DOCSLIB.ORG

The Opitz Syndrome Gene Product, MID1, Associates with Microtubules

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
The Opitz Syndrome Gene Product, MID1, Associates with Microtubules Proc. Natl. Acad. Sci. USA Vol. 96, pp. 2794–2799, March 1999 Cell Biology The Opitz syndrome gene product, MID1, associates with microtubules SUSANN SCHWEIGER*†,JOHN FOERSTER‡,TANJA LEHMANN*, VANESSA SUCKOW*, YVES A. MULLER§, i GERALD WALTER*, THERESA DAVIES¶,HELEN PORTER ,HANS VAN BOKHOVEN**, PETER W. LUNT††, PETER TRAUB‡‡, AND HANS-HILGER ROPERS*,** *Max Planck Institute for Molecular Genetics, 14195 Berlin, Germany; ‡Research Institute for Molecular Pharmacology, 12207 Berlin, Germany; §Department of Crystallography, Max Delbru¨ck Center, 13125 Berlin-Buch, Germany; ¶Regional Cytogenetics Center, Southmead Hospital, Bristol BS2 8BJ, United Kingdom; iDepartment of Pediatric Pathology, University of Bristol BS2 8BJ, Bristol, United Kingdom; **Department of Human Genetics, University Hospital, 6500 HB Nijmegen, The Netherlands; ††Clinical Genetics Unit, Institute of Child Health, Bristol Childrens Hospital, Bristol BS2 8BJ, United Kingdom; and ‡‡Max-Planck Institute for Cell Biology, 68522 Ladenburg, Germany Edited by Lewis G. Tilney, University of Pennsylvania, Philadelphia, PA, and approved December 21, 1998 (received for review September 23, 1998) ABSTRACT Opitz syndrome (OS) is a genetically heter- a-helical region capable of coiled-coil formation (4–6). Mem- ogeneous disorder characterized by defects of the ventral bers of this protein family are involved in diverse cellular midline, including hypertelorism, cleft lip and palate, heart processes: Xenopus nuclear factor 7 (XNF7) was found to play defects, and mental retardation. We recently identified the an important role in dorsalyventral patterning of the Xenopus gene responsible for X-linked OS. The ubiquitously expressed embryo (7–9), whereas the promyelocytic protein (PML), the gene product, MID1, is a member of the RING finger family. ret finger protein (RFP-1), and transcription intermediary These proteins are characterized by an N-terminal tripartite factor (TIF-1) are protooncogenes (10–13). Furthermore, as protein–protein interaction domain and a conserved C ter- some of the RING finger proteins are part of macromolecular minus of unknown function. Unlike other RING finger pro- complexes, the formation of which depends on an intact N teins for which diverse cellular functions have been proposed, terminus (11), the tripartite motif is thought to be involved in the function of MID1 is as yet undefined. By using the green protein–protein interactions. fluorescent protein as a tag, we show here that MID1 is a A second cluster of amino acids highly conserved between microtubule-associated protein that influences microtubule MID1 and five other RING finger proteins (3) is located in the dynamics in MID1-overexpressing cells. We confirm this C terminus. The function of this protein domain is largely observation by demonstrating a colocalization of MID1 and unknown except for the C terminus of murine butyrophilin, tubulin in subcellular fractions and the association of endog- which was reported to be specifically associated with a 150-kDa enous MID1 with microtubules after in vitro assembly. Fur- cytoplasmatic protein (14). Surprisingly, all of the mutations thermore, overexpressed MID1 proteins harboring mutations identified in OS patients so far are located in the C terminus described in OS patients lack the capability to associate with of the MID1 protein (3, 15). This finding suggests that the microtubules, forming cytoplasmic clumps instead. These C-terminal domain is critical for a functional MID1 protein. data give an idea of the possible molecular pathomechanism The cellular localization of RING finger proteins has been underlying the OS phenotype. shown to be very important for their specific functions. In an attempt to shed light on the function of the MID1 protein, we Opitz GyBBB syndrome (OS) is a congenital syndrome char- have studied its intracellular localization employing transfec- acterized by malformations involving several unrelated ana- tion of green fluorescent protein (GFP) fusion constructs into tomical structures, all situated in the midline of the human COS-7, MCF-7, and HeLa cells and into human fibroblasts. body. Mental retardation associated with dysplasia of the Unlike other RING finger proteins, MID1 was not found in the corpus callosum, ocular hypertelorism (excessive distance be- nucleus but was confined to the cytoplasm. More detailed tween any paired organs, e. g. the eyes), cleft lip and cleft analysis revealed a close association of MID1 with microtu- palate, laryngotracheo-esophageal fistulas, and genitourinary bules, whereas the introduction of mutations found in OS defects such as hypospadias are all prominent manifestations patients completely abolished microtubule association. Thus, of the syndrome. Imperforate anus and hymen and cardiac our data establish a physiological role for MID1 in microtubule abnormalities such as tetralogy of Fallot have also been dynamics. At the same time, they suggest a possible patho- described (1). By linkage analysis, two main gene loci, one on mechanism for OS. chromosome 22 and one on the X chromosome, were shown to be responsible for this heterogeneous disorder (2). Employ- MATERIALS AND METHODS ing a positional cloning approach, we have recently identified a gene located at Xp22.3, designated MID1, and found that it GFP Constructs and Site-Directed Mutagenesis. GFP- is selectively mutated in patients suffering from Opitz syn- fusion constructs were generated by using the CLONTECH drome (3). GFP system employing pGFP-N3 for the C-terminal and The protein encoded by the MID1 gene comprises four pEGFP-C1 for the N-terminal MID1 fusion. Inserts were separate domains common to the RING finger proteins. amplified with Stratagene Pfu polymerase in the appropriate Therefore, MID1 represents a new member of this protein buffer containing 1 mM MgCl2. Primers used for amplifying family. Three of the four conserved domains are part of an the complete translated region were GCTCAAGCTTCGAT- N-terminal tripartite motif consisting of the RING finger GGAAACAATGGAGTCAG and TCGAATTCTTCACG- itself, a so-called B box (present in one or two copies), and an GCAGCTGCTCTGT for the N-terminal construct and GCT- The publication costs of this article were defrayed in part by page charge This paper was submitted directly (Track II) to the Proceedings office. Abbreviations: OS, Opitz syndrome; GFP, green fluorescent protein. payment. This article must therefore be hereby marked ‘‘advertisement’’ in †To whom reprint requests should be addressed at: Max-Planck accordance with 18 U.S.C. §1734 solely to indicate this fact. Institute for Molecular Genetics, Ihnestrasse 73, 14195 Berlin, Ger- PNAS is available online at www.pnas.org. many. e-mail: [email protected]. 2794 Downloaded by guest on September 29, 2021 Cell Biology: Schweiger et al. Proc. Natl. Acad. Sci. USA 96 (1999) 2795 CAAGCTTCGATGGAAACACTGGAGTCAG and TC- prepared as described (18) based on three differential centrif- GAATTCTCGGCAGCTGCTCTGTGCA for the C-terminal ugation steps (1,000 3 g, 17,500 3 g, and 100,000 3 g). MID1 construct. PCR products were digested with HindIIIy Fractions were separated on a 7.5% SDS gel, transferred to EcoRI and subsequently isolated from low melting tempera- nitrocellulose membranes, and subsequently incubated with an ture agarose with the Qiagen (Chatsworth, CA) gel extraction affinity-purified anti-MID1 and two anti-tubulin antibodies kit. (see above). Blots were incubated with horseradish peroxi- Site-directed mutagenesis was performed by using the dase-conjugated anti-rabbit Fab fragments (Amersham Phar- QuickChange kit from Stratagene. All oligonucleotides used macia) and developed with enhanced chemiluminescence re- were HPLC-purified. agents (Amersham Pharmacia) as specified by the manufac- Tissue Culture and Microtubule Stability Assay. COS-7 turer. cells were purchased from the American Type Culture Col- In Vitro Assembly of Microtubules. HeLa microtubules were lection and spread at 1 3 105 cells per well of a 6-well plate 1 prepared from 4 3 107 cells according to a protocol described day before transfection. Transfection was carried out following previously (19) by using Taxol to facilitate microtubule assem- the CLONTECH protocol of the GFP system for liposome- bly. MID1yGFP-overexpressing COS-7 cells (1 3 106) were mediated transfection by using Lipofectace (Gibco) at a ratio treated with 200 ngyml colcemid overnight to destroy the of 1.2:1 (liposomeyvector). Expression was optimal 48 hours microtubules, homogenized in 5 vol of microtubule assembly after transfection. For the microtubule stability assay, cells buffer (19), and centrifuged at 60,000 3 g for 60 min. The were incubated for 2 hours at increasing colcemid concentra- supernatant was mixed with Taxol, GTP, and HeLa microtu- tions (range 50–400 ngyml) and with 100 ngyml of colcemid bules and incubated at 37°C for 30 min. The pellet of the for 2–14 hours, respectively. The percentage of destroyed subsequent ultracentrifugation of 30 min at 40,000 3 g was microtubules bundles was calculated by dividing the number of washed once with Taxol-containing assembly buffer and ana- transfected cells with intact microtubules stained with indirect lyzed by Western blot analysis. Membranes were probed immunofluorescence by the total number of cells showing sequentially with affinity-purified anti-MID1 (see above) and GFP–MID1-expression of one coverslip (350–500 cells anti-GFP purchased from CLONTECH. In vitro assembly of counted per coverslip). This
Load more

Recommended publications
  • Causal Varian Discovery in Familial Congenital Heart Disease - an Integrative -Omic Approach Wendy Demos Marquette University
    Marquette University e-Publications@Marquette Master's Theses (2009 -) Dissertations, Theses, and Professional Projects Causal Varian discovery in Familial Congenital Heart Disease - An Integrative -Omic Approach Wendy Demos Marquette University Recommended Citation Demos, Wendy, "Causal Varian discovery in Familial Congenital Heart Disease - An Integrative -Omic Approach" (2012). Master's Theses (2009 -). 140. https://epublications.marquette.edu/theses_open/140 CAUSAL VARIANT DISCOVERY IN FAMILIAL CONGENITAL HEART DISEASE – AN INTEGRATIVE –OMIC APPROACH by Wendy M. Demos A Thesis submitted to the Faculty of the Graduate School, Marquette University, in Partial Fulfillment of the Requirements for the Degree of Master of Science Milwaukee, Wisconsin May 2012 ABSTRACT CAUSAL VARIANT DISCOVERY IN FAMILIAL CONGENITAL HEART DISEASE – AN INTEGRATIVE –OMIC APPROACH Wendy M. Demos Marquette University, 2012 Background : Hypoplastic left heart syndrome (HLHS) is a congenital heart defect that leads to neonatal death or compromised quality of life for those affected and their families. This syndrome requires extensive medical intervention for the affected to survive. It is characterized by significant underdevelopment or non-existence of the components of the left heart and the aorta, including the left ventricular cavity and mass. There are many factors ranging from genetics to environmental relationships hypothesized to lead to the development of the syndrome, including recent studies suggesting a link between hearing impairment and congenital heart defects (CHD). Although broadly characterized those factors remain poorly understood. The goal of this project is to systematically utilize bioinformatics tools to determine the relationships of novel mutations found in exome sequencing to a familial congenital heart defect. Methods A systematic genomic and proteomic approach involving exome sequencing, pathway analysis, and protein modeling was implemented to examine exome sequencing data of a patient with HLHS.
    [Show full text]
  • X-Linked Microtubule-Associated Protein, Mid1, Regulates Axon Development
    X-linked microtubule-associated protein, Mid1, regulates axon development Tingjia Lua,b,1, Renchao Chena,b,1,2, Timothy C. Coxc,d, Randal X. Moldriche, Nyoman Kurniawanf, Guohe Tana, Jo K. Perryg, Alan Ashworthg, Perry F. Bartlette,LiXua, Jing Zhanga, Bin Lua, Mingyue Wua,b, Qi Shena, Yuanyuan Liua,b, Linda J. Richardse,h, and Zhiqi Xionga,2 aInstitute of Neuroscience and State Key Laboratory of Neuroscience, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200031, China; bUniversity of Chinese Academy of Sciences, Shanghai 200031, China; cDepartment of Pediatrics, University of Washington, Seattle, WA 98105; dDepartment of Anatomy and Developmental Biology, Monash University, Clayton, Victoria 3800, Australia; eQueensland Brain Institute, fCentre for Advanced Imaging, and hSchool of Biomedical Sciences, University of Queensland, Brisbane, QLD 4072, Australia; and gBreakthrough Breast Cancer Research Centre, Institute of Cancer Research, London SW7 3RP, United Kingdom Edited by Yuh Nung Jan, Howard Hughes Medical Institute, University of California, San Francisco, CA, and approved October 8, 2013 (received for review March 25, 2013) Opitz syndrome (OS) is a genetic neurological disorder. The gene axonal growth and branch formation whereas down-regulation of responsible for the X-linked form of OS, Midline-1 (MID1), encodes Mid1 in the developing cortex accelerated callosal axon growth an E3 ubiquitin ligase that regulates the degradation of the cata- and altered the projection pattern of callosal axons. In addition, lytic subunit of protein phosphatase 2A (PP2Ac). However, how a similar defect of axon development was observed in Mid1 Mid1 functions during neural development is largely unknown. knockout (KO) mice.
    [Show full text]
  • Rnai and Heterochromatin Repress Centromeric Meiotic Recombination
    RNAi and heterochromatin repress centromeric meiotic recombination Chad Ellermeiera,1, Emily C. Higuchia, Naina Phadnisa, Laerke Holma,b, Jennifer L. Geelhooda, Genevieve Thonb, and Gerald R. Smitha,2 aDivision of Basic Sciences, Fred Hutchinson Cancer Research Center, Seattle, WA 98109; and bDepartment of Molecular Biology, University of Copenhagen Biocenter, DK-2200 Copenhagen, Denmark Edited* by Paul Nurse, The Rockefeller University, New York, NY, and approved April 2, 2010 (received for review December 9, 2009) During meiosis, the formation of viable haploid gametes from diploid correlated with birth defects resulting from chromosome mis- precursors requires that each homologous chromosome pair be segregation (2). (Here and subsequently, “centromeric” is meant to properly segregated toproduce anexact haploid set ofchromosomes. include “pericentromeric.”) Thus, repression of recombination spe- Genetic recombination, which provides a physical connection be- cifically in the centromere is crucial for the proper segregation of tween homologous chromosomes, is essential in most species for meiotic chromosomes, but the mechanism by which centromeric proper homologue segregation. Nevertheless, recombination is re- recombination is repressed during meiosis has been largely unknown. pressed specifically in and around the centromeres of chromosomes, Centromeric heterochromatin in many species represses apparently because rare centromeric (or pericentromeric) recombina- within its domain the abundance of transcripts and the expres- tion events, when they do occur, can disrupt proper segregation and sion of genes inserted into the heterochromatic region (4). In the lead to genetic disabilities, including birth defects. The basis by which fission yeast Schizosaccharomyces pombe, the formation of cen- centromeric meiotic recombination is repressed has been largely tromeric heterochromatin is facilitated by RNAi functions, which unknown.
    [Show full text]
  • Evidence of Functional Redundancy Between MID Proteins: Implications for the Presentation of Opitz Syndrome
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector Developmental Biology 277 (2005) 417–424 www.elsevier.com/locate/ydbio Evidence of functional redundancy between MID proteins: implications for the presentation of Opitz syndrome Alessandra Granata, Dawn Savery, Jamile Hazan, Billy M.F. Cheung, Andrew Lumsden, Nandita A. Quaderi* MRC Centre for Developmental Neurobiology, King’s College London, Guy’s Hospital Campus, London, SE1 1UL, UK Received for publication 30 April 2004, revised 17 July 2004, accepted 8 September 2004 Available online 27 October 2004 Abstract Opitz G/BBB syndrome (OS) is a congenital defect characterized by hypertelorism and hypospadias, but additional midline malformations are also common in OS patients. X-linked OS is caused by mutations in the ubiquitin ligase MID1. In chick, MID1 is involved in left–right determination: a mutually repressive relationship between Shh and cMid1 in Hensen’s node plays a key role in establishing the avian left–right axis. We have utilized our existing knowledge of the molecular basis of avian L/R determination to investigate the possible existence of functional redundancy between MID1 and its close homologue MID2. The expression of cMid2 overlaps with that of cMid1 in the node, and we demonstrate that MID2 can both mimic MID1 function as a right side determinant and rescue the laterality defects caused by knocking down endogenous MID proteins in the node. Our results show that MID2 is able to compensate for an absence in MID1 during chick left–right determination and may explain why OS patients do not suffer laterality defects despite the association between midline and L/R development.
    [Show full text]
  • The E3-Ubiquitin Ligase MID1 Catalyzes Ubiquitination and Cleavage of Fu
    Repository of the Max Delbrück Center for Molecular Medicine (MDC) in the Helmholtz Association http://edoc.mdc-berlin.de/14376 The E3-ubiquitin ligase MID1 catalyzes ubiquitination and cleavage of Fu Schweiger, S. and Dorn, S. and Fuchs, M. and Koehler, A. and Matthes, F. and Mueller, E.C. and Wanker, E. and Schneider, R. and Krauss, S. This is a copy of the original article. This research was originally published in Journal of Biological Chemistry. Schweiger, S. and Dorn, S. and Fuchs, M. and Koehler, A. and Matthes, F. and Mueller, E.C. and Wanker, E. and Schneider, R. and Krauss, S. The E3-ubiquitin ligase MID1 catalyzes ubiquitination and cleavage of Fu. J Biol Chem. 2014; 289: 31805-31817. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc. Journal of Biological Chemistry 2014 NOV 14 ; 289(46): 31805-31817 Doi: 10.1074/jbc.M113.541219 American Society for Biochemistry and Molecular Biology Cell Biology: The E3 Ubiquitin Ligase MID1 Catalyzes Ubiquitination and Cleavage of Fu Susann Schweiger, Stephanie Dorn, Melanie Fuchs, Andrea Köhler, Frank Matthes, Eva-Christina Müller, Erich Wanker, Rainer Downloaded from Schneider and Sybille Krauß J. Biol. Chem. 2014, 289:31805-31817. doi: 10.1074/jbc.M113.541219 originally published online October 2, 2014 http://www.jbc.org/ Access the most updated version of this article at doi: 10.1074/jbc.M113.541219 Find articles, minireviews, Reflections and Classics on similar topics on the JBC Affinity Sites. at MAX DELBRUECK CENTRUM FUE on November 17, 2014 Alerts: • When this article is cited • When a correction for this article is posted Click here to choose from all of JBC's e-mail alerts This article cites 40 references, 10 of which can be accessed free at http://www.jbc.org/content/289/46/31805.full.html#ref-list-1 THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL.
    [Show full text]
  • Sonic Hedgehog Repression Underlies Gigaxonin Mutation– Induced Motor Deficits in Giant Axonal Neuropathy
    Sonic Hedgehog repression underlies gigaxonin mutation– induced motor deficits in giant axonal neuropathy Yoan Arribat, … , Mireille Rossel, Pascale Bomont J Clin Invest. 2019;129(12):5312-5326. https://doi.org/10.1172/JCI129788. Research Article Neuroscience Graphical abstract Find the latest version: https://jci.me/129788/pdf RESEARCH ARTICLE The Journal of Clinical Investigation Sonic Hedgehog repression underlies gigaxonin mutation–induced motor deficits in giant axonal neuropathy Yoan Arribat,1 Karolina S. Mysiak,1 Léa Lescouzères,1 Alexia Boizot,1 Maxime Ruiz,1 Mireille Rossel,2 and Pascale Bomont1 1ATIP-Avenir team, INM, INSERM, University of Montpellier, Montpellier, France. 2MMDN, University of Montpellier, EPHE, INSERM, U1198, PSL Research University, Montpellier, France. Growing evidence shows that alterations occurring at early developmental stages contribute to symptoms manifested in adulthood in the setting of neurodegenerative diseases. Here, we studied the molecular mechanisms causing giant axonal neuropathy (GAN), a severe neurodegenerative disease due to loss-of-function of the gigaxonin–E3 ligase. We showed that gigaxonin governs Sonic Hedgehog (Shh) induction, the developmental pathway patterning the dorso-ventral axis of the neural tube and muscles, by controlling the degradation of the Shh-bound Patched receptor. Similar to Shh inhibition, repression of gigaxonin in zebrafish impaired motor neuron specification and somitogenesis and abolished neuromuscular junction formation and locomotion. Shh signaling was impaired in gigaxonin-null zebrafish and was corrected by both pharmacological activation of the Shh pathway and human gigaxonin, pointing to an evolutionary-conserved mechanism regulating Shh signaling. Gigaxonin-dependent inhibition of Shh activation was also demonstrated in primary fibroblasts from patients with GAN and in a Shh activity reporter line depleted in gigaxonin.
    [Show full text]
  • Embryonic Expression of the Human MID1 Gene and Its Mutations In
    381 LETTER TO JMG J Med Genet: first published as 10.1136/jmg.2003.014829 on 30 April 2004. Downloaded from Embryonic expression of the human MID1 gene and its mutations in Opitz syndrome L Pinson, J Auge´, S Audollent, G Matte´i, H Etchevers, N Gigarel, F Razavi, D Lacombe, S Odent, M Le Merrer, J Amiel, A Munnich, G Meroni, S Lyonnet, M Vekemans, T Attie´-Bitach ............................................................................................................................... J Med Genet 2004;41:381–386. doi: 10.1136/jmg.2003.014829 pitz syndrome (G/BBB syndrome, MIM145410 and Key points MIM300000) is a midline congenital malformation Ocharacterised by hypertelorism, hypospadias and oesophagolaryngotracheal defects leading to swallowing N Opitz syndrome (G/BBB syndrome, MIM145410, and difficulties and a hoarse cry.1 Additional defects include cleft MIM300000) is a midline congenital malformation lip with or without cleft palate, imperforate anus, anomalies characterised by hypertelorism, hypospadias and of the central nervous system (including corpus callosum oesophagolaryngotracheal defects leading to swallow- agenesis or vermis agenesis and hypoplasia),2 congenital ing difficulties and hoarse voice. This condition is heart defects (atrial and ventricular septal defects, patent genetically heterogeneous with an X-linked recessive ductus arteriosus and coarctation of the aorta),3 and form mapped to Xp22.3 and at least one autosomal developmental delay in two thirds of patients. This condition dominant form mapped to chromosome 22q11.2. is genetically heterogeneous with an X-linked recessive form Recently, mutations in MID1 have been identified mapped to Xp22.3 and at least one autosomal dominant form in the X-linked form of the disease but the gene for 4 mapped to chromosome 22q11.2.
    [Show full text]
  • Developmental Timing of Mutations Revealed by Whole-Genome Sequencing of Twins with Acute Lymphoblastic Leukemia
    Developmental timing of mutations revealed by whole-genome sequencing of twins with acute lymphoblastic leukemia Yussanne Maa,1, Sara E. Dobbinsa,1, Amy L. Sherbornea,1, Daniel Chubba, Marta Galbiatib, Giovanni Cazzanigab, Concetta Micalizzic, Rick Tearled, Amy L. Lloyda, Richard Haine, Mel Greavesf,2,3, and Richard S. Houlstona,2,3 aMolecular and Population Genetics, Division of Genetics and Epidemiology, Institute of Cancer Research, Sutton, Surrey SM2 5NG, United Kingdom; bCentro Ricerca Tettamanti, Clinica Pediatrica, Università di Milano-Bicocca, Ospedale San Gerardo, 20900 Monza (Mi), Italy; cExperimental Clinical Hematology Unit, Istituto di Ricovero e Cura a Carattere Scientifico (IRCCS) G. Gaslini, 16148 Genova, Italy; dComplete Genomics, Inc., Mountain View, CA 94043; ePaediatric Palliative Medicine, Children’s Hospital for Wales, University Hospital of Wales, Cardiff CF14 4XW, United Kingdom; and fHaemato-Oncology Research Unit, Division of Molecular Pathology, Institute of Cancer Research, Surrey SM2 5NG, United Kingdom Edited* by Max D. Cooper, Emory University, Atlanta, GA, and approved March 5, 2013 (received for review December 10, 2012) Acute lymphoblastic leukemia (ALL) is the major pediatric cancer. ETV6-RUNX1 fusion-negative ALL. Sequencing of matched tu- At diagnosis, the developmental timing of mutations contributing mor-normal (remission) samples from each patient was carried critically to clonal diversification and selection can be buried in the out using unchained combinatorial probe anchor ligation chem- leukemia’s covert natural history. Concordance of ALL in monozy- istry on arrays of self-assembling DNA nanoballs (11). Paired-end gotic, monochorionic twins is a consequence of intraplacental reads were aligned to the Human Genome [National Center for spread of an initiated preleukemic clone.
    [Show full text]
  • The Identification of Novel Regions for Reproduction Trait in Landrace and Large White Pigs Using a Single Step Genome-Wide Association Study
    Open Access Asian-Australas J Anim Sci Vol. 31, No. 12:1852-1862 December 2018 https://doi.org/10.5713/ajas.18.0072 pISSN 1011-2367 eISSN 1976-5517 The identification of novel regions for reproduction trait in Landrace and Large White pigs using a single step genome-wide association study Rattikan Suwannasing1, Monchai Duangjinda1,*, Wuttigrai Boonkum1, Rutjawate Taharnklaew2, and Komson Tuangsithtanon3 * Corresponding Author: Monchai Duangjinda Objective: The purpose of this study was to investigate a single step genome-wide association Tel: +66-43-202362, Fax: +66-43-202361, E-mail: [email protected] study (ssGWAS) for identifying genomic regions affecting reproductive traits in Landrace and Large White pigs. 1 Department of Animal Science, Faculty of Agriculture, Methods: The traits included the number of pigs weaned per sow per year (PWSY), the Khon Kaen University, Khon Kaen 40002, Thailand 2 Research and Development Center Betagro Group, number of litters per sow per year (LSY), pigs weaned per litters (PWL), born alive per litters Pathumthani 12120, Thailand (BAL), non-productive day (NPD) and wean to conception interval per litters (W2CL). A 3 Betagro Hybrid International Company Limited, total of 321 animals (140 Landrace and 181 Large White pigs) were genotyped with the Illumina Bangkok 10210, Thailand Porcine SNP 60k BeadChip, containing 61,177 single nucleotide polymorphisms (SNPs), ORCID while multiple traits single-step genomic BLUP method was used to calculate variances of Rattikan Suwannasing 5 SNP windows for 11,048 Landrace and 13,985 Large White data records. https://orcid.org/0000-0002-6950-4384 Monchai Duangjinda Results: The outcome of ssGWAS on the reproductive traits identified twenty-five and twenty- https://orcid.org/0000-0001-7044-8271 two SNPs associated with reproductive traits in Landrace and Large White, respectively.
    [Show full text]
  • The Opitz Syndrome Gene MID1 Is Essential for Establishing Asymmetric Gene Expression in Hensen's Node
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector Available online at www.sciencedirect.com R Developmental Biology 258 (2003) 397–405 www.elsevier.com/locate/ydbio The Opitz syndrome gene MID1 is essential for establishing asymmetric gene expression in Hensen’s node Alessandra Granata and Nandita A. Quaderi* MRC Centre for Developmental Neurobiology, King’s College London, 4th Floor New Hunt’s House, Guy’s Hospital Campus, London, SE1 1UL, UK Received for publication 13 January 2003, revised 21 February 2003, accepted 25 February 2003 Abstract Patterning the avian left–right (L/R) body axis involves the establishment of asymmetric molecular signals on the left and right sides of Hensen’s node. We have examined the role of the chick Midline 1 gene, cMid1, in generating asymmetric gene expression in the node. cMid1 is initially expressed bilaterally, but its expression is then confined to the right side of the node. We show that this restriction of cMid1 expression is a result of repression by Shh on the left side of the node. Misexpression of cMid1 on the left side of the node results in bilateral Bmp4 expression and a loss of Shh expression. Correspondingly, downstream left pathway genes are repressed while right pathway genes are ectopically activated. Conversely, knocking down endogenous right-sided cMid1 results in a loss of Bmp4 expression and bilateral Shh expression. This results in an absence of right pathway genes and the ectopic activation of the left pathway on the right. Here, we present a revised model for the establishment of asymmetric gene expression in Hensen’s node based on the epistatic interactions observed between Shh, cMid1, and Bmp4.
    [Show full text]
  • AR-Dependent Phosphorylation and Phospho-Proteome Targets in Prostate Cancer
    27 6 Endocrine-Related V B Venkadakrishnan et al. AR-regulated phosphorylation 27:6 R193–R210 Cancer in prostate cancer REVIEW AR-dependent phosphorylation and phospho-proteome targets in prostate cancer Varadha Balaji Venkadakrishnan1,2, Salma Ben-Salem1 and Hannelore V Heemers1 1Department of Cancer Biology, Cleveland Clinic, Cleveland, Ohio, USA 2Department of Biological, Geological and Environmental Sciences, Cleveland State University, Cleveland, Ohio, USA Correspondence should be addressed to H V Heemers: [email protected] Abstract Prostate cancer (CaP) is the second leading cause of cancer-related deaths in Western Key Words men. Because androgens drive CaP by activating the androgen receptor (AR), blocking f kinase AR’s ligand activation, known as androgen deprivation therapy (ADT), is the default f phosphatase treatment for metastatic CaP. Despite an initial remission, CaP eventually develops f castration resistance to ADT and progresses to castration-recurrent CaP (CRPC). CRPC continues f hormonal therapy to rely on aberrantly activated AR that is no longer inhibited effectively by available f treatment resistance therapeutics. Interference with signaling pathways downstream of activated AR that f coregulator mediate aggressive CRPC behavior may lead to alternative CaP treatments. Developing such therapeutic strategies requires a thorough mechanistic understanding of the most clinically relevant and druggable AR-dependent signaling events. Recent proteomics analyses of CRPC clinical specimens indicate a shift in the phosphoproteome during CaP progression. Kinases and phosphatases represent druggable entities, for which clinically tested inhibitors are available, some of which are incorporated already in treatment plans for other human malignancies. Here, we reviewed the AR-associated transcriptome and translational regulon, and AR interactome involved in CaP phosphorylation events.
    [Show full text]
  • Enrichment of in Vivo Transcription Data from Dietary Intervention
    Hulst et al. Genes & Nutrition (2017) 12:11 DOI 10.1186/s12263-017-0559-1 RESEARCH Open Access Enrichment of in vivo transcription data from dietary intervention studies with in vitro data provides improved insight into gene regulation mechanisms in the intestinal mucosa Marcel Hulst1,3* , Alfons Jansman2, Ilonka Wijers1, Arjan Hoekman1, Stéphanie Vastenhouw3, Marinus van Krimpen2, Mari Smits1,3 and Dirkjan Schokker1 Abstract Background: Gene expression profiles of intestinal mucosa of chickens and pigs fed over long-term periods (days/ weeks) with a diet rich in rye and a diet supplemented with zinc, respectively, or of chickens after a one-day amoxicillin treatment of chickens, were recorded recently. Such dietary interventions are frequently used to modulate animal performance or therapeutically for monogastric livestock. In this study, changes in gene expression induced by these three interventions in cultured “Intestinal Porcine Epithelial Cells” (IPEC-J2) recorded after a short-term period of 2 and 6 hours, were compared to the in vivo gene expression profiles in order to evaluate the capability of this in vitro bioassay in predicting in vivo responses. Methods: Lists of response genes were analysed with bioinformatics programs to identify common biological pathways induced in vivo as well as in vitro. Furthermore, overlapping genes and pathways were evaluated for possible involvement in the biological processes induced in vivo by datamining and consulting literature. Results: For all three interventions, only a limited number of identical genes and a few common biological processes/ pathways were found to be affected by the respective interventions. However, several enterocyte-specific regulatory and secreted effector proteins that responded in vitro could be related to processes regulated in vivo, i.e.
    [Show full text]