DOCSLIB.ORG

Cytochrome C Oxidase Subunit 1 (COI) Profile of the Philippine Helicostylinae (Gastropoda: Stylommatophora: Camaenidae)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Cytochrome C Oxidase Subunit 1 (COI) Profile of the Philippine Helicostylinae (Gastropoda: Stylommatophora: Camaenidae) Philippine Journal of Science 148 (S1): 1-13, Special Issue on Genomics ISSN 0031 - 7683 Date Received: 31 Jan 2019 Cytochrome C Oxidase Subunit 1 (COI) Profile of the Philippine Helicostylinae (Gastropoda: Stylommatophora: Camaenidae) Gizelle A. Batomalaque1,4,*, Gerard Clinton L. Que1, Tyrill Adolf B. Itong5, Anna Regina L. Masanga1, Emmanuel Ryan C. de Chavez3, and Ian Kendrich C. Fontanilla1,2 1Insitute of Biology, College of Science, University of the Philippines Diliman, Quezon City 1101 Philippines 2Natural Sciences Research Institute, University of the Philippines Diliman, Quezon City 1101 Philippines 3Institute of Biological Sciences, College of Arts and Sciences, University of the Philippines Los Baños 4031 Laguna, Philippines 4Department of Biodiversity, Earth and Environmental Sciences, College of Arts and Sciences, Drexel University, Philadelphia, PA 19104 USA 5College of Science, University of the Philippines Cebu, Cebu City 6000 Philippines The Philippines is the center of radiation of the land snail subfamily Helicostylinae, with around 253 recognized species. Despite their morphological diversity, research on their biology and taxonomy is lacking. We present here the first mitochondrial COI profiles of 32 species of Philippine helicostyline land snails. With the addition of sequences downloaded from GenBank, we tested the utility of the COI for species identification. Relative distributions of intraspecific and interspecific distances overlapped; hence, no barcoding gap was observed. However, 90% of uncorrected interspecific comparisons can distinguish species at 14% genetic distance or lower. Furthermore, the COI barcodes could not discriminate several co-distributed species that have similar conchological features, which should be flagged for taxonomic re-evaluation. Keywords: DNA barcoding, Helicostylinae, mitochondrial COI, Philippine land snails INTRODUCTION exhibit a range in shell forms from discoidal, depressed and keeled, globose, to elongated conical forms (Parkinson The Helicostylinae, a subfamily under family Camaenidae et al. 1987). Within the Philippines, different helicostyline (sensu Bouchet et al. 2017) and order Stylommatophora, species vary in distributions, with most occurring in are hermaphroditic ground and tree snails whose center single islands (e.g., Anixa siquijorensis in Siquijor Is. of diversity is the Philippine Islands (Parkinson et al. and Helicostyla (Calocochlea) chrysocheila in Luzon 1987, Abbott 1989, de Chavez et al. 2015) and whose Is.) and some occurring in multiple adjacent islands (e.g., distribution extends to Taiwan, the Moluccas, and the Leytia fragilis in Samar and Leyte islands and Trachystyla smaller islands off the coast of Borneo (Schileyko 2004, cryptica in the islands of Samar, Leyte, and Mindanao). Schilthuizen et al. 2013). Members of this subfamily There are about 245 species (Batomalaque n/p, Faustino 1930, Richardson 1983, Abbott 1989) belonging to *Corresponding author: [email protected] 1 Special Issue on Genomics Batomalaque et al.: Philippine Helicostylinae DNA Barcodes 23 genera (Schileyko 2004, Bouchet et al. 2017). The amplification using Taq DNA Polymerase and dNTPack current taxonomy of the helicostylines is based on shell (Roche, USA), and universal (forward LCO 1490 morphology, although the reproductive anatomy for GGTCAACAAATCATAAACATATTGG, reverse HCO some species has been described (Schileyko 2004). No 2198 TAAACTTCAGGGTGACCAAAAAATCA; Folmer molecular work has been done to evaluate their current et al. 1994) and stylommatophoran-specific (forward STY_ classification, and phylogenetic relationships among the LCOii ACGAATCATAAGGATATTGGTAC, reverse species are unknown. STY_HCO GAATTAAAATATATACTTCTGGGTG; Fontanilla et al. 2017) primers for the mitochondrial The mitochondrial cytochrome c oxidase subunit 1 (COI) cytochrome c oxidase subunit I (COI) gene. A 50 μL PCR gene has been the gene of choice for DNA barcoding in mix consisted of the following components: 5 μL of 10X animals (Hebert et al. 2003, Meyer and Paulay, 2005, PCR buffer; 1 μL of 10 mM dNTP; 2.5 μL each of 10 mM Park et al. 2011, Siddall et al. 2012, Perez et al. 2014). forward and reverse primers; 22.75 μL distilled water; However, its utility in species discrimination in low- 0.25 μL Taq-polymerase (5 units/μL); 10 μL Q-buffer vagility species (Davison et al. 2009, Virgilio et al. 2010) (Qiagen, USA); 2 μL of 15 mM MgCl2; and 4 μL of 10 appears to be fraught with high error rates due to lack of mM DNA. Amplification protocol consisted of 2 min at baseline differences established through morphology and 94°C followed by 38 cycles of 30 sec at 94°C, 30 sec at a DNA sequence database. In land snails, several studies 45°C, 60 sec at 65°C, and a final extension of 5 min at have shown high levels of mtDNA sequence divergence 72°C. PCR products were visualized in a 1% agarose gel in intraspecific populations (Watanabe and Chiba 2001, using EtBr UV illumination. Pfenniger and Posada 2002, Davison et al. 2009). Amplified PCR products were extracted using QIAquick® In this paper, we present the first COI profiles of the Gel Extraction Kit (Qiagen, USA). Purified samples were Philippine helicostyline land snails, and we test the sent to 1stBASE, Malaysia for sequencing. utility of 463-bp COI barcodes in distinguishing among morphological species. Sequence Alignment and DNA Barcoding Analysis Sequences were assembled using the STADEN package v.1.5.3 (Staden et al. 2000), and aligned using BioEdit MATERIALS AND METHODS v.5.0.5 (Hall 1999). Only unambiguously aligned nucleotide sites were included in the analyses. All sequences were deposited in GenBank (Table 1). Taxon Sampling and Identification A total of 134 specimens attributed to 35 camaenid An additional 292 stylommatophoran COI sequences species were collected from 27 localities across the from GenBank were analyzed together with those from Philippines (Table 1), representing approximately 15% this study for a total of 423 sequences to test their utility of the total nominal species of Helicostylinae. The 41 in species discrimination. Sequences of species under camaenid species comprised 35 species under subfamily family Polygyridae were used as outgroups, following the Helicostylinae and three under subfamily Bradybaeninae. recent molecular helicoid phylogeny of Sei et al. (2017). Cuttings of foot tissue were preserved in 95% (v/v) Sequences were viewed and trimmed to 463 nucleotides ethanol, while the vouchers were preserved in 70% (v/v) common to all taxa using BioEdit v.7.0.9 (Hall 1999) ethanol. Identification of species was based on shell and aligned using the ClustalW (Thompson et al. 1994) morphology, using literature (Springsteen and Leobrera accessory program. Haplotypes were counted using 1986, Abbott 1989), and by examination of reference DnaSP v. 6.12.01 (Rozas et al. 2017). collections in the University of the Philippines Diliman The substitution model was determined using ModelTest- Invertebrate Museum (UPDIM), Quezon City, Philippines. NG v.0.1.5 (Darriba et al. 2015), and the model with the best log-likelihood score was chosen using the Akaike DNA Extraction and Sequencing Information Criterion (Akaike 1973, 1974; Hurvich and DNA was extracted using the relatively rapid and Tsai 1993). The Xia Test (Xia et al. 2003, Xia and Lemey inexpensive modified NaOH-lysis method (Fontanilla et 2009) for substitution saturation was also performed in al. 2017). In this method, tissue slices were ground using DAMBE v. 6.4.81 (Xia 2013, 2017). Pairwise comparisons glass beads with 200 μL of 0.1 N NaOH and centrifuged of likelihood scores were performed on the dataset using with 300 μL chloroform-isoamyl alcohol (24:1). The uncorrected p-distances and GTR+Γ corrected distances upper phase was then collected and centrifuged with generated by PAUP* v4.10b (Swofford 2003), with ~300 μL isopropanol. The pellets were washed with GTR+Γ (Tavare 1986) determined as an optimal model ethanol, air-dried, and finally re-suspended in 150 by ModelTest-NG. Comparisons of pairwise distances μL TE buffer. DNA extracts were subjected to PCR 2 Special Issue on Genomics Batomalaque et al.: Philippine Helicostylinae DNA Barcodes Table 1. Species of Philippine camaenids collected with their corresponding GenBank accession numbers. Subfamily Species name Locality Collector/s GenBank accession no. Helicostylinae Chloraea amoena (Pfeiffer, 1845) Alaminos, I.K.C. Fontanilla, G.A. KM279469 Pangasinan, Luzon Batomalaque, E. de Vera KM279470 KM279471 KM279472 KM279473 Chloraea hennigiana Moellendorff, 1893 Alaminos, I.K.C. Fontanilla, G.A. KM279464 Pangasinan, Luzon Batomalaque, E. de Vera KM279465 KM279466 KM279467 KM279468 Chloraea fibula Not Uploaded to GenBank Chrysallis chrysalidiformis (Sowerby, 1833) Puerto Galera, A.U. Luczon KM056693 Mindoro KM056694 KM056695 Cochlostyla bicolorata (Lea, 1840) Laguna, Luzon C.P. Española KM056744 Cochlostyla daphnis (Broderip, 1841) Borbon, Cebu R.J.C. Canoy KM056706 Santander, Cebu P. Olvis KM056707 Cochlostyla fauna (Broderip, 1841) Bantayan Is., Cebu P. Olvis KM056713 KM056714 KM056715 Cochlostyla imperator (Pfeiffer, 1848) Sibulan Is., Polillo E.R.C. de Chavez KM056725 KM056726 Cochlostyla intermedia (Quadras and Moellendorff, 1896) Benguet, Luzon D. Constantino-Santos, KM056728 I.K.C. Fontanilla, A.U. Luczon KM056729 KM056730 KM056731 Cochlostyla marinduquensis (Hidalgo, 1887) Gasan, Marinduque B.O. Sosa III, R.D.C. KM279486 Pedales KM279487 KM279488 KM279489 KM279490 KM279491 KM279492 KM279493 KM279494
Load more

Recommended publications
  • Arianta 6, 2018
    ZOBODAT - www.zobodat.at Zoologisch-Botanische Datenbank/Zoological-Botanical Database Digitale Literatur/Digital Literature Zeitschrift/Journal: Arianta Jahr/Year: 2018 Band/Volume: 6 Autor(en)/Author(s): diverse Artikel/Article: Abstracts Talks Alpine and other land snails 11-27 ARIANTA 6 and correspond ecologically. For instance, the common redstart is a bird species breeding in the lowlands, whereas the black redstart is native to higher altitudes. Some species such as common swift and kestrel, which are originally adapted to enduring in rocky areas, even found a secondary habitat in the house facades and street canyons of towns and big cities. Classic rock dwellers include peregrine, eagle owl, rock­thrush, snowfinch and alpine swift. The presentation focuses on the biology, causes of threat as well as conservation measures taken by the national park concerning the species golden eagle, wallcreeper, crag martin and ptarmigan. Birds breeding in the rocks might not be that high in number, but their survival is all the more fascinating and worth protecting as such! Abstracts Talks Alpine and other land snails Arranged in chronological order of the program Range­constrained co­occurrence simulation reveals little niche partitioning among rock­dwelling Montenegrina land snails (Gastropoda: Clausiliidae) Zoltán Fehér1,2,3, Katharina Jaksch­Mason1,2,4, Miklós Szekeres5, Elisabeth Haring1,4, Sonja Bamberger1, Barna Páll­Gergely6, Péter Sólymos7 1 Central Research Laboratories, Natural History Museum Vienna, Austria; [email protected]
    [Show full text]
  • Xoimi AMERICAN COXCIIOLOGY
    S31ITnS0NIAN MISCEllANEOUS COLLECTIOXS. BIBLIOGIIAPHY XOimi AMERICAN COXCIIOLOGY TREVIOUS TO THE YEAR 18G0. PREPARED FOR THE SMITHSONIAN INSTITUTION BY . W. G. BINNEY. PART II. FOKEIGN AUTHORS. WASHINGTON: SMITHSONIAN INSTITUTION. JUNE, 1864. : ADYERTISEMENT, The first part of the Bibliography of American Conchology, prepared for the Smithsonian Institution by Mr. Binuey, was published in March, 1863, and embraced the references to de- scriptions of shells by American authors. The second part of the same work is herewith presented to the public, and relates to species of North American shells referred to by European authors. In foreign works binomial authors alone have been quoted, and no species mentioned which is not referred to North America or some specified locality of it. The third part (in an advanced stage of preparation) will in- clude the General Index of Authors, the Index of Generic and Specific names, and a History of American Conchology, together with any additional references belonging to Part I and II, that may be met with. JOSEPH HENRY, Secretary S. I. Washington, June, 1864. (" ) PHILADELPHIA COLLINS, PRINTER. CO]^TENTS. Advertisement ii 4 PART II.—FOREIGN AUTHORS. Titles of Works and Articles published by Foreign Authors . 1 Appendix II to Part I, Section A 271 Appendix III to Part I, Section C 281 287 Appendix IV .......... • Index of Authors in Part II 295 Errata ' 306 (iii ) PART II. FOEEIGN AUTHORS. ( V ) BIBLIOGRxVPHY NOETH AMERICAN CONCHOLOGY. PART II. Pllipps.—A Voyage towards the North Pole, &c. : by CON- STANTiNE John Phipps. Loudou, ITTJc. Pa. BIBLIOGRAPHY OF [part II. FaliricillS.—Fauna Grcenlandica—systematice sistens ani- malia GrcEulandite occidentalis liactenus iudagata, &c., secun dum proprias observatioues Othonis Fabricii.
    [Show full text]
  • Revisión De Las Especies Ibéricas De La Familia Xanthonychidae
    Itutl1. Inst. ('at. IIkt. Nat., 6385-101. 199 GEA, FLORA ET FAUNA Revision de las especies ibericas de la familia Xanthonychidae ( Gastropoda: Pulmonata: Helicoidea) Ana 1. Puente & Kepa Altonaga* Rebut 08 03.95 Acceptat 19 09.95 Resumen Abstract Se ha realiiado una revision de las especies Revision of the Iberian species L'lona guimperiuna ( I'erussae, 1 821) y belonging to the family Xanthonychidae Norelona pyrenaicu (Draparnaud, I805), que son los unicos representantes vivos (Gastropoda : Pulmonata : Helicoidea) de la familia Xanthonychidae en la region palcartica. Se presentan una relation A revision of the species Elona quimperiana cxhaustiva de trabajos acerca de ambas (Ferussac, 1821) and Norelona pyrenaica especies, redescripciones de los dos generos (Draparnaud, 1805) has been done These are monotipicos, datos dcscriptivos y figures the only living representatives of the family de la morfologia genital y mapas de dis- Xanthonychidae in the Palaearctic region An tribution en la Peninsula Ibcrica. E. quimperiana exhaustive bibliographical revision of both taxa esta distribuida por el norte de la Peninsu- is presented, together with descriptive data and la, ocupando tambien una pequena zona de figures of the genitalia of the species, Rretana, donde parece que pudo haber sido redescriptions of both monotypic genera, and introducida. N. pyrenaica es endemica de distribution maps in the Iberian Peninsula. E. los Pirineos orientales. quimperiana ranges throughout northern Iberia, and is also found in a small area in Brittany, PA! AURAS ('I.AVI.: Gastropoda, Pulmonata, where it has probably been introduced. N. I Iclicoidea, Xanthonychidae, Elonu, Norelona, pyrenaica is endemic of the eastern Pyrenees. Peninsula Iberica, taxonomia, distribution.
    [Show full text]
  • The Gastropod Shell Has Been Co-Opted to Kill Parasitic Nematodes
    www.nature.com/scientificreports OPEN The gastropod shell has been co- opted to kill parasitic nematodes R. Rae Exoskeletons have evolved 18 times independently over 550 MYA and are essential for the success of Received: 23 March 2017 the Gastropoda. The gastropod shell shows a vast array of different sizes, shapes and structures, and Accepted: 18 May 2017 is made of conchiolin and calcium carbonate, which provides protection from predators and extreme Published: xx xx xxxx environmental conditions. Here, I report that the gastropod shell has another function and has been co-opted as a defense system to encase and kill parasitic nematodes. Upon infection, cells on the inner layer of the shell adhere to the nematode cuticle, swarm over its body and fuse it to the inside of the shell. Shells of wild Cepaea nemoralis, C. hortensis and Cornu aspersum from around the U.K. are heavily infected with several nematode species including Caenorhabditis elegans. By examining conchology collections I show that nematodes are permanently fixed in shells for hundreds of years and that nematode encapsulation is a pleisomorphic trait, prevalent in both the achatinoid and non-achatinoid clades of the Stylommatophora (and slugs and shelled slugs), which diverged 90–130 MYA. Taken together, these results show that the shell also evolved to kill parasitic nematodes and this is the only example of an exoskeleton that has been co-opted as an immune system. The evolution of the shell has aided in the success of the Gastropoda, which are composed of 65–80,000 spe- cies that have colonised terrestrial and marine environments over 400MY1, 2.
    [Show full text]
  • Endemic Land Snail Fauna (Mollusca) on a Remote Peninsula in the Ogasawara Archipelago, Northwestern Pacific1
    Endemic Land Snail Fauna (Mollusca) on a Remote Peninsula in the Ogasawara Archipelago, Northwestern Pacific1 Satoshi Chiba2,3, Angus Davison,4 and Hideaki Mori3 Abstract: Historically, the Ogasawara Archipelago harbored more than 90 na- tive land snail species, 90% of which were endemic. Unfortunately, about 40% of the species have already gone extinct across the entire archipelago. On Haha- jima, the second-largest island and the one on which the greatest number of species was recorded, more than 50% of species are thought to have been lost. We report here the results of a recent survey of the snails of a remote peninsula, Higashizaki, on the eastern coast of Hahajima. Although the peninsula is small (@0.3 km2) and only part is covered by forest (<0.1 km2), we found 12 land snail species, all of which are endemic to Ogasawara. Among these species, five had been thought to already be extinct on Hahajima, including Ogasawarana yoshi- warana and Hirasea acutissima. Of the former, there has been no record since its original description in 1902. Except for the much larger island of Anijima and the main part of Hahajima, no single region on the Ogasawara Archipelago maintains as great a number of native land snail species. It is probable that the land snail fauna of the Higashizaki Peninsula is exceptionally well preserved be- cause of a lack of anthropogenic disturbance and introduced species. In some circumstances, even an extremely small area can be an important and effective refuge for threatened land snail faunas. The native land snail fauna of the Pacific one such example: of 95 recorded species, islands is one of the most seriously endan- more than 90% are endemic (Kuroda 1930, gered faunas in the world (e.g., Murray et al.
    [Show full text]
  • Gastropoda, Stylommatophora) 1 Doi: 10.3897/Zookeys.372.6581 Research Article Launched to Accelerate Biodiversity Research
    A peer-reviewed open-access journal ZooKeys 372:Revision 1–16 (2014) of three camaenid and one bradybaenid species (Gastropoda, Stylommatophora) 1 doi: 10.3897/zookeys.372.6581 RESEARCH ARTICLE www.zookeys.org Launched to accelerate biodiversity research Revision of three camaenid and one bradybaenid species (Gastropoda, Stylommatophora) from China based on morphological and molecular data, with description of a new bradybaenid subspecies from Inner Mongolia, China Pei Wang1,†, Qiong Xiao1,‡, Wei-Chuan Zhou1,§, Chung-Chi Hwang2,| 1 Key Laboratory of Molluscan Quarantine and Identification of AQSIQ, Fujian Entry-Exit Inspection & Quarantine Bureau, Fuzhou, Fujian 350001, China 2 Department of Life Sciences, National University of Kaohsiung, No.700, Kaohsiung University Road, Nan-Tzu District, Kaohsiung 81148, Taiwan † http://zoobank.org/053584B0-FF18-4DB1-B1FB-DD5B1598A848 ‡ http://zoobank.org/899F4240-3528-49E2-9634-CEC190648F50 § http://zoobank.org/F2D83F80-3A6A-4DC8-ABC4-2093430589C7 | http://zoobank.org/D1BC3819-15B9-48C6-AC2F-03A8239F409D Corresponding author: Wei-Chuan Zhou ([email protected]); Chung-Chi Hwang ([email protected]) Academic editor: M. Haase | Received 7 November 2013 | Accepted 9 January 2014 | Published 22 January 2014 http://zoobank.org/5766D7E9-5513-45B4-9C2C-23EC9571D857 Citation: Wang P, Xiao Q, Zhou W-C, Hwang C-C (2014) Revision of three camaenid and one bradybaenid species (Gastropoda, Stylommatophora) from China based on morphological and molecular data, with description of a new bradybaenid subspecies from Inner Mongolia, China. ZooKeys 372: 1–16. doi: 10.3897/zookeys.372.6581 Abstract We have revised the taxonomy of three camaenid and one bradybaenid species from China and described one new subspecies of the genus Bradybaena (Family Bradybaenidae) from Inner Mongolia, China.
    [Show full text]
  • Pulmonata, Helicoidea, Hygromiidae)
    Ruthenica, 2019, vol. 29, No. 2: 77-86. © Ruthenica, 2019 Published online March 5, 2019 http: www.ruthenica.com On the phylogenetic relationships of Elbasania Schileyko et Fehér, 2017 (Pulmonata, Helicoidea, Hygromiidae) Marco T. NEIBER Universität Hamburg, Centrum für Naturkunde (CeNak), Zoologisches Museum, Abteilung Biodiversität der Tiere, Martin-Luther-King-Platz 3, 20146 Hamburg, GERMANY. E-Mail [email protected]; [email protected] ABSTRACT. The genus-group taxon Elbasania Schi- mainly on the basis of similarities of the dart appara- leyko et Fehér, 2017 has recently been introduced as a tus. subgenus of Metafruticicola Ihering, 1892 for a spe- In a comprehensive molecular phylogenetic study cies occurring in north-western Greece and Albania. Using mitochondrial and nuclear markers, the phyloge- of western Palearctic Helicoidea Rafinesque, 1815, netic relationships of Elbasania within Metafruticico- Razkin et al. [2015] classified the clade to which lini (Hygromiidae) are reconstructed. The results of hygromiids and related groups belong into three these analyses suggest that Elbasania is more closely newly delimited families: Canariellidae Schileyko, related to Hiltrudia Nordsieck, 1993, which has a range 1991, Geomitridae Boettger, 1909 and Hygromii- adjacent to that of Elbasania from Croatia to northern dae. The Hygromiidae were classified into three Albania, than to Metafruticicola. Elbasania shares subfamilies, Hygromiinae (including Trochulinae with Hiltrudia and also Cyrnotheba Germain, 1929 a Lindholm, 1927 and Monachainae Wenz, 1930 very characteristic microsculpture of the shell and an (1904)), Ciliellinae Schileyko, 1970 and Leptaxinae overall similar genital system, which however differs Boettger, 1909. However, the sampling of Hygromi- among these three taxa with regard to its internal struc- idae was focused on West European taxa and repre- tures, especially those of the penis.
    [Show full text]
  • Chromosome Diversity and Evolution in Helicoide a (Gastropoda: Stylommatophora): a Synthesis from Original and Literature Data
    animals Article Chromosome Diversity and Evolution in Helicoide a (Gastropoda: Stylommatophora): A Synthesis from Original and Literature Data Agnese Petraccioli 1, Paolo Crovato 2, Fabio Maria Guarino 1 , Marcello Mezzasalma 1,3,* , Gaetano Odierna 1,* , Orfeo Picariello 1 and Nicola Maio 1 1 Department of Biology, University of Naples Federico II, I-80126 Naples, Italy; [email protected] (A.P.); [email protected] (F.M.G.); [email protected] (O.P.); [email protected] (N.M.) 2 Società Italiana di Malacologia, Via Mezzocannone, 8-80134 Naples, Italy; [email protected] 3 CIBIO-InBIO, Centro de Investigação em Biodiversidade e Recursos Genéticos, InBIO, Universidade do Porto, Rua Padre Armando Quintas 7, 4485-661 Vairaõ, Portugal * Correspondence: [email protected] (M.M.); [email protected] (G.O.) Simple Summary: The superfamily Helicoidea is a large and diverse group of Eupulmonata. The su- perfamily has been the subject of several molecular and phylogenetic studies which greatly improved our knowledge on the evolutionary relationships and historical biogeography of many families. In contrast, the available karyological information on Helicoidea still results in an obscure general picture, lacking a homogeneous methodological approach and a consistent taxonomic record. Never- theless, the available karyological information highlights the occurrence of a significant chromosomal diversity in the superfamily in terms of chromosome number (varying from 2n = 40 to 2n = 62), Citation: Petraccioli, A.; Crovato, P.; chromosome morphology and the distribution of different karyological features among different Guarino, F.M.; Mezzasalma, M.; taxonomic groups. Here we performed a molecular and a comparative cytogenetic analysis on of Odierna, G.; Picariello, O.; Maio, N.
    [Show full text]
  • Broderip, 1841) in Borbon and Sogod, Cebu, Philippines
    Funesto ‒ Flores: Effects of physicochemical factors and the local ecological knowledge on the population of Helicostyla daphnis - 1455 - EFFECTS OF PHYSICOCHEMICAL FACTORS AND THE LOCAL ECOLOGICAL KNOWLEDGE ON THE POPULATION OF HELICOSTYLA DAPHNIS (BRODERIP, 1841) IN BORBON AND SOGOD, CEBU, PHILIPPINES FUNESTO, E. G. M.* ‒ FLORES, M. J. L. Department of Biology and Environmental Science, College of Science, University of the Philippines Cebu, Cebu City 6000, Philippines *Corresponding author e-mail: [email protected] (Received 29th Dec 2016; accepted 27th Apr 2017) Abstract. Helicostyla daphnis (Broderip, 1841), an arboreal edible snail endemic to Cebu, Philippines that was thought to be extinct, was discovered to be still thriving. To formulate strategies for conservation of H. daphnis, a survey of selected physicochemical parameters and local ecological knowledge (LEK) that could affect its population was conducted. On each the three sites, physicochemical parameters were measured and a standardized direct search method for snails was used. LEK was gathered among fifteen snail-hunting experts. Snail total abundance significantly varied across sites in the dry season (p=0.006), being highest at Site 1(private property), and least in at Site 2 (tree plantation). Snails were found to be more abundant in the dry season than the wet (dry=306; wet=152) but significant only at Site 1. Adult snails were the most dominant among the age categories in both the dry and wet seasons. Neonates, comprising 5% of the sampled population, were found only in the wet season. Relative humidity and air temperature were the major determinants of the total abundance. However LEK gathered pointed out that overharvesting and habitat destruction could be major contributors as well.
    [Show full text]
  • Molluscan Forum 2018
    Number 72 (February 2019) The Malacologist Page 1 NUMBER 72 FEBRUARY 2019 Contents Editorial ………………………………...………….…... 2 News and Notes…………………………………………. 2 Travel Grant Report Franziska S. Bergmeier, Molluscan Forum 2018 Abstracts…..…...…………8 to 27 15th Deep-Sea Biology Symposium in Monterey Bay, Research Grant Reports: California (USA) …………………………………………39 Rodrigo Brincalepe Salvador In Memoriam Palaeogene land snails of Europe ...……………….……….. 28 Charles F Sturm.......................................................................40 Robert Fernandez-Vilert Colin Redfearn ……………………………………………...40 Tylodinae species complex in the Mediterranean Sea and Eastern Atlantic ………………………………...……... ... 28 Forthcoming Meetings ………………………………..41 Sydney Lundquist Notice of the Annual General Meeting Freshwater mussels as environmental indicators in UK river And Nominations for Council………………....…..43. systems using a sclerochronological approach ………………...29 Society Awards and Grants …………………………...44 Kasper P. Hendriks et al Notices concerning Membership ……………………..45 Fieldwork to sample microsnails for diet and microbiome studies along the Kinabatangan River, Sabah, Malaysian Borneo ……..33 Molluscan Forum 2018 Last November young malacologists from across Europe took part in the 20th Malaco- logical Forum at the Natural History Museum. The abstracts of the twenty nine presentations start inside on page 8. The Malacological Society of London was founded in 1893 and registered as a charity in 1978 (Charity Number 275980) Number 72 (February 2019) The Malacologist Page 2 EDITORIAL David Reid was editor of the Journal of Molluscan Studies from 2002 to 2018, in which year he began the process of retiring from his editorial role. Before completely retiring, David managed an extended handover to the new editor Dr Dinazarde Raheem so that she would be fully au fait with all the complicated issues which underly the production of the Journal.
    [Show full text]
  • And Freshwater Molluscs of the Seychelles, with Consequences for Taxa from Africa, Madagascar, India, the Philippines, Jamaica, and Europe
    B72(4-6)_totaal-backup_corr:Basteria-basis.qxd 15-9-2008 10:34 Pagina 93 BASTERIA, 72: 93-110, 2008 Notes on the nomenclature of some land- and freshwater molluscs of the Seychelles, with consequences for taxa from Africa, Madagascar, India, the Philippines, Jamaica, and Europe Ruud A. BANK & Henk P.M.G. MENKHORST c/o National Museum of Natural History Naturalis, P.O. Box 9517, NL 2300 RA Leiden, The Netherlands; [email protected] & [email protected] The nomenclature of the non-marine molluscs of the Seychelles islands (western Indian Ocean) as used in the 2006 treatise by Gerlach is critically reviewed. Notes are given regarding the use of brackets, publication dates, spelling of species-group names, overlooked genus-group names, and overlooked homonyms and synonyms in species-group names. A revised bibliog- raphy is presented. The Philippine species Steatodryas cepoides should be called Pachya cepoides; the European species now known as Petasina unidentata (Draparnaud, 1805) should be called Petasina monodon (A. Férussac, 1807). For Edouardia sensu auctt. (non Gude, 1914), a group of taxa living in Africa, Madagascar and India, the name Gittenedouardia is introduced. The nomen novum Annularia rosenbergi is introduced for the Jamaican species Turbo pulcher W. Wood, 1828 nec Dillwyn, 1817. Key words: Gastropoda Pulmonata, Acavidae, Stylodonta, Bradybaenidae, Pachya, Steatodryas, Hygromiidae, Petasina, Cerastidae, Conulinus, Edouardia, Gittenedouardia, Annulariidae, Annularia, synonymy, nomenclature, Seychelles, Philippines, Africa, India, Madagascar, Europe. INTRODUCTION Taxonomy (and thus biology as a whole) needs a universal and unambiguous lan- guage for the designation of taxa, and this language is provided by the codes of nomen- clature.
    [Show full text]
  • Current Status of Philippine Mollusk Museum Collections and Research, and Their Implications on Biodiversity Science and Conservation
    Philippine Journal of Science 147 (1): 123-163, March 2018 ISSN 0031 - 7683 Date Received: 28 Feb 2017 Current Status of Philippine Mollusk Museum Collections and Research, and their Implications on Biodiversity Science and Conservation Dino Angelo E. Ramos2*, Gizelle A. Batomalaque1,3, and Jonathan A. Anticamara1,2 1Ecology and Taxonomy Academic Group (ETAG), Institute of Biology, University of the Philippines, Diliman, Quezon City 1101 Philippines 2UP Biology Invertebrate Museum, Institute of Biology, University of the Philippines, Diliman, Quezon City 1101 Philippines 3Department of Biodiversity, Earth, and Environmental Science, Drexel University, Philadelphia, Pennsylvania 19104 USA Mollusks are an invaluable resource in the Philippines, but recent reviews on the status of museum collections of mollusks or research trends in the country are lacking. Such assessments can contribute to a more comprehensive evaluation of natural history museums in the Philippines, as well as biodiversity management. This review showed that local museums in the Philippines have much to improve in terms of their accessibility and geographic coverage in order to effectively cater to research and conservation needs of the country. Online access to databases was lacking for local museums, making it cumbersome to retrieve collection information. The UST museum held the most species and subspecies across all museums (4899), comparable to the national museums of countries such as the USA and France. In terms of size, there were larger Philippine mollusk collections in museums abroad. Majority of mollusk specimens come from Regions 4 and 7, while the CAR and Region 12 were least sampled. Publications on Philippine mollusks are dominated by taxonomic and biodiversity research.
    [Show full text]