Development of a Multiplex PCR and Magnetic DNA Capture

pathogens

Article Development of a Multiplex PCR and Magnetic DNA Capture Assay for Detecting Six Species Pathogens of the Genera Anaplasma and Ehrlichia in Canine, Bovine, Caprine and Ovine Blood Samples from Grenada, West Indies

Bhumika Sharma 1,* , Roman R. Ganta 2, Diana Stone 1, Andy Alhassan 1 , Marta Lanza-Perea 3, Vanessa Matthew Belmar 1, Inga Karasek 4, Elizabeth Cooksey 4, Catherine M. Butler 4, Kathryn Gibson 1,† and Melinda J. Wilkerson 1

1 Department of Pathobiology, School of Veterinary Medicine, St. George’s University, St. George, West Indies, Grenada; [email protected] (D.S.); [email protected] (A.A.); [email protected] (V.M.B.); [email protected] (K.G.); [email protected] (M.J.W.) 2 Center of Excellence of Vector Borne Diseases, Department of Diagnostic Medicine/Pathobiology, College of Veterinary Medicine, Kansas State University, Manhattan, KS 66506, USA; [email protected] 3 Department of Small Animal Medicine & Surgery, School of Veterinary Medicine, St Georges University, St. George, West Indies, Grenada; [email protected] 4 Department of Large Animal Medicine & Surgery, School of Veterinary Medicine, St. George’s University, St. George, West Indies, Grenada; [email protected] (I.K.); [email protected] (E.C.); Citation: Sharma, B.; Ganta, R.R.; [email protected] (C.M.B.) Stone, D.; Alhassan, A.; Lanza-Perea, * Correspondence: [email protected] M.; Matthew Belmar, V.; Karasek, I.; † Current address: Office of Field Operations, Food Safety and Inspection Service, Cooksey, E.; Butler, C.M.; Gibson, K.; United States Department of Agriculture, Edinburg, VA 22824, USA. et al. Development of a Multiplex PCR and Magnetic DNA Capture Abstract: Infections with tick-borne pathogens belonging to Anaplasma/Ehrlichia in various vertebrate Assay for Detecting Six Species hosts are a persistent problem resulting in nonspecific clinical signs during early infection. Diagnosis Pathogens of the Genera Anaplasma of single and multi-infections with these pathogens, causing diseases in companion/agricultural and Ehrlichia in Canine, Bovine, Caprine and Ovine Blood Samples animals and people, remains a challenge. Traditional methods of diagnosis, such as microscopy and from Grenada, West Indies. Pathogens serology, have low sensitivity and specificity. Polymerase chain reaction (PCR) assays are widely 2021, 10, 192. https://doi.org/ used to detect early-phase infections, since these have high sensitivity and specificity. We report 10.3390/pathogens10020192 the development and validation of an assay involving PCR followed by magnetic capture method using species-specific oligonucleotides to detect six Anaplasma/Ehrlichia species pathogens in canine, Academic Editor: bovine, caprine, and ovine blood samples. Overall, the assay application to 455 samples detected Alejandro Cabezas-Cruz 30.1% (137/455) positives for one or more out of six screened pathogens. Single-pathogen infections Received: 30 December 2020 were observed in 94.9% (130/137) of the positive samples, while co-infections were detected in 5.1% Accepted: 7 February 2021 (7/137). Anaplasma marginale infection in cattle had the highest detection rate (34.4%), followed Published: 10 February 2021 by canines positive for Anaplasma platys (16.4%) and Ehrlichia canis (13.9%). The assay aided in documenting the first molecular evidence for A. marginale in cattle and small ruminants and Ehrlichia Publisher’s Note: MDPI stays neutral chaffeensis and Ehrlichia ewingii in dogs in the Caribbean island of Grenada. with regard to jurisdictional claims in published maps and institutional affil- Keywords: Anaplasma; Ehrlichia; PCR; xMAP iations.

1. Introduction Copyright: © 2021 by the authors. Licensee MDPI, Basel, Switzerland. For over three decades, Anaplasma and Ehrlichia species pathogens have been known This article is an open access article to cause diseases in humans, while in pets and livestock these infections have been well- distributed under the terms and documented for many decades [1–3]. In the United States, human infections with Anaplasma conditions of the Creative Commons and Ehrlichia species are identiﬁed as the second leading cause of tick-borne diseases after Attribution (CC BY) license (https:// Lyme disease [4]. Clinical outcomes of ehrlichiosis and anaplasmosis vary from asymp- creativecommons.org/licenses/by/ tomatic infections to severe, potentially fatal illness in animals and humans. Two or more 4.0/).

Pathogens 2021, 10, 192. https://doi.org/10.3390/pathogens10020192 https://www.mdpi.com/journal/pathogens Pathogens 2021, 10, 192 2 of 18

tick-borne infections are also common in vertebrate hosts [5–17]. Multi-infections with tick- borne pathogens may enhance the disease severity and complicate the clinical presentation in a host [18–20]. Gaunt et al. [21] reported a greater pathophysiological response in dogs experimentally co-infected with Ehrlichia canis and Anaplasma platys, than when infected with either one of the pathogens. Multiple-pathogen infections can also persist for months to years and complicate a patient’s clinical presentation, substantially influencing the pro- gression of the diseases, while also creating challenges for laboratory diagnosis [13,22,23]. Early detection of these infections, when antibiotic treatment is most effective, is often very challenging. This is because early signs and symptoms of these illnesses are nonspecific, making clinical diagnosis difficult [24]. Assays that can rapidly confirm and discriminate between tick-borne rickettsial pathogens are limited and not readily available at an affordable cost. The Indirect immunofluorescence antibody (IFA) assays performed on paired acute and convalescent sera are considered the gold-standard for serologic confirmation of rickettsial infections [25,26]. However, IFA assays are insensitive during the acute phase of rickettsial infection [24,27–30], because during the early infection stage pathogen-specific antibodies are yet to develop. For tick-borne rickettsial infections, seroconversion usually occurs within two to four weeks, at which time pathogen-specific antibodies can be detected. Therefore, the Centers for Disease Prevention and Control, USA, recommends performing an IgG IFA assay on acute and convalescent-phase samples (sampled two to four weeks apart) in tandem, a four-fold or greater increase in the antibody titer is evidence of seroconversion and reflects current infection [30]. For the detection of Anaplasma marginale in particular, the World Organization for Animal Health recommends performing microscopic examination of the freshly prepared blood smears as well as polymerase chain reaction (PCR) assays [31]. PCR assays are based on the principle of artificial amplification of species-specific DNA and are widely used for rapid, sensitive, and specific detection of Anaplasma/Ehrlichia species, in the whole blood specimens collected during the acute stages of illness. These molecular methods include both conventional and real-time quantitative PCR assays targeting mostly 16S rRNA or 16S rDNA [6,32–37]. Other PCR assays use primers targeting genes such as dsb [38], groEL [39,40], msp1a, and msp4 of A. marginale [41,42], major outer membrane protein genes of Ehrlichia species such as p28-p30/MAP1 [43,44], and citrate synthase gene gltA [45]. However, most of these assays only detect a limited number of Anaplasma/Ehrlichia species. Recently, new technologies have been developed for molecular diagnosis of tick-borne rickettsial infections and identi- fying the infecting agent. For example, Michelet et al., [46] utilized a microfluidics system to perform parallel real-time PCRs to test ticks for the presence of 25 bacterial and 12 parasitic species simultaneously. In Grenada, one of the Windward Islands of the Caribbean, Anaplasma and Ehrlichia infections are highly prevalent in dogs, and are considered endemic in cattle infections with A. marginale as judged by serological analysis [47–53], and have recently been reported in small ruminants [54]. In dogs, these infections are primarily transmitted by the vector Rhipicephalus sanguineus (brown dog tick). Reports on PCR and serology-based assays have identified co-infections in dogs of Grenada to both E. canis and A. platys [48–50]. Molecular evidence of Anaplasma and Ehrlichia infections in ruminants in Grenada, however, is limited, and infections by multiple pathogens are also not well documented [47]. Moreover, Ehrlichia ewingii, Ehrlichia chaffeensis, and Ehrlichia ruminantium infections have not previously been reported from Grenada, although they have been documented from some of the islands of the Caribbean [47–50,54,55]. Grenada experiences both human and animal international movements throughout the year from the Americas, Africa, Asia, and Europe since it is an educational hub and a popular tourist destination. With the population influx, the possibility of the introduction of exotic ticks and tick-borne rickettsial pathogens in Grenada is high. The currently available assays in Grenada (point-of-care enzyme-linked immunosorbent assay and conventional PCR) only focus on E. canis and A. platys due to the endemic status of these two pathogens. Due to globalization and Grenada’s unique Pathogens 2021, 10, 192 3 of 18

status as a tourist and educational destination, this is no longer sufficient for the detection and control of tick-borne rickettsial infection. Therefore, in this study, we report the development and validation of a new multiplex PCR coupled with oligonucleotide probe based multi-analyte profiling (xMAP) bead assay for the simultaneous detection of six different Anaplasma/Ehrlichia species pathogens in animal-blood samples. The assay uses the basic principles of a 16S rRNA-based real-time quantitative PCR assay, as previously described [37], combined with the Luminex xMAP hybridization technology. This technology utilizes advanced “solution-phase kinetics” in combination with optics and digital signaling to allow a high degree of multiplexing (up to 50 analytes). Other benefits of xMAP technology are the reduced sample volume re- quirements and fast results. The assay involves in vitro amplification of a 100 bp 16S rDNA gene fragment targeting six different species of Anaplasma and Ehrlichia and is followed by the capture and detection of species-specific amplicons using pathogen-specific complementary oligonucleotide probes attached to magnetic beads. The xMAP hybridization assay offers a distinct advantage similar to several previously reported similar methods for detecting human and veterinary pathogens [56–59].

2. Results 2.1. Optimization of the xMAP Assay To develop an xMAP assay with high analytical sensitivity and specificity, optimization was performed by varying primer-annealing temperatures, amplification cycles, and varying MgCl2 concentrations. For the xMAP hybridization step, we optimized the probe concentration, the amount of PCR product used, hybridization time and temperature, and the ‘washed’ versus ‘no-wash’ protocols. While we used our previously reported species- specific probes for five pathogens [37], the A. marginale-specific probe required designing a new probe and optimization. The newly designed probe gave higher median fluorescence intensity (MFI) value for the xMAP assay when tested with the positive control plasmid. The final optimized xMAP protocol for all experiments was as follows: PCR was conducted for 35 cycles with an annealing at 50 ◦C for 30 s, extension at 72 ◦C for 30 s, and 2.5 mM of MgCl2. For xMAP analyses, the no-wash protocol was used with 0.1 nmols each of the probes and 5 µL of the PCR product. The probe hybridization temperature and time to achieve an optimal balance between the sensitivity and specificity were 55 ◦C and 15 min, respectively, for the xMAP analysis.

2.2. Analytical Speciﬁcity

The MFI data from all the samples in each assay was corrected for background (F − F0, where F is the MFI value of a sample, and F0 is the average background MFI value of the no-template controls (NTCs)). The multiplex analysis performed with different dilutions of positive control plasmid DNAs revealed that each species was correctly detected by its respective probe-bead set without cross-reactions with any other probe-bead sets. No positive MFI signal above the cut-off value was observed for any probe-bead set for which the corresponding speciﬁc plasmid DNA was not present. The six-plex xMAP assay had the highest (100%) analytical speciﬁcity, as no hybridization signals were observed for DNA templates from known negative animals (MFI values of negative animal samples did not differ from no-template controls) (Tables1 and2). A decrease in the MFI values was observed when two plasmid combinations were present in the hybridization mix as compared to the MFI of a single species. This MFI reduction was more evident in mixtures where differences in concentrations were above one order of magnitude. For example, when 10,000 copies of E. canis were present singly, an average MFI value of 2088.6 was recorded (Table1) but, when mixed with 100 copies of E. chaffeensis, the MFI value for E. canis decreased to 1500.5 (Table2). It was also observed that some two plasmid combinations, at nonequivalent concentrations at a ratio greater than 100-fold, would only result in a positive MFI for the plasmid DNA having the higher concentration. For example, a combination of 10,000 copies of E. chaffeensis and 100 copies of E. canis gave average Pathogens 2021, 10, 192 4 of 18

MFI values of 2231.6 and 28.2, respectively, without the background correction (Table2). However, when the MFI values were corrected for background (F − F0), an average MFI of 2212.1, (2231.6 − 19.5) was calculated for 10,000 copies E. chaffeensis while 100 copies of E. canis resulted in an average MFI of 7.9 (28.2 − 20.3), a value below the cut-off (21.8) for E. canis probe-bead set (Table2).

Table 1. Median ﬂuorescence intensity (MFI) values of each probe-bead set shown by a single plasmid present in the hybridization mix.

MFI for Hybridization of Species-Speciﬁc Oligonucleotides to DNA Targets DNA Targets A. marginale E. canis E. ewingii A. platys E. chaffeensis E. ruminantium 23.5 ± 11.1 a 24 ± 14.1 a 23.1 ± 11.4 a 24.6 ± 10.8 a 23.1 ± 10.2 a 25.5 ± 10.2 a NTCs c (>34.6) (>38.5) (>35) (>35.8) (>33.5) (>36) A. marginale # 670.5 b ± 118.6 21.6 ± 3.7 24 ± 2.6 22 ± 2.6 21.6 ± 4.6 24 ± 3.4 E. canis # 21.6 ± 1.1 2088.6 b ± 92.5 21.6 ± 2 22 ± 2 22 ± 1 24 ± 1.7 E. ewingii # 18.3 ± 1.5 20.3 ± 0.5 1605.3 b ± 147 20.6 ± 2.5 19.3 ± 1.1 21 ± 2 A. platys # 21 ± 2.6 22.8 ± 3.1 21.6 ± 1.1 1870.2 b ± 270 21.3 b ± 3.2 24.6 ± 3 E. chaffeensis # 23.5 ± 2.3 25.3 ± 2 24 ± 1.7 23.6 ± 1.1 2715.8 b ± 321.4 27 ± 1.7 E. ruminantium # 20.3 ± 1.5 22.3 ± 2.3 21.6 ± 1.5 21 ± 1.7 19.3 ± 2 828 b ± 83.9 The MFI values shown in the table are the average MFI values of each sample run in three independent assays ± standard deviations (SD) (without background correction). a Cut-off values deﬁned as mean ± 3SD of the no-template controls (NTCs) for each probe-bead set obtained with replicates of each sample run in three independent assays. Values in parenthesis indicates the cut off incorporating mean + 3SD. b In bold are the values considered as positive (based on mean ± 3SD). c No Template Controls (PCR grade water). # Plasmid present at 10,000 copies/µL.

Table 2. MFI values of each probe-bead set shown by two plasmid combinations present in the hybridization mix.

MFI for Hybridization of Species-Speciﬁc Oligonucleotides to DNA Targets DNA Targets A. marginale E. canis E. ewingii A. platys E. chaffeensis E. ruminantium 19.2 ± 4.5 a 20.3 ± 1.5 a 20.3 ± 1.5 a 21.1 ± 4.2 a 19.5 ± 1.5 a 22 ± 2.4 a NTC c (>23.7) (>21.8) (>21.8) (>25.3) (>21) (>24.4) Neg D d 17.8 ± 0.5 19 ± 0 18 ± 0.8 19.2 ± 0.5 18 ± 0.8 20.5 ± 1 Neg C e 19.5 ± 0.5 19.8 ± 0.9 19.2 ± 0.9 20 ± 0.8 19.2 ± 0.5 21.5 ± 2 EC-AP f 20 ± 0 1344.2 b ± 16.2 20.5 ± 0.5 331.1 b ± 7.3 20.8 ± 1.7 23.6 ± 1.3 AP-EC g 18.9 ± 0.2 36 b ± 2.1 19.8 ± 1.2 1242.6 b ± 39.3 20.2 ± 2.3 21.6 ± 1.7 EC-ECH h 21.2 ± 0.9 1500.5 b ± 19.2 22.8 b ± 1.8 22 ± 0.8 55 b ± 0 24.5 b ± 1.2 ECH-EC i 18.8 ± 1.7 28.2 b ± 2.6 18.5 ± 2 18.9 ± 1.6 2231.6 b ± 80.9 20.4 ± 1.7 AM-ECH j 1077.6 b ± 26.8 20 ± 0.8 25.2 b ± 0.9 19.8 ± 0.5 107.5 b ± 2.6 21.8 ± 0.5 ECH-AM k 25.8 b ± 1.7 26.2 b ± 1.2 23.5 b ± 0.5 24.9 ± 1 3997 b ± 120.8 27 b ± 2 The MFI values shown in the table are the average MFI values of each sample run in four replicates within the assays ± SD (without background correction). a Cut-off values deﬁned as mean ± 3SD of the NTCs for each probe-bead set obtained with four-replicates of each sample run on the same plate. Values in parenthesis indicates the cut off incorporating mean + 3SD. b In bold are the values considered as positive (based on mean ± 3SD). c No Template Control (PCR grade water). d Spike-DNA sample from known negative dog. e Spike-DNA sample from known negative cattle. f Ehrlichia canis at 10,000 copies/µL mixed with A. platys 100 copies/µL and spiked with negative dog DNA. g Anaplasma platys at 10,000 copies/µL mixed with E. canis 100 copies/µL and spiked with negative dog DNA. h Ehrlichia canis at 10,000 copies/µL mixed E. chaffeensis 100 copies/µL and spiked with negative dog DNA. i Ehrlichia chaffeensis at 10,000 copies/µL mixed with E. canis 100 copies/µL and spiked with negative dog DNA. j Anaplasma marginale at 10,000 copies/µL mixed E. chaffeensis 100 copies/µL and spiked with negative cattle DNA. k Ehrlichia chaffeensis at 10,000 copies/µL mixed A. marginale 100 copies/µL and spiked with negative cattle DNA.

2.3. The Limit of Detection and Analytical Sensitivity The detection limit was 10 copies/µL for E. canis, E. chaffeensis, and A. platys and 100 copies/µL for A. marginale, E. ewingii, and E. ruminantium. For analytical sensitivity, the MFIs differed by at least two times the MFI signal between copy numbers 10, 100, 1000, and Pathogens 2021, 10, 192 5 of 18

10,000 for E. canis, E. chaffeensis, and A. platys species; however, for A. marginale, E. ewingii, and E. ruminantium the analytical sensitivity of the MFI signals was less and not able to distinguish between 10 and 100 copies of the template.

2.4. Repeatability Assessment of intra-assay and inter-assay variability was determined by the percentage of coefﬁcient of variation (%CV) of replicates run either within the plate (intra-assay) or between the plates (inter-assay). Each probe-bead set gave a different value for the intra-assay and inter-assay %CV. Therefore, the intra-assay %CV ranged between 2% to 9%, and the inter-assay %CV ranged between 4% to 19%. These values are within the acceptable range; according to Luminex [60], the values for intra-assay %CV and inter-assay %CV should be below 10 and 20, respectively.

2.5. Testing of the Field Samples A total of 455 blood samples collected from the six parishes in Grenada were analyzed by performing PCR and xMAP assays (Table3) (Figure1). The geographic location with most positive samples was concentrated in the southern half of the island, in St. George and St. David’s parishes (Figure1). Positive and negative controls were included as part of the analysis. Figure2 represents the distribution of the MFIs for each detected bacterial species in the six-plex xMAP assay for all samples. Anaplasma marginale was primarily detected in cattle and small ruminant blood samples, whereas E. canis and A. platys were detected predominantly in dog blood samples. The highest MFI values detected among A. marginale and A. platys positives were 1290.3 and 2799.8, respectively. Similarly, the highest MFI values for E. canis, and E. chaffeensis positive samples were 3561.3, and 1422.8, respectively. In contrast, the lowest MFI values detected for positives were as follows: A. marginale, 131.8; A. platys, 40.2; E. canis, 38.7; and E. chaffeensis, 51.8. Sample from a dog reacted with the E. ewingii probe and had an MFI of 1515.8 (Figure2). None of the samples were positive for E. ruminantium.

Table 3. The number and parish location of the animals sampled.

Parish (# Sampled) Species/# # of Year of Collection Sampled Samples SG SA SM SP SD SJ Uk Canine/353 358 * 185 48 12 4 50 1 58 2014–2018 Caprine and 65 18 25 - - 22 - - 2017–2018 Ovine/65 Bovine/32 32 25 7 - - - - - 2017 455 228 80 12 4 72 1 58 Total (%) (50.1) (17.6) (2.6) (0.8) (15.8) (0.2) (12.7) * Blood samples from ﬁve dogs were collected twice (one week apart). SG: Saint George parish; SA: Saint Andrew parish; SM: Saint Mark parish; SP: Saint Patrick parish; SD: Saint David parish; SJ: Saint John parish; Uk: Unknown (location not recorded).

Of the 455 samples analyzed, 137 (30.1%) tested positive for one or more pathogens. Of all the positive samples, 130 (94.9%) tested positive for a single pathogen infection, and seven samples (5.1%) tested positive for infections with two different pathogens. Single- pathogen infections were the highest in cattle for A. marginale (11/32; 34.3%), followed by dogs for E. canis, A. platys, and E. chaffeensis (110/358; 30.7%). Unique findings included finding E. canis in one goat, and A. platys in the blood of five ruminants (three bovine and two small ruminants). Pathogens 2021, 10, x FOR PEER REVIEW 6 of 19

Pathogens 2021, 10, x FOR PEER REVIEW 6 of 19 Pathogens 2021, 10, 192 6 of 18

Figure 1. Map of Grenada showing six different parishes and the type of samples collected from each parish.

Of the 455 samples analyzed, 137 (30.1%) tested positive for one or more pathogens. Of all the positive samples, 130 (94.9%) tested positive for a single pathogen infection, and seven samples (5.1%) tested positive for infections with two different pathogens. Single- pathogen infections were the highest in cattle for A. marginale (11/32; 34.3%), followed by dogs for E. canis, A. platys, and E. chaffeensis (110/358; 30.7%). Unique findings included Figure Figure1.finding Map 1.of E. MapGrenada canis of in Grenada showing one goat, showing six and different A. six platys different parishes in the parishesand blood the type and of five of the samples typeruminants of collected samples (three from collected bovine from and each parish.eachtwo parish.small ruminants).

Of the 455 samples analyzed, 137 (30.1%) tested positive for one or more pathogens. Of all the positive samples, 130 (94.9%) tested positive for a single pathogen infection, and seven samples (5.1%) tested positive for infections with two different pathogens. Single- pathogen infections were the highest in cattle for A. marginale (11/32; 34.3%), followed by dogs for E. canis, A. platys, and E. chaffeensis (110/358; 30.7%). Unique findings included finding E. canis in one goat, and A. platys in the blood of five ruminants (three bovine and two small ruminants).

Figure 2. Cont.

PathogensPathogens2021 2021, 10, 10, 192, x FOR PEER REVIEW 77 of of 18 19

Figure 2. Scatter plot illustrating the distribution of corrected median fluorescent intensity values for the 455 samples obtained by the hybridizationFigure 2. Scatter with differentplot illustrating probes withinthe distribution the six-plex of xMAPcorrected assay. median PS: positive fluorescent samples; intensity NS: negativevalues for samples the 455 and samples NTC: No Templateobtained Controls by the (n = hybridization 92) from nine with different differ assaysent probes and usedwithin to the calculate six-plex the xMAP cut-offs. assa (Ay.) PS:A. marginalepositive ;(samples;B) E. canis NS:;( negativeC) E. ewingii ; (D) A.samples platys;(E and) E. chaffeensisNTC: No .‘Template4’ blood Controls from cattle; (n = ‘92)’ blood from fromnine different small ruminants; assays and ‘E ’used blood to fromcalculate dogs. the Whiskers cut-offs. in (A each) A. plot representmarginale the interquartile; (B) E. canis range; (C) E. (Median—middle ewingii; (D) A. platys line3; and(E) E. lower chaffeensis. and upper ‘’ blood lines meanfrom cattle; 25 and ‘ 75’ percentilesblood from ofsmall the distribution).ruminants; ‘’ blood from dogs. Whiskers in each plot represent the interquartile range (Median—middle line and lower and upper lines mean 25 and 75 percentilesCo-infection of the distribution). was not detected in any cattle and small ruminant samples, whereas 1.9% (7/358) of the dog samples tested positive for co-infection with two rickettsial pathogens; E. canisCo-infectionand E. chaffeensis was notin twodetected dogs, inE. any canis cattlande A.and platys smallin fourruminant dogs, samples, and A. platys whereasand E.1.9% ewingii (7/358)in one of the dog dog (Table samples4). tested positive for co-infection with two rickettsial pathogens; E. canis and E. chaffeensis in two dogs, E. canis and A. platys in four dogs, and A. 2.6.platys Confirmatory and E. ewingii PCR in Assays one dog (Table 4). In order to confirm and validate the results obtained from this newly developed Table 4. Number and percentagexMAP of assay, animals conventional that tested positive PCR assays for single and or direct multiple sequencing bacterial species were by performed the Luminex on the assay. extracted genomic DNA for a subset of the field samples. The target gene for PCR assays and sequencing were msp1a for A. marginale and 16S rRNA for E. canis, E. chaffeensis, Bacterial sp. and E. ewingii. The sequences shown in Table5 had at least 94% identity with the reference Canine Bovine Caprine and Ovine Total sequences. All these sequences have been deposited in the GenBank (Accession numbers; Animal sp. MW474807-15, MW486117, and MW486118). xMAP results for A. platys positives were not AMconfirmed via the conventional - PCR 11/32 method. (34.3) 3/65 (4.6) 14 Single species EC 50/358 (13.9) - 1/65 (1.5) 51 infections AP 59/358 (16.4) 3/32 (9.3) 2/65 (3) 64 ECH 1/358 (0.2) - - 1

Pathogens 2021, 10, 192 8 of 18

Table 4. Number and percentage of animals that tested positive for single or multiple bacterial species by the Luminex assay.

Bacterial sp. Canine Bovine Caprine and Ovine Total Animal sp. AM - 11/32 (34.3) 3/65 (4.6) 14 EC 50/358 (13.9) - 1/65 (1.5) 51 Single AP 59/358 (16.4) 3/32 (9.3) 2/65 (3) 64 speciesinfections ECH 1/358 (0.2) - - 1 Total 110/358 (30.7) 14/32 (43.7) 6/65 (9.2) 130 EC-ECH 2/358 (0.5) - - 2 EC-AP 4/358 (1.1) - - 4 Co-infections EE-AP 1/358 (0.2) - - 1 Total 7/358 (1.9) 0/36 (0) 0/65 (0) 7 Grand Total 117/358 (32.6) 14/32 (43.7) 6/65 (9.2) 137 Unique ﬁndings are in bold. AM: A marginale; EC: E. canis; EE: E. ewingii; AP: A. platys; ECH: E. chaffeensis; and ER: E. ruminantium. Hyphenated abbreviations indicate co-infections of two different pathogens.

Table 5. Homology between deposited sequences and reference sequences in GenBank.

Deposited Percentage # of Samples # of Samples Reference Species Target Gene Sequence Length (bp) of Identity Tested Sequenced Sequence GenBank #s (%) MW486117 568 94.00 NC_012026 A. marginale msp1a 8 2 MW486118 326 94.00 NC_012026 MW474807 335 99.40 NR_118741 E. canis 16S rRNA 6 2 MW474808 335 99.40 NR_118741 MW474809 300 100.00 NR_074500 MW474810 334 100.00 NR_074500 MW474811 318 100.00 NR_074500 E. chaffeensis 16S rRNA 10 6 MW474812 334 100.00 NR_074500 MW474813 333 100.00 NR_074500 MW474814 334 100.00 NR_074500 E. ewingii 16S rRNA 6 1 MW474815 308 100.00 NR_074500

3. Discussion In this study, we described the development and application of an xMAP six-plex PCR and oligonucleotide bead-based assay having high analytical specificity and sensitivity. The three-step assay involves: (1) PCR amplification from a sample DNA targeting a 100 bp 16S rRNA gene segment common to the six rickettsial pathogens; (2) PCR product hybridization with species-specific probes captured on magnetic beads and (3) detection of the hybrids by xMAP suspension array technology on a 96-well plate format. This assay has a quick turnaround time (3.5 h) and tests for six different pathogen DNAs simultaneously, which can be expanded to detect DNA targets from many other hemoparasite infections in a diverse host species. In particular, MagPix analyzers have the capability to test up to 84 different samples in addition to 12 controls in a 96-well plate format. Therefore, the assay has a broader applicability than a conventional PCR assay. Anaplasma and Ehrlichia genera-specific primer sets targeting the 16S rRNA gene fragment described previously by Sirigireddy and Ganta [37] enabled the amplification of all six selected rickettsial pathogen-specific DNAs in a single step. Within the amplicon includes variable region sequences specific for each species allowing the design of magnetic capture probes, which permitted the identification of pathogen-specific detections simultaneously on the xMAP platform. One major advantage of this assay is that it can test DNA samples from different sources as demonstrated in the present study through the application of Pathogens 2021, 10, 192 9 of 18

canine, bovine, ovine, and caprine blood samples. To validate the performance characteristics of this six-plex assay, we performed experiments to define the analytical specificity and sensitivity, detection limit, and repeatability. We achieved a 100% analytical specificity for the assay after limiting the PCR cycles to 35 and optimizing the hybridization step at 55 ◦C. Any deviation from these two parameters resulted in either cross-reactions amongst the probe-bead sets or a decrease in the MFI signals. Although there was a decrease in the MFI signals when two different species-specific positive control plasmid DNAs were mixed at nonequivalent concentrations above 10-fold, this did not preclude the detection of the plasmids as positives. The decrease in MFI when the assay included two different DNA targets was attributed to increased competition between the amplicons during the PCR step rather than xMAP assay detection, as reported previously [61]. We observed that some two plasmid combinations, at nonequivalent concentrations at a ratio greater than 100-fold, would result in a positive MFI detection only for the pathogen DNA present at the higher concentration. This could be a potential limitation of the assay in situations where clinical samples are co-infected with two or more pathogens differing in bacteremia by greater than 100-fold. However, this issue is not likely to be clinically significant because the antibiotic treatment regime for all these pathogens is the same. The detection limit for each of the analytes was between 10 and 100 copies/µL, with good analytical sensitivity between log fold concentrations of copy numbers that were above the limit of detection. The high analytical specificity and sensitivity of this assay was not affected by spiking the samples with pathogen-negative DNA from dogs or cattle. The results from these experiments illustrate that the assay is both sensitive and specific for detecting the target species even when genomic DNA from the host species is present during PCR and xMAP analysis. The application of the xMAP six-plex PCR assay to 455 field samples detected 30.1% (137/455) of positives, where amongst these positive samples we found 34.3% (11/32) cattle for A. marginale, 16.4% (59/358) dogs for A. platys, and 13.9% (50/358) dogs for E. canis. These results are consistent with prior published reports from other endemic regions for bovine anaplasmosis and canine rickettsial pathogens of the world, including the Caribbean region [62–66]. Co-infection with E. canis and A. platys in the Grenadian dog population was 1.1% (4/358) and this observation is also similar to previous reports from the Caribbean islands of St. Kitts and Republic of Haiti [67,68]. In 2006, the reported prevalence of Grenadian dogs based on conventional PCR for E. canis and A. platys was 24.7% and 19.2%, respectively, with 5.5% of dual infections [50]. While the previously published data is consistent with the data reported here, the current study had a lower prevalence in E. canis and A. platys, which may reflect natural fluctuations in the pathogen distribution rather than the sensitivity differences in the assays. Although statistical comparisons were not performed between the prior published data and the current data, the reported variations in results may be due to differences in sample selection sites. Landscape and climatic differences among the various parishes in Grenada may have contributed to some variation in prevalence of the pathogens as noted in the current study compared to the previous reports. However, a more extensive study of the island is necessary. Anaplasma marginale has been known to infect bovine species worldwide, particularly in tropical, subtropical, and temperate regions [69–73]. However, in the Caribbean region, molecular detection of A. marginale infections in bovine species (e.g., cattle and buffalo) have only been reported from Cuba and Puerto Rico [74–76]. The present study augments those previous findings, and it is the first report on the molecular detection of A. marginale in cattle and small ruminants from Grenada. Previously, only serological data had been reported demonstrating exposure to A. marginale in the livestock animals in Grenada [47,53] and the current data validates the existence of the predicted cattle infections with the pathogen. The xMAP assay analysis performed on various field specimens also revealed novel data. For example, our study is the second in reporting the presence of E. canis in goat blood [54]. Additional investigations are warranted to define the significance of E. canis infections in goats in causing disease in this host. The xMAP analysis of samples from domestic ruminants also resulted in the identification of A. platys DNA in five samples Pathogens 2021, 10, 192 10 of 18

tested from domestic ruminants (cattle, goats, and sheep). This is the first study to report A. platys in these animal species. Additional investigations are necessary to determine the significance of A. platys infection to the ruminant population health. This study is also the first to report co-infections in dogs with E. chaffeensis and E. canis and with E. ewingii and A. platys. The sample cohort of dogs investigated in this study included some dogs having a travel history from the USA where E. chaffeensis and E. ewingii infections are more widespread. Therefore, the presence of E. chaffeensis and E. ewingii in dogs residing in Grenada may represent dogs originating from the USA. Since Grenada is a popular tourist and education destination with frequent movement of both humans and pet animals from other countries, including the USA and Canada, the introduction of new bacterial infections and tick species by means of importation of animals to the island cannot be ruled out.

4. Materials and Methods 4.1. Collection of the Field Specimens A total of 455 samples were collected between the years 2014 and 2018. These samples included whole blood collected from canines (n = 358), caprine and ovine (n = 65), and bovine (n = 32). (Table3). The sample cohort for dogs was comprised of community-owned (mostly free roaming) dogs that were presented to the Small Animal Clinic (as part of diagnostic service) and to the Junior Surgery Laboratory (for blood sampling prior to spay and neuter surgeries) of the School of Veterinary Medicine (SVM) at St. George’s University (SGU). Cattle blood-samples were collected at farms in several parishes of Grenada (Figure 1) and from animals brought to the Large Animal Medicine and Surgery clinic of SVM, SGU. Small ruminants were sampled at various farms located in the parishes of Grenada (Figure1). Bleeding and sample collections for all the animals were performed as per the approved Institutional Animal Care and Use Committee protocols of SGU. Blood samples were collected in EDTA-anticoagulant tubes and stored at 4 ◦C until processing, which typically occurred within 24 h. Table3 represents the Grenada parish location of the blood samples collected from each animal species.

4.2. DNA Extraction Genomic DNA (gDNA) from the blood samples was isolated from 100 µL of blood using the DNeasy Blood and Tissue kit (Qiagen, Hilden, Germany) as per the manufacturer’s instruction. Yield and purity of DNAs were determined using a Nanodrop™ 2000 Spectrophotometer (Thermo Scientiﬁc, Waltham, Massachusetts, US) and then all DNAs were stored at −20 ◦C until subsequent analyses.

4.3. Optimization of the PCR and xMAP Hybridization Assay Conditions To achieve a balance between the analytical sensitivity and speciﬁcity of the assay developed in the present study, PCR and xMAP assay conditions were optimized, as shown in Table6. Previous reports that used the PCR-based xMAP technology have reported the use of PCR cycles from 35 [77,78] up to 45 [79,80] depending on the target-genes. In the present study, 16S rRNA gene fragment was used for the PCR protocol, and the cycling conditions were carefully optimized after testing 30, 35, and 40 cycles in combination ◦ ◦ with different primer annealing temperatures (50 C and 52 C) and MgCl2 concentrations (1.5 mM and 2.5 mM). Pathogens 2021, 10, 192 11 of 18

Table 6. xMAP assay optimization at different levels.

Optimization Conditions Test Conditions Primer Annealing temperature (◦C) 50, 52

PCR optimization MgCl2 concentration (mM) 1.5, 2.5 PCR cycle numbers 30, 35, 40 Hybridization Temperature (◦C) 50, 52, 55, 60 Hybridization time (min.) 10, 15, 20 xMAP optimization PCR product volume (µL) 5, 10 xMAP protocol Washed, no-wash Concentration of the probes (nmol/µL) 0.1, 0.2

For the xMAP hybridization step, different concentrations of the probes (0.1 and 0.2 nmol/µL) were tested in combination with different hybridization temperatures (50, 52, 55 and 60 ◦C), and incubation times (10, 15, and 20 min). A washed versus a no-wash protocol was also tested [55]. The probe for A. marginale was redesigned since the original probe [37] performed sub-optimally with various test conditions.

4.4. DNA Amplification for xMAP Assay PCRs were performed to amplify the Anaplasma/Ehrlichia common 100 bp fragment corresponding to the 16S rRNA gene segment, as described previously [37] using forward primer EHRANA-F (50-CTCAGAACGAACGCTGG-30) and reverse primer EHRANA-R2bio (50/5Biosg/GCATTACTCACCCGTCTGC-30) (Integrated DNA Technologies, Coralville, Iowa, US). The reverse primer was 50-biotinylated to allow conjugation of streptavidin phy- coerythrin (SAPE) for detection via xMAP assay by Luminex (Austin, Texas, US). All amplification reactions contained 12.5 µL of 2X Platinum Hot Start Master Mix (1.5 mM MgCl2, 200 µM of each dNTP, and 1 U of Taq Platinum Polymerase (Invitrogen, California, US), an additional 0.5 µL of 1mM MgCl2 to increase the concentration to 2.5 mM, 1.25 µL of each of primers at 0.5 µM, 1 µL of gDNA template (10–20 ng/µL), and 8.5 µL of nuclease- free water to make the final volume to 25 µL. For the positive controls, six recombinant plasmid DNAs containing inserts corresponding to a 100 bp 16S rRNA gene-segments of A. marginale, A. platys, E. canis, E. chaffeensis, E. ewingii, and E. ruminantium, as described previously [37], were diluted to the copy numbers 100, 500, 1000, and 10,000. These plasmid controls were used in the PCR assays to serve as serial dilution positive controls. Ten reactions were included at each assay to serve as NTCs where gDNA solution was replaced with nuclease-free water. PCR thermal cycler conditions consisted of an initial denaturation step of 4 min at 94 ◦C, followed by 35 cycles of denaturation for 30 s at 94 ◦C, annealing of 30 s at 50 ◦C and an extension of 30 s at 72 ◦C. Subsequently, a final extension step was set at 72 ◦C for 5 min and the samples were stored at 4 ◦C.

4.5. Oligonucleotide xMAP Assay 4.5.1. Oligonucleotide Probe Design Species-speciﬁc oligonucleotide probes (size range between 21 and 32 bp) corresponding to the variable regions located within the amplicons were prepared as described previously [37]. Anaplasma marginale-speciﬁc probe was designed in the current study and listed in Table7, as the previously designed probe was found to be suboptimal for the xMAP analysis. All probes were manufactured with the inclusion of a six-carbon amino linker attached to the 50 end (Integrated DNA Technologies, Coralville, IA, USA). Pathogens 2021, 10, 192 12 of 18

Table 7. Sequences of the oligonucleotide probes that were covalently linked to the carboxylated microspheres used in the development of xMAP assay for the detection of species identiﬁcation of Ehrlichia/Anaplasma in animals.

xMAP COOH-Microsphere Probes Bacterial Species Sequences (50-30) Reference Regions for Probe Binding RG270Ecan E. canis TATAGCCTCTGGCTATAGGAAATTGTTAG R25 [37] RG266Echaf E. chaffeensis CTTATAACCTTTTGGTTATAAATAATTGTTAG R43 [37] RG268Eewin E. ewingii CTAAATAGTCTCTGATTTAGATAGTTGTTAG R34 [37] RG260Erum E. ruminantium GTTATTTATAGCTTCGGCTAT R48 [37] RG272Aplat A. platys CGGATTTTTGTCGTAGCTTGCTATGAT R38 [37] RG262Amarg A. marginale CGTATACGCAGCTTGCTGCGT R20 This study R20, R25, R34, R38, R43, and R48 represent bead-set stocks with different spectral properties.

4.5.2. Oligonucleotide Probe Coupling to xMAP Beads Species-specific oligonucleotide probes were conjugated to six unique sets of fluorescent- dyed magnetic carboxylated MagPlex® Microspheres (beads) (Luminex, Austin, TX, USA) by a chemical reaction attaching the carboxy groups on the beads to the amine group of the 50 end probe liners, as per the manufacturer’s protocol [60]. Six different bead-set stocks (represented as R20, R25, R34, R38, R43, R48, and R53) were then resuspended by being vortexed at 20 rpm for 1 to 2 min and sonicated for 1 min. Five million beads from each bead-set stock were coupled to amine-linked species-speciﬁc oligonucleotide probes protocol as per manufacturer’s protocol [60]. Coupling efﬁciency was evaluated by hybridization of the coupled beads with two-fold dilutions of femtomolar concentrations of biotinylated oligonucleotide sequences that were complementary to the probes coupled to the bead-sets. The degree of hybridization was evaluated as outlined below.

4.5.3. Direct Hybridization of Blood-Derived DNA Samples to Six Oligonucleotide Probe-Coupled xMAP Beads For these experiments, a no-wash protocol was followed [60]. Five micro liters of biotinylated PCR products were mixed with 33 µL of the six species-specific oligonucleotide bead mixtures and the volumes were raised to 50 µL with the addition of Tris-ethylene- diamine-tetraacetic acid (TE) buffer. The probe-bead mixture was calculated to contain about 23 beads/µL in 1.5× tetramethyl ammonium chloride (TMAC) hybridization buffer (4.5 M TMAC, 0.15% Sarkosyl, 75 mM Tris HCl, 6 mM EDTA pH 8.0). Biotin-labeled PCR products made from six recombinant plasmids and 10 NTCs were used as positive and negative controls, respectively. The NTCs served to calculate background MFI for each xMAP assay. The hybridization reaction was performed in Bio-Rad Hard-shell 96-well thin wall PCR plates (Hercules, CA, USA) at 55 ◦C for 15 min in Eppendorf Mastercycler® pro (Hamburg, Germany). Twenty-five microliters of SAPE (New England Biolabs, Ipswich, MA, USA) in 1× TMAC buffer at a final concentration of 4 µg/µL was added to each reaction well and was incubated at 55 ◦C for a further 5 min. Each bead was analyzed by a red-light emitting diode (LED), which identified unique fluorescent dyes coating the bead region for each probe coupled bead-set and a green LED, which detects the SAPE signal of the hybridization between the amplified biotinylated-product and with complementary oligonucleotide probe(s). All analyses were performed on a MAGPIX® instrument (Luminex, Austin, TX, USA) using xPONENT version 4.2 software (Luminex Corporation, Austin, TX, USA). The analysis was performed at 55 ◦C with an average of ~750 beads present for each of the six bead regions representing 750 replicate measurements for each bead region. An internal wash-step for each sample was carried out during the analysis to ensure removal of unbound SAPE reporter in the supernatant from interfering with the imaging chamber before reading the microspheres. The MFI data from all the samples in each assay was corrected for background (F − F0, where F is the MFI value Pathogens 2021, 10, 192 13 of 18

of a sample, and F0 is the average background MFI value of the NTCs). For each probe hybridization, positive and negative cut-off values were calculated as the arithmetic mean of MFI values for the NTCs replicates included in each assay plus three standard deviations (SD) from the mean.

4.5.4. Determination of the Analytical Specificity of the Luminex Assay The analytical specificity of all probe-bead sets was tested against recombinant plasmids (i) to identify a single DNA species when all six probe-bead sets are present and (ii) to identify combinations of two different positive control plasmids when added to the six-oligo bead sets. Table8 illustrates the experimental set-up for different plasmid combinations tested to determine the analytical specificity of the Luminex assay. Every analysis was performed with 5 µL of PCR amplicon containing positive control plasmid DNA as described in the above section. To simulate natural infection, plasmids were spiked with known negative genomic DNAs (3–5 ng/µL) recovered from dog and cattle blood. The spiked DNAs from known negatives were run separately as additional controls along with the NTCs.

Table 8. Combinations of plasmid DNA mixes analyzed to determine analytical speciﬁcity.

Mix

Species E E E E E E 7 and 9 and 11 and 1 2 3 4 5 6 8 F 10 F 12 F E. canis !%%%%%!!% E. chaffeensis %!%%%%%!! E. ewingii %%!%%%%%% E. ruminantium %%%!%%%%% A. platys %%%%!%!%% A. marginale %%%%%!%%! !Shows the presence of the corresponding bacterial plasmid DNA in the mix. %Indicates the absence of the E corresponding bacterial plasmid DNA in the mix. Positive control plasmid mixtures 1 to 6 contain single bacterial species (indicated by !) at 10,000 copies/µL in each mixture. F Positive control plasmid mixtures 7 and 8, 9 and 10, and 11 and 12 contain two bacterial species (indicated by !) at 10,000 and 100 copies/µL.

4.5.5. Determination of Limit of Detection and Analytical Sensitivity Detection limit is deﬁned as the lowest concentration of an analyte detected as positive by an assay [81]. To determine the detection limit of the assay, serial dilutions of plasmid controls of each species were used in PCRs. Six 10-fold dilutions created 10,000 to 0 copies/µL of each plasmid control [82]. To determine the ability of the assay to detect differences between MFIs of plasmid copy numbers or analytical sensitivity, the MFI of the plasmid controls were compared between each dilution or copy number. To simulate co-infections, a combination of two different control plasmids was added into wells containing the six different oligonucleotide coupled beads. All the plasmids at different concentrations were spiked with known negative dog or cattle DNA for PCR and xMAP experiments so that each reaction well also contained gDNA from negative ﬁeld samples.

4.5.6. Intra-Assay and Inter-Assay Variability The intra-assay variability (repeatability or precision within a plate or run) was calculated by testing plasmid controls at concentrations of 100 and 10,000 copies/µL, in four replicates each, on a single plate. The inter-assay repeatability or precision between plates and runs was calculated by running the six plasmid controls at various dilutions (100, 500, 1000, and 10,000 copies/µL) in four different plates each run on four different days. The percent of coefﬁcient of variation (%CV) for the intra-assay and inter-assay variability Pathogens 2021, 10, 192 14 of 18

was determined by dividing the standard deviation of the replicates by the mean, then multiplied by 100.

4.6. Confirmation of the Results by PCR and Sequencing Results for a subset of xMAP positive samples were confirmed using conventional PCR assays followed by sequencing. The primers targeted different genes or regions than those used for the xMAP assay (Table9) to confirm the pathogen-DNA in the field samples. Am- plicons were extracted and sent for direct sequencing to the sequencing facility of Molecular Cloning Laboratories (South San Francisco, CA, USA). The sequencing histograms were cleaned and compared to the sequence-database present in GenBank® using the Nucleotide Basic Local Alignment Search Tool of the National Center for Biotechnology Information.

Table 9. Primers used for conﬁrmatory PCR assays for various species.

Amplicon Size Species Target Gene Primer Name Sequence (50→30) Reference (bp) MSP1aF1 GCATTACAACGCAACGCTTGAG A. marginale msp1a 1638 This study MSP1aRN CAGGAGCACCACCAAACATCATCACA EP2 GAAGATAATGACGGTACCC A. platys 16S rRNA 385 [83] EP3 CGTTTTGTCTCTGTGTTG ECA CAATTATTTATAGCCTCTGGCTATAGG E. canis 16S rRNA 385 [34] HE3 TATAGGTACCGTCATTATCTTCCCTAT HE1 CAATTGCTTATAACCTTTTGGTTATAAAT E. chaffeensis 16S rRNA 385 [84] HE3 TATAGGTACCGTCATTATCTTCCCTAT EE72 CAATTCCTAAATAGTCTCTGACTATT E. ewingii 16S rRNA 385 [85] HE3 TATAGGTACCGTCATTATCTTCCCTAT

5. Conclusions In conclusion, this novel six-plex oligonucleotide PCR-based bead assay is highly speciﬁc, sensitive, and repeatable for the simultaneous detection of six Anaplasma/Ehrlichia species frequently observed in vertebrate hosts and tick vectors. The assay identiﬁed multi- infections in dogs with two Anaplasma/Ehrlichia species, which is consistent with prior reports in Grenada using conventional PCR. Thus, it may contribute to our understanding of the expansion of vertebrate hosts and vectors for these pathogens, their prevalence and geographic spread, and to assess possible zoonotic concerns.

Author Contributions: Conceptualization, B.S., R.R.G., D.S., A.A., K.G. and M.J.W.; Data curation, B.S., R.R.G., D.S., A.A., M.L.-P., I.K., E.C., C.M.B. and M.J.W.; Funding acquisition, R.R.G. and M.J.W.; Investigation, B.S., R.R.G., A.A., M.L.-P., V.M.B., I.K., E.C., C.M.B. and M.J.W.; Project administration, B.S. and M.J.W.; Supervision, R.R.G., D.S. and M.J.W.; Validation, B.S., R.R.G. and M.J.W.; Writing— original draft, B.S.; Writing—review & editing, B.S., R.R.G., D.S., A.A., M.L.-P., V.M.B., I.K., E.C., C.M.B., K.G. and M.J.W. All authors have read and agreed to the published version of the manuscript. Funding: This research was funded by One Health Research Initiative OHRI-10-26-8 grant awarded by WINDREF at SGU, Grenada, West Indies to M.J.W., and the PHS grant # AI070908 to R.R.G. from the National Institute of Allergy and Infectious Diseases, National Institutes of Health, USA. Institutional Review Board Statement: The study was conducted according to the guidelines approved by the Institutional Animal Care and Use Committee of ST. GEORGE’S UNIVERSITY (protocol #17006-R dated 4 July 2017). Informed Consent Statement: Informed consent was obtained from all the owners of the animal- subjects involved in the study. Data Availability Statement: The new nucleic acid sequences have been deposited in the database of GenBank. Accession numbers provided by GenBank have been included in the manuscript under the Table5. Pathogens 2021, 10, 192 15 of 18

Acknowledgments: The authors gratefully acknowledge St. George’s University, Grenada, West Indies for funding the project under One Health Research Initiative (OHRI-10-26-8), awarded to Melinda J. Wilkerson. This work was also supported by the PHS grant # AI070908 to Roman R. Ganta from the National Institute of Allergy and Infectious Diseases, National Institutes of Health, USA. We are grateful to all the students and clinicians at the Small Animal Clinic, Department of Large Animal Medicine and Surgery, and Department of Small Animal Medicine and Surgery, SVM, SGU for their assistance in sample collection. The skilled technical assistance provided by Elizabeth Peach is greatly appreciated. Conﬂicts of Interest: The authors declare no conﬂict of interest. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, or in the decision to publish the results.

References 1. Dumler, J.S.; Barbet, A.F.; Bekker, C.P.; Dasch, G.A.; Palmer, G.H.; Ray, S.C.; Rikihisa, Y.; Rurangirwa, F.R. Reorganization of genera in the families Rickettsiaceae and Anaplasmataceae in the order Rickettsiales: Unification of some species of Ehrlichia with Anaplasma, Cowdria with Ehrlichia and Ehrlichia with Neorickettsia, descriptions of six new species combinations and designation of Ehrlichia equi and ‘HGE agent’ as subjective synonyms of Ehrlichia phagocytophila. Int. J. Syst. Evol. Microbiol. 2001, 51, 2145–2165. [CrossRef][PubMed] 2. Rymaszewska, A.; Grenda, S. Bacteria of the genus Anaplasma–characteristics of Anaplasma and their vectors: A review. Vet. Med. 2008, 53, 573–584. [CrossRef] 3. Rar, V.; Golovljova, I. Anaplasma, Ehrlichia, and “Candidatus Neoehrlichia” bacteria: Pathogenicity, biodiversity, and molecular genetic characteristics, a review. Infect. Genet. Evol. 2011, 11, 1842–1861. [CrossRef] 4. Centers for Disease Control and Prevention. Tickborne Disease Surveillance Data Summary. Available online: https://www.cdc. gov/ticks/data-summary/index.html (accessed on 22 August 2020). 5. Alhassan, A.; Pumidonming, W.; Okamura, M.; Hirata, H.; Battsetseg, B.; Fujisaki, K.; Yokoyama, N.; Igarashi, I. Development of a single-round and multiplex PCR method for the simultaneous detection of Babesia caballi and Babesia equi in horse blood. Vet. Parasitol. 2005, 129, 43–49. [CrossRef] 6. Breitschwerdt, E.B.; Hegarty, B.C.; Hancock, S.I. Sequential evaluation of dogs naturally infected with Ehrlichia canis, Ehrlichia chaffeensis, Ehrlichia equi, Ehrlichia ewingii, or Bartonella vinsonii. J. Clin. Microbiol. 1998, 36, 2645–2651. [CrossRef] 7. Chang, Y.F.; Novosel, V.; Chang, C.F.; Kim, J.B.; Shin, S.J.; Lein, D.H. Detection of human granulocytic ehrlichiosis agent and Borrelia burgdorferi in ticks by polymerase chain reaction. J. Vet. Diagn. Investig. 1998, 10, 56–59. [CrossRef] 8. Cui, Y.; Zhang, Y.; Jian, F.; Zhang, L.; Wang, R.; Cao, S.; Wang, X.; Yan, Y.; Ning, C. Development of duplex PCR for simultaneous detection of Theileria spp. and Anaplasma spp. in sheep and goats. Exp. Parasitol. 2017, 176, 1–7. [CrossRef] 9. Hoskins, J.D.; Breitschwerdt, E.B.; Gaunt, S.D.; French, T.W.; Burgdorfer, W. Antibodies to Ehrlichia canis, Ehrlichia platys, and spotted fever group rickettsiae in Louisiana dogs. J. Vet. Intern. Med. 1988, 2, 55–59. [CrossRef][PubMed] 10. Hua, P.; Yuhai, M.; Shide, T.; Yang, S.; Bohai, W.; Xiangrui, C. Canine ehrlichiosis caused simultaneously by Ehrlichia canis and Ehrlichia platys. Microbiol. Immunol. 2000, 44, 737–739. [CrossRef][PubMed] 11. Kordick, S.K.; Breitschwerdt, E.B.; Hegarty, B.C.; Southwick, K.L.; Colitz, C.M.; Hancock, S.I.; Bradley, J.M.; Rumbough, R.; McPherson, J.T.; MacCormack, J.N. Coinfection with multiple tick-borne pathogens in a Walker Hound kennel in North Carolina. J. Clin. Microbiol. 1999, 37, 2631–2638. [CrossRef] 12. Lorusso, V.; Wijnveld, M.; Majekodunmi, A.O.; Dongkum, C.; Fajinmi, A.; Dogo, A.G.; Thrusfield, M.; Mugenyi, A.; Vau- mourin, E.; Igweh, A.C.; et al. Tick-borne pathogens of zoonotic and veterinary importance in Nigerian cattle. Parasites Vectors 2016, 9, 217. [CrossRef] 13. Maggi, R.G.; Mascarelli, P.E.; Havenga, L.N.; Naidoo, V.; Breitschwerdt, E.B. Co-infection with Anaplasma platys, Bartonella henselae and Candidatus Mycoplasma haematoparvum in a veterinarian. Parasit Vectors 2013, 6, 103. [CrossRef][PubMed] 14. Meinkoth, J.H.; Ewing, S.A.; Cowell, R.L.; Dawson, J.E.; Warner, C.K.; Mathew, J.S.; Bowles, M.; Thiessen, A.E.; Panciera, R.J.; Fox, C. Morphologic and molecular evidence of a dual species ehrlichial infection in a dog presenting with inflammatory central nervous system disease. J. Vet. Intern. Med. 1998, 12, 389–393. [CrossRef] 15. Njiiri, N.E.; Bronsvoort, B.M.; Collins, N.E.; Steyn, H.C.; Troskie, M.; Vorster, I.; Thumbi, S.M.; Sibeko, K.P.; Jennings, A.; van Wyk, I.C.; et al. The epidemiology of tick-borne haemoparasites as determined by the reverse line blot hybridization assay in an intensively studied cohort of calves in western Kenya. Vet. Parasitol. 2015, 210, 69–76. [CrossRef] 16. Rajput, Z.I.; Hu, S.H.; Arijo, A.G.; Habib, M.; Khalid, M. Comparative study of Anaplasma parasites in tick carrying buffaloes and cattle. J. Zhejiang Univ. Sci. B 2005, 6, 1057–1062. [CrossRef][PubMed] 17. Ringo, A.E.; Adjou Moumouni, P.F.; Taioe, M.; Jirapattharasate, C.; Liu, M.; Wang, G.; Gao, Y.; Guo, H.; Lee, S.H.; Zheng, W.; et al. Molecular analysis of tick-borne protozoan and rickettsial pathogens in small ruminants from two South African provinces. Parasitol. Int. 2018, 67, 144–149. [CrossRef] 18. De Tommasi, A.S.; Otranto, D.; Dantas-Torres, F.; Capelli, G.; Breitschwerdt, E.B.; de Caprariis, D. Are vector-borne pathogen co-infections complicating the clinical presentation in dogs? Parasites Vectors 2013, 6, 97. [CrossRef][PubMed] Pathogens 2021, 10, 192 16 of 18

19. Mylonakis, M.E.; Koutinas, A.F.; Baneth, G.; Polizopoulou, Z.; Fytianou, A. Mixed Ehrlichia canis, Hepatozoon canis, and presumptive Anaplasma phagocytophilum infection in a dog. Vet. Clin. Pathol. 2004, 33, 249–251. [CrossRef][PubMed] 20. Tuttle, A.D.; Birkenheuer, A.J.; Juopperi, T.; Levy, M.G.; Breitschwerdt, E.B. Concurrent bartonellosis and babesiosis in a dog with persistent thrombocytopenia. J. Am. Vet. Med. Assoc. 2003, 223, 1306–1310. [CrossRef] 21. Gaunt, S.; Beall, M.; Stillman, B.; Lorentzen, L.; Diniz, P.; Chandrashekar, R.; Breitschwerdt, E. Experimental infection and co-infection of dogs with Anaplasma platys and Ehrlichia canis: Hematologic, serologic and molecular findings. Parasit Vectors 2010, 3, 33. [CrossRef] 22. Gal, A.; Harrus, S.; Arcoh, I.; Lavy, E.; Aizenberg, I.; Mekuzas-Yisaschar, Y.; Baneth, G. Coinfection with multiple tick-borne and intestinal parasites in a 6-week-old dog. Can. Vet. J. 2007, 48, 619–622. [PubMed] 23. Otranto, D.; Dantas-Torres, F.; Breitschwerdt, E.B. Managing canine vector-borne diseases of zoonotic concern: Part two. Trends Parasitol. 2009, 25, 228–235. [CrossRef][PubMed] 24. Chapman, A.S.; Bakken, J.S.; Folk, S.M.; Paddock, C.D.; Bloch, K.C.; Krusell, A.; Sexton, D.J.; Buckingham, S.C.; Marshall, G.S.; Storch, G.A.; et al. Diagnosis and management of tickborne rickettsial diseases: Rocky Mountain spotted fever, ehrlichioses, and anaplasmosis–United States: A practical guide for physicians and other health-care and public health professionals. MMWR Recomm. Rep. 2006, 55, 1–27. [PubMed] 25. Reller, M.E.; Dumler, J.S. Ehrlichia, Anaplasma, and related intracellular bacteria. Man. Clin. Microbiol. 2015, 1135–1149. [CrossRef] 26. Walker, D.H.; Bouyer, D.H. Rickettsia and orientia. In Manual of Clinical Microbiology, 11th ed.; Jorgensen, J.H., Carroll, K.C., Funke, G., Pfaller, M.A., Landry, M.L., Richter, S.S., Warnock, D.W., Carroll, K.C., Funke, G., Bernard, K.A., et al., Eds.; American Society of Microbiology Press: Washington, DC, USA, 2015; pp. 1122–1134. 27. Chandrashekar, R.; Mainville, C.A.; Beall, M.J.; O’Connor, T.; Eberts, M.D.; Alleman, A.R.; Gaunt, S.D.; Breitschwerdt, E.B. Performance of a commercially available in-clinic ELISA for the detection of antibodies against Anaplasma phagocytophilum, Ehrlichia canis, and Borrelia burgdorferi and Dirofilaria immitis antigen in dogs. Am. J. Vet. Res. 2010, 71, 1443–1450. [CrossRef] 28. Malheiros, J.; Costa, M.M.; do Amaral, R.B.; de Sousa, K.C.M.; André, M.R.; Machado, R.Z.; Vieira, M.I.B. Identification of vector-borne pathogens in dogs and cats from Southern Brazil. Ticks Tick Borne Dis. 2016, 7, 893–900. [CrossRef] 29. O’Connor, T.P.; Hanscom, J.L.; Hegarty, B.C.; Groat, R.G.; Breitschwerdt, E.B. Comparison of an indirect immunofluorescence assay, western blot analysis, and a commercially available ELISA for detection of Ehrlichia canis antibodies in canine sera. Am. J. Vet. Res. 2006, 67, 206–210. [CrossRef][PubMed] 30. Biggs, H.M.; Behravesh, C.B.; Bradley, K.K.; Dahlgren, F.S.; Drexler, N.A.; Dumler, J.S.; Folk, S.M.; Kato, C.Y.; Lash, R.R.; Levin, M.L.; et al. Diagnosis and Management of Tickborne Rickettsial Diseases: Rocky Mountain Spotted Fever and Other Spotted Fever Group Rickettsioses, Ehrlichioses, and Anaplasmosis—United States. MMWR Recomm. Rep. 2016, 65, 1–44. [CrossRef] 31. World Organization for Animal Health. Manual of Diagnostic Tests and Vaccines for Terrestrial Animals, Chapter 3.4.1. Bovine Anaplasmosis. Available online: https://www.oie.int/en/standard-setting/terrestrial-manual/access-online/ (accessed on 9 February 2021). 32. Chen, S.M.; Dumler, J.S.; Bakken, J.S.; Walker, D.H. Identification of a granulocytotropic Ehrlichia species as the etiologic agent of human disease. J. Clin. Microbiol. 1994, 32, 589–595. [CrossRef][PubMed] 33. Courtney, J.W.; Kostelnik, L.M.; Zeidner, N.S.; Massung, R.F. Multiplex real-time PCR for detection of anaplasma phagocytophilum and Borrelia burgdorferi. J. Clin. Microbiol. 2004, 42, 3164–3168. [CrossRef] 34. Dawson, J.E.; Biggie, K.L.; Warner, C.K.; Cookson, K.; Jenkins, S.; Levine, J.F.; Olson, J.G. Polymerase chain reaction evidence of Ehrlichia chaffeensis, an etiologic agent of human ehrlichiosis, in dogs from southeast Virginia. Am. J. Vet. Res. 1996, 57, 1175–1179. 35. Eddlestone, S.M.; Gaunt, S.D.; Neer, T.M.; Boudreaux, C.M.; Gill, A.; Haschke, E.; Corstvet, R.E. PCR detection of Anaplasma platys in blood and tissue of dogs during acute phase of experimental infection. Exp. Parasitol. 2007, 115, 205–210. [CrossRef] 36. Hulínská, D.; Langrová, K.; Pejcoch, M.; Pavlásek, I. Detection of Anaplasma phagocytophilum in animals by real-time polymerase chain reaction. Apmis 2004, 112, 239–247. [CrossRef] 37. Sirigireddy, K.R.; Ganta, R.R. Multiplex detection of Ehrlichia and Anaplasma species pathogens in peripheral blood by real-time reverse transcriptase-polymerase chain reaction. J. Mol. Diagn. 2005, 7, 308–316. [CrossRef] 38. Doyle, C.K.; Labruna, M.B.; Breitschwerdt, E.B.; Tang, Y.W.; Corstvet, R.E.; Hegarty, B.C.; Bloch, K.C.; Li, P.; Walker, D.H.; McBride, J.W. Detection of medically important Ehrlichia by quantitative multicolor TaqMan real-time polymerase chain reaction of the dsb gene. J. Mol. Diagn. 2005, 7, 504–510. [CrossRef] 39. Benevenute, J.L.; Dumler, J.S.; Ogrzewalska, M.; Roque, A.L.R.; Mello, V.V.C.; de Sousa, K.C.M.; Gonçalves, L.R.; D’Andrea, P.S.; de Sampaio Lemos, E.R.; Machado, R.Z.; et al. Assessment of a quantitative 5’ nuclease real-time polymerase chain reaction using groEL gene for Ehrlichia and Anaplasma species in rodents in Brazil. Ticks Tick Borne Dis. 2017, 8, 646–656. [CrossRef][PubMed] 40. Lew, A.E.; Gale, K.R.; Minchin, C.M.; Shkap, V.; de Waal, D.T. Phylogenetic analysis of the erythrocytic Anaplasma species based on 16S rDNA and GroEL (HSP60) sequences of A. marginale, A. centrale, and A. ovis and the specific detection of A. centrale vaccine strain. Vet. Microbiol. 2003, 92, 145–160. [CrossRef] 41. Lew, A.E.; Bock, R.E.; Minchin, C.M.; Masaka, S. A msp1alpha polymerase chain reaction assay for specific detection and differentiation of Anaplasma marginale isolates. Vet. Microbiol. 2002, 86, 325–335. [CrossRef] 42. Vidotto, M.C.; Kano, S.F.; Gregori, F.; Headley, S.A.; Vidotto, O. Phylogenetic analysis of Anaplasma marginale strains from Paraná State, Brazil, using the msp1alpha and msp4 genes. J. Vet. Med. B Infect. Dis. Vet. Public Health 2006, 53, 404–411. [CrossRef] Pathogens 2021, 10, 192 17 of 18

43. Gusa, A.A.; Buller, R.S.; Storch, G.A.; Huycke, M.M.; Machado, L.J.; Slater, L.N.; Stockham, S.L.; Massung, R.F. Identification of a p28 gene in Ehrlichia ewingii: Evaluation of gene for use as a target for a species-specific PCR diagnostic assay. J. Clin. Microbiol. 2001, 39, 3871–3876. [CrossRef][PubMed] 44. Zhang, C.; Xiong, Q.; Kikuchi, T.; Rikihisa, Y. Identification of 19 polymorphic major outer membrane protein genes and their immunogenic peptides in Ehrlichia ewingii for use in a serodiagnostic assay. Clin. Vaccine Immunol. 2008, 15, 402–411. [CrossRef][PubMed] 45. Inokuma, H.; Brouqui, P.; Drancourt, M.; Raoult, D. Citrate synthase gene sequence: A new tool for phylogenetic analysis and identification of Ehrlichia. J. Clin. Microbiol. 2001, 39, 3031–3039. [CrossRef][PubMed] 46. Michelet, L.; Delannoy, S.; Devillers, E.; Umhang, G.; Aspan, A.; Juremalm, M.; Chirico, J.; van der Wal, F.J.; Sprong, H.; Boye Pihl, T.P.; et al. High-throughput screening of tick-borne pathogens in Europe. Front. Cell. Infect. Microbiol. 2014, 4, 103. [CrossRef] 47. Gibson, K.; Fitzpatrick, D.; Stone, D.; Noel, T.; MacPherson, C. Vector-borne diseases in the Caribbean: History and current status. Cab. Rev. 2016, 11, 1–28. [CrossRef] 48. Lanza-Perea, M.; Zieger, U.; Qurollo, B.A.; Hegarty, B.C.; Pultorak, E.L.; Kumthekar, S.; Bruhl-Day, R.; Breitschwerdt, E.B. Intraoperative bleeding in dogs from Grenada seroreactive to Anaplasma platys and Ehrlichia canis. J. Vet. Intern. Med. 2014, 28, 1702–1707. [CrossRef] 49. Wilkerson, M.J.; Black, K.E.; Lanza-Perea, M.; Sharma, B.; Gibson, K.; Stone, D.M.; George, A.; Nair, A.D.; Ganta, R.R. Initial development and preliminary evaluation of a multiplex bead assay to detect antibodies to Ehrlichia canis, Anaplasma platys, and Ehrlichia chaffeensis outer membrane peptides in naturally infected dogs from Grenada, West Indies. J. Vet. Diagn. Investig. 2017, 29, 109–114. [CrossRef] 50. Yabsley, M.J.; McKibben, J.; Macpherson, C.N.; Cattan, P.F.; Cherry, N.A.; Hegarty, B.C.; Breitschwerdt, E.B.; O’Connor, T.; Chandrashekar, R.; Paterson, T.; et al. Prevalence of Ehrlichia canis, Anaplasma platys, Babesia canis vogeli, Hepatozoon canis, Bartonella vinsonii berkhoffii, and Rickettsia spp. in dogs from Grenada. Vet. Parasitol. 2008, 151, 279–285. [CrossRef] 51. Camus, E.; Barré, N. Vector situation of tick-borne diseases in the Caribbean islands. Vet. Parasitol. 1995, 57, 167–176. [CrossRef] 52. Camus, E.; Maran, M.; Montenegro-James, S.; Accipe, A. Sero-Epidemiological Survey on Bovine Tick-Borne Diseases in the Lesser Antilles. In Proceedings of the Final Research Co-Ordination Meetings of FAO/IAEA/SIDA Co-Ordinated Research Projects, Guadeloupe, Lesser Antilles, France, 13–17 June 1994; International Atomic Energy Agency: Vienna, Austria, 1998; pp. 241–245. 53. Camus, E.; Montenegro-James, S. Bovine anaplasmosis and babesiosis in the Lesser Antilles: Risk assessment of an unstable epidemiologic situation. Vet. Res. 1994, 25, 313–317. 54. Zhang, J.; Kelly, P.; Guo, W.; Xu, C.; Wei, L.; Jongejan, F.; Loftis, A.; Wang, C. Development of a generic Ehrlichia FRET-qPCR and investigation of ehrlichioses in domestic ruminants on five Caribbean islands. Parasit. Vectors 2015, 8, 506. [CrossRef][PubMed] 55. Gondard, M.; Cabezas-Cruz, A.; Charles, R.A.; Vayssier-Taussat, M.; Albina, E.; Moutailler, S. Ticks and Tick-Borne Pathogens of the Caribbean: Current Understanding and Future Directions for More Comprehensive Surveillance. Front. Cell. Infect. Microbiol. 2017, 7, 490. [CrossRef][PubMed] 56. Christopher-Hennings, J.; Araujo, K.P.; Souza, C.J.; Fang, Y.; Lawson, S.; Nelson, E.A.; Clement, T.; Dunn, M.; Lunney, J.K. Opportunities for bead-based multiplex assays in veterinary diagnostic laboratories. J. Vet. Diagn. Investig. 2013, 25, 671–691. [CrossRef][PubMed] 57. Livengood, J.; Hutchinson, M.L.; Thirumalapura, N.; Tewari, D. Detection of Babesia, Borrelia, Anaplasma, and Rickettsia spp. in Adult Black-Legged Ticks (Ixodes scapularis) from Pennsylvania, United States, with a Luminex Multiplex Bead Assay. Vector Borne Zoonotic Dis. 2020, 20, 406–411. [CrossRef] 58. Reslova, N.; Huvarova, V.; Hrdy, J.; Kasny, M.; Kralik, P. A novel perspective on MOL-PCR optimization and MAGPIX analysis of in-house multiplex foodborne pathogens detection assay. Sci. Rep. 2019, 9, 2719. [CrossRef] 59. Reslova, N.; Michna, V.; Kasny, M.; Mikel, P.; Kralik, P. xMAP Technology: Applications in Detection of Pathogens. Front. Microbiol. 2017, 8, 55. [CrossRef] 60. Angeloni, S.D.S.; Dunbar, S.; Stone, V.; Swift, S. xMAP®Cookbook. A Collection of Methods and Protocols for Developing Multiplex Assays with xMAP Technology. Available online: https://cdn2.hubspot.net/hubfs/128032/Cookbook/BR76862 .xMAPCookbook.Ed4.WR.pdf (accessed on 9 February 2021). 61. Ros-García, A.; Juste, R.A.; Hurtado, A. A highly sensitive DNA bead-based suspension array for the detection and species identification of bovine piroplasms. Int. J. Parasitol. 2012, 42, 207–214. [CrossRef][PubMed] 62. Abanda, B.; Paguem, A.; Abdoulmoumini, M.; Kingsley, M.T.; Renz, A.; Eisenbarth, A. Molecular identification and prevalence of tick-borne pathogens in zebu and taurine cattle in North Cameroon. Parasit. Vectors 2019, 12, 448. [CrossRef][PubMed] 63. Kelly, P.J.; Xu, C.; Lucas, H.; Loftis, A.; Abete, J.; Zeoli, F.; Stevens, A.; Jaegersen, K.; Ackerson, K.; Gessner, A.; et al. Ehrlichiosis, babesiosis, anaplasmosis and hepatozoonosis in dogs from St. Kitts, West Indies. PLoS ONE 2013, 8, e53450. [CrossRef] 64. Lara, B.; Conan, A.; Thrall, M.A.; Ketzis, J.K.; Branford, G.C.; Rajeev, S. Serologic and Molecular Diagnosis of Anaplasma platys and Ehrlichia canis Infection in Dogs in an Endemic Region. Pathogens 2020, 9, 488. [CrossRef] 65. Peter, S.G.; Aboge, G.O.; Kariuki, H.W.; Kanduma, E.G.; Gakuya, D.W.; Maingi, N.; Mulei, C.M.; Mainga, A.O. Molecular prevalence of emerging Anaplasma and Ehrlichia pathogens in apparently healthy dairy cattle in peri-urban Nairobi, Kenya. BMC Vet. Res. 2020, 16, 364. [CrossRef] Pathogens 2021, 10, 192 18 of 18

66. Tana-Hernández, L.; Navarrete-Arroyo, K.; Ron-Román, J.; Reyna-Bello, A.; Chávez-Larrea, M.A. PCR-diagnosis of Anaplasma marginale in cattle populations of Ecuador and its molecular identification through sequencing of ribosomal 16S fragments. BMC Vet. Res. 2017, 13, 392. [CrossRef][PubMed] 67. Loftis, A.D.; Kelly, P.J.; Freeman, M.D.; Fitzharris, S.; Beeler-Marfisi, J.; Wang, C. Tick-borne pathogens and disease in dogs on St. Kitts, West Indies. Vet. Parasitol. 2013, 196, 44–49. [CrossRef][PubMed] 68. Starkey, L.A.; Newton, K.; Brunker, J.; Crowdis, K.; Edourad, E.J.P.; Meneus, P.; Little, S.E. Prevalence of vector-borne pathogens in dogs from Haiti. Vet. Parasitol. 2016, 224, 7–12. [CrossRef] 69. Carelli, G.; Decaro, N.; Lorusso, A.; Elia, G.; Lorusso, E.; Mari, V.; Ceci, L.; Buonavoglia, C. Detection and quantification of Anaplasma marginale DNA in blood samples of cattle by real-time PCR. Vet. Microbiol. 2007, 124, 107–114. [CrossRef][PubMed] 70. Cossío-Bayúgar, R.; Rodríguez, S.D.; García-Ortiz, M.A.; García-Tapia, D.; Aboytes-Torres, R. Bovine anaplasmosis prevalence in northern Veracruz state, Mexico. Prev. Vet. Med. 1997, 32, 165–170. [CrossRef] 71. da Silva, N.B.; Taus, N.S.; Johnson, W.C.; Mira, A.; Schnittger, L.; Valente, J.D.M.; Vidotto, O.; Masterson, H.E.; Vieira, T.; Ueti, M.W.; et al. First report of Anaplasma marginale infection in goats, Brazil. PLoS ONE 2018, 13, e0202140. [CrossRef] 72. Torioni de Echaide, S.; Knowles, D.P.; McGuire, T.C.; Palmer, G.H.; Suarez, C.E.; McElwain, T.F. Detection of cattle naturally infected with Anaplasma marginale in a region of endemicity by nested PCR and a competitive enzyme-linked immunosorbent assay using recombinant major surface protein 5. J. Clin. Microbiol. 1998, 36, 777–782. [CrossRef] 73. Yousefi, A.; Rahbari, S.; Shayan, P.; Sadeghi-dehkordi, Z.; Bahonar, A. Molecular detection of Anaplasma marginale and Anaplasma ovis in sheep and goat in west highland pasture of Iran. Asian Pac. J. Trop. Biomed. 2017, 7, 455–459. [CrossRef] 74. Fosgate, G.T.; Urdaz-Rodríguez, J.H.; Dunbar, M.D.; Rae, D.O.; Donovan, G.A.; Melendez, P.; Dobek, G.L.; Alleman, A.R. Diagnostic accuracy of methods for detecting Anaplasma marginale infection in lactating dairy cattle of Puerto Rico. J. Vet. Diagn. Investig. 2010, 22, 192–199. [CrossRef] 75. Díaz-Sánchez, A.A.; Meli, M.L.; Obregón Álvarez, D.; Fonseca-Rodríguez, O.; Cabezas-Cruz, A.; Hofmann-Lehmann, R.; Corona- González, B. Development and application of a multiplex TaqMan®real-time qPCR assay for the simultaneous detection of Anaplasma marginale and Theileria annulata and molecular characterization of Anaplasma marginale from cattle in Western Cuba. Ticks Tick Borne Dis. 2020, 11, 101356. [CrossRef][PubMed] 76. Obregón, D.; Cabezas-Cruz, A.; Armas, Y.; Silva, J.B.; Fonseca, A.H.; André, M.R.; Alfonso, P.; Oliveira, M.C.S.; Machado, R.Z.; Corona-González, B. High co-infection rates of Babesia bovis, Babesia bigemina, and Anaplasma marginale in water buffalo in Western Cuba. Parasitol. Res. 2019, 118, 955–967. [CrossRef][PubMed] 77. Bergval, I.; Sengstake, S.; Brankova, N.; Levterova, V.; Abadía, E.; Tadumaze, N.; Bablishvili, N.; Akhalaia, M.; Tuin, K.; Schuitema, A.; et al. Combined species identification, genotyping, and drug resistance detection of Mycobacterium tuberculosis cultures by MLPA on a bead-based array. PLoS ONE 2012, 7, e43240. [CrossRef][PubMed] 78. Wuyts, V.; Roosens, N.H.; Bertrand, S.; Marchal, K.; De Keersmaecker, S.C. Guidelines for optimisation of a multiplex oligonucleotide ligation-PCR for characterisation of microbial pathogens in a microsphere suspension array. BioMed Res. Int. 2015, 2015, 790170. [CrossRef][PubMed] 79. Deshpande, A.; Gans, J.; Graves, S.W.; Green, L.; Taylor, L.; Kim, H.B.; Kunde, Y.A.; Leonard, P.M.; Li, P.E.; Mark, J.; et al. A rapid multiplex assay for nucleic acid-based diagnostics. J. Microbiol. Methods 2010, 80, 155–163. [CrossRef] 80. Thierry, S.; Hamidjaja, R.A.; Girault, G.; Löfström, C.; Ruuls, R.; Sylviane, D. A multiplex bead-based suspension array assay for interrogation of phylogenetically informative single nucleotide polymorphisms for Bacillus anthracis. J. Microbiol. Methods 2013, 95, 357–365. [CrossRef] 81. Armbruster, D.A.; Pry, T. Limit of blank, limit of detection and limit of quantitation. Clin. Biochem. Rev. 2008, 29 (Suppl. 1), S49–S52. 82. Sharma, B. Development of a PCR Based Direct DNA Hybridization Oligonucleotide Microbead Assay for Detection of Ehrlichia and Anaplasma Species in Animals and Ticks from Grenada, West Indies. Ph.D. Thesis, St. George’s University, West Indies, Grenada, 2020. 83. Chang, W.L.; Pan, M.J. Specific amplification of Ehrlichia platys DNA from blood specimens by two-step PCR. J. Clin. Microbiol. 1996, 34, 3142–3146. [CrossRef] 84. Anderson, B.E.; Sumner, J.W.; Dawson, J.E.; Tzianabos, T.; Greene, C.R.; Olson, J.G.; Fishbein, D.B.; Olsen-Rasmussen, M.; Holloway, B.P.; George, E.H.; et al. Detection of the etiologic agent of human ehrlichiosis by polymerase chain reaction. J. Clin. Microbiol. 1992, 30, 775–780. [CrossRef] 85. Anderson, B.E.; Greene, C.E.; Jones, D.C.; Dawson, J.E. Ehrlichia ewingii sp. nov., the etiologic agent of canine granulocytic ehrlichiosis. Int. J. Syst. Bacteriol. 1992, 42, 299–302. [CrossRef]