Proc. Natl. Acad. Sci. USA Vol. 96, pp. 2794–2799, March 1999 Cell Biology The Opitz syndrome gene product, MID1, associates with microtubules SUSANN SCHWEIGER*†,JOHN FOERSTER‡,TANJA LEHMANN*, VANESSA SUCKOW*, YVES A. MULLER§, i GERALD WALTER*, THERESA DAVIES¶,HELEN PORTER ,HANS VAN BOKHOVEN**, PETER W. LUNT††, PETER TRAUB‡‡, AND HANS-HILGER ROPERS*,** *Max Planck Institute for Molecular Genetics, 14195 Berlin, Germany; ‡Research Institute for Molecular Pharmacology, 12207 Berlin, Germany; §Department of Crystallography, Max Delbru¨ck Center, 13125 Berlin-Buch, Germany; ¶Regional Cytogenetics Center, Southmead Hospital, Bristol BS2 8BJ, United Kingdom; iDepartment of Pediatric Pathology, University of Bristol BS2 8BJ, Bristol, United Kingdom; **Department of Human Genetics, University Hospital, 6500 HB Nijmegen, The Netherlands; ††Clinical Genetics Unit, Institute of Child Health, Bristol Childrens Hospital, Bristol BS2 8BJ, United Kingdom; and ‡‡Max-Planck Institute for Cell Biology, 68522 Ladenburg, Germany Edited by Lewis G. Tilney, University of Pennsylvania, Philadelphia, PA, and approved December 21, 1998 (received for review September 23, 1998) ABSTRACT Opitz syndrome (OS) is a genetically heter- a-helical region capable of coiled-coil formation (4–6). Mem- ogeneous disorder characterized by defects of the ventral bers of this protein family are involved in diverse cellular midline, including hypertelorism, cleft lip and palate, heart processes: Xenopus nuclear factor 7 (XNF7) was found to play defects, and mental retardation. We recently identified the an important role in dorsalyventral patterning of the Xenopus gene responsible for X-linked OS. The ubiquitously expressed embryo (7–9), whereas the promyelocytic protein (PML), the gene product, MID1, is a member of the RING finger family. ret finger protein (RFP-1), and transcription intermediary These proteins are characterized by an N-terminal tripartite factor (TIF-1) are protooncogenes (10–13). Furthermore, as protein–protein interaction domain and a conserved C ter- some of the RING finger proteins are part of macromolecular minus of unknown function. Unlike other RING finger pro- complexes, the formation of which depends on an intact N teins for which diverse cellular functions have been proposed, terminus (11), the tripartite motif is thought to be involved in the function of MID1 is as yet undefined. By using the green protein–protein interactions. fluorescent protein as a tag, we show here that MID1 is a A second cluster of amino acids highly conserved between microtubule-associated protein that influences microtubule MID1 and five other RING finger proteins (3) is located in the dynamics in MID1-overexpressing cells. We confirm this C terminus. The function of this protein domain is largely observation by demonstrating a colocalization of MID1 and unknown except for the C terminus of murine butyrophilin, tubulin in subcellular fractions and the association of endog- which was reported to be specifically associated with a 150-kDa enous MID1 with microtubules after in vitro assembly. Fur- cytoplasmatic protein (14). Surprisingly, all of the mutations thermore, overexpressed MID1 proteins harboring mutations identified in OS patients so far are located in the C terminus described in OS patients lack the capability to associate with of the MID1 protein (3, 15). This finding suggests that the microtubules, forming cytoplasmic clumps instead. These C-terminal domain is critical for a functional MID1 protein. data give an idea of the possible molecular pathomechanism The cellular localization of RING finger proteins has been underlying the OS phenotype. shown to be very important for their specific functions. In an attempt to shed light on the function of the MID1 protein, we Opitz GyBBB syndrome (OS) is a congenital syndrome char- have studied its intracellular localization employing transfec- acterized by malformations involving several unrelated ana- tion of green fluorescent protein (GFP) fusion constructs into tomical structures, all situated in the midline of the human COS-7, MCF-7, and HeLa cells and into human fibroblasts. body. Mental retardation associated with dysplasia of the Unlike other RING finger proteins, MID1 was not found in the corpus callosum, ocular hypertelorism (excessive distance be- nucleus but was confined to the cytoplasm. More detailed tween any paired organs, e. g. the eyes), cleft lip and cleft analysis revealed a close association of MID1 with microtu- palate, laryngotracheo-esophageal fistulas, and genitourinary bules, whereas the introduction of mutations found in OS defects such as hypospadias are all prominent manifestations patients completely abolished microtubule association. Thus, of the syndrome. Imperforate anus and hymen and cardiac our data establish a physiological role for MID1 in microtubule abnormalities such as tetralogy of Fallot have also been dynamics. At the same time, they suggest a possible patho- described (1). By linkage analysis, two main gene loci, one on mechanism for OS. chromosome 22 and one on the X chromosome, were shown to be responsible for this heterogeneous disorder (2). Employ- MATERIALS AND METHODS ing a positional cloning approach, we have recently identified a gene located at Xp22.3, designated MID1, and found that it GFP Constructs and Site-Directed Mutagenesis. GFP- is selectively mutated in patients suffering from Opitz syn- fusion constructs were generated by using the CLONTECH drome (3). GFP system employing pGFP-N3 for the C-terminal and The protein encoded by the MID1 gene comprises four pEGFP-C1 for the N-terminal MID1 fusion. Inserts were separate domains common to the RING finger proteins. amplified with Stratagene Pfu polymerase in the appropriate Therefore, MID1 represents a new member of this protein buffer containing 1 mM MgCl2. Primers used for amplifying family. Three of the four conserved domains are part of an the complete translated region were GCTCAAGCTTCGAT- N-terminal tripartite motif consisting of the RING finger GGAAACAATGGAGTCAG and TCGAATTCTTCACG- itself, a so-called B box (present in one or two copies), and an GCAGCTGCTCTGT for the N-terminal construct and GCT- The publication costs of this article were defrayed in part by page charge This paper was submitted directly (Track II) to the Proceedings office. Abbreviations: OS, Opitz syndrome; GFP, green fluorescent protein. payment. This article must therefore be hereby marked ‘‘advertisement’’ in †To whom reprint requests should be addressed at: Max-Planck accordance with 18 U.S.C. §1734 solely to indicate this fact. Institute for Molecular Genetics, Ihnestrasse 73, 14195 Berlin, Ger- PNAS is available online at www.pnas.org. many. e-mail: [email protected]. 2794 Downloaded by guest on September 29, 2021 Cell Biology: Schweiger et al. Proc. Natl. Acad. Sci. USA 96 (1999) 2795 CAAGCTTCGATGGAAACACTGGAGTCAG and TC- prepared as described (18) based on three differential centrif- GAATTCTCGGCAGCTGCTCTGTGCA for the C-terminal ugation steps (1,000 3 g, 17,500 3 g, and 100,000 3 g). MID1 construct. PCR products were digested with HindIIIy Fractions were separated on a 7.5% SDS gel, transferred to EcoRI and subsequently isolated from low melting tempera- nitrocellulose membranes, and subsequently incubated with an ture agarose with the Qiagen (Chatsworth, CA) gel extraction affinity-purified anti-MID1 and two anti-tubulin antibodies kit. (see above). Blots were incubated with horseradish peroxi- Site-directed mutagenesis was performed by using the dase-conjugated anti-rabbit Fab fragments (Amersham Phar- QuickChange kit from Stratagene. All oligonucleotides used macia) and developed with enhanced chemiluminescence re- were HPLC-purified. agents (Amersham Pharmacia) as specified by the manufac- Tissue Culture and Microtubule Stability Assay. COS-7 turer. cells were purchased from the American Type Culture Col- In Vitro Assembly of Microtubules. HeLa microtubules were lection and spread at 1 3 105 cells per well of a 6-well plate 1 prepared from 4 3 107 cells according to a protocol described day before transfection. Transfection was carried out following previously (19) by using Taxol to facilitate microtubule assem- the CLONTECH protocol of the GFP system for liposome- bly. MID1yGFP-overexpressing COS-7 cells (1 3 106) were mediated transfection by using Lipofectace (Gibco) at a ratio treated with 200 ngyml colcemid overnight to destroy the of 1.2:1 (liposomeyvector). Expression was optimal 48 hours microtubules, homogenized in 5 vol of microtubule assembly after transfection. For the microtubule stability assay, cells buffer (19), and centrifuged at 60,000 3 g for 60 min. The were incubated for 2 hours at increasing colcemid concentra- supernatant was mixed with Taxol, GTP, and HeLa microtu- tions (range 50–400 ngyml) and with 100 ngyml of colcemid bules and incubated at 37°C for 30 min. The pellet of the for 2–14 hours, respectively. The percentage of destroyed subsequent ultracentrifugation of 30 min at 40,000 3 g was microtubules bundles was calculated by dividing the number of washed once with Taxol-containing assembly buffer and ana- transfected cells with intact microtubules stained with indirect lyzed by Western blot analysis. Membranes were probed immunofluorescence by the total number of cells showing sequentially with affinity-purified anti-MID1 (see above) and GFP–MID1-expression of one coverslip (350–500 cells anti-GFP purchased from CLONTECH. In vitro assembly of counted per coverslip). This