Penicillium Pimiteouiense: a New Species Isolated from Polycystic Kidney Cell Cultures

Penicillium pimiteouiense: a new species isolated from polycystic kidney cell cultures

Stephen W. Peterson 1,2 (PKD) , fungi appeared in some cell culture bottles Microbial Properties Research Unit, National Center (Miller-Hjelle et al 1997). Contemporaneous epithe for Agricultural Utilization Research, Agricultural lial cell cultures originating with nondiseased kidney Research Service, Us. Department ofAgriculture, cells did not display fungal growths. Initial examina 1815 N. University St., Peoria, Illinois 61604 tion of the fungus on the basis of phenotypic data Sylvia Corneli (Raper and Thorn 1949, Pitt 1979, Ramirez 1982) Mycotoxin Research Unit, National Center for showed that the fungus resembled several monover Agricultural Utilization Research, Agricultural Research Service, us. Department ofAgriculture, ticillate species, Penicillium restrictum Gilman & Ab 1815 N. University St., Peoria, Illinois 61604 bot, P. dimorphosporum Swart, and P. striatisporum ]. Thomas Hjelle Stolk. Detailed phenotypic examination showed that Marcia A. Miller-Hjelle this strain did not fit the description of any of these Deborah M. owak species. Department of Biomedical and Therapeutic Sciences, Lobuglio et al (1994) and Peterson (1998) have University ofIllinois School ofMedicine at Peoria, One shown that ribosomal DNA (rD A) sequences can be Illini Drive, Peoria, Illinois 61605 used to distinguish the species of Penicillium and to Paul A. Bonneau determine their phylogenetic relationships. Ribosom Microbial Properties Research Unit, National Center al DA from each of these species was amplified us for Agricultural Utilization Research, Agricultural ing PCR, sequenced, and analyzed by maximum par Research Service, us. Department ofAgriculture, simony. The strains from PKD cell cultures had rD A 1815 N. University St., Peoria, Illinois 61604 sequences that were distinct from the three species it resembles and from all other known Penicillium Abstract: As part of a study of polycystic kidney dis species (Peterson 1998). The monoverticillate peni ease (PKD), epithelial cells were isolated and propa cillus of the new species would place it in subgenus gated from cyst walls of human kidneys obtained at A spergilloides, but Peterson (1998) has shown that nephrectomy. A Penicillium species was found grow subgenus Aspergilloides is not monophyletic. Its phy ing with the epithelial cells in some culture flasks. It logenetic relationship to other species was examined was monoverticillate and somewhat resembled P. res by parsimony analysis with species from subgenera trictum but differed morphologically from this and all Aspergillioides and Furcatum (Pitt 1979). other Penicillium species. Two strains of this fungus Ochratoxin A is known to cause nephritis of kid were isolated in pure culture and described as the neys when ingested (Creppy 1995). Although ochra new species Penicillium pimiteouiense. Ochratoxin A toxin A is known from only four species of Aspergillus production was not detected in P. pimiteouiense. The and Penicillium, and although ochratoxin A may not role, if any, that this fungus plays in polycystic kidney be produced by the fungus growing in tissue, we as disease is not known. sayed the new species for production of ochratoxin Key Words: fungi, polycystic kidney disease, A because of its habitat. rD A, systematics, Trichocomaceae

MATERIALS D METHODS

I TTRODUCTIO Media and cultures.-Czapek's agar (Cz) (Raper and Thorn 1949), Czapek's yeast extract agar (CYA) , Blakeslee's extract In the course of growing kidney epithelial cell lines MEA, and G25 agar (Pitt 1979) were formulated as de from kidneys displaying polycystic kidney disease scribed. Czapek's agar with 20% sucrose (Cz20) and M40Y agar were made as described (Raper and Fennell 1965). Accepted for publication October 15, 1998. Colony transfers were made by touching a sterile inoculat I E-mail: [email protected] ing wire to a sporulating colony, dispersing the conidia in 2 Tames are necessary to report factually on available data; how ca 50 jJ..L of sterile 0.5% Kodak photoflo, dipping the in ever, the SDA neither guarantees nor warrants the standard of the product, and the use of the name by SDA implies no approval oculating wire in the conidial suspension and touching it of the product to the exclusion of others that may also be suitable. to the agar surface. For identification using the keys of Pitt

269 270 MYCOLOGIA

(1979), the cultures were grown on CYA at 5 C, 25 C, and method of Breitholtz et al (1991) on plasma with some mod 37 C; on G25 at 25 C; and on MEA at 25 C for 7 d in the ifications: 2 mL of sample were acidified with 500 ILL of HCI dark. For identification using the keys of Raper and Thorn concentrate solution, extracted with 10 mL of methylene (1949) and Ramirez (1982), the cultures were grown on Cz chloride and centrifuged at 2000 g for 10 min. The bottom and MEA for 7-10 d at 25 C in the dark. Cultures were also layer was collected and evaporated to dryness under a nitro grown on Cz20 and M40Y for 7 d at 25 C to assess growth gen stream, reconstituted with 1 mL of acetonitrile/water on media with reduced water activity. (50:50) solution, filtered with a 0.2 ILm, 13 mm syringe filter (Whatman Inc., Clifton, New Jersey) and 50 ILL portions of Origins offungal growths.-Fungal growth was observed in sample were subjected to HPLC analyses. The HPLC column kidney cell cultures obtained from two separate kidneys. used was a RP-18 Spheri-5, 5 ILm, 220 X 4.6 mm from Perkin The kidneys were obtained from patients with autosomal Elmer Applied Biosystems Div., Foster City, California (ABI) , dominant polycystic kidney disease: Patient #1, a 43-year-old maintained at 30 C during the analyses. The mobile phase female, had undergone peritoneal dialysis for two yr prior consisted of acetonitrile/water/acetic acid (50:49:1) with a to nephrectomy; Patient #2, a 47-year-old female, had un flow rate of 1.0 mL/min, and the fluorometric detector dergone hemodialysis continuously for nearly 10 yr prior to (Spectra System FL2000, Spectra-Physics, San Jose, Califor nephrectomy. The kidneys were obtained 17 mo apart. Cells nia) was set at 333 nm excitation and 470 nm emission. The lining the inner (urinary) surface of kidney cysts were iso average recovery value for sample spiked with 10 ILg/Kg OA lated from each kidney by digestion with warm collagenase in Delbecco's Modified Essential Medium (DMEM) nutri was 96% (standard deviation: 2.4). ent mixture F-12 HAM (Sigma Chemical Co., St. Louis, Mis DNA extraction and sequencing.-Five mm plugs of agar and souri) (Hjelle et al 1990). The cells obtained were pelleted, mycelium were cut from a MEA plate and placed in a 15 the collagenase solution discarded, the cells resuspended in mL sterile disposable centrifuge tube. Two mL of DA ex DMEM/F12 HAM, and fortified with 10 mg/mL strepto traction buffer (100 mM Tris, 50 mM EDTA, 1% sarcosyl, mycin, 2 mM glutamine, 0.25 ug/mL amphotericin B, 3 g/ pH 8.0), 2 g glass beads (0.5 mm diam) and 2 mL of phe L sodium bicarbonate, 10% bovine calf serum (Hyclone nol : chloroform (1: 1) were added. Cell walls were disrupted Lab Inc., Logan, Utah), and seeded in plastic T-25 flasks for and an emulsion was formed by vortexing the tube for 45 growth at 37 C in humidified 95% air/5% CO , All culture 2 60 s. Proteins were extracted by gentle rocking of the emul solutions used in cell isolation and propagation were devoid sion for 20 min. Organic and aqueous phases were separat of microbial growth for two mo, the endpoint for the ste rility checks. ed by low speed centrifugation (ca 2000 g) for 5 min. The Single colonies of the Penicillium sp. were picked from aqueous phase was pipetted to a clean tube, 0.1 vol 3M kidney cell culture bottles with a sterile inoculating wire and sodium acetate and 1.3 vol 95% ethanol were added to pre transferred to MEA petri plates. After 4-5 d growth, conidia cipitate D A. The precipitate was pelleted by low speed were picked from this plate, dispersed in dilute sterile pho centrifugation (ca 2000 g), and the liquid was decanted. toflo and ca 50 colonies were spotted on MEA plates from The pellet was dissolved in 100 ILL of TE (10 mM Tris, 1 the conidial suspension. Colonies were checked daily for the mM EDTA, pH 8.0), 2.5 vol of saturated NaI was added, appearance of mixed cultures. After 10 d, one of the pure and DA was adsorbed to a silica matrix (Geneclean, colonies was subcultured and kept for further study. Bio101, La Jolla, California) following the manufacturer's All strains and species of Penicillium used in this study are instructions. The matrix was rinsed to remove impurities. permanently preserved in the Agricultural Research Service Genomic DA was eluted into 1/10th strength TE buffer Culture Collection ( RRL), Peoria, Illinois, as lyophilized and stored at - 20 C. cultures. The strains, their origins, and GenBank deposit A fragment of the ribosomal DA repeat unit that in numbers for the nucleotide sequences are listed in TABLE 1. cludes ITS1, ITS2, 5.8S rD A and about 635 bases of the 28S rD A (regions D1 and D2) was amplified using PCR SEM microscopy.-Blocks of agar with mycelium were cut and site-specific oligonucleotide primers (Peterson et al from MEA plates and placed in screw-eap vials with 0.5 mL 1998, White et al 1990). The PCR amplified fragment was of 1% OS04 in cacodylate buffer (Peterson 1992). Fixation purified using Geneclean. Sequencing reactions were per continued overnight (at least 12 h) at room temperature. formed using the ABI Dye Deoxy sequencing kits. ucle Samples were dehydrated by immersing the agar block in a otide sequences from both DNA strands were read on an graded series of ethanol solutions (25%, 50%, 75%, 95% ABI 373 DA sequencer. The primers used for sequencing and 100%) for 30 min each. Samples were critical point are ITS1 5'-TCCGTAGGTGAACCTGCGG; ITS2 5' dried and sputter coated with gold-palladium and viewed GCTGCGTTCTTCATCGATGC; ITS3 5'-GCATCGATGAA in a JEOL scanning electron microscope. GAACGCAGC; ITS4 5'-TCCTCCGCTTATTGATATGC; D1 Ochratoxin (OA) assay.-500 mL of YES medium (Ciegler 5'-GCATATCAATAAGCGGAGGA; DIR 5'-ACTCTCTTTT 1972) was sterilized in a 2.8-L Fernbach flask closed with a CAAAGTGCTTTTC; D2 5'-GAAAAGCACTTTGAAAAGA cotton stopper. After cooling, the flask was inoculated with GAGT; and D2R 5'-AACCAGGCACAAAGTTCTGC. Se the conidia from a MEA slant of the Penicillium sp., and held quences for phylogenetic analysis were aligned using stationary at 28 C for 7 d. Portions of the culture media were ClustalW (Higgins and Sharp 1988, 1989) followed by collected for the OA determination and were kept at 4 C manual modification of the alignment using a text editor. until analyzed. The OA analysis was carried out following the Phylogenetic analysis was performed using the parsimony PETERSON ET AL: P. PIMITEOUIENSE SP. OV. 271 program DNAPARS in the PHYLIP package of programs colony reverse was light straw yellow. No growth or (Felsenstein 1993) and PAUP 3.1.1 (Swofford 1993). germination was observed at 5 C. Growth on Cz20 was 18-21 mm in 7 d, and the

RESULTS colonies were raised, white, and produced very few conidia. 0 exudate or soluble pigments were pro Penicillium pimiteouiense S. W. Peterson, sp. nov. duced. Similarly, on M40Y plates, colonies attained FIcs. 1-5 17-18 mm diam in 7 d, and produced white colonies Coloniae in agaro cum extracto malti cultae 20-22 mm with very sparse conidia. diam post 7 dies. Coloniae margo submersus, hyphis aeri Assays for ochratoxin A in the culture medium of alibus parum funicularibus. Conidiogenesis moderata, co P. pimiteouiense were uniformly negative, in a system lore conidiali universali pallide olivaceo-griseo (R, Ll). Con that detects 10 IJ-g/Kg ochratoxin A. In samples of idiophori ex hyphis aerialibus enascentes, stipitibus brevi bus, 5-10(-16) !-Lm X 2-3 !-Lm diam. Penicillus non-vesicu the culture medium that were spiked with pure och latus, 2-3(-4) phialides 5-6(-8) !-Lm X 1.5-2.2(-3) !-Lm ratoxin A, more than 96% of the added ochratoxin diam gerens. Conidia globosa vel subglobosa, subtiliter ex was detected in the assay. asperata, 1.5-3 !-Lm diam, in catenis brevibus in phialide A phylogenetic tree (FIe. 6) was generated by a portata. heuristic search using maximum parsimony with ran Colonies grown on MEA (FIe. 1) are 20-22 mm dom addition order of the combined ITS1, ITS2, diam after 7 d. Colony margin submerged, aerial hy 5.8S and 28S rDNA data set. The total length of the phae slightly ropy. Conidiogenesis moderate, conidial aligned sequences used in the analysis was 1241 ba color in mass light olive gray (Ridgway 1912, plate ses. Of the total, 901 positions were constant, 70 po LI). Conidiophores are born on aerial hyphae on sitions were variable but parsimony-uninformative, MEA plates and penicilli (FIcs. 2, 4, 5) are strictly and 270 positions were phylogenetically informative. monoverticillate and nonvesiculate. Stipes are short Each region of the total data set was also analyzed 5-10(-16) IJ-m X 2-3 IJ-m bearing whorls of 2-3(-4) separately to determine whether all gene regions short, ampulliform phialides, 5-6(-8) IJ-m X 1.5 gave congruent trees (O'Donnell and Cigelnik 2.2(-3) IJ-m, per verticil. Conidia (FIcs. 2, 3, 5) are 1997). The partial data sets were bootstrapped and globose to subglobose, 1.5-3 IJ-m diam, finely rough only branches with greater than 70% bootstrap value ened, and born in short chains (FIe. 2). were compared (data not shown). All branches of the HOLOTYPE. Dried colonies of NRRL 25542, after trees obtained from analysis of the subsets and the 7 d growth on MEA, deposited in the National Her entire data set were consistent. The phylogenetic barium (BPI # 806262). Ex-type culture RRL 25542. analysis placed P. pimiteouiense in a clade with Eupen Etymology. Pimiteoui (literally "fat river") is the icillium parvum, E. rubidurum, P. striatisporum and name given to the upper Peoria Lake section of the P. vinaceum. Other monoverticillate and furcate spe Illinois River by the Peoria tribe of the Algonquin cies of Penicillium are intermixed in clades on this nation who lived in the region prior to exploration tree, and are more distantly related to P. pimi and settlement of the Illinois River valley by Euro teouiense. pean settlers. Origin of strains. RRL 25542 was isolated from a DISCUSSION kidney epithelial cell culture flask in which epithelial cells from polycystic kidneys were being grown, 1 Apr Penicillium pimiteouiense is most similar phenotypical 1996, Peoria, Illinois. NRRL 26976 isolated from a ly to P. restrictum. Both species have restricted growth PKD kidney epithelial cell culture flask, 11 Sep 1997. on all media, and monoverticillate, nonvesiculate Colonies grown for 7 d on CYA attained 16-18 mm penicilli. The short stipe is common to both. When diam, were raised, radially sulcate with 4-5 furrows compared to P. restrictum (TABLE II), P. pimiteouiense and the margin grows on the surface. The hyphae has similar growth rates on MEA and CYA at 25 C. are white, slightly funiculose, and conidiogenesis is However, the growth of P. pimiteouiense is much more very sparse. Colony is white, a yellow exudate and a luxurious at 37 C than that of P. restrictum. At 5 C, brown soluble pigment are present and the reverse P. pimiteouiense does not grow or germinate, while is dark brown. When grown at 37 C on CYA, colonies germination of spores at 5 C is common in isolates attained 21 mm diam but otherwise were the same of P. restrictum. Penicillium pimiteouiense has whorls as colonies grown at 25 C. When grown on G25N, of 2-3 phialides (FIGs. 2, 4, 5) on each stipe produc colonies attained 8-9 mm diam, were raised, margins ing short chains of finely roughened conidia, while were on the surface, and were slightly funiculose. P. restrictum cultures typically produce whorls of 7-9 The hyphae are white, conidiogenesis is absent, no phialides per verticil. exudate or soluble pigment was observed and the Penicillium pimiteouiense also bears a resemblance 272 MVCOLOGIA

TABLE I. Fungal strains used in this study

Species RRL# Origina GenBank #

Talaromyces helicus (Raper & D. I. 2106 Isolated from soil, Sweden, 1945. ATCC 10451, AF033396 Fennell) C. R. Benjamin CBS 335.48, IMI 40593. Penicillium aculeatum Raper & D. I. 2129 Isolated from biscuits, Florida, 1946. ATCC AF033397 Fennell 10409, CBS 289.48, IMI 40588. Penicillium adametzii Zaleski 737 Isolated from forest soil, Poland, 1928. ATCC AF033401 10407, CBS 209.28, IMI 39751 Penicillium bilaiae Chalabuda 3391 Isolated from soil, Kiev, Ukraine, 1968. ATCC AF033402 48731, CBS 221.66, IMI 113677. Penicillium adametzioides Abe ex G. 3405 From Japan, 1968. ATCC 18306, CBS 313.59, AF033403 Smith IMI68227. Penicillium sclerotiorum Beyma 2074 Received from CBS. Isolated from air, Indone- AF033404 sia, 1945. ATCC 10494, CBS 287.36, IMI 40569. Penicillium herquei Bainier & Sarto- 1040 Isolated from Agauria leaf, France, 1922. ATCC AF033405 ry 10118, CBS 336.48, IMI 28809. Penicillium pimiteouiense S. W. Peter- 25542 Ex-type of P pimiteouiense. Isolated from kidney AF037431 son epithelial cell culture flask, Peoria, IL, 1 April 1996 by J. T. Hjelle, University of Illinois. 26796 Nontype isolate from PKD kidney epithelial cell AF037432 culture, Peoria, IL, 11 Sept 1997. Penicillium lividum Westling 754 ATCC 10102, CBS 347.48, IMI 39736. AF033406 Penicillium glabrum (Wehmer) Wes- 766 Recieved from Biourge, 1924, as P aurantiob- AF033407 tling runneum. ATCC 10103, IMI 92195. Penicillium purpurescens (Sopp) 720 Isolated from soil, Canada, 1932. ATCC 10485, AF033408 Biourge CBS 366.48, IMI 39745. Penicillium spinulosum C. Thorn 1750 Isolated as culture contaminant, Germany. AF033410 ATCC 10498, CBS 374.48, IMI 24316 Eupenicillium pinetorum Stolk 3008 Isolated from forest soil, Wisconsin, 1962. ATCC AF033411 14770, CBS 295.62, IMI 94209. Penicillium roseopurpureum Dierckx 2064 ATCC 10492, CBS 266.29, IMI 40573. AF033415 Penicillium miczynskii Zaleski 1077 Isolated from conifer forest soil, Poland, 1928. AF033416 ATCC 10470, CBS 220.28, IMI 40030. Eupenicillium hirayamae D. B. Scott 143 Isolated from milled Thai rice, 1960. ATCC AF033418 & Stolk 18312, CBS 229.60, IMI 78255. Penicillium citrinum Thorn 1841 Received from G. Smith, U.K., 1929. TYPE AF033422 strain of P aurifluum. ATCC 36382, CBS 139.45, IMI 91961. Eupenicillium anatolicum Stolk 5820 Isolated from soil, South Africa, 1967. CBS AF033425 467.67. Penicillium cyaneum (Bainier & Sar- 775 ATCC 10432, CBS 315.48, IMI 39744. AF033427 tory) Biourge Penicillium implicatum Biourge 2061 Isolated from soil, India, 1944. ATCC 48445, AF033428 CBS 184.81, IMI 190235. Penicillium capsulatum Raper & D. 2056 Isolated from a camera lens, Panama, 1945. AF033429 I. Fennell ATCC 10420, CBS 301.48, IMI 40576. Eupenicillium terrenum D. B. Scott 5824 Isolated from forest soil, Luzon, Philippines, AF033446 1973. ATCC 48205, CBS 622.72. Penicillium raciborskii Zaleski 2150 Isolated from soil, Poland, 1946. ATCC 10488, AF033447 CBS 224.28, IMI 40568. Penicillium velutinum Beyma 2069 Isolated from sputum, etherlands. ATCC AF033448 10510, CBS 250.32, IMI 40571. Penicillium melinii C. Thorn 2041 Isolated from forest soil, USA, 1946. AF033449 Eupenicillium lapidosum D. B. Scott 718 Isolated from spoiled, canned blueberries, USA, AF033409 & Stolk 1929. ATCC 10462, CBS 343.48, IMI 39743. PETERSO ET AL: P. PIMTTEOUJENSE SP. NOV. 273

TABLE I. Continued

Species RRL# Origina GenBank Penicillium thomii Maire 2077 Isolated from a pine cone, USA. ATCC 48218, AF034448 CBS 255.81, IMI 189694. Penicillium decumbens Thorn 741 Received from Biourge, 1924. ATCC 48470, CBS AF033453 230.81, IMI 190875. Eupenicillium alutaceum D. B. Scott 5812 Isolated from soil, South Africa, 1967. ATCC AF033454 18542, CBS 317.67, IMI 136243. Penicillium cinerascens Biourge 748 Received from Biourge, 1924. ATCC 48693, IMI AF033455 92234. Penicillium citreonigrum Dierckx 761 Received from Biourge, 1924, as type of P sub- AF033456 cinereum. ATCC 48736, CBS 258.29, IMI 92209. Penicillium restrictum Gilman & Ab 1748 Isolated from soil, Honduras, 1940. ATCC 11257, AF033457 bott CBS 367.48, IMI 40228. Eupenicillium katangense Stolk 5182 Isolated from soil, Zaire, 1970. ATCC 18388, CBS AF033458 247.67, IMI 135206. Eupenicillium parvum (Raper & D. I. 2095 Isolated from soil, Nicaragua, 1945. ATCC 10479, AF033460 Fennell) Stolk & D.B. Scott CBS 359.48, IMI 40587. Penicillium vinaceum Gilman & Ab 739 Isolated from soil, Utah, 1927. ATCC 10514, CBS AF033461 bott 389.48, IMI 29189. Eupenicillium rubidurum Udagawa & 6033 Isolated from soil, Papua, New Guinea 1973. AF033462 Horie ATCC 28051, CBS 609.73, IMI 22855l. Eupenicillium erubescens D. B. Scott 6223 Isolated from soil, South Africa, 1969. ATCC AF033464 18544, CBS 318.67, IMI 136204. Penicillium stratisporum Stolk 26877 Isolated from Acacia sp. leaf litter, South Africa, AF038938 1966. ATCC 22052; CBS 705.68, IMI 151749. Penicillium dimorphosporum Swart 5207 Isolated from mangrove swamp soil, Victoria, AF038939 Australia, 1970. CBS 456.70.

a Except where noted, each strain is an ex-type culture. ATCC = American Type Culture Collection. CBS = Centraalbureau voor Schimmelcultures. IMI = International Mycological Institute. to P dimorphosporum. However, colony growth rate though this relationship is not implied in the current of P dimorphosporum is much less at 37 C than that taxonomic hierarchy of Eupenicillium (Scott 1968, of P pimiteouiense; P dimorphosporum produces Pitt 1979, Stolk and Samson 1983). The species occur sparse conidia on CYA that initially are pale green on a subbranch with less than 50% bootstrap sup but become deep purple-red as they age; it does not port. Penicillium pimiteouiense differs from E. parvum produce exudate; and soluble pigments are some in forming no asci, in forming much shorter stipes times present. Penicillium dimorphosporum produces (5-8 /Lm versus 40-50 /Lm) and having fewer (2-3) verticils with 2-10 phialides of much greater diame phialides per verticil than E. parvum (7-8), and the ter (3-4.5 /Lm) and the conidia are of greater di conidia of E. parvum are smooth and form long ameter (4-5 /Lm versus 2-3 /Lm). The rD A sequenc chains that remain intact in fluid mounts. Eupenicil es of these two species are distinct. lium rubidurum forms long stipes (15-60 /Lm) with Penicillium striatisporum also resembles P pimi occasional branching of the conidiophore, has 10 teouiense but P striatisporum can be distinguished by 15 phialides per verticil and its conidia are smooth the stria on the conidia, the lack of soluble pigments walled. Eupenicillium erubescens resembles this species and the rosy color of colonies when it is grown on closely, producing very short, strictly monoverticillate Cz. Also phenotypically resembling P pimiteouiense is conidiophores. It differs from P pimiteouiense in pro P vasconiae Ramirez & Martinez. However, P vascon ducing purple to reddish-brown exudate, purple iae sporulates well on Cz in gray-green to brownish brown colony reverse on Cz, conidiophore walls that gray shades, produces no exudate or soluble pig are roughened, 3-5 phialides per verticil, and conid ments, and produces larger (4-5 /Lm diam) spinose ia that are smooth-walled. conidia (Ramirez 1982). Lobuglio et al (1994) and Peterson (1995), and Phylogenetically, P pimiteouiense is most closely re Peterson et al (1998) have shown that there is little lated to P striatisporum, P vinaceum and two species or no ITS sequence variation or 28S rD A variation of Eupenicillium, E. rubidurum and E. parvum, al- among strains of a morphologically defined species, 274 MYCOLOGIA

FIGs. 1-5. Penicillium pimiteouiense. 1. Seven-day-old colony grown on MEA. The aerial hyphae are somewhat ropy, and sporulation is light, so that the vegetative hyphae dominate the appearance of the colony. 2. SEM micrograph of phialides and conidia; the three phialides are a common arrangement in this species. The stipe is smooth, and the conidia are slightly roughen by puncta on the surfaces of the conidial walls. The short chains of conidia break into individual conidia in water mounts for microscopy. 3. SEM micrograph of a mass of conidia. Conidia are mostly 1.5-2.5 f..Lm diam, and predominantly globose to subglobose, and mostly with punctate walls. Some of the conidia appear nearly smooth in this micrograph. 4. Phase contrast micrograph showing the typically short conidiophores bearing 2-3 phialides per verticil on aerial hyphae of the colony. 5. SEM micrograph of an exceptionally short conidiophore bearing 2 phialides. PETERSON ET AL: P. PIMITEOUIENSE SP.. OV. 275

E. terrenum (A) P raciborskii (F) P velutinum (F) P melinii (F) P restrictum (A) E. katangense (A) P cinerescens (F) P citreonigrum (A) P decumbens (A) E. alutaceum (A) P dimorphosporum (A) E. erubescens (A) P vinaceum (A) P striatisporum (A) E. parvum (A) P pimiteouiense (A) E. rubidurum (A) P thomii (A) 81 E. lapidosum (A) P spinulosum (A) P glabrum (A) P purpurescens (A) E. pinetorum (A) P lividum (A) P sclerotiorum (A) E. hirayamae (A) P adametzii (A) P biliaie (A) P adameztioides (A) P herquei (F) P miczynskii (F) '----- P citrinum (F) P roseopurpureum (A) E. anatolicum (A) P cyaneum (A) P implicatum (A) P capsulatum (A) Talaromyces helicus P aculeatum 10

FiG. 6. Phylogram from maximum parsimony analysis of ITSl, ITS2, 5.8S rD A and 28S rD A sequences. Numbers of steps between tree nodes are proportional to branch length (see 10 step bar), and numbers below the lines are bootstrap values for those nodes. Bootstrap values below 70% are not listed. Parenthetical A or F indicate placement in subgenus Aspergilloides or Furcatum (Pitt 1979). 276 MVCOLOCIA

TABLE II. Colony growth of P pimiteouiense and some phenotypically similar Penicillium spp. after 7 d

Colony growth (mm) Species and RRL number 5 C CYA 25 C CYA 25 C ME 37 C CYA G25 P pimeteouiense 25542 no germination 17 19 21 8 P pimiteouiense 26796 no germination 17 20 21 8 P restrictum 1748 germination 19 26 10 11-14 P dimorphosporum 5207 no germination 23 29 28 8-12 P striatisporum 26877 - a 14 14 10 P vinaceum 739 17-19 19 17-19 E. rubidurum 6033 no growth 21 30 E. erubescens 6223 no growth 16-20 9 E. parvum 2085 17-19 16-19 24-30

a Data not collected.

sexually compatible strains of yeast (Peterson and Because the fungus was found in diseased kidney Kurtzman 1991) and sexually compatible filamentous cells and OA is a known nephrotoxin, we assayed the fungi (Peterson and Logrieco 1991). Aspergillus par strains for ochratoxin A production. The lack of OA asiticus and A. flavus are distinguished by eight ITS production suggests that any affect the fungus may nucleotide substitutions and among more than 150 have on PKD is not mediated by the toxin. strains of A. tamarii, there was but a single ITS sub Polycystic kidney disease is an inherited disease usu stitution Peterson et al (1998). Geiser et al (1998) ally transmitted in an autosomal dominant fashion have found a cryptic species among strains of the well that causes cellular abnormalities in the kidneys. By studied species A. flavus. Given this experience, the age 50, about half of the PKD population may pro numerous ITS and 28S rD A nucleotide substitu gress to end stage renal disease, but the factors causing tions between P pimiteouiense and the Eupenicillium progression to renal failure are not clearly under spp. strongly suggest that P pimiteouiense is a distinct stood. Fungi are infrequently reported etiological species rather than an anamorphic state of one of agents of urinary tract infections in PKD patients (e.g., the Eupenicillium species. On the basis of phenotypic Sklar et al 1987), but recent studies have detected fun analysis and on the basis of phylogenetic analysis of gal DA in fluid and tissue from PKD kidneys (Miller ITS and rD A sequence data, it appears justifiable to Hjelle et al 1997). Invasive fungal growth itself may describe P pimiteouiense as a distinct species. not lead to kidney failure, but most Penicillium species In the phylogram (FIc. 6), species from subgenus synthesize a number of secondary metabolites and Aspergilloides (A) and subgenus Furcatum (F) do not their effects on kidney tissue are unknown. segregate as distinct clades, but form mixed clades. Penicillium pimiteouiense may playa role in polycys The high bootstrap values on nodes of the tree (FIc. tic kidney disease (Miller-Hjelle et al 1997), or it may 6) indicate strong statistical support for this arrange simply be able to grow in the PKD kidney tissue cul ment of the species in the tree. Complexity of the ture medium. The new species has only been ob penicillus (Pitt 1979) has been used to characterize tained from kidney cell cultures made from polycystic the four subgenera of Penicillium. The rD A se kidney material, but not from kidney cell cultures quence data show that penicillus complexity, as judged under the conditions specified (Pitt 1979), is started from normal human, rabbit, dog, or rat kid not a good character for delimiting monophyletic ney tissue. It seems likely that this fungus also grows subgenera (Peterson 1998). in additional habitats in nature, but we have not yet Ochratoxin A (OA), a mycotoxin produced by A. isolated it from other sources. The ability of P pimi ochraceus Wilhelm, P verrucosum Dierkx A. niger teouiense to grow at 37 C makes it a potential oppor Tieg., and A. carbonarius (Bainier) C. Thom, is tunistic pathogen of debilitated patients. Additional known to be nephrotoxic, immunotoxic and a potent examination of PKD kidney tissue may resolve wheth teratogen (Hayes 1981, Krogh 1987, Kuiper-Good er this species is commonly found in PKD kidney. It man and Scott 1989, Ono et al 1995). Its well estab would also be valuable for the study of polycystic kid lished carcinogenity in rats and mice, has caused och ney disease to determine the relative effects of the ratoxin A to be classified as a possible human carcin various metabolites produced by P pimiteouiense on ogen (Anonymous 1993, Kanasawa and Suzuki 1978). healthy and PKD kidney epithelial cells. PETERSO ET AL: P. PIMTTEOUIENSE sr. NOV. 277

ACKNOWLEDGMENTS brink-Kurtzman MA, Peterson SW, Nowak DM, Darras FS. 1997. Polycystic kidney disease: an unrecognized The authors appreciate the skilled technical assistance of F. emerging infectious disease? Emerging Infect Dis 3: Lee Baker, ational Center for Agricultural Utilization Re 113-127. search, Peoria, Illinois, who operated the scanning electron O'Donnell K, Cigelnik E. 1997. Two divergent intragenomic microscope and Dr. William J. Dress, L. H. Bailey Horta rDNA ITS2 types within a monophyletic lineage of the rium, Ithaca, New York, who kindly prepared the Latin for fungus Fusarium are nonorthologous. Mol Phylogenet the description. Evol 7:103-116. Ono H, Kataora A, Koakutsu M, Tanaka K, Kawasugi S, Wak azawa M, Ueno Y, Manabe M. 1995. Ochratoxin A LITERATURE CITED producibility by strains of Aspergillus nigergroup stored Anonymous. 1993. Ochratoxin A. Monographs on the eval- in IFO culture collection. Mycotoxins 41:47-51. uation of carcinogenic risks to humans: some naturally Peterson SW. 1992. Neosartorya pseudofischeri sp. nov. and occurring substances; food items and constituents, het- it relationship to other species in Aspergillus section erocyclic aromatic amines and mycotoxins, IARC 56: Fumigati. Mycol Res 91:547-554. 489-521 (Geneva: International Agency for Research ---. 1995. Phylogenetic analysis of Aspergillus sections on Cancer). Cremei and Wentii based on ribosomal DNA sequences. Breitholtz A, Olsen M, Dahlback A, Hult K. 1991. Plasma Mycol Res 99:1349-1355. Ochratoxin A levels in three Swedish populations sur- ---. 1998. Phylogenetic analysis of Penicillium species veyed using a ion-pair HPLC technique. Food Addit based on ITS and Isu-rDNA. Proc Third Int Workshop Contam 8:183-192. Penicillium and Aspergillus (In press). Ciegler A. 1972. Bioproduction of ochratoxin A and peni- ---, Kurtzman CPo 1991. Ribosomal RNA sequence di- cillic acid by members of the Aspergillus ochraceus vergence among sibling species of yeasts. Syst Appl Mi- group. Can] Microbiol 18:631-636. crobiol 14:124-129. Creppy EE. 1995. Ochratoxin A in food: molecular basis of ---, Logrieco A. 1991. Ribosomal RNA sequence varia- its chronic effects and detoxification. In: Eklund M, tion among interfertile strains of some Gibberella spe- Richard ]L, Mise K, eds. Molecular approaches to food cies. Mycologia 83:397-402. safety, issues involving toxic microorganisms. Fort Col- ---, Horn BW, Ito Y, Goto T. 1998. Genetic variation lins, Colorado: Alaken. p 445-460. and aflatoxin production in Aspergillus tamarii and A. Felsenstein J. 1993. PHYLIP version 3.5. Seattle: University caelatus. Proc Third Int Workshop Penicillium and As- of Washington. pergillus (In press). Geiser DM, Pitt]I, Taylor ]W. 1998. Cryptic speciation and Pitt]I. 1979. The genus Penicillium and its teleomorphic recombination in the aflatoxin-producing fungus As- states Eupenicillium and Talaromyces. New York: Aca- pergillus flavus. Proc atl Acad Sci USA 95:388-393. demic Press. 634 p. Hayes AW. 1981. Mycotoxin teratogenicity and mutagenici- Ramirez C. 1982. Manual and atlas of the Penicillia. ew ty. Boca Raton, Florida: CRC Press. 121 p. York: Elsevier Biomedical Press. 874 p. Higgins DG, Sharp PM. 1988. CLUSTAL: a package for per- Raper KB, Fennell DI. 1965. The genus Aspergillus. Balti- forming multiple sequence alignments on a microcom- more: Williams and Wilkins. 686 p. puter. Gene 73:237-244. ---, Thorn C. 1949. A manual of the Penicillia. Balti- ---,---. 1989. Fast and sensitive multiple sequence more: Williams and Wilkins. 875 p. alignments on a microcomputer. CABIOS 5:151-153. Hjelle]T, Waters DC, Golinska BT, Steidley KR, Burmeister Ridgway R. 1912. Color standards and color nomenclature. V, Caughey R, Ketel B, McCarroll DR, Olsson P], Prior Washington, DC: Publ by author. 43 p 53 pI. RB, Miller MA. 1990. Autosomal recessive polycystic kid- Scott DB. 1968. The genus Eupenicillium Ludwig. CSIR Re- ney disease: characterization of human peritoneal and search Report nr 272. 150 p. cystic kidney cells in vitro. Am] Kidney Dis 15:123-136. Sklar A, Caruana R], Lammers]E, Strauser GD. 1987. Renal Kanisawa M, Suzuki S. 1978. Induction of renal and hepatic infection in autosomal dominant polycystic kidney dis- tumors in mice by ochratoxin A, a mycotoxin. Gann ease. Am] Kidney Dis 82:714-718. 69:599-600. Stolk AC, Samson RA. 1983. The Ascomycete genus Eupen- Krogh P. 1987. Ochratoxins in food. In: Krogh P, ed. My- icillium and related Penicillium anamorphs. Stud Mycol cotoxin in food. New York: Academic Press. p 97-121. 23:1-149. Kuiper-Goodman T, Scott PM. 1989. Risk assessment of the Swofford DL. 1993. PAUP; phylogenetic analysis using par- mycotoxin ochratoxin A. Biomed Environ Sci 2:176- simony, version 3.1.1. Distributed by Illinois Natural 248. History Survey, Champaign, Illinois. Lobuglio KF, Pitt]I, Taylor JW. 1994. Independent origins White T], Bruns TD, Lee SB, Taylor JW. 1990. Amplification of the synnematous Penicillium species, P duclauxii, P and direct sequencing of fungal ribosomal DNA for phy- clavigerum, and P vulpinum, as assessed by two ribo- logenetics. In: Innis MA, Gelfand DH, Sninsky jJ, White somal DA regions. Mycol Res 98:250-256. T], eds. PCR protocols: a guide to the methods and ap- Miller-Hjelle MA, Hjelle]T, Jones M, MaYbe;:~~i:dbY U.S. D~ptofAgnc~ fi cademic Press, p 315-322,

« ationa Center for Agric 'tura' . \za i n Re ezrch~ Pe r~, Hinj~