Insight into mechanisms of 3′-5′ exonuclease activity PNAS PLUS and removal of bulky 8,5′-cyclopurine adducts by apurinic/apyrimidinic endonucleases
Abdelghani Mazouzia, Armelle Vigourouxb, Bulat Aikesheva,c, Philip J. Brooksd,e, Murat K. Saparbaeva, Solange Morerab,1, and Alexander A. Ishchenkoa,1
aUniversité Paris-Sud, Laboratoire “Stabilité Génétique et Oncogenèse”, Centre National de la Recherche Scientifique (CNRS), Unité Mixte de Recherche 8200, Institut de Cancérologie Gustave-Roussy, F-94805 Villejuif Cedex, France; bLaboratoire d’Enzymologie et Biochimie Structurales, CNRS, F-91198 Gif-sur-Yvette Cedex, France; cL.N. Gumilev Eurasian National University, Astana, Republic of Kazakhstan, 010008; and dLaboratory of Neurogenetics and Division of Metabolism and Health Effects, National Institute on Alcohol Abuse and Alcoholism, eOffice of Rare Diseases Research, National Center for Advancing Translational Sciences, National Institutes of Health, Bethesda, MD 20892
Edited by Philip C. Hanawalt, Stanford University, Stanford, CA, and approved June 28, 2013 (received for review March 19, 2013) 8,5′-cyclo-2’-deoxyadenosine (cdA) and 8,5′-cyclo-2’-deoxyguano- compared with regular dA, implying that this base lesion would sine generated in DNA by both endogenous oxidative stress and be resistant to DNA glycosylase action (3). ionizing radiation are helix-distorting lesions and strong blocks for The cdA adducts in DNA are a strong block to various DNA DNA replication and transcription. In duplex DNA, these lesions are polymerases, such as T7, δ, and η (4). Interestingly, translesion repaired in the nucleotide excision repair (NER) pathway. How- DNA polymerase η can perform lesion bypass synthesis on the ever, lesions at DNA strand breaks are most likely poor substrates R-cdA but not on S-cdA (5). Both diastereomers of cdA also for NER. Here we report that the apurinic/apyrimidinic (AP) endo- inhibit DNA transcription by blocking primer extension by T7 nucleases—Escherichia coli Xth and human APE1—can remove 5′S DNA polymerase, and S-cdA inhibits binding of the TATA box cdA (S-cdA) at 3′ termini of duplex DNA. In contrast, E. coli Nfo and protein in vitro and strongly reduces gene expression in vivo (6). yeast Apn1 are unable to carry out this reaction. None of these In addition, in vivo human RNA polymerase II generates mutated enzymes can remove S-cdA adduct located at 1 or more nt away RNA transcripts when using DNA template containing S-cdA (7). from the 3′ end. To understand the structural basis of 3′ repair Given the strong genotoxic effect of cdA adducts on DNA me- activity, we determined a high-resolution crystal structure of E. coli tabolism, cells should have a repair mechanism to remove these Nfo-H69A mutant bound to a duplex DNA containing an α-anomeric helix-distorting DNA adducts. Indeed, it was shown that the nu- 2′-deoxyadenosine:T base pair. Surprisingly, the structure reveals a cleotide excision repair (NER) pathway can remove cdA adducts bound nucleotide incision repair (NIR) product with an abortive 3′- with efficiency comparable to that of T = T cyclobutane dimers terminal dC close to the scissile position in the enzyme active site, and exhibits higher activity in excising the R-isomer (4, 8). In providing insight into the mechanism for Nfo-catalyzed 3′→5′ exo- agreement with the biochemical data, it was shown that cdPu ′ S BIOCHEMISTRY nuclease function and its inhibition by 3 -terminal -cdA residue. adducts accumulate in keratinocytes from xeroderma pigmento- ′ This structure was used as a template to model 3 -terminal residues sum group C and Cockayne syndrome (CS) group A patients ex- in the APE1 active site and to explain biochemical data on APE1- posed to X-rays and potassium bromate (KBrO ) (9, 10) and also ′ 3 catalyzed 3 repair activities. We propose that Xth and APE1 may in organs of CS group B knockout mice (11). Importantly, cdA act as a complementary repair pathway to NER to remove S-cdA adducts from 3′ DNA termini in E. coli and human cells, respectively. Significance
oxidative DNA damage | endonuclease IV | DNA glycosylase | base excision repair | damage specific endonuclease Oxidative DNA damage has been postulated to play an im- portant role in human neurodegenerative disorders and cancer. 8,5′-cyclo-2′-deoxyadenosine (cdA) is generated in DNA by xidative damage to DNA caused by reactive oxygen species hydroxyl radical attack and strongly blocks DNA replication Ois believed to be a major type of endogenous cellular damage. and transcription. Here we demonstrate that cdA adducts at If unrepaired, the damage will tend to accumulate and lead to 3′ termini of DNA can be removed by 3′-5′ exonuclease activity premature aging, neurodegenerative disorders, and cancer (1). of the apurinic/apyrimidinic (AP) endonucleases: Escherichia More than 80 different oxidative modifications of DNA bases coli Xth and human APE1. The crystal structure of bacterial AP and sugar backbone have been identified to date (2). Diaste- endonuclease in complex with DNA duplex provides insight reoisomeric (5′S)- and (5′R)-8,5′-cyclo-2′-deoxyadenosine (cdA) into the mechanism of this activity. This new repair function and 8,5′-cyclo-2′-deoxyguanosine (cdG) are generated by endog- provides an alternative pathway to counteract genotoxic effect enous oxidative stress and ionizing radiation among other oxidized of helix-distorting DNA lesions. bases (Fig. 1A). 8,5′-cyclo-2′-deoxypurines (cdPu) are generated by ′ Author contributions: A.M., A.V., M.K.S., S.M., and A.A.I. designed research; A.M., A.V., hydroxyl radical attack at C5 sugar by H-abstraction resulting in B.A., S.M., and A.A.I. performed research; P.J.B. contributed new reagents/analytic tools; formation of C5′-centered sugar radical, which then reacts in the A.M., B.A., P.J.B., M.K.S., S.M., and A.A.I. analyzed data; and P.J.B., M.K.S., S.M., and A.A.I. absence of oxygen with the C8 of the purine. Subsequent oxidation wrote the paper. of the resulting N7-centered radical leads to intramolecular cy- The authors declare no conflict of interest. clization with the formation of a covalent bond between the C5′- This article is a PNAS Direct Submission. and C8-positions of the purine nucleoside. When present in DNA Freely available online through the PNAS open access option. duplex cdA causes large changes in backbone torsion angles, Data deposition: The atomic coordinates and structure factors of H69A Endo IV:DNA have been deposited in the Protein Data Bank, www.pdb.org (PDB ID code 4K1G). which leads to weakening of base pair hydrogen bonds and 1To whom correspondence may be addressed. E-mail: [email protected] or strong perturbations of the helix conformation near the lesion [email protected]. for both diastereoisomers. Interestingly, the glycosidic bond in This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10. S-cdA is approximately 40-fold more resistant to acid hydrolysis 1073/pnas.1305281110/-/DCSupplemental.
www.pnas.org/cgi/doi/10.1073/pnas.1305281110 PNAS | Published online July 29, 2013 | E3071–E3080 Downloaded by guest on September 23, 2021 coupled NER may participate in cleansing single-strand breaks from this 3′ adduct (13). Therefore, it is unlikely that NER could be able to efficiently remove cdPu located at 3′ termini of a sin- gle-strand break. Recently it has been demonstrated that 5′R and 5′S isomers of cdATP could be incorporated with low efficiency by replicative DNA polymerases and then inhibit further DNA synthesis, thus potentially generating gapped DNA with a cdA adduct at the 3′ end (14). Furthermore, in the absence of ion- izing radiation and/or drugs, cdPu could arise at 3′ termini as a result of 3′→5′ exonuclease degradation of DNA, for example by TREX1 (5). The majority of oxidatively damaged DNA bases are sub- strates for two overlapping pathways: DNA glycosylase-initiated base excision repair (BER) and apurinic/apyrimidinic (AP) en- donuclease-mediated nucleotide incision repair (NIR) (15). In the NIR pathway, an AP endonuclease makes an incision 5′ to a damaged nucleotide and then extends the resulting single-strand break to a gap by a nonspecific3′→5′ exonuclease activity (16, 17). AP endonucleases are multifunctional DNA repair enzymes that possess AP site nicking, 3′ repair diesterase, NIR, and 3′→5′ exonuclease activities and are divided into two distinct families based on amino acid sequence identity to either Escherichia coli exonuclease III (Xth) or endonuclease IV (Nfo) (18). Human APE1 is homologous to Xth, whereas Saccharomyces cerevisiae Apn1 is homologous to Nfo. Previously it was shown that AP endonuclease-catalyzed 3′→5′ exonuclease activity could serve as a3′ editing function for removing mismatched and oxidized bases at 3′ termini of DNA duplex (19–21). However, the de- tailed mechanisms for those 3′ editing repair activities are not yet clearly understood. Although Xth and Nfo AP endonuclease families share common DNA substrate specificities, they are distinguished by their modes of DNA damage recognition. In- deed, cocrystal structures of Nfo bound to an AP site analog, tetrahydrofuran (THF), showed that the enzyme drastically dis- torts the DNA helix by ∼90° bending and flips out not only the target AP site but also its opposing nucleotide out of the DNA base stack (22, 23). Interestingly, the Nfo active site pocket sterically excludes binding of normal β-configuration nucleotides, but it can fit α-anomeric nucleotides. In contrast, cocrystal struc- tures of APE1 bound to abasic site-containing DNA show that the enzyme kinks the DNA helix by only 35° and binds a flipped-out Fig. 1. Repair of 3′-blocking bulky adducts by AP endonucleases-catalyzed AP site in a pocket that excludes DNA bases, whereas the op- ′→ ′ ′ ′ posite base remains stacked in the duplex (24). Importantly, the 3 5 exonuclease activity. (A) Chemical structures of 5 S-(S-cdA) and 5 R- fi (R-cdA) diastereoisomers of cdA. (B) Denaturing PAGE analysis of repair DNA substrate speci city of APE1 but not that of Xth varies products generated by the AP endonucleases when acting upon 3′-terminal depending on reaction condition (25). S-cdA nucleotide. 5′-[32P]-labeled A•Trec,cdA•Trec, and cdAA•Trec duplex Here we investigate whether S-cdA adducts in DNA can be oligonucleotides were incubated with various AP endonucleases of different removed in alternative to NER pathways by AP endonucleases. origins (5 nM of APE1, Nfo, and Apn1 or 10 pM of Xth) for 10 min at 37 °C. Our results show that in contrast to Nfo and Apn1, Xth and (C) APE1-catalyzed 3′ repair activities toward recessed, gapped, and nicked APE1 remove S-cdA adducts when present at 3′ termini of ′ 32 duplex DNA. 5 -[ P]-labeled oligonucleotide duplexes were incubated in the a recessed, nicked, or a gapped DNA duplex. However, S-cdA presence of 5 nM Ape1 for 10 min at 37 °C. The “X” denotes the position of ′ S-cdA nucleotide. Details in Materials and Methods. adducts located at 1 or more nt away from the 3 end are not substrates for AP endonucleases. Using the high-resolution crystal structure of Nfo-H69A:DNA complex, which provides a picture and cdG lesions accumulate spontaneously in nuclear DNA of of the position of the DNA for exonuclease activity, we were able ’ WT mice with age, suggesting that DNA repair is unable to keep to model the DNA exonuclease conformation into APE1 s active S the steady-state level of these complex DNA lesions over the site and provide insight into the mechanism for repair of -cdA adducts. The structural basis and potential biological importance lifespan of an organism (12). Interestingly, S-cdA diastereoisomers of the reported substrate specificity of Xth and APE1 in are removed in the NER pathway much less efficiently than the cleansing genomic DNA of highly cytotoxic lesions are discussed. corresponding 5′R-cdA ones and are also present at a higher level in nontreated mice organs (4, 12). Results At present, NER is the only known DNA repair pathway to Xth/APE1 but Not Nfo/Apn1 Remove Bulky S-cdA Adducts at 3′ Termini remove cyclopurine adducts in duplex DNA. However, removal of Recessed, Nicked, and Gapped Duplex DNA. First we examined of lesions located in close proximity to DNA strand breaks by whether an S-cdA nucleotide in duplex DNA is a substrate for NER has not been reported except in one study by Plunkett and NIR-AP endonucleases E. coli Nfo, yeast Apn1, human APE1, coworkers (13). These authors demonstrated that a 3′-terminal or the human endonuclease VIII-like 1 (NEIL1) DNA glyco- cytosine analog present at a single-strand break is not a substrate sylase. For this, we incubated a 3′-[32P]-labeled 42-mer duplex for the human global genome NER pathway, but transcription- oligonucleotide referred to as cdA42•T42 with an excess of en-
E3072 | www.pnas.org/cgi/doi/10.1073/pnas.1305281110 Mazouzi et al. Downloaded by guest on September 23, 2021 zyme and then analyzed the reaction products by denaturing E. coli Xth can efficiently eliminate S-cdA adduct at the 3′ ter- PNAS PLUS PAGE. No cleavage of cdA42•T42 by any of these enzymes was mini of a recessed DNA duplex. observed, indicating that bulky S-cdA adduct is not a substrate Next we examined APE1 activities on the recessed, nicked, and for either NIR or BER pathways (Fig. S1). gapped DNA duplexes containing either regular dA or S-cdA It was previously shown that S-cdA nucleotide in duplex DNA nucleotide in close proximity to the 3′ end. As shown in Fig. 1C, is a strong block to 3′→5′ exonuclease activities of T4 DNA whereas APE1 exhibits highly processive 3′→5′ exonuclease polymerase, mammalian 3′ repair exonuclease 1 (TREX1), E. coli activity on nondamaged recessed A•Trec duplex (lane 2), it is Xth, snake venom phosphodiesterase, and nuclease P1 (5). Be- strongly inhibited on the gapped A•Tgap duplex and almost cause AP endonucleases contain robust 3′→5′ exonuclease ac- blocked on the nicked A•Tnick duplex (lanes 3 and 4). These tivity that removes regular and modified nucleotides in duplex results indicate that APE1 requires an extended single-stranded DNA (20), we examined whether APE1, Nfo, Apn1, and Xth DNA region for its processive exonuclease function. It should be could remove S-cdA monophosphate (S-cdAMP) when placed in noted that previous studies showed either similar efficiency of close proximity to 3′ termini of the recessed duplex oligonucle- APE1-catalyzed exonuclease toward the recessed, nicked, and otide cdA•Trec and cdAA•Trec (Table 1). As shown in Fig. 1, all gapped DNA (26, 27) or even lowest efficiency on the recessed AP endonucleases tested efficiently degrade regular dA•Trec DNA duplex (28). These apparent discrepancies between our duplex oligonucleotide containing normal dA nucleotide at the data and the previous studies could be explained by several 3′ termini of a gap (Fig. 1B, lanes 2, 7, 10, and 14). Intriguingly, factors, such as (i) different reaction conditions used, (ii) dif- APE1 and Xth, but not Nfo and Apn1, can remove 3′-terminal ferent sequence context of DNA substrates used, and (iii) the S-cdA nucleotide in cdA•Trec with high efficiency (lanes 4 and use of histidine-tagged APE1 instead of native form (19, 28). 15 vs. 8 and 11) and then continue to degrade DNA further in Interestingly, APE1 efficiently eliminates S-cdA nucleotide at the a processive manner by their nonspecific3′→5′ exonuclease ac- 3′ end of all recessed, nicked, and gapped DNA duplexes (lanes tivity (Fig. 1B, lanes 2, 7, 10, and 14). Interestingly, the recessed 6–8), suggesting that a single-strand break at the 3′ side of the duplex cdAA•Trec with the S-cdA adduct placed at the second S-cdA adduct in duplex DNA is sufficient for its removal. After position from the 3′ terminus completely blocks the 3′→5′ removing the 3′-terminal S-cdA nucleotide in the recessed DNA exonuclease activity of APE1, Nfo, and Xth (lanes 6, 9, and 16). duplex, APE1-catalyzed 3′→5′ exonuclease activity continues to However, Apn1 was able to remove 3′-terminal dAMP in degrade DNA in a nonspecific manner (lane 6), whereas it is cdAA•Trec duplex with very low efficiency but then was com- inhibited on the gapped and nicked DNA duplexes (lanes 7 and pletely blocked by the remaining S-cdA adduct (lane 12). 8). Strikingly, when acting upon nicked DNA duplexes APE1 To precisely determine the distance from the 3′ end to S-cdA efficiently removes a 3′-terminal S-cdAMP (lane 8) but not a nucleotide at which the adduct starts to inhibit 3′→5′ exo- 3′-terminal regular dAMP (lane 4). This result strongly suggests nuclease activity of AP endonucleases, we constructed recessed that APE1 recognizes S-cdA adduct with a high degree of speci- DNA duplex cdA42•T55 containing S-cdA nucleotide on the re- ficity when present at the 3′ end. However, APE1 exonuclease cessed strand 14 nt away from the 3′ end. As expected, the pres- function is totally inhibited on the recessed cdAA•Trec, nicked ence of S-cdA adduct strongly blocks the 3′→5′ exonuclease cdAA•Tnick, and gapped cdAA•Tgap DNA duplexes where
activities of all AP endonucleases tested (Fig. S2). APE1 and Xth S-cdA is located 1 nt before the 3′ end (lanes 10–12), in agree- BIOCHEMISTRY exonuclease activities stop 2 nt before the S-cdA adduct (in the ment with the results described above. context 5′-DNA-cdA-A-T-3′), whereas Nfo exonuclease slows down 3 nt and completely blocked 1 nt before the lesion, and Characterization of APE1 Interactions with DNA Duplex Containing Apn1 is blocked at the lesion site (Fig. S2). Taken together, these 3′-Terminal S-cdA Adduct. To characterize the specificity of APE1 results suggest that a bulky S-cdA adduct placed in the middle of interactions with S-cdA adducts, we measured the kinetic param- a DNA duplex cannot be removed by AP endonuclease-catalyzed eters of excision of 3′-terminal S-cdA adduct by APE1 under NIR or by exonuclease activities. Nevertheless, human APE1 and steady-state conditions. Comparison of the kinetic constants for
Table 1. Sequence of the oligonucleotides used in the study, where X is S-cdA Oligonucleotide name Sequence 5′→3′ Source
Upstream strands Exo20A, 21 mer d(GTGGCGCGGAGACTTAGAGAA) 20 Exo20THF, 21 mer d(GTGGCGCGGAGACTTAGAGA-THF) 20, 30, 35 Exo20PG, 21 mer d(GTGGCGCGGAGACTTAGAGA-PG) This study Exo20-ScdA, 21 mer d(GTGGCGCGGAGACTTAGAGAX) This study Exo19-ScdAA, 21 mer d(GTGGCGCGGAGACTTAGAGXA) This study cdA42, 42 mer d(AGAAACAACAGCACTACTGTACTCATGXATTCTATTCCAGCA) This study Downstream strands 3′-pExo19, 19 mer pd(ATTTGGCGCGGGGAATTCC) 16, 17, 20, 28, 30 3′-pExo18, 18 mer pd(TTTGGCGCGGGGAATTCC) 16 Template strands Rex-T, 40 mer d(GGAATTCCCCGCGCCAAATTTCTCTAAGTCTCCGCGCCAC) 20, 35 T42, 42 mer d(TGCTGGAATAGAATTCATGAGTACAGTAGTGCTGTTGTTTCT) This study T55, 55 mer d(CGAGGACAGACACTGCTGGAATAGAATTCATGAGTACAGTAGTGCTGTTGTTTCT) This study Duplex name Oligonucleotides hybridized A•Trec (nick/gap) Exo20A, Rex-T and 3′-pExo19 (nick) or 3′-pExo18 (gap) 20, 35 THF•Trec Exo20THF and Rex-T 17, 35 PG•Trec Exo20PG and Rex-T This study cdA•Trec (nick/gap) Exo20-ScdA, Rex-T and 3′-pExo19 (nick) or 3′-pExo18 (gap) This study cdAA•Trec (nick/gap) Exo19-ScdAA, Rex-T and 3′-pExo19 (nick) or 3′-pExo18 (gap) This study
Mazouzi et al. PNAS | Published online July 29, 2013 | E3073 Downloaded by guest on September 23, 2021 Table 2. Steady-state kinetic parameters of the WT and D308A mutant APE1 proteins APE1 WT APE1 D308A Fold decrease of −1 −1 kcat/KM,min kcat/KM,min kcat/KM value, −1 −6 −1 −6 Substrates KM,nM kcat,min M KM,nM kcat,min M WT/D308A Source
cdA•Trec 5.4 9.3 1700 15 5.5 360 4.7 This study A•Trec 2.4 0.86 360 21 0.027 1.3 280.0 35 THF•Trec 8.2 6.4 780 5.4 0.56 104 7.5 35
SDs for KM and kcat values varied within 20–40%. Details in Materials and Methods.
recessed DNA substrates containing different DNA lesions on 3′ that the WT enzyme, E261Q, and H69A mutants bend the DNA termini (Table 2) showed that the kcat/KM value for the WT identically by making similar protein–DNA interactions (Fig. − − APE1-catalyzed excision of S-cdA adduct (1,700 min 1 μM 1) 2E). However, the state of the bound DNA in the Nfo-H69A was two- and fivefold higher compared with that for 3′-terminal structure was unexpected. Instead of showing the base of αdA − − THF residue (780 min 1 μM 1) and regular 3′-terminal dA nu- placed in the solvent-accessible pocket on the enzyme surface to − − cleotide (360 min 1 μM 1), respectively. These results indicate accommodate its 5′ phosphate in the active site for a catalytically that the efficiency of APE1 3′ cleansing activity for the S-cdA competent complex, as proposed by Hosfield et al. (22), elec- adduct was comparable to that for 3′ sugar-phosphate group and tron density maps show that the αdA site 5′ phosphate is not significantly higher than for a regular deoxynucleotide in the connected to the 3′ hydroxyl of the preceding nucleotide but is recessed DNA duplex. 13.4 Å away from the cytosine C6 (Fig. 2B and Fig. S4). The Next, to understand the mechanism of inhibition of APE1 phosphodiester bond cleavage proves that the Nfo-H69A mutant 3′→5′ exonuclease activity on the recessed DNA duplex con- was able to cleave the DNA backbone 5′ of αdA in the crystal- taining an S-cdA adduct located 1 nt away from the 3′ end, we lization solution, and thus it can recognize the αdA nucleotide as studied the interactions between APE1 and 5′-[32P]-labeled A•Trec, a target base (Fig. S5A). This cleavage occurred before the for- cdA•Trec, and cdAA•Trec duplexes using an EMSA. APE1 binds mation of the crystal because the structure represents a bound to recessed duplex cdA•Trec with 3′-terminal S-cdA more effi- NIR product in a catalytically abortive complex for exonuclease ciently than to a regular A•Trec duplex and essentially fails to activity (Fig. S5B). form stable DNA–protein complexes with cdAA•Trec duplex in which S-cdA nucleotide is located at the second position from the 3′ end of a gap (Fig. S3A). These results suggest that the lack Table 3. Crystallographic and refinement data for NfoH69A– of APE1 activity on recessed DNA duplexes containing an S-cdA DNA complex ′ adduct 1 or more nt away from the 3 end might be due to the PDB code 4K1G loss of enzyme affinity to the DNA substrate. Data collection Structure of E. coli Nfo-H69A Mutant Bound to a Cleaved DNA Duplex Beamline PROXIMA 1 (SOLEIL) Reveals the Mechanism of Exonuclease Activity. To gain insight into Wavelength (Å) 0.98
the structural basis of substrate specificity of E. coli Nfo and Space group C2221 human APE1, we performed crystallographic studies using a Cell parameters (Å) a = 117.9, b = 136.6, c = 112.4 15-mer DNA duplex containing a single α-anomeric 2′-deoxy- Resolution (Å) 40–1.9 (2.02–1.9) adenosine (αdA) nucleotide. The sequence context was taken No. of observed reflections 429,728 (68,483) from previous study by Garcin et al. (23) [Protein Data Bank No. of unique reflections 71,003 (11,229)
(PDB) code 2NQJ] of the catalytically inactive mutant E261Q Rsym (%)* 9.5 (68.1) but having an αdA•T pair instead of a AP•G pair at position 7. Completeness (%) 99.7 (98.8) Unfortunately, all attempts to cocrystallize these two WT AP I/σ 13 (2.5) endonucleases with αdA•T oligonucleotide duplex were un- Redundancy 6 successful because both enzymes contain a nonspecific3′→5′ Wilson B factor 26.58 exonuclease activity (29). Previously we have isolated Nfo-H69A Refinement statistics † mutant that contains reduced metal content and lacks NIR and Rcryst (%) 17.6 ‡ 3′→5′ exonuclease activities in the absence of divalent cations. It Rfree (%) 21.2 also contains lower AP endonuclease/3′-diesterase activities rms bond deviation (Å) 0.01 compared with WT Nfo (30). Therefore, we decided to use this rms angle deviation (°) 1.1 Nfo mutant for cocrystallization with DNA because it should not Average B (Å2), molecules A; B (no. of atoms) degrade DNA in a nonspecific manner (17). Protein 24.5; 26.8 (4,366) We succeeded in obtaining a 1.9-Å resolution X-ray structure Zn ions 20; 23.6 (4) of Nfo-H69A 15-mer αdA•T complex (Table 3). The electron DNA 46.8; 48.9 (1,182) density maps are of very good quality, and the asymmetric unit Solvent 36.3 (610) contains two identical DNA-Nfo complexes with an rmsd value Ramachandran statistics (%) of 0.13 Å between 279 Cα atoms. The small differences concern Preferred regions 98.92 four additional residues at the C terminus of molecule A (283 Allowed regions 1.08 residues) and the disordered terminal DNA base pair in mole- Outliers 0 cule B, whereas the full DNA fragment is well defined in mol- Numbers in parentheses are for the highest-resolution range. ecule A. Additionally, this structure resembles previously th *Rsym = Σhkl ΣijIi(hkl) -
E3074 | www.pnas.org/cgi/doi/10.1073/pnas.1305281110 Mazouzi et al. Downloaded by guest on September 23, 2021 PNAS PLUS
Fig. 2. Crystal structure of Nfo:αdA•T-DNA complex. (A) Superposition of the DNA fragment shown in ribbon and bound to Nfo: in magenta the 15 mer containing an αdA•T site in the H69A structure with the 3′-terminal cytosine is cyan, in orange the same 15 mer containing an AP•G site in the inactive E261Q structure (2NQJ.pdb). Nfo is shown in gray surface representation. (B) Close-up view showing the two unpaired C6:G25 in cyan. The αdA•T pair shown in pink is well stacked, making Watson–Crick-like interactions. The cleavage separates the O3′ atom of the cytosine C6 13.4 Å away from its phosphodiester bond. Hydrogen bonds are shown as black dashes. (C) Close-up view of the cytosine C6 in an abortive complex for the intrinsic exonuclease activity of Nfo. Su- perposition around the DNA cleavage site of the H69A:DNA complex (in magenta except the cytosine C6 in cyan) and the E261Q:DNA complex containing an AP site (in orange). The ribose O3′ atom of C6 rotates by 180° around the phosphate group, moving it 6.4 Å away from its intrahelical position, and points toward the mutated residue H69A. The two present Zn ions are shown in green spheres and that lost in the H69A mutant in a red sphere. Hydrogen bonds are shown as black dashes. (D) Model of S-cdA at the position of the C6 shows steric hindrance: it is in close contact (less than 2 Å) with the phosphate group of the preceding nucleotide. (E) Schematic diagram of NfoH69A–DNA interactions. Polar interactions of DNA–protein side chains and DNA–backbone atoms are shown in blue and black arrows, respectively. The active site Zn2+ ions, which bind the phosphate of the C6 nucleotide, are shown as green spheres.
The base pair αdA7•T24 is well stacked in the DNA (Fig. 2B), 2 Å from the phosphate group of the preceding nucleotide, and the phosphate group of αdA points toward the solvent. The resulting in a clash (Fig. 2D). The coordinates of all models are αdA base, which is 180° rotated around the C1’-N9 axis compared part of the Supporting Information, where Nfo coordinates for with an adenine base makes modified Watson–Crick contacts. Its Fig. 2D and Fig. S6 presented as Dataset S1; APE1 coordinates BIOCHEMISTRY N6 atom interacts with the O2 and not O4 atom of the partner for Fig. 3A and Fig. 3C as Dataset S2; S-cdA model for Fig. 2D thymine (Fig. 2B). Its N6 and N7 atoms make hydrogen bonds as Dataset S3; Nfo DNA model for Fig. 3A as Dataset S4; with Asn35 side chain. In contrast, the preceding base pair (C6: S-cdA model for Fig. 3C as Dataset S5;C6modelforFig. S6 G25) is now unpaired, with both bases being extrahelical. Al- as Dataset S6. though G occupies the previously observed position of the flip- These structural considerations can explain why E. coli Nfo- ′ S ped-out AP site opposite base in previously published Nfo•DNA H69A mutant cannot bind 3 -terminal -cdAMP nucleotide in • rec ′ complexes, the cytosine C6 occupies the position of the flipped- cdA T duplex contrary to nondamaged 3 -terminal dAMP • rec out AP site in a compact conformation (Fig. 2B). A 2-Å rear- nucleotide in A T duplex. To test this prediction, we performed ′ 32 rangement of Tyr72 side chain coupled to that of Gln36 allows C6 an EMSA using the mutant Nfo-H69A protein and 5 -[ P]- • rec • rec to adopt this particular position. The base is maintained by two labeled A T and cdA T duplexes. The results showed that under the conditions used Nfo-H69A forms a stable DNA–protein hydrogen bonds; its N4 atom interacts with the main chain car- rec ′ complex only with regular A•T duplex but not with a damaged bonyl group of the catalytic E261 residue and with a 5 phosphate • rec B oxygen of the base upstream C5 (Fig. 2C). The C6 ribose O3′ cdA T one (Fig. S3 ). These results are in agreement with our structural model demonstrating that the Nfo-H69A mutant can atom, rotated by 180° around the phosphate group, moving it 6.4 Å bind regular nicked DNA duplex in a nonproductive enzyme/ away from its intrahelical position, points toward the mutated substrate complex but loses its affinity to DNA duplex containing residue H69A and interacts with the E261 side chain (Fig. 2C). 3′-terminal S-cdA adduct at a nick site. The phosphate group is 1.6 Å away from its position to be cleaved. Moving this phosphate group to a position amenable for Superimposition of APE1 and Nfo Active Site Structures: Model of catalysis leads to a displacement of the whole cytosine compatible Human APE1–3′-Terminal S-cdA Adduct Interactions and Effect of with the presence of the His69 (Fig. S6). Thus, in the WT enzyme, D308A Mutation. Although Nfo and APE1 have distinct struc- ′ we expect that the ribose O3 atom would make an additional tures, comparison of their active site conformations reveals interaction with the His7 side chain, whereas the N4 atom would strong geometric conservation of the catalytic reaction, sup- preserve the interactions observed in the H69A mutant (Fig. S6). porting a unified mechanism for AP site removal from DNA Replacing the C6 base by dT, dA, or dG shows that any natural (32). Indeed, both enzymes flip-out the AP site in a similar DNA base would be in contact with the 5′ phosphate group of the conformation into the active site pocket. To determine whether preceding nucleotide and the E261 CO group. the conformation and the position of the 3′-terminal nucleotide To assess the effect of S-cdA, we used data from a recently for exonuclease activity were the same in Nfo and APE1, we used published NMR structure (PDB 2LSF) of DNA containing the a structural analysis similar to that described by Tsutakawa et al. lesion (31). In contrast to natural DNA bases, replacing the C6 (32). Using the common AP site substrate, we superimposed nucleotide with a S-cdA adduct (referred to as 02I in PDB 2LSF tertiary structures of APE1 (1DEW) (24) and Nfo (2NQJ) (22) of the NMR in structure) shows that the base would be less than in complex with DNA. As described, the superposition based on
Mazouzi et al. PNAS | Published online July 29, 2013 | E3075 Downloaded by guest on September 23, 2021 In Vitro Reconstitution and Repair of DNA Containing S-cdA Adducts in E. coli, Yeast, and Human Cell-Free Extracts. Removal of 3′-terminal S-cdAMP by AP endonuclease-catalyzed hydrolysis of the phos- phodiester bond on the 5′ side of the damaged nucleotide should generate 3′-OH termini and enable DNA synthesis. To examine this, we reconstituted the repair of 5′-[32P]-labeled A•Trec and cdA•Trec oligonucleotide duplexes in the presence of the purified APE1 and DNA polymerase β (POLβ) and dNTPs. Incubation of A•Trec with POLβ generated elongated products up to the full- length 40-mer product after 30 min (Fig. S9). Interestingly, addi- tion of APE1 resulted in the appearance of degradation products with size less than 21 mer owing to its processive 3′→5′ exo- nuclease activity. The presence of 3′-terminal S-cdA adduct in cdA•Trec duplex strongly inhibited the first nucleotide insertion and completely blocked POLβ-catalyzed strand elongation from Fig. 3. Model of APE1 with 3′-terminal nucleotide. (A) Superposition of the 3′-terminal S-cdAA. As expected, addition of APE1 resulted in DNA fragment of APE1:substrate (1DEW.pdb in green) and Nfo-H69A:exo (in the removal of 3′-blocking S-cdAMP and allowed the elongation magenta). Only the part of the DNA fragment of Nfo-H69A that overlays is and restoration of the damaged recessed DNA duplex by POLβ shown. APE1 is shown in gray surface representation. Because the cytosine fi C6 (shown in cyan) in exonuclease position in Nfo makes steric clashes in (Fig. S9). These results indicate that ef cient elongation of DNA APE1, the cytosine has been rotated around its phosphate group to find an primers containing 3′-blocking bulky S-cdA nucleotide can be adequate position in APE1 shown in the figure. (B) Close-up view of the reactivated by the 3′-repair cleansing function APE1. modeled cytosine in exonuclease conformation in APE1. Hydrogen bonds are Data obtained with the purified AP endonucleases show that shown as black dashes. (C) Close-up view of a modeled S-cdA adduct in exo- S-cdA nucleotide at the 3′ end are efficiently repaired by E. coli nuclease position in APE1. Hydrogen bonds are shown as black dashes. Xth and human APE1 enzymes but not by E. coli Nfo and yeast Apn1. To address the role of the AP endonuclease-catalyzed 3′ repair cleansing activity in a more physiological context, we ex- only the THF moiety in the DNA oriented the respective scissile ′ 32 • rec ′ ′ amined repair of 5 -[ P]-labeled cdA T duplex in cell-free ex- 5 phosphates and 3 ribose oxygen atoms to overlay on top of tracts from E. coli, S. cerevisiae, and HeLa cells lacking Nfo/Xth, each other. A portion of the DNA in Nfo:DNA complex (the Apn1, and APE1, respectively (Fig. 4). As expected, we observed strand from the 5′-αdA nucleotide to the downstream end and its rec robust nonspecific3′→5′ exonuclease activities on regular A•T partner strand) can be overlaid with that in APE1, and the scissile duplex in cell-free extracts from HeLa (Fig. 4, lane 2), S. cer- bond superimposes well (Fig. 3A and Fig. S7A). The superposition evisiae WT (lane 4), and E. coli WT (lane 17). The nonspecific of our present DNA structure describing the exonuclease activity exonuclease activity is strongly decreased in S. cerevisiae apn1 of Nfo on DNA in APE1 was then straightforward (Fig. S7A). This (lane 5) and E. coli xth (lane 19) but not in siRNA-APE1 silenced superposition reveals that the 3′-terminal cytosine C6 cannot be HeLa cells (lane 3) and nfo (lane 18) compared with extracts orientated and positioned in APE1 as it is in Nfo because of steric hindrances (Fig. S7B). Indeed, the ribose O3′ atom clashes with the phenol ring of Phe266, the O2 atom is less than 2 Å to the Trp280 side chain, and the N4 atom is at similar distances (less than 2 Å) from the carbonyl of N212 and the Cα of Gly231. Rotating the cytosine around the phosphate group (180° along the P-O5′ axis) leads to a unique position of C6 for APE1 exo- nuclease activity (Fig. 1A and Fig. S7C). To optimize this posi- tion, the Phe266 side chain needs to slightly reorient. Our model confirms the biochemical data showing that Phe266 mutations increase APE1-catalyzed 3′→5′ exonuclease activity (33). In our model, the ribose O3′ atom is shifted by 3.3 Å away from its intrahelical position and interacts with the Asn174 side chain and the carbonyl group of Ala130 (Fig. 3B). The N4 and O2 atoms of C6 hydrogen bond the Asp308 and Arg177 side chains, re- spectively. Replacing the C6 base by dA or dG shows that a regular purine could be adapted with a rearrangement of the Arg177 side chain and would be involved in a contact with Thr268. An S-cdA nucleotide at this position can also be ac- commodated making the same protein interactions (Fig. 3C). However, a close contact (around 2 Å) with Asp308 would force the side chain to slightly move. Therefore, Asp308 would have little or no effect on the removal of S-cdAMP. In agreement with this, the D308A mutant is capable of removing the 3′-terminal S-cdA, THF, and phosphoglycolate (PG) adducts almost as ef- ficiently as WT APE1 (Table 2 and Fig. S8). As shown in Table 2, the kcat/KM values for the APE1 D308A-catalyzed excision of 3′-terminal S-cdA, THF, and dA nucleotides were 5-, 7-, and 280-fold lower compared with that of WT APE1, respectively, indicating that D308 residue is very important for the efficient ′ ′ S Fig. 4. 3 repair activities in cell-free extracts of human, yeast, and E. coli removal of 3 -terminal regular nucleotides but not that of -cdA cells. 5′-[32P]-labeled recessed oligonucleotide duplexes (5 nM) were in- in agreement with our structure-based model of APE1-DNA cubated with 1 μg of cell-free extract for 10 min at 37 °C. The “X” denotes exo interactions. the position of S-cdA nucleotide. Details in Materials and Methods.
E3076 | www.pnas.org/cgi/doi/10.1073/pnas.1305281110 Mazouzi et al. Downloaded by guest on September 23, 2021 from WT cells. As expected, cell-free extracts from HeLa and DNA duplex at the site of mismatch (26). Therefore, we propose PNAS PLUS E. coli WT and nfo efficiently remove 3′-terminal S-cdA nucleotide that helix-distorting S-cdA adduct at the 3′ end would resemble in cdA•Trec duplex (lanes 7, 21, and 22). Importantly, extracts a melted duplex conformation similar to that of a 3′-terminal from siRNA-APE1 silenced HeLa cells and E. coli xth still contain mismatch base pair and thus would facilitate the recognition of exonuclease activity on A•Trec (lanes 3 and 19) but have lost the the adduct by APE1. activity on cdA•Trec duplexes (lanes 8 and 23). No activity was At present there are no structural data available on AP en- observed on cdAA•Trec duplex in the extracts from HeLa and donuclease-catalyzed 3′→5′ exonuclease function. Here, we solved E. coli cells (lanes 12–13 and 25–27). Interestingly, the extracts the crystal structure of Nfo mutant with nicked DNA duplex. from S. cerevisiae WTcanremovewithverylowefficiency Initially, the crystal structure of the Nfo-H69A mutant in com- S-cdAMP in cdA•Trec duplex (lane 9) and 3′-terminal dAMP in plex with a 15 mer containing a αdA•T base pair at position 7 cdAA•Trec duplex (lane 14), and this weak activity was not ob- was expected to reveal the molecular mechanism of the NIR served in apn1 extracts (lanes 10 and 15), thus confirming results activity because the H69A mutant was previously shown to be obtained with the purified protein. These results suggest that in inactive for both NIR and 3′→5′ exonuclease functions owing to yeast extracts S-cdA adducts present in DNA duplex could be a loss of one Zn atom (30). Surprisingly, the cocrystal structure removed, albeit inefficiently, by combined action of Apn1 and showed a cleaved αdA•T duplex (the expected product of WT nonidentified factors. Taken together the results obtained with Nfo). The NIR product with the 3′-terminal cytosine C6 bound cell-free systems confirm the role of APE1, Apn1, and Xth to the enzyme’s active site forms a nonproductive complex with proteins in the repair of bulky S-cdA adduct when present next the Nfo-H69A mutant, which is unable to perform exonuclease to a DNA strand break in human, yeast, and E. coli cells. activity. This structure of the Nfo-H69A:DNA complex with the 3′-terminal cytosine C6 bound to the enzyme active site is very Discussion interesting and informative for understanding the mechanism of Structurally unusual helix-distorting cdA and cdG adducts in 3′→5′ exonuclease activity of the WT Nfo, because both mutant DNA are biologically important owing to their strong inhibitory and WT enzymes behave identically. Indeed, both Nfo proteins effect on DNA replication and transcription. The presence of recognize an AP site and 3′-terminal nucleotide by binding and C8-C5′ covalent bond prevents repair of cdPu by DNA glyco- distorting two DNA substrates by 90° and flipping-out the base sylase-mediated excision and direct damage reversal. Therefore, opposite the target AP site or the 3′-terminal base (Fig. 2 and cells use the NER system to remove cdPu adducts in vitro and in Fig. S6). Because the 3′-end of C6 nucleotide overlaps with the vivo (4, 8, 9). However, ionizing radiation, breakage of replica- AP site, a slight shifting of the C6 nucleotide to bring it in an tion forks stalled at bulky DNA lesions, and/or misincorporation amenable position for catalysis was accomplished by super- of oxidatively damaged precursors during DNA synthesis can imposing the complexed H69A and WT Nfo structures. It is generate cdPu lesions located in close proximity to strand breaks, important to note that the catalytic 5′-phosphate group in the making them resistant to NER. Therefore, alternative repair resulting model stays in the same scissile position for both AP pathways may exist to remove these endogenous helix-distorting endonuclease and 3′-exonuclease activities of Nfo, ensuring the DNA lesions at DNA termini. hydrolysis of phosphodiester bond. Replacing C6 by either A, G, Here, we investigated the mechanism of 3′→5′ exonuclease or T nucleotide was also straightforward. All these regular nucleo- activity of AP endonucleases involved in the BER and NIR tides can be accommodated in the WT Nfo active site, thus BIOCHEMISTRY pathways and their ability to recognize S-cdA adducts in DNA explaining the structural basis of nonspecific3′ exonuclease duplex. We have shown that the S-cdA nucleotide, when present function of Nfo. It should be stressed that the compact and in fully duplex DNA, is not a substrate of the AP endonuclease- curved position of the 3′-terminal C6 nucleotide, which interacts catalyzed NIR activity, but it can be a substrate of AP endonu- with the phosphate group of an upstream C5 nucleotide, is not clease-catalyzed 3′→5′ exonuclease activity when present at the compatible with the presence of a S-cdA, which will generate 3′ end of single-stranded DNA break. E. coli Xth and human steric hindrance in the enzyme’s active site. Therefore, the in- APE1, but not E. coli Nfo and yeast Apn1, remove S-cdA ability of Nfo to remove 3′-terminal S-cdA adduct comes from an adducts at 3′ termini of recessed DNA duplex with high effi- inadequate accommodation of this nucleotide in the enzyme ciency. However, when the S-cdA nucleotide is located 1 or more active site pocket. In agreement with previous data (30), the nt away from the 3′ termini of a DNA duplex, it strongly blocks complex of Nfo with cleaved DNA well illustrates that after in- the 3′→5′ exonuclease activity of all AP endonucleases tested. cision of the duplex 5′ next to the lesion site by NIR activity, Nfo Our EMSA data suggest that APE1 fails to bind DNA duplexes proceeds further to degrade DNA by its 3′→5′ exonuclease ac- with S-cdA adduct located at the second position from the 3′ end tivity at the site of the nick and that this latter function fails when of a gap. Taken together these results establish that 3′-terminal the imidazole group of His69 and Zinc-1 atom are absent. S-cdA adduct in gapped DNA duplex can be removed by an Recent work by Tsutakawa et a. (32) demonstrated that ter- alternative mechanism distinct from NER that involves 3′→5′ tiary structures of APE1 and Nfo in complex with DNA can be exonuclease function of the Xth family AP endonucleases. superimposed. Therefore, the structure of Nfo-H69A:DNA com- It should be stressed that Xth and APE1 contain two distinct plex can serve as an excellent template for modeling of interactions activities toward DNA strand breaks: a 3′ repair diesterase between active site of APE1 and DNA to provide the structural function that catalyzes removal of 3′-dRP groups (34), and 3′→5′ basis for the enzyme’s3′ repair activities. Using superimposed exonuclease, which catalyzes nonspecific removal of regular and active site structures of APE1:AP site-DNA and Nfo:AP site- oxidized bases (19, 20). Comparison of APE1 exonuclease ac- DNA complexes, we have been able to observe how the C6 tivities on recessed, gapped, and nicked DNA duplexes as well as nucleotide in Nfo would be positioned in APE1. The confor- kinetic data for recessed DNA substrates revealed that APE1 mation of C6 nucleotide adopted in the Nfo’s active site results in was much more efficient on 3′-terminal S-cdA compared with steric clashes with F266, W280, G231, and CO Asn212 amino acid a regular dA nucleotide. This strongly suggests that APE1-cat- residues of APE1. To avoid steric hindrance and to accommodate alyzed 3′ cleansing activities are highly specific to damaged C6 into the APE1 active site, we rotated the nucleotide around its DNA. Interestingly, APE1 also removes mismatched nucleotides 5′ phosphate group, fixing it in catalytic position. In the resulting from the 3′ terminus of DNA much more efficiency than model, N174 interacts with the ribose O3′ atom of C6, whereas nucleotides from matched pairs (26–28). It was suggested that D308 interacts with the C6 base moiety and maintains the 3′-ter- the efficiency of APE1’s proof-reading exonuclease activity minal nucleotide in a position favorable for exonuclease activity depends primarily on the melted conformation of the 3′ end of of APE1. Most interestingly, replacing the 3′ end C6 by an S-cdA
Mazouzi et al. PNAS | Published online July 29, 2013 | E3077 Downloaded by guest on September 23, 2021 nucleotide creates no steric hindrance except a small rear- to the drug’s cytotoxicity (38). It is tempting to speculate that rangement of D308 side chain to accommodate the bulky adduct. tirapazamine treatment may generate DNA strand breaks con- The present model of APE1 interactions with 3′-terminal nu- taining cdPu adducts and that this specific APE1 activity on the cleotide adducts provides the structural basis for the observed 3′ 3′-terminal lesions described in the present work could provide repair exonuclease activity toward regular nucleotides and S-cdA a rationale for the use of APE1 inhibitors to enhance effective- adduct and reveals the role of D308 residue. In agreement ness of tirapazamine and perhaps other anticancer drugs. Pre- with this model, we showed that APE1-D308A mutant can viously, it was shown that APE1 removes β-L-Dioxolane-cytidine S • rec fi remove -cdA adduct in cdA T duplex with good ef ciency, (L-OddC), a nonnatural stereochemical L-nucleoside analog, similar to that of WT APE1 (Table 2), indicating that APE1 when incorporated at the 3′ terminus of duplex DNA by DNA removes the damaged bulky nucleotide by its 3′ repair cleansing polymerases (39). APE1 was also shown to remove 3′-tyrosyl function. Furthermore, we have previously demonstrated that residues from the recessed and nicked DNA duplexes, suggesting D308A mutant has dramatically decreased 3′→5′ exonuclease its potential role in the processing of covalent topoisomerase I: activity compared with WT APE1 (35). DNA complexes generated by anticancer drugs (27). Recently it S The lack of exonuclease activity toward -cdA adduct in has been demonstrated that 5′S isomer of cdATP could be in- • rec cdAA T duplex in all AP endonuclease tested observed in our corporated more efficiently than the 5′R isomer by replicative studies is very intriguing. To examine the structural basis of this DNA polymerases during DNA synthesis (14). On the basis of exonuclease resistance, we used the recently published NMR S the results reported here, we propose that APE1 may act in structure of duplex DNA containing -cdA nucleotide (31) to a similar manner on above adducts and also on 3′-terminal superimpose it onto DNA bound to APE1. As described, the S S -cdA nucleotides resulting from DNA polymerase catalyzed presence of -cdA nucleotide at position 6 in DNA duplex re- misincorporation. Such an activity would be of relevance to the sults in the decrease of the phosphate oxygen atom (from residue S ′ S proposal that -cdA could be used as an anticancer and/or an- at position 7)-O5 (from -cdA) bond distance that shortens by tiviral drug (14). approximately 1 Å (31), which could explain the lack of exo- Finally, recent studies from the Dizdaroglu laboratory (40) nuclease activity toward S-cdA nucleotide in cdAA•Trec duplex have found that both free R-cdA and S-cdA nucleosides can be in all AP endonucleases tested. Therefore, the shorter distance detected in human urine. Whether this material derived from of 6.3 Å between the phosphate group of S-cdA and that of the nuclease digestion of cdA-containing oligonucleotides resulting 3′ nucleotide instead of 7.05 Å between two regular nucleotides from NER, and/or APE1-catalyzed repair, and/or digestion of probably leads to an incorrect positioning of the scissile phos- phodiester bond in the AP endonuclease active site and conse- DNA from dead cells remains to be determined. However, on quently to the loss of both 3′ repair activities and stable binding the basis of the current results, an intriguing possibility is that to cdAA•Trec duplex. Finally, although the conserved structural AP endonucleases play a key role in the generation of urinary chemistry of active sites of APE1 and Nfo supports a unified cdA, which could be a biomarker of endogenous oxidative stress mechanism for the AP site cleavage in DNA, our structural to DNA. models reveal that this mechanism cannot be extended to APE1 Materials and Methods and Nfo exonuclease activities. The conformation and position of the 3′-terminal nucleotide for exonuclease activity differs between Oligonucleotides, Proteins, and Antibodies. Sequences of the oligonucleotides and their duplexes used in the present work are shown in Table 1. All oli- these two enzymes and thus involves different protein interactions. fi gonucleotides were purchased from Eurogentec, including regular oligo- This also leads to a different DNA substrate speci city of their nucleotides and those containing S-cdA, αdA, THF, and PG. Before enzymatic respective exonuclease functions. In conclusion, the structural assays oligonucleotides were either 5′-end-labeled by T4 polynucleotide ki- data described in the present work provide insight into the nase (New England Biolabs, Ozyme) in the presence of [γ-32P]-ATP (3,000 Ci/ mechanism of 3′ cleansing activity of the Nfo and Xth families of mmol-1) (PerkinElmer), or 3′-end-labeled by terminal deoxynucleotidyl trans- AP endonucleases. ferase (New England Biolabs) in the presence of [α-32P]-3′-dATP (Cordycepin Ionizing radiation and certain anticancer drugs generate 5′-triphosphate, 5,000 Ci/mmol-1) (PerkinElmer) as recommended by the complex or “dirty” DNA strand breaks containing 3′ end proxi- manufacturers. Radioactively labeled oligonucleotides were desalted with mal damaged bases, which are poorly repaired by classic BER a Sephadex G-25 column equilibrated in water and then annealed with and NER pathways (21, 36). Here we demonstrate that APE1- corresponding complementary strands for 3 min at 65 °C in a buffer con- catalyzed removal of 3′-terminal S-cdA nucleotide in recessed taining 20 mM Hepes-KOH (pH 7.6) and 50 mM KCl. The sequence of the 15-mer DNA duplex used for crystallization assays is DNA duplex enables otherwise blocked DNA polymerase syn- α thesis in vitro, pointing to a possible role of APE1 in cleansing of d(GCGTCCXCGACGACG)/d(CGTCGTCGTGGACGC), where X is dA. The oli- gonucleotides were hybridized by mixing equal concentrations (10 mM) in complex and/or dirty DNA strand breaks (Fig. 2). To further · fi 2 mM Tris HCl (pH 7.0) heated to 65 °C for 3 min and cooled down to room substantiate physiological relevance of this speci c repair func- temperature over 2 h. The MALDI-TOF mass spectrometry analysis of the tion of AP endonucleases, we demonstrated the presence of the oligonucleotides performed by the manufacturer validated their size and 3′ repair activities in cell-free extracts toward DNA duplexes homogeneity. In addition the purity and integrity of the oligonucleotide containing a 3′-terminal S-cdA adduct (Fig. 4). Importantly, under preparations were verified by denaturing PAGE. The siRNA sequences used the experimental condition used we did not observe significant to decrease APE1 in HeLa cells have been taken from previously described repair of cdAA•Trec duplex in any cell-free extracts tested. In- studies (41). The siRNA specific to mouse major AP endonuclease, mAPEX, terestingly, we have identified a weak Apn1-independent activity was used as negative control in both cases. on cdA•Trec duplex in yeast extracts and also found that extracts All AP endonucleases, their mutants, and human DNA glycosylase Neil1 from WT cells and the purified Apn1 can remove a regular dA used in the present study were expressed and purified in their native form fi nucleotide in cdAA•Trec duplex, albeit with low efficiency. Thus, without tags or other modi cations as described previously (16, 17). The fi β S. cerevisiae contains two enzymes: Apn1 and unknown exo- puri ed human DNA POL and T4 DNA polymerase were purchased from Trevigen and New England Biolabs, respectively. nuclease that can remove S-cdA adducts when located 1 or more ′ nt away from the 3 end of strand breaks. Strains, Extract Preparation, Cell Culture, and Silencing of APE1 Expression. Tirapazamine is an experimental bioreductively activated an- AB1157 [IeuB6 thr-1 Δ(gpt-proA2) hisG4 argE3 lacY1 gaIK2 ara-14 mtl-1 ticancer drug that selectively kills cells under hypoxia (37). It has xyl-5 thi-1 tsx-33 rpsL31 supE44 rac] (WT) and its isogenic derivatives BH130 been demonstrated that in vitro tirapazamine mediates forma- (nfo::kanR) and BH110 (nfo::kanR [Δ(xth-pncA)90 X::Tn10]) were from the tion of 8,5′-cyclopurine-2’-deoxynucleosides in DNA under laboratory stock (42). S. cerevisiae FF18733 WT strain (MATa his7-3 leu2- hypoxic condition, suggesting that these lesions may contribute 1,112 lys1-1 trp1-289 ura3-52) and its isogenic derivative BG1 (apn1Δ::HIS3)
E3078 | www.pnas.org/cgi/doi/10.1073/pnas.1305281110 Mazouzi et al. Downloaded by guest on September 23, 2021 were kindly provided by S. Boiteux (French Alternative Energies and Atomic sitting-drop vapor diffusion experiments using a nanodrop Cartesian robot PNAS PLUS Energy Commission, France). (Proteomic Solutions) at 293 K. One condition [number 88: 30% (wt/vol) PEG
Crude cellular extracts from E. coli, S. cerevisiae, and HeLa cells with down- 4000, 0.1 M Tris·HCl (pH 8.5), and 0.2 M MgCl2] in the Classics suite was regulated APE1 expression were prepared as described previously (16, 20, 43). manually optimized with home-made solutions in hanging drops composed of 1:1 volume ratio of crystallization solution and of Nfo-H69A:DNA complex. DNA Repair Assays. The 3′-phosphodiesterase/exonuclease activity assay of Crystals obtained in 0.1 M Tris·HCl (pH 8.0), 12% (wt/vol) PEG 4000, and 200 APE1 was performed in the standard reaction mixture (20 μL) containing mM MgCl2 were flash-frozen in a cryo-protecting solution consisting of the 32 5nMof[ P]-labeled oligonucleotide duplexes, 50 mM KCl, 20 mM Hepe- mother solution supplemented with 20% (wt/vol) PEG 400. · s KOH (pH 6.8), 0.1 mg/mL BSA, 1 mM DTT, 1 mM MgCl2, and a limited X-ray diffraction data were collected at 100 K on beamline PROXIMA I at amount of pure protein or extract; when measuring repair activities in hu- SOLEIL, and intensities were integrated using XDS19.Theasymmetricunitcan man cell-free extracts BSA and DTT were omitted. For bacterial cell-free contain two complexes of Nfo-H69A:DNA, corresponding to a Matthews co- extracts and the purified Xth and Apn1 proteins, the standard reaction efficient(44)of2.78Å3 Da−1 and a solvent content of 55.8%. The phase problem mixture (20 μL) contained 5 nM of [32P]-labeled DNA substrate, 50 mM KCl, was solved by molecular replacement using the program PHASER (45) and an 20 mM Hepes·KOH (pH 7.6), 0.1 mg/mL BSA, and 5 mM MgCl2, except when incubating with Nfo, when MgCl was omitted from the buffer. Nfo mutant:DNA structure (PDB code 2NQJ) as a search model. The resulting 2 fi The reactions were stopped by adding 10 μL of a solution containing 0.5% atomic model was re ned using BUSTER (46) and manually improved using 23 fi SDS and 20 mM EDTA and then desalted by hand-made spin columns filled COOT . Data collection and re nement statistics are given in Table 3. His-109 is fi with Sephadex G25 (Amersham Biosciences) equilibrated in 7.5 M urea. not well de ned in the electron density owing to the absence of the Zn1 ion. Purified reaction products were separated by electrophoresis in denaturing 20% (wt/vol) polyacrylamide gels (7 M urea, 0.5× tris-borate-EDTA buffer, ACKNOWLEDGMENTS. We thank Dr. Jacques Laval for critical reading of the 42 °C). Gels were exposed to a Fuji FLA-3000 Phosphor Screen and analyzed manuscript and thoughtful discussions, and Dr. Beatriz Guimaraes for help in using Image Gauge V3.12 software. data collection on PROXIMA I at SOLEIL. This work was supported by Fondation de France Grant 2012 00029161 (to A.A.I.) (www.fondationdefrance.org); The kinetic parameters for exonuclease activity of APE1 were measured as “ fi fl – Russian Federal Program Scienti c and education personnel for innovative described previously (35). Brie y, 2 1,000 nM of duplex oligonucleotide Russia” for 2009–2013 No. 8473 (to A.A.I.) (www.fcpk.ru); Centre National substrate was incubated with 0.2 nM APE1 under standard reaction con- de la Recherche Scientifique funds to S.M. and Grant PICS N5479-Russie (to ditions, the linear velocity was measured, and the KM and kcat constants M.K.S.) (www.cnrs.fr); Agence Nationale pour la Recherche Blanc 2010 Projet were determined from Lineweaver-Burk plots. All biochemical experiments ANR-09-GENO-000 (to M.K.S.) (www.agence-nationale-recherche.fr); and Elec- were performed independently and repeated at least three times. tricité de France Contrat Radioprotection RB 2012 (to M.K.S.) (www.edf.fr). The crystallization work has benefited from the Laboratoire d’Enzymologie et Bio- chimie Structurales (LEBS) facilities of the IMAGIF Structural Biology and Pro- Crystallographic Analysis. The E. coli Nfo-H69A mutant was cloned, expressed, “ ” fi teomic Unit in the Centre de Recherche de Gif (www.imagif.cnrs.fr). A.M. and puri ed as previously described (17). In crystallization trials, the 15-mer and B.A. were supported by the student scholarships from Institut de Cancér- DNA duplex was mixed with Nfo-H69A used at a concentration of 18 mg/mL in ologie Gustave-Roussy (www.igr.fr) and the Bolashak International Program, a buffer containing 50 mM KCl and 20 mM Hepes·KOH (pH 7.6) in a 2:1 stoi- Kazakhstan (www.bolashak.gov.kz), respectively. Funding for open access charge chiometry. Commercial crystallization solutions (Qiagen kits) were screened in was provided by Agence Nationale pour la Recherche.
1. Hoeijmakers JH (2009) DNA damage, aging, and cancer. N Engl J Med 361(15):1475–1485. 18. Wilson DM, 3rd, Barsky D (2001) The major human abasic endonuclease: Formation, 2. Cadet J, Douki T, Gasparutto D, Ravanat JL (2003) Oxidative damage to DNA: consequences and repair of abasic lesions in DNA. Mutat Res 485(4):283–307. Formation, measurement and biochemical features. Mutat Res 531(1-2):5–23. 19. Chou KM, Cheng YC (2002) An exonucleolytic activity of human apurinic/apyrimidinic
3. Theruvathu JA, Jaruga P, Dizdaroglu M, Brooks PJ (2007) The oxidatively induced DNA endonuclease on 3′ mispaired DNA. Nature 415(6872):655–659. BIOCHEMISTRY lesions 8,5′-cyclo-2′-deoxyadenosine and 8-hydroxy-2′-deoxyadenosine are strongly 20. Ishchenko AA, Yang X, Ramotar D, Saparbaev M (2005) The 3′->5′ exonuclease of resistant to acid-induced hydrolysis of the glycosidic bond. Mech Ageing Dev 128(9): Apn1 provides an alternative pathway to repair 7,8-dihydro-8-oxodeoxyguanosine in – 494 502. Saccharomyces cerevisiae. Mol Cell Biol 25(15):6380–6390. ′ 4. Kuraoka I, et al. (2000) Removal of oxygen free-radical-induced 5 ,8-purine 21. Parsons JL, Dianova II, Dianov GL (2005) APE1-dependent repair of DNA single-strand cyclodeoxynucleosides from DNA by the nucleotide excision-repair pathway in human breaks containing 3′-end 8-oxoguanine. Nucleic Acids Res 33(7):2204–2209. – cells. Proc Natl Acad Sci USA 97(8):3832 3837. 22. Hosfield DJ, Guan Y, Haas BJ, Cunningham RP, Tainer JA (1999) Structure of the DNA 5. Kuraoka I, et al. (2001) Oxygen free radical damage to DNA. Translesion synthesis by repair enzyme endonuclease IV and its DNA complex: Double-nucleotide flipping at human DNA polymerase eta and resistance to exonuclease action at cyclopurine abasic sites and three-metal-ion catalysis. Cell 98(3):397–408. deoxynucleoside residues. J Biol Chem 276(52):49283–49288. 23. Garcin ED, et al. (2008) DNA apurinic-apyrimidinic site binding and excision by 6. Marietta C, Gulam H, Brooks PJ (2002) A single 8,5′-cyclo-2′-deoxyadenosine lesion in endonuclease IV. Nat Struct Mol Biol 15(5):515–522. a TATA box prevents binding of the TATA binding protein and strongly reduces 24. Mol CD, Izumi T, Mitra S, Tainer JA (2000) DNA-bound structures and mutants reveal abasic transcription in vivo. DNA Repair (Amst) 1(11):967–975. – 7. Marietta C, Brooks PJ (2007) Transcriptional bypass of bulky DNA lesions causes new DNA binding by APE1 and DNA repair coordination [corrected]. Nature 403(6768):451 456. mutant RNA transcripts in human cells. EMBO Rep 8(4):388–393. 25. Gros L, Ishchenko AA, Ide H, Elder RH, Saparbaev MK (2004) The major human AP 8. Brooks PJ, et al. (2000) The oxidative DNA lesion 8,5′-(S)-cyclo-2′-deoxyadenosine is endonuclease (Ape1) is involved in the nucleotide incision repair pathway. Nucleic repaired by the nucleotide excision repair pathway and blocks gene expression in Acids Res 32(1):73–81. fi mammalian cells. J Biol Chem 275(29):22355–22362. 26. Dyrkheeva NS, Lomzov AA, Pyshnyi DV, Khodyreva SN, Lavrik OI (2006) Ef ciency of 9. D’Errico M, et al. (2006) New functions of XPC in the protection of human skin cells exonucleolytic action of apurinic/apyrimidinic endonuclease 1 towards matched and from oxidative damage. EMBO J 25(18):4305–4315. mismatched dNMP at the 3′ terminus of different oligomeric DNA structures 10. D’Errico M, et al. (2007) The role of CSA in the response to oxidative DNA damage in correlates with thermal stability of DNA duplexes. Biochim Biophys Acta 1764(4):699–706. human cells. Oncogene 26(30):4336–4343. 27. Wilson DM, 3rd (2003) Properties of and substrate determinants for the exonuclease 11. Kirkali G, de Souza-Pinto NC, Jaruga P, Bohr VA, Dizdaroglu M (2009) Accumulation activity of human apurinic endonuclease Ape1. J Mol Biol 330(5):1027–1037. of (5’S)-8,5′-cyclo-2′-deoxyadenosine in organs of Cockayne syndrome complementation 28. Chou KM, Cheng YC (2003) The exonuclease activity of human apurinic/apyrimidinic group B gene knockout mice. DNA Repair (Amst) 8(2):274–278. endonuclease (APE1). Biochemical properties and inhibition by the natural dinucleotide 12. Wang J, Clauson CL, Robbins PD, Niedernhofer LJ, Wang Y (2012) The oxidative DNA Gp4G. JBiolChem278(20):18289–18296. ′ fi lesions 8,5 -cyclopurines accumulate with aging in a tissue-speci c manner. Aging Cell 29. Retailleau P, Ishchenko AA, Kuznetsov NA, Saparbaev M, Moréra S (2010) Crystallization – 11(4):714 716. and preliminary X-ray analysis of human endonuclease 1 (APE1) in complex with 13. Wang Y, Liu X, Matsuda A, Plunkett W (2008) Repair of 2′-C-cyano-2′-deoxy-1-beta-D- an oligonucleotide containing a 5,6-dihydrouracil (DHU) or an alpha-anomeric 2′- arabino-pentofuranosylcytosine-induced DNA single-strand breaks by transcription- deoxyadenosine (alphadA) modified base. Acta Crystallogr Sect F Struct Biol Cryst coupled nucleotide excision repair. Cancer Res 68(10):3881–3889. Commun 66(Pt 7):798–800. 14. Kamakura N, Yamamoto J, Brooks PJ, Iwai S, Kuraoka I (2012) Effects of 30. Ishchenko AA, et al. (2006) Uncoupling of the base excision and nucleotide incision 5′,8-cyclodeoxyadenosine triphosphates on DNA synthesis. Chem Res Toxicol 25(12): repair pathways reveals their respective biological roles. Proc Natl Acad Sci USA 2718–2724. – 15. Sancar A, Lindsey-Boltz LA, Unsal-Kaçmaz K, Linn S (2004) Molecular mechanisms of 103(8):2564 2569. mammalian DNA repair and the DNA damage checkpoints. Annu Rev Biochem 73:39–85. 31. Zaliznyak T, Lukin M, de los Santos C (2012) Structure and stability of duplex DNA ’ ′ ′ 16. Daviet S, et al. (2007) Major oxidative products of cytosine are substrates for the containing (5 S)-5 ,8-cyclo-2 -deoxyadenosine: An oxidatively generated lesion repaired nucleotide incision repair pathway. DNA Repair (Amst) 6(1):8–18. by NER. Chem Res Toxicol 25(10):2103–2111. 17. Golan G, Ishchenko AA, Khassenov B, Shoham G, Saparbaev MK (2010) Coupling of 32. Tsutakawa SE, et al. (2013) Conserved structural chemistry for incision activity in the nucleotide incision and 3′—>5′ exonuclease activities in Escherichia coli endonuclease structurally non-homologous apurinic/apyrimidinic endonuclease APE1 and IV: Structural and genetic evidences. Mutat Res 685(1-2):70–79. endonuclease IV DNA repair enzymes. J Biol Chem 288(12):8445–8455.
Mazouzi et al. PNAS | Published online July 29, 2013 | E3079 Downloaded by guest on September 23, 2021 33. Hadi MZ, Ginalski K, Nguyen LH, Wilson DM, 3rd (2002) Determinants in nuclease 40. Jaruga P, Dizdaroglu M (2010) Identification and quantification of (5’R)- and (5’S)- specificity of Ape1 and Ape2, human homologues of Escherichia coli exonuclease III. J 8,5′-cyclo-2′-deoxyadenosines in human urine as putative biomarkers of oxidatively Mol Biol 316(3):853–866. induced damage to DNA. Biochem Biophys Res Commun 397(1):48–52. 34. Demple B, Harrison L (1994) Repair of oxidative damage to DNA: Enzymology and 41. Wang D, Luo M, Kelley MR (2004) Human apurinic endonuclease 1 (APE1) expression – biology. Annu Rev Biochem 63:915 948. and prognostic significance in osteosarcoma: Enhanced sensitivity of osteosarcoma to 35. Gelin A, et al. (2010) Genetic and biochemical characterization of human AP endo- DNA damaging agents using silencing RNA APE1 expression inhibition. Mol Cancer nuclease 1 mutants deficient in nucleotide incision repair activity. PLoS ONE 5(8):e12241. Ther 3(6):679–686. 36. Peng X, Ghosh AK, Van Houten B, Greenberg MM (2010) Nucleotide excision repair of 42. Ishchenko AA, Sanz G, Privezentzev CV, Maksimenko AV, Saparbaev M (2003) Charac- a DNA interstrand cross-link produces single- and double-strand breaks. Biochemistry terisation of new substrate specificities of Escherichia coli and Saccharomyces 49(1):11–19. – 37. Zeman EM, Brown JM, Lemmon MJ, Hirst VK, Lee WW (1986) SR-4233: A new bioreductive cerevisiae AP endonucleases. Nucleic Acids Res 31(21):6344 6353. agent with high selective toxicity for hypoxic mammalian cells. Int J Radiat Oncol Biol Phys 43. Ischenko AA, Saparbaev MK (2002) Alternative nucleotide incision repair pathway for 12(7):1239–1242. oxidative DNA damage. Nature 415(6868):183–187. 38. Birincioglu M, et al. (2003) DNA base damage by the antitumor agent 3-amino-1,2,4- 44. Matthews BW (1968) Solvent content of protein crystals. J Mol Biol 33(2):491–497. benzotriazine 1,4-dioxide (tirapazamine). J Am Chem Soc 125(38):11607–11615. 45. Storoni LC, McCoy AJ, Read RJ (2004) Likelihood-enhanced fast rotation functions. 39. Chou KM, Kukhanova M, Cheng YC (2000) A novel action of human apurinic/apyrimidinic Acta Crystallogr D Biol Crystallogr 60(Pt 3):432–438. endonuclease: Excision of L-configuration deoxyribonucleoside analogs from the 3′ termini 46. Blanc E, et al. (2004) Refinement of severely incomplete structures with maximum of DNA. J Biol Chem 275(40):31009–31015. likelihood in BUSTER-TNT. Acta Crystallogr D Biol Crystallogr 60(Pt 12 Pt 1):2210–2221.
E3080 | www.pnas.org/cgi/doi/10.1073/pnas.1305281110 Mazouzi et al. Downloaded by guest on September 23, 2021