DOCSLIB.ORG

Broderip, 1841) in Borbon and Sogod, Cebu, Philippines

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Broderip, 1841) in Borbon and Sogod, Cebu, Philippines Funesto ‒ Flores: Effects of physicochemical factors and the local ecological knowledge on the population of Helicostyla daphnis - 1455 - EFFECTS OF PHYSICOCHEMICAL FACTORS AND THE LOCAL ECOLOGICAL KNOWLEDGE ON THE POPULATION OF HELICOSTYLA DAPHNIS (BRODERIP, 1841) IN BORBON AND SOGOD, CEBU, PHILIPPINES FUNESTO, E. G. M.* ‒ FLORES, M. J. L. Department of Biology and Environmental Science, College of Science, University of the Philippines Cebu, Cebu City 6000, Philippines *Corresponding author e-mail: [email protected] (Received 29th Dec 2016; accepted 27th Apr 2017) Abstract. Helicostyla daphnis (Broderip, 1841), an arboreal edible snail endemic to Cebu, Philippines that was thought to be extinct, was discovered to be still thriving. To formulate strategies for conservation of H. daphnis, a survey of selected physicochemical parameters and local ecological knowledge (LEK) that could affect its population was conducted. On each the three sites, physicochemical parameters were measured and a standardized direct search method for snails was used. LEK was gathered among fifteen snail-hunting experts. Snail total abundance significantly varied across sites in the dry season (p=0.006), being highest at Site 1(private property), and least in at Site 2 (tree plantation). Snails were found to be more abundant in the dry season than the wet (dry=306; wet=152) but significant only at Site 1. Adult snails were the most dominant among the age categories in both the dry and wet seasons. Neonates, comprising 5% of the sampled population, were found only in the wet season. Relative humidity and air temperature were the major determinants of the total abundance. However LEK gathered pointed out that overharvesting and habitat destruction could be major contributors as well. Ficus leucantatoma, Buchananiaar borescens and Artocarpus heterophyllus are the vegetation most prefered by H. daphnis, according to LEK. Keywords: LEK, takyong, conservation, land snail Introduction Invertebrates make up nearly 99% of animal diversity (Pechenik, 2014). Unfortunately, many of these invertebrates are already extinct or endangered (Pimm et al., 2014). Studying invertebrates have less publicity, and thus, fewer scientists are attracted to do research on them. One of the most ignored groups of animals among the invertebrates is the non-marine mollusk. These mollusks play an important role in the mobilization of calcium to higher trophic levels. They are also involved in the plant litter decomposition process, as most of the species are considered to be consumers of decaying plant materials including microbial decomposers such as fungi and bacteria. Despite the important functions non-marine mollusks have in the ecosystem, they and other mollusks have suffered from extinction, and little efforts have been done to conserve them. In the IUCN List of Threatened Species in 2016, 6,033 gastropods are listed (IUCN, 2016). Helicostyla daphnis (Fig. 1) locally known as “takyong”, is an endemic land snail in Cebu, Philippines. The book Endangered Wildlife and Plants of the World (2001) stated that these landsnails was known only from the rain forests near Cebu Island in the Philippines. It was further stated that destruction of the rainforests by agriculture and the logging industry has had a serious impact on this tree snail. In 2001, Helicostyla APPLIED ECOLOGY AND ENVIRONMENTAL RESEARCH 15(3):1455-1471. http://www.aloki.hu ● ISSN 1589 1623 (Print) ● ISSN 1785 0037 (Online) DOI: http://dx.doi.org/10.15666/aeer/1503_14551471 2017, ALÖKI Kft., Budapest, Hungary Funesto ‒ Flores: Effects of physicochemical factors and the local ecological knowledge on the population of Helicostyla daphnis - 1456 - daphnis was reported to be extinct (Coney, 2001). However, in 2010, there were reports of the presence of these snails in Borbon, one of the municipalities of Cebu. When some faculty members of the University of the Philippines Cebu did an investigation, it was found out that these snails are sold commercially, consumed as food, and harvested for the making of accessories. Figure 1. Helicostyla dapnhnis attached on a tree. In Borbon, ‘takyong’ is considered as a delicacy. In 2011, these snails served as an entry to Obra Negosyo, a program that encouraged entrepreneurship development in the province. The snail was rumored to have therapeutic effects to those who have asthma and allergies. Local folks claim that when they eat ‘takyong’ they are relieved of their respiratory and allergy-related ailments, and the meat seemed to be a good source of energy and stamina. Some even consider it an aphrodisiac (Garces, 2011). The reports of these land snails’ extinction have urged the local government to regulate their harvest (Garces, 2011). However, currently, there is very limited information about these land snails. Based on the principles of environmental conservation, to effectively protect a certain species of animal or plant, an adequate amount of knowledge is necessary to design effective conservation programs. There is then a need then to fill in this gap of knowledge. To address this issue, this study tried to find out the effects of physicochemical factors like relative humidity, pH, elevation, air temperature, and soil calcium on the population of H. daphnis. This study also tried to collect the local ecological knowledge on the biology and ecology of H. daphnis. Materials and Methods The study site This study was done in three sampling sites. The sites (Fig. 2) were selected according to local knowledge on where the snails were collected for consumption. Three 20m x 20m quadrats that represented the plots were placed randomly at each site. APPLIED ECOLOGY AND ENVIRONMENTAL RESEARCH 15(3):1455-1471. http://www.aloki.hu ● ISSN 1589 1623 (Print) ● ISSN 1785 0037 (Online) DOI: http://dx.doi.org/10.15666/aeer/1503_14551471 2017, ALÖKI Kft., Budapest, Hungary Funesto ‒ Flores: Effects of physicochemical factors and the local ecological knowledge on the population of Helicostyla daphnis - 1457 - Figure 2. Map showing Site 1 (Barangay Cajel), Site 2 (Barangay Lugo) and Site 3 (Barangay Liki) where the study was done (image from Google Earth). Site 1, had coordinates of 10°49’30.9”N, 123°57’12.9” E and an elevation of 184 masl. It had secondary growth vegetation. Site 2 had coordinates 10°49’11.1”N, 123°59’9.4”E and an elevation of 265 masl. Since it was a tree plantation site, it was dominated by two tree species: Leucaena leucocephala and Cocos nucifera L. Site 3 had coordinates of 10°47”56.9”N, 123°59’35.6”E” at 132 masl (Plot 1) and 10°47”23.0”N, 123°59’47.9” at 148 masl (Plots 2 and 3). It had a steep slope and a dominant thick ground cover of Cogon grasses and shrubs. Physicochemical and biological survey Methods by de Chavez and de Lara (2011) adopted from Schilthuizen and Rutjes (2001) were used. The physicochemical factors (elevation, air temperature, relative humidity, top soil pH, soil exchangeable calcium) in all study sites were collected in replicates of three. A hand-held Global Positioning System was used to know the geographic coordinates and elevation of each sampling site. A field thermometer was suspended for at least 5 m above the ground to take note of the air temperature. To measure relative humidity, a hand-held sling psychrometer was used. Approximately 500 grams of topsoil was collected from three points in each quadrat. The soil samples were air-dried, then brought to a soil laboratory for analysis of soil exchangeable calcium. For the measurement of pH, a pH meter was used. For each quadrat, people conducting the survey searched for live snails equivalent to a two-hour sampling effort. The number of H. daphnis individuals found in each quadrat was accounted for the species abundance for that quadrat. The sampling was done twice in a year, once during the dry season and once during the rainy season, between 0600-0900 h and/or from 1600-1800 h. APPLIED ECOLOGY AND ENVIRONMENTAL RESEARCH 15(3):1455-1471. http://www.aloki.hu ● ISSN 1589 1623 (Print) ● ISSN 1785 0037 (Online) DOI: http://dx.doi.org/10.15666/aeer/1503_14551471 2017, ALÖKI Kft., Budapest, Hungary Funesto ‒ Flores: Effects of physicochemical factors and the local ecological knowledge on the population of Helicostyla daphnis - 1458 - Gathering of local ecological knowledge Participants for the local ecological knowledge survey were determined following the method suggested by Davis and Wagner (2003). A list of ten snail hunters was solicited from the local officials of the three barangays. Each snail hunter on the list were asked the following questions: 1. “Other than yourself, who would you say knows the most about ‘takyong’ (Helicostyla daphnis)? 2. Are there any other persons who you think are very knowledgeable about ‘takyong’ (Helicostyla daphnis)”? At least five names were solicited for each snail hunter interviewed. The names of people mentioned by the snail hunters were then ranked-ordered based on the frequency of mentions. The top five names from each barangay are the ones considered as the “experts” from which local ecological knowledge was taken. The fifteen experts (five for each site) were then subjected to in-depth, face-to-face interviews. The objectives of the project were presented and discussed before the data collection. Each key informant was interviewed following a semi-structured conversation. All encounters were audio recorded with previous consent from informants. The knowledge claim should be mentioned at least three times by the experts for it to be considered acceptable. Conversations were freely conducted, giving opportunity for the deeper exploration of the informant’s knowledge, with the following pre-determined topics: o medicinal effect o vegetation preference o diet o life cycle o hunting practices and consumption Analyses of data The physicochemical and biological variables were analyzed using Statistical Package for Social Sciences (SPSS) Version 22 (trial version). To determine the significance of the relationship of more than two variables (e.g., physicochemical parameters at the different sites during the different seasons), the one-way Analysis of Variance (ANOVA) and independent t-test were used.
Load more

Recommended publications
  • The Gastropod Shell Has Been Co-Opted to Kill Parasitic Nematodes
    www.nature.com/scientificreports OPEN The gastropod shell has been co- opted to kill parasitic nematodes R. Rae Exoskeletons have evolved 18 times independently over 550 MYA and are essential for the success of Received: 23 March 2017 the Gastropoda. The gastropod shell shows a vast array of different sizes, shapes and structures, and Accepted: 18 May 2017 is made of conchiolin and calcium carbonate, which provides protection from predators and extreme Published: xx xx xxxx environmental conditions. Here, I report that the gastropod shell has another function and has been co-opted as a defense system to encase and kill parasitic nematodes. Upon infection, cells on the inner layer of the shell adhere to the nematode cuticle, swarm over its body and fuse it to the inside of the shell. Shells of wild Cepaea nemoralis, C. hortensis and Cornu aspersum from around the U.K. are heavily infected with several nematode species including Caenorhabditis elegans. By examining conchology collections I show that nematodes are permanently fixed in shells for hundreds of years and that nematode encapsulation is a pleisomorphic trait, prevalent in both the achatinoid and non-achatinoid clades of the Stylommatophora (and slugs and shelled slugs), which diverged 90–130 MYA. Taken together, these results show that the shell also evolved to kill parasitic nematodes and this is the only example of an exoskeleton that has been co-opted as an immune system. The evolution of the shell has aided in the success of the Gastropoda, which are composed of 65–80,000 spe- cies that have colonised terrestrial and marine environments over 400MY1, 2.
    [Show full text]
  • 2008-2009 Chromodoris Kuniei Ransoni
    Fromia millepora Eriphia scrabricola Chloeia sp. Lybia n. sp. Florida MuseuM of Natural History Elysia pusilla Annual Report 2008-2009 Chromodoris kuniei ransoni Trapezia lutea Paraplanocera n. sp. Pilodius flavus Fromia sp. Chromodoris tinctoria Thyrolambrus efflorescens Dolabrifera dolabrifera Aniculus aniculus “The Florida Museum of Natural History is Florida’s state museum Florida Museum of Natural History Marketing and Public Relations of natural history, dedicated to understanding, preserving and PO Box 112710 interpreting biological diversity and cultural heritage.” Gainesville, FL 32611-2710 Editor: Paul Ramey, APR [email protected] Contributing Editors: Elise LeCompte Sharon Thomas Photography: Dan Brumbaugh Jeff Gage Jim Maragos Gustav Paulay Mary Warrick Eric Zamora Design: Leah Parchinski Printing: StorterChilds Printing Co. This Annual Report features images from the Florida Museum of Natural History Malacology Collection. Malacology is devoted to the study of mollusks, the second largest phylum of animals in terms of described species. About 100,000 species of mollusks are known, and the Florida Museum holds more than 30,000 species among 400,000 lots of specimens. More than 300,000 lots are now databased and accessible online (flmnh.ufl.edu/ malacology/collections.htm). The collection is among the five largest in the U.S., and one of the most rapidly growing. It is the second largest mollusk collection worldwide in online accessibility. (left) Marine Malacology Curator Gustav Paulay surveys the biodiversity of Kiritimati Island in the Pacific. Since Paulay’s hire in 2000, the Museum also has added an increasing number of non- molluscan marine invertebrates to its collection. A Message From the Director In December 2008, the Florida Museum received the most significant gift in its long history from its most generous benefactors.
    [Show full text]
  • Cytochrome C Oxidase Subunit 1 (COI) Profile of the Philippine Helicostylinae (Gastropoda: Stylommatophora: Camaenidae)
    Philippine Journal of Science 148 (S1): 1-13, Special Issue on Genomics ISSN 0031 - 7683 Date Received: 31 Jan 2019 Cytochrome C Oxidase Subunit 1 (COI) Profile of the Philippine Helicostylinae (Gastropoda: Stylommatophora: Camaenidae) Gizelle A. Batomalaque1,4,*, Gerard Clinton L. Que1, Tyrill Adolf B. Itong5, Anna Regina L. Masanga1, Emmanuel Ryan C. de Chavez3, and Ian Kendrich C. Fontanilla1,2 1Insitute of Biology, College of Science, University of the Philippines Diliman, Quezon City 1101 Philippines 2Natural Sciences Research Institute, University of the Philippines Diliman, Quezon City 1101 Philippines 3Institute of Biological Sciences, College of Arts and Sciences, University of the Philippines Los Baños 4031 Laguna, Philippines 4Department of Biodiversity, Earth and Environmental Sciences, College of Arts and Sciences, Drexel University, Philadelphia, PA 19104 USA 5College of Science, University of the Philippines Cebu, Cebu City 6000 Philippines The Philippines is the center of radiation of the land snail subfamily Helicostylinae, with around 253 recognized species. Despite their morphological diversity, research on their biology and taxonomy is lacking. We present here the first mitochondrial COI profiles of 32 species of Philippine helicostyline land snails. With the addition of sequences downloaded from GenBank, we tested the utility of the COI for species identification. Relative distributions of intraspecific and interspecific distances overlapped; hence, no barcoding gap was observed. However, 90% of uncorrected interspecific comparisons can distinguish species at 14% genetic distance or lower. Furthermore, the COI barcodes could not discriminate several co-distributed species that have similar conchological features, which should be flagged for taxonomic re-evaluation. Keywords: DNA barcoding, Helicostylinae, mitochondrial COI, Philippine land snails INTRODUCTION exhibit a range in shell forms from discoidal, depressed and keeled, globose, to elongated conical forms (Parkinson The Helicostylinae, a subfamily under family Camaenidae et al.
    [Show full text]
  • New Names Introduced by H. A. Pilsbry in the Mollusca and Crustacea, by William J
    jbyH.l in the 1 ILML 'r-i- William J. Clench Ruth D. Turner we^ f >^ ,iV i* * ACADKMY OF NATURAL SCIENCES OF PHILADELPHLV'-' NAMES INTRODUCED BY PILSBRY m mLT) Oi -0 Dr^ 5: D m NEW NAMES INTRODUCED BY H. A. PILSBRY IN THE MOLLUSCA AND CRUSTACEA by William J. C^lencli and Ivutli _L). liirner Curator ana Research Associate in Aialacology, respectively, Aiiiseum ol Comparative Zoology at Harvara College ACADEMY OF NATURAL SCIENCES OF PHILADELPHIA — Special Publication No. 4 1962 SPECIAL PUBLICATIONS OF THE ACADEMY OF NATURAL SCIENCES OF PHILADELPHIA No. I.—The Mineralogy of Pennsylvania, by Samuel Gordon. No. 2.—Crystallographic Tables for the Determination of Minerals, by V. GoLDSCHMiDT and Samuel Gordon, (Out of print.) No. 3.—Gabb's California Cretaceous and Tertiary Lamellibranchs, by Ralph B. Stewart. No. 4.—New Names Introduced by H. A. Pilsbry in the Mollusca and Crustacea, by William J. Clench and Ruth D. Turner. Publications Committee: H. Radclyffe Roberts, Chairman C. Willard Hart, Jr., Editor Ruth Patrick James A. G. Rehn James Bond James Bohlke Printed in the United States of America WICKERSHAM PRINTING COMPANY We are most grateful to several people who have done much to make this present work possible: to Drs. R. T. Abbott and H. B. Baker of the Academy for checking several names and for many helpful suggestions; to Miss Constance Carter of the library staff of the Museum of Comparative Zoology for her interest and aid in locating obscure publications; to Drs. J. C. Bequaert and Merrill Champion of the Museum of Comparative Zoology for editorial aid; and to Anne Harbison of the Academy of Natural Sciences for making possible the publication of Pilsbry's names.
    [Show full text]
  • Catalog of Recent Molluscan Types in the Natural History Museum of Los
    CATALOG OF RECENT MOLLUSCAN TYPES IN THE NATURAL HISTORY MUSEUM OF LOS ANGELES COUNTY compiled by Lindsey T. Groves NATURAL HISTORY MUSEUM OF LOS ANGELES COUNTY MALACOLOGY SECTION 900 Exposition Boulevard, Los Angeles, California, 90007, USA [email protected] [last updated 3 January, 2012] Abstract. Recent molluscan types currently housed in the Malacology Section of the Natural History Museum of Los Angeles County are listed herein. Each type lot entry includes original species/subspecies name, original genus, author, original citation, type status, LACM number, number of specimens and preservation, type locality or collection locality, collector [if known], date collected [if known], and current taxonomic status if different from original description. INTRODUCTION This catalog is published in accordance with Recommendation 72F.4 of the International Code of Zoological Nomenclature (Ride & others, 2000:79). This listing includes all molluscan type material currently housed at the Natural History Museum of Los Angeles County and supercedes the type listing of Sphon (1971). To date 1922 molluscan type lots (71,000+ specimens) are reported for 1147 species and 99 subspecies, which includes 589 holotypes, 1277 paratype lots, 10 lectotypes, 13 paralectotype lots, 29 syntype lots, 3 neotypes, and 2 neotype lots in 550+ references. Type categories listed include: Holotype (in red), paratype(s) (in blue), syntype(s) (in orange), lectotype (in pink), paralectotype(s) (in aqua), and neotype and/or neotype lots (in brown) as defined by Ride & others (2000). Because the term cotype is not recognized by the ICZN, lots originally designated as cotype(s) (in green) by original specimen labels are now referred to as syntype(s).
    [Show full text]
  • Corel Ventura
    Alphabetical index of taxa higher than species Accepted names are given in normal type. Synonyms are shown in italics. Pages in bold refer to main descriptive text. Aa .........................................................1084 Actinaria (?=Philalanka) ...............................924 Aaadonta .......................................................901 Actinella ...................................................... 2019 Abaconia (=Litiopa) ............................513, 2108 Acusta .............................................. 1677, 1678 Abbadia .........................................................672 Acutidens (=Linisa) ..................................... 1871 Abchasohela (=Circassina) ...........................1970 Adclarkia...................................................... 1538 Aberdaria (= Gulella) ....................................815 Adelodonta (=Polygyrella) ........................... 1890 Abida .............................................................117 Adenodia .......................................................295 Acalcchlicella (=Prietocella) ..........................1756 Adiverticula ................................................ 1804 Acantharion...................................... 1274, 2110 Adjua...............................................................825 Acantharionini ............................................1274 Adriaca (=Semirugata)...................................660 Acanthennea ..................................................778 Adriatica (=Semirugata) ...............................660
    [Show full text]
  • Observations on Land-Snail Shells in Near-Ultraviolet, Visible and Near-Infrared
    Journal of The Malacological Society of London Molluscan Studies Journal of Molluscan Studies (2013) 79: 95–111. doi:10.1093/mollus/eys039 Advance Access publication date: 29 January 2013 OBSERVATIONS ON LAND-SNAIL SHELLS IN NEAR-ULTRAVIOLET, VISIBLE AND NEAR-INFRARED RADIATION Downloaded from https://academic.oup.com/mollus/article/79/2/95/1072615 by guest on 23 September 2021 ENRICO SAVAZZI1 AND TAKENORI SASAKI2 1School of Geosciences, Monash University, Building 28, Victoria 3800, Australia; and 2The University Museum, The University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-0033, Japan Correspondence: Enrico Savazzi, Hagelgra¨nd 8, 75646 Uppsala, Sweden; e-mail: [email protected] (Received 18 March 2013; accepted 28 November 2012) ABSTRACT The shells of a broad range of land snails were digitally imaged in the near-ultraviolet (NUV), visible range (VIS) and near infrared (NIR). NIR images were recorded in both incident and trans- mitted illumination. In most cases, shell and periostracal pigmentation observed in the VIS was com- pletely translucent in the NIR, while its contrast was enhanced in the NUV. Exceptions to the above rule fit into four main categories. (1) Snails with green or tan shells or periostraca, presumably func- tional as camouflage among vegetation, were often highly absorbing in the NUV, thus matching the optical characteristics of green vegetation in this range. (2) Pigmented spiral stripes in the shells of several Camaenidae and Helicidae were adjacent to nonpigmented areas that display a heightened reflectivity and reduced translucence in the VIS and NIR. This enhanced the contrast of the colour pattern in the VIS, but appeared to lack functions in the NIR.
    [Show full text]
  • Molecular Phylogeny of the Western Palaearctic Helicoidea (Gastropoda, Stylommatophora)
    Molecular Phylogenetics and Evolution 83 (2015) 99–117 Contents lists available at ScienceDirect Molecular Phylogenetics and Evolution journal homepage: www.elsevier.com/locate/ympev Molecular phylogeny of the western Palaearctic Helicoidea (Gastropoda, Stylommatophora) Oihana Razkin a,b, Benjamín Juán Gómez-Moliner a,b, Carlos Enrique Prieto c, Alberto Martínez-Ortí d, ⇑ José Ramón Arrébola e, Benito Muñoz f, Luis Javier Chueca a,b, María José Madeira a,b, a Department of Zoology and Animal Cell Biology, Faculty of Pharmacy, University of the Basque Country, Paseo de la Universidad 7, 01006 Vitoria-Gasteiz, Alava, Spain b Biodiversity Research Group CIEA Lucio Lascaray, Avda. Miguel de Unamuno 3, 01006 Alava, Spain c Department of Zoology and Animal Cell Biology, Faculty of Science and Technology, University of the Basque Country, Barrio Sarriena s/n, 48940 Leioa, Bizkaia, Spain d Museum of Natural History & Biotaxa, L’Hort de Feliu, Alginet P.O. Box 8460, E-46018 Valencia, Spain e Department of Animal Biology (Zoology), Faculty of Biology, University of Seville, Avda. Reina Mercedes 6, 41012 Seville, Spain f Faculty of Biological Sciences, Complutense University of Madrid, José Antonio Novais 12, Ciudad Universitaria, 28040 Madrid, Spain article info abstract Article history: The Helicoidea is one of the most diverse superfamilies of terrestrial land snails. In this study we present Received 29 May 2014 a molecular phylogeny of the western Palaearctic Helicoidea obtained by means of neighbor joining, max- Revised 25 November 2014 imum likelihood and Bayesian analysis of the mitochondrial 16S rRNA gene fragment and the nuclear Accepted 28 November 2014 rRNA gene cluster including the 30 end of the 5.8S gene, the complete ITS2 region and 50 end of the large Available online 5 December 2014 subunit 28S.
    [Show full text]
  • Malacofaunal Diversity and Distribution in the Masungi Georeserve in Luzon Island, Philippines
    Toxoplasmosis ARTICLE Malacofaunal diversity and distribution in the Masungi Georeserve in Luzon Island, Philippines Benjamin K. Valdez*1, Julius A. Parcon2, and Emmanuel Ryan C. de Chavez1,2 1Animal Biology Division, Institute of Biological Sciences, University of the Philippines Los Baños, College, Laguna, Philippines, 4031; 2Museum of Natural History, University of the Philippines Los Baños, College, Laguna, Philippines, 4031 any limestone ecosystems, particularly in α-dominated community and efficient sampling (completeness tropical countries like the Philippines, still lack ratio=0.97). Analysis of similarity further confirmed significant data regarding their malacofaunal diversity differences in land snail community assemblages between its amidst extensive habitat destruction and karst and non-karst sites. These results suggest the rich Mmodification, and uncontrolled tourism. To malacofauna of the Masungi Georeserve needs to be protected address this, the diversity and spatial distribution of land snails as a refugia of land snail diversity. in the Masungi Georeserve in Rizal Province, Luzon Island were determined. A total of 120 5x5m quadrats were randomly set along six karst and six non-karst sites of the georeserve. Altitude, KEYWORDS temperature, relative humidity, soil moisture, exchangeable soil calcium, number of trees, diameter of trees, canopy cover, and Malacology, land snails, karst, diversity, distribution leaf litter depth were also determined per quadrat. A total of 1,283 land snails belonging to 45 species and 12 families were sampled. Three major land snail communities were INRODUCTION distinguished by detrended correspondence analysis: the first group preferred cooler environments with high-calcium soil Land snails are among the fauna that occur in tropical rainforests (karst), the second group dominated in warmer habitats with and karst ecosystems.
    [Show full text]
  • An Updated Survey and Biodiversity Assessment of the Terrestrial Snail (Mollusca: Gastropoda) Species in Marinduque, Philippines
    Philippine Journal of Science 143 (2): 199-210, December 2014 ISSN 0031 - 7683 Date Received: ?? ???? 2014 An Updated Survey and Biodiversity Assessment of the Terrestrial Snail (Mollusca: Gastropoda) Species in Marinduque, Philippines Benjamin O. Sosa III1, Gizelle A. Batomalaque1 and Ian Kendrich C. Fontanilla1,2 1Institute of Biology, University of the Philippines Diliman, Diliman, Quezon City 1101, Philippines 2Natural Sciences Research Institute, University of the Philippines, Diliman, Quezon City 1101, Philippines Marinduque is an island province of volcanic origin and is found in the southern portion of the Luzon Group of Islands. The island has an uneven topography but has experienced drastic deforestation in recent times. Records on the terrestrial snail species diversity in the Philippines in general and Marinduque in particular are sparse in the zoological literature. Previous literature noted only 13 species in Marinduque, which could be a gross underestimation of the terrestrial malacofaunal diversity of the island because the area was not systematically surveyed. This study aimed to assess the malacofaunal biodiversity of Marinduque and prepare a comprehensive list of snail taxa via opportunistic sampling. Sampling was conducted in 12 pre-determined areas of the island, with emphasis on minimally disturbed areas. This study reported ten (10) new records of stylommatophoran species and six (6) new records of terrestrial prosobranch species in Marinduque, which brings a total of 24 terrestrial snail species known to date (or 26 if two previously recorded species that were not encountered in this study are included). Keywords: Marinduque, opportunistic sampling, biodiversity indices, stylommatophoran, terrestrial prosobranch INTRODUCTION includes most species of prosobranchs (Pechenik 2005).
    [Show full text]
  • Dna Barcoding of Three Selected Gastropod Species Using Cytochrome Oxidase (Coi) Gene
    Annals of West University of Timişoara, ser. Biology, 2018, vol. 21 (1), pp.93-102 DNA BARCODING OF THREE SELECTED GASTROPOD SPECIES USING CYTOCHROME OXIDASE (COI) GENE Gloria L. GALAN 1*, Noe P. MENDEZ 1,2 , Reggie Y. DELA CRUZ 1,2 1Department of Biology, College of Arts and Sciences, Central Mindanao University, University Town, Musuan, Bukidnon 8710, Philippines 2Center for Biodiversity Research and Extension in Mindanao (CEBREM), Central Mindanao University, University Town, Musuan, Bukidnon 8710, Philippines *Corresponding author e-mail: [email protected] Received 5 April 2018; accepted 12 June 2018 ABSTRACT This study focused on DNA barcoding and phylogenetic tree construction of three selected gastropod species viz., Pomacea canaliculata, Helicostyla sp. and Vivipara costata using cytochrome oxidase I (COI) gene. Genomic DNA samples of selected gastropod species were successfully isolated using modified cetyltrimethylammonium bromide (CTAB) extraction method. A set of primers, LCO1490 (5’GGTCAAATCATAAAGATATTGG 3’) and HCO2198 (5′ TAAACTTCAGGGTGACCAAAAAATCA 3′) was used for the amplification of COI gene of mitochondria. Analysis of homology using BLASTn revealed that P. canaliculata (identified based on morphology) matched with P. canaliculata (AB728585.1), while previously identified Helicostyla sp.(identified based on morphology) was closest to Macrochlamys sp. (MF983631.1) and V. costata (identified based on morphology) was most similar to Bellamya aeruginosa (KP150594.1) in the BLAST analysis. The morphological identification of P. canaliculata was proven correct with 100% similarity to all existing P. canaliculata sequences using BLASTn analysis. However, BLASTn showed that Helicostyla sp. and V. costata were closest to Machrochlamys sp. and B. aeruginosa with 91% and 94% similarity, respectively.
    [Show full text]
  • Species Composition, Relative Abundance, and Distribution of Land Snail Species in Mt. Lantoy Key Biodiversity Area, Cebu, Philippines
    BIODIV ERSITAS ISSN: 1412-033X Volume 21, Number 11, November 2020 E-ISSN: 2085-4722 Pages: 5438-5447 DOI: 10.13057/biodiv/d211152 Species composition, relative abundance, and distribution of land snail species in Mt. Lantoy Key Biodiversity Area, Cebu, Philippines RAAMAH ROSALES1,, EDGARDO LILLO2, STEVE MICHAEL ALCAZAR2, LEA COLITA1, JOED CABALLERO1, ARCHIEBALD BALTAZAR MALAKI2 1College of Arts and Sciences, Cebu Technological University. Main Campus, Cebu City 6000, Philippines email: [email protected] 2Department of Forestry, Cebu Technological University. Argao Campus, Argao, Cebu 6021, Philippines Manuscript received: 2 September 2020. Revision accepted: 27 October 2020. Abstract. Rosales R, Lillo E, Alcazar SM, Colita L, Caballero J, Malaki AB. 2020. Species composition, relative abundance, and distribution of land snail species in Mt. Lantoy Key Biodiversity Area, Cebu, Philippines. Biodiversitas 21: 5438-5447. This study aimed to establish an inventory of land snails in Mt. Lantoy, Cebu Island, Philippines. A two-person team conducted sampling on eight permanent plots with an elevation range of 182 m-691 m. The study has listed a total of 872 individuals represented by 25 species belonging to 15 genera and nine families. Seven families belong to the air-breathing pulmonate group, Order Stylommatophora: Bradybaenidae, Camaenidae, Trochomorphidae, Achatinidae, Ariophantidae, Helicarionidae, Helicinidae. Two families were under the prosobranch group, Order Caenogastopoda: Cyclophoridae, and Pupinidae. The Cyclophoridae was the richest family with five species, followed by Bradybaenidae, Camaenidae, Helicinidae, having four species. The Trochomorphidae and Helicarionidae have three species. The Pupinidae has two species, while the Achatinidae and Ariophantidae has one species each. There were three (3) endemic and ten (10) new island record species collected and identified with four (4) species that were classified as rare.
    [Show full text]