al., 2005; Reece-Hoyes et fects in elongation of the posterior axis phenotype and in situ hybridization al., 2005; Isaacs, unpublished data). in comparison to the marked posterior were injected into the marginal zone Despite the high degree of conserva- truncation in the homozygous nulls. at the pigment boundary or vegetal tion in the genomic organization of the Similarly, axial development in Cdx4 pole region and cultured at 22°C until Cdx genes, important differences have knockout mice is relatively normal, the desired stage. Embryos for animal emerged in how these genes are de- whereas Cdx4 knockout mice, which cap explants were injected into the an- ployed during the development of am- are also heterozygous for a Cdx2 null imal pole region. Animal cap explants allele, are truncated posterior to the were dissected out using sharpened niotes and amphibians. For example, hindlimbs (van Nes et al., 2006). tungsten needles at mid-blastula in Xenopus tropicalis, Cdx4 has the Evidence indicates that Cdx function stage 8. Animal cap explants for most anterior boundary of expression is required for the regulation of similar growth factor treatment were cul- and Cdx1 the most posterior boundary key pathways in all vertebrate groups tured in 15-␮l microtiter dish wells in in the dorsal axis, whereas in the mouse examined. However, there appears to 50% Normal Amphibian Medium Cdx1 has the most anterior boundary. be considerable variability in exactly (NAM) ϩ 5% bovine serum albumin, This calls into question the “functional” how the individual Cdx genes are de- either in the presence or absence of orthology of these genes despite their ployed in individual species to fulfill growth factors. Recombinant Xenopus proven orthology at the genomic level this set of conserved Cdx functions. FGF4 protein (Isaacs et al., 1992) and (Gaunt et al., 2004). We also note that These observations support the notion activin A protein (Sigma) were used at outside the homeodomain regions the that during vertebrate evolution the 10 U/ml and 50 U/ml, respectively. peptide sequences of the amphibian or- main selective pressure on the comple- To produce neurula stage dorsal thologs are relatively poorly conserved ment of Cdx genes has been to maintain and ventral explants, embryos previ- (Reece-Hoyes et al., 2002). the overall landscape of Cdx activity in ously injected with 40 ng of the Cdx1, Analyses of single and compound the developing embryo rather than to Cdx2, and Cdx4 MO combination were Cdx knockdown in other model sys- select for the specific functions associ- dissected at stage 16 as described in tems also indicate that the require- ated with individual Cdx proteins. Re- Larkin and Danilchick (1999). Dorsal ments for individual Cdx genes in pos- latedly, we note that the Cdx2 gene has and ventral explants were cultured terior development vary between been lost from the teleost fish genome, separately in MRS/3 in agarose-coated animal groups. Thus mutation in or while there are two Cdx1 orthologues plates until stage 27. The length of knockdown of the zebrafish Cdx4 gene present (Mulley et al., 2006). Such flex- explants were measured as described leads to posterior truncation, whereas ibility during evolution almost certainly in Larkin and Danilchick (1999), us- knockdown of zebrafish Cdx1a has no emerges from the overlapping and par- ing the Spot Junior CCD digital cam- effect on posterior morphogenesis tially redundant function of the three era and software (Diagnostic Instru- (Shimizu et al., 2005). Also, Cdx4 Cdx proteins. The observed variability ments). Statistical analysis was knockout mice have rather normal ax- underlines the importance of detailed carried out in Excel (Student’s t-test). ial development (van Nes et al., 2006), analysis of Cdx function in a wide range whereas Cdx1 knockout mice have al- of animal species. DNA Constructs and mRNA terations in patterning of the cervical vertebrae (Subramanian et al., 1995). Synthesis These relatively mild effects are in EXPERIMENTAL The 5Ј UTR and coding region of the contrast with the dramatic inhibition PROCEDURES Cdx1, Cdx2, and Cdx4 cDNAs were of posterior axial development noted Embryo Culture and polymerase chain reaction amplified in Cdx2 knockout mice (Chawengsak- using Pfu hi-fidelity polymerase Micromanipulation sophak et al., 2004). In contrast to the (Stratagene) and subcloned, in frame situation in mice and zebrafish, we Xenopus laevis eggs were obtained as with 6ϫ repeats of a sequence coding find that knockdown of each of the previously described (Isaacs et al., for of the myc-epitope tag in the Xenopus Cdx genes results in a rather 1992). Xenopus tropicalis eggs were pCS2ϩMYC vector. Cs2ϩCdx-myc Cdx KNOCKDOWN IN Xenopus tropicalis 851

constructs, Cs2ϩXcadVP16, Cs2ϩGFP, branes were probed with rabbit anti- Randy Moon for providing Wnt cDNAs. Cs2ϩWnt3A and Cs2ϩCdx1 were lin- mouse secondary antibody conjugated H.V.I. and L.F. were funded by a Well- earized with NotI and transcribed with with peroxidase (1:2,000; Amersham) come Trust project grant. the SP6 Megascript kit (Ambion) using for 1 hr at room temperature, and de- a modified protocol including 0.5 mM veloped using the ECL Chemolumines- GTP and 5 mM m7G(5Ј)Gppp(5Ј)G cap cence kit (Roche Diagnostics). Glyceral- REFERENCES analogue (Isaacs et al., 1998). dehyde-3-phosphate dehydrogenase Beck CW, Slack JM. 1999. A developmental (GAPDH; 1:2,000, Insight Biotechnolo- pathway controlling outgrowth of the Xe- gies, Inc.) was used as loading control. nopus tail bud. Development 126:1611– Morpholino Oligonucleotides 1620. (MO) Histology Beck F, Chawengsaksophak K, Waring P, Playford RJ, Furness JB. 1999. Repro- All Cdx MOs used in this study were Embryos were fixed in 4% paraformal- gramming of intestinal differentiation targeted to the 5ЈUTR region of the dehyde /phosphate buffered saline, and intercalary regeneration in Cdx2 gene and/or the start site of translation. stained in borax carmine, dehydrated mutant mice. Proc Natl Acad Sci U S A The set-1 antisense MOs were kindly 96:7318–7323. through an ethanol series and embed- Beck F. 2004. The role of Cdx genes in the provided by E. Amaya. The set-2 anti- ded in Paraplast (Sigma). Microtome mammalian gut. Gut 53:1394–1396. sense MOs, set-1 five mismatch Cdx sections were counterstained with Bel-Vialar S, Itasaki N, Krumlauf R. 2002. MOs, and the standard control MO picroblue-black and mounted in Histo- Initiating Hox gene expression: in the were obtained from GeneTools, LLC. mount (National Diagnostics). Speci- early chick neural tube differential sen- The sequences of the MOs used in this sitivity to FGF and RA signaling subdi- mens were photographed using a Spot vides the HoxB genes in two distinct study are as follows: Standard Control, Insight CCD digital camera (Diagnostics groups. Development 129:5103–5115. 5Ј CCTCCTACCTCAGTTACAATTTA- Instruments) and image manipulation Brooke NM, Garcia-Ferna`ndez J, Holland TA 3Ј. Set 1 MOs: Cdx1/Xtcad2, 5Ј CG- was carried out using Adobe Photoshop. PW. 1998. The ParaHox gene cluster is GGTAACAATCTCCTGAGTCTGTG 3Ј; an evolutionary sister of the Hox gene Cdx2/Xtcad1, 5Ј AACAAGTAACTCAC- Whole-Mount In Situ cluster. Nature 392:920–922. Ј Ј Chalmers AD, Slack JM. 2000. The Xenopus GTACATGGCGG 3 ; Cdx4/Xtcad3, 5 Hybridization tadpole gut: fate maps and morphogenetic ATCCTTGGTGGTCATCTTTATCCTC movements. Development 127:381–392. 3Ј; Cdx1 mismatch control, 5Ј CGcGT- Antisense digoxigenin (DIG) -labeled Chalmers AD, Slack JM, Beck CW. 2000. ϫ AAgAATCTgCTGAcTCTcTG 3Ј; Cdx2 probes were synthesized using 10 Regional gene expression in the epithelia mismatch control, 5Ј AAgAAcTAACTg- DIG labeling mix (Roche Diagnostics). of the Xenopus tadpole gut. Mech Dev Ј Templates were linearized and tran- 96:125–128. ACGTAgATGcCGG 3 ; Cdx4 mismatch Charite J, de Graaff W, Consten D, Reijnen control, 5Ј ATgCTTcGTGcTCATgTTT- scribed as follows: X. laevis cDNAs MJ, Korving J, Deschamps J. 1998. ATgCTC 3Ј. Set 2 MOs: Cdx1/Xtcad2, 5Љ HoxD9 and HoxD10 NcoI /SP6; MyoD, Transducing positional information to ATCCAAAAGATAACCCACGTACA- Xbra, and SCL XhoI/T7, Wnt3A the Hox genes: critical interaction of cdx gene products with position-sensitive TC 3Љ; Cdx2/Xtcad1, 5Ј CTCCAACAAG- BamHI/T3, Wnt5A BstXI/SP6, IFABP XhoI/T7, Xsox2 EcoRI/T7, and X. regulatory elements. Development 125: TAACTCACGTACATG 3Ј; Cdx4/Xtcad3, 4349–4358. 5Ј CTAGGCGAGATCCTTGGTGGT- tropicalis cDNAs Cdx2 (Xtcad1) NdeI/ Chawengsaksophak K, James R, Ham- CATC 3Ј. Lower case letters indicate T7, Cdx1 (Xtcad2) EcoRV/T3, Cdx4 mond VE, Kontgen F, Beck F. 1997. Ho- changes in bases respect to the corre- (Xtcad3) PvuII/T7; Wnt11 DraI/T7; meosis and intestinal tumours in Cdx2 mutant mice. Nature 386:84–87. sponding antisense MO. HoxA9, HoxA11, and HoxC11 SpeI/T7; HoxC8 and HoxC9 SacII/SP6, HoxB9, Chawengsaksophak K, de Graaff W, Ros- sant J, Deschamps J, Beck F. 2004. Cdx2 Xhox3, HoxA7 darmin, vito, vent-2, is essential for axial elongation in mouse Western Blotting and Sox17b EcoRI/T7. Whole-mount development. Proc Natl Acad Sci U S A Embryos were harvested at late blas- in situ hybridization was performed 101:7641–7645. Costa RM, Mason J, Lee M, Amaya E, Zorn tula stage 9, homogenized in lysis as described in Harland (1991), with minor modifications (Reece-Hoyes et AM. 2003. Novel gene expression domains buffer (0.2 M sucrose, 100 mM Tris pH reveal early patterning of the Xenopus ␮ al., 2002). Proteinase K treatment was 8, 10 mM CaCl2,10mMMg2Cl, 4 l/ endoderm. Gene Expr Patterns 3:509–519. embryo) on ice and centrifuged for 10 carried out for 10 to 25 min with 10 Davidson AJ, Zon LI. 2006. The caudal-re- ␮ min at 4°C. Protein concentration in g/ml of proteinase K (Roche Diagnos- lated homeobox genes cdx1a and cdx4 act tics). Specimens were photographed redundantly to regulate hox gene expres- the supernatant was determined us- sion and the formation of putative hema- ing the BioRad colorimetric assay using a Spot Junior CCD digital cam- topoietic stem cells during zebrafish em- (Bio-Rad, Hercules, CA). Equal pro- era (Diagnostic Instruments), and im- bryogenesis. Dev Biol 292:506–518. tein amounts per sample were ana- age manipulation was carried out us- Davidson AJ, Ernst P, Wang Y, Dekens lyzed on 7.5% sodium dodecyl sulfate- ing Adobe Photoshop Elements. MP, Kingsley PD, Palis J, Korsmeyer SJ, Daley GQ, Zon LI. 2003. Cdx4 mutants polyacrylamide gel electrophoresis, fail to specify blood progenitors and can transferred onto Immobilon-P mem- ACKNOWLEDGMENTS be rescued by multiple hox genes. Na- branes (Millipore, Billerica, MA) and We thank Enrique Amaya for provid- ture 425:300–306. subsequently probed with mouse anti- ing us with some of the Cdx AMOs Epstein M, Pillemer G, Yelin R, Yisraeli JK, Fainsod A. 1997. Patterning of the myc antibody (9B11, 1:5,000, Cell Sig- used in this study and Betsy Pownall embryo along the anterior-posterior axis: nalling Technology, Inc.) overnight at for critical reading of the manuscript. the role of the caudal genes. Develop- 4°C. After extensive washing, mem- We also thank Stefan Hoppler and ment 124:3805–3814. 852 FAAS AND ISAACS

Ferrier DEK, Dewar K, Cook A, Chang JL, Khokha MK, Yeh J, Grammer TC, Harland Xenopus caudal genes along the anteri- Hill-Force A, Amemiya C. 2005. The RM. 2005. Depletion of three BMP an- or-posterior axis. Mech Dev 71:193–196. chordate ParaHox gene cluster. Curr tagonists from Spemann’s organizer Pilon N, Oh K, Sylvestre JR, Bouchard N, Biol 15:820–822. leads to a catastrophic loss of dorsal Savory J, Lohnes D. 2006. Cdx4 is a di- Gamer LW, Wright CVE. 1993. Murine structures. Dev Cell 8:401–411. rect target of the canonical Wnt path- Cdx-4 bears striking similarity to the Kilian B, Mansukoski H, Barbosa FC, Ul- way. Dev Biol 289:55–63. Drosophila caudal gene in its homeodo- rich F, Tada M, Heisenberg CP. 2003. Pownall ME, Tucker AS, Slack JMW, main sequence and early expression pat- The role of Ppt/Wnt5 in regulating cell Isaacs HV. 1996. eFGF, Xcad3 and Hox tern. Mech Dev 43:71–81. shape and movement during zebrafish genes form a molecular pathway that es- Gaunt SJ, Drage D, Cockley A. 2003. Ver- gastrulation. Mech Dev 120:467–476. tablishes the anteroposterior axis in Xe- tebrate caudal gene expression gradients Larkin K, Danilchik MV. 1999. Ventral cell nopus. Development 122:3881–3892. investigated by use of chick cdx-A/lacZ rearrangements contribute to anterior- Prinos P, Joseph S, Oh K, Meyer BI, Gruss and mouse cdx-1/lacZ reporters in trans- posterior axis lengthening between neu- P, Lohnes D. 2001. Multiple pathways genic mouse embryos: evidence for an rula and tailbud stages in Xenopus lae- governing Cdx1 expression during mu- intron enhancer. Mech Dev 120:573–586. vis. Dev Biol 216:550–560. rine development. Dev Biol 239:257–269. Gaunt SJ, Cockley A, Drage D. 2004. Ad- Levy V, Marom K, Zins S, Koutsia N, Yelin Reece-Hoyes JS, Keenan ID, Isaacs HV. ditional enhancer copies, with intact cdx R, Fainsod A. 2002. The competence of 2002. The cloning and expression of the binding sites, anteriorize Hoxa-7/lacZ ex- marginal zone cells to become Spe- Cdx family from the frog Xenopus tropi- pression in mouse embryos: evidence in mann’s organizer is controlled by Xcad2. calis. Dev Dyn 223:134–140. keeping with an instructional cdx gradi- Dev Biol 248:40–51. Reece-Hoyes JS, Keenan ID, Pownall ME, ent. Int J Dev Biol 48:613–622. Lohnes D. 2003. The Cdx1 homeodomain Isaacs HV. 2005. A consensus Oct1 binding Gaunt SJ, Drage D, Trubshaw RC. 2008. protein: an integrator of posterior signal- site is required for the activity of the Xeno- Increased Cdx protein dose effects upon ing in the mouse. Bioessays 25:971–980. pus Cdx4 promoter. Dev Biol 282:509–23. axial patterning in transgenic lines of MacDonald PM, Struhl G. 1986. A molecu- Ruiz i Altaba A, Melton DA. 1989. Bimodal mice. Development 135:2511–2520. lar gradient in early Drosophila em- and graded expression of the Xenopus ho- Godsave S, Dekker EJ, Holling T, Pannese bryos. Nature 324:537–545. meobox gene Xhox3 during embryonic de- M, Boncinelli E, Durston A. 1994. Ex- Marom K, Shapira E, Fainsod A. 1997. The velopment. Development 106:173–183. pression patterns of Hoxb genes in the chicken caudal genes establish an ante- Shimizu T, Bae YK, Muraoka O, Hibi M. Xenopus embryo suggest roles in antero- rior-posterior gradient by partially over- 2005. Interaction of Wnt and caudal-re- posterior specification of the hindbrain lapping temporal and spatial patterns of lated genes in zebrafish posterior body and in dorsoventral patterning of the expression. Mech Dev 64:41–52. formation. Dev Biol 279:125–141. mesoderm. Dev Biol 166:465–476. Mead PE, Kelley CM, Hahn PS, Piedad O, Showell C, Binder O, Conlon FL. 2004. T- Guo RJ, Suh ER, Lynch JP. 2004. The role of Zon LI. 1998. SCL specifies hematopoi- box genes in early embryogenesis. Dev Cdx proteins in intestinal development etic mesoderm in Xenopus embryos. De- Dyn 229:201–218. and cancer. Cancer Biol Ther 3:593–601. velopment 125:2611–2620. Harland RM. 1991. In situ hybridization: Meyer BI, Gruss P. 1993. Mouse Cdx-1 ex- Silberg DG, Sullivan J, Kang E, Swain GP, an improved whole-mount method for pression during gastrulation. Develop- Moffett J, Sund NJ, Sackett SD, Kaestner Xenopus embryos. Methods Cell Biol 36: ment 117:191–203. KH. 2002. Cdx2 ectopic expression induces 685–695. Mlodzik M, Gehring WJ. 1987. Expression gastric intestinal metaplasia in transgenic Horb ME, Slack JM. 2001. Endoderm spec- of the caudal gene in the germline of mice. Gastroenterology 122:689–696. ification and differentiation in Xenopus Drosophila: formation of an RNA and Subramanian V, Meyer BI, Gruss P. 1995. embryos. Dev Biol 236:330–343. protein gradient during early embryo- Disruption of the murine homeobox gene Hudson C, Clements D, Friday RV, Stott D, genesis. Cell 48:465–478. Cdx1 affects axial skeletal identities by Woodland HR. 1997. Xsox17alpha and Mlodzik M, Gibson G, Gehring WJ. 1987. altering the mesodermal expression do- -beta mediate endoderm formation in Xe- Effects of ectopic expression of caudal mains of Hox genes. Cell 83:641–653. nopus. Cell 91:397–405. during Drosophila development. Devel- Takada S, Stark KL, Shea MJ, Vassileva G, Ikeya M, Takada S. 2001. Wnt-3a is re- opment 109:271–277. McMahon JA, McMahon AP. 1994. Wnt-3a quired for somite specification along the Mulley JF, Chiu CH, Holland PW. 2006. regulates somite and tailbud formation in anteroposterior axis of the mouse em- Breakup of a homeobox cluster after ge- the mouse embryo. Genes Dev 8:174–189. bryo and for regulation of cdx-1 expres- nome duplication in teleosts. Proc Natl van den Akker E, Forlani S, Chawengsak- sion. Mech Dev 103:27–33. Acad SciUSA103:10369–10372. sophak K, de Graaff W, Beck F, Meyer Illes JC, Winterbottom EF, Isaacs HV. Mutoh H, Hakamata Y, Sato K, Eda A, BI, Deschamps J. 2002. Cdx1 and Cdx2 2009. Cloning and expression analysis of Yanaka I, Honda S, Osawa H, Kaneko Y, have overlapping functions in anteropos- the anterior ParaHox genes Gsh1 and Sugano K. 2002. Conversion of gastric terior patterning and posterior axis elon- Gsh2 from Xenopus tropicalis. Dev Dyn mucosa to intestinal metaplasia in Cdx2- gation. Development 129:2181–2193. 238:194–203. expressing transgenic mice. Biochem van Nes J, de Graaff W, Lebrin F, Gerhard Isaacs HV, Tannahill D, Slack JMW. 1992. Biophys Res Commun 294:470–479. M, Beck F, Deschamps J. 2006. The Cdx4 Expression of a novel FGF in the Xeno- Nieuwkoop PD, Faber J. 1967. Normal Ta- mutation affects axial development and pus embryo. A new candidate inducing ble of Xenopus laevis (Daudin). Amster- reveals an essential role of Cdx genes in factor for mesoderm formation and an- dam: North-Holland. the ontogenesis of the placental labyrinth teroposterior specification. Development Onichtchouk D, Glinka A, Niehrs C. 1998. in mice. Development 133:419–428. 114:711–720. Requirement for Xvent-1 and Xvent-2 Wallingford JB. 2004. Closing in on verte- Isaacs HV, Pownall ME, Slack JMW. 1998. gene function in dorsoventral patterning brate planar polarity. Nat Cell Biol Regulation of Hox gene expression and of Xenopus mesoderm. Development 125: 6:687–689. posterior development by the Xenopus 1447–1456. Wallingford JB, Vogeli KM, Harland RM. caudal homologue Xcad3. EMBO J 17: Pera EM, Martinez SL, Flanagan JJ, Brech- 2001. Regulation of convergent exten- 3413–3427. ner M, Wessely O, De Robertis EM. 2003. sion in Xenopus by Wnt5a and Frizzled-8 Katsuyama Y, Sato Y, Wada S, Saiga H. Darmin is a novel secreted protein ex- is independent of the canonical Wnt 1999. Ascidian tail formation requires pressed during endoderm development in pathway. Int J Dev Biol 45:225–227. caudal function. Dev Biol 213:257–268. Xenopus. Gene Expr Patt 3:147–152. Yamaguchi TP, Bradley A, McMahon AP, Keenan ID, Sharrard RM, Isaacs HV. Pillemer G, Epstein M, Blumberg B, Yis- Jones S. 1999. A Wnt5a pathway under- 2006. FGF signal transduction and the raeli JK, De Robertis EM, Steinbeisser lies outgrowth of multiple structures in regulation of Cdx gene expression. Dev H, Fainsod A. 1998. Nested expression the vertebrate embryo. Development 126: Biol 299:478–488. and sequential downregulation of the 1211–1223.