UHI Research Database pdf download summary

Ecological adaptations and commensal evolution of the Polynoidae (Polychaeta) in the Southwest Indian Ocean Ridge: a phylogenetic approach. Serpetti, Natalia; Taylor, Michelle; Brennan, Debra; Green, David; Rogers, Alex; Paterson, Gordon; Narayanaswamy, Bhavani Published in: Deep-Sea Research Part II - Topical Studies in Oceanography Publication date: 2017 Publisher rights: Copyright © 2017 Elsevier B.V. The re-use license for this item is: CC BY-NC-ND The Document Version you have downloaded here is: Peer reviewed version

The final published version is available direct from the publisher website at: 10.1016/j.dsr2.2016.06.004 Link to author version on UHI Research Database

Citation for published version (APA): Serpetti, N., Taylor, M., Brennan, D., Green, D., Rogers, A., Paterson, G., & Narayanaswamy, B. (2017). Ecological adaptations and commensal evolution of the Polynoidae (Polychaeta) in the Southwest Indian Ocean Ridge: a phylogenetic approach. Deep-Sea Research Part II - Topical Studies in Oceanography, 137, 273-281. https://doi.org/10.1016/j.dsr2.2016.06.004

General rights Copyright and moral rights for the publications made accessible in the UHI Research Database are retained by the authors and/or other copyright owners and it is a condition of accessing publications that users recognise and abide by the legal requirements associated with these rights:

1) Users may download and print one copy of any publication from the UHI Research Database for the purpose of private study or research. 2) You may not further distribute the material or use it for any profit-making activity or commercial gain 3) You may freely distribute the URL identifying the publication in the UHI Research Database

Take down policy If you believe that this document breaches copyright please contact us at [email protected] providing details; we will remove access to the work immediately and investigate your claim.

Download date: 01. Oct. 2021 1 Ecological adaptations and commensal evolution of the Polynoidae (Polychaeta) in the 2 Southwest Indian Ocean Ridge: a phylogenetic approach

3 Natalia Serpetti1, M.L. Taylor2, D. Brennan1, D.H. Green1, A.D. Rogers2, G.L.J. Paterson3, 4 B.E. Narayanaswamy1

5 1 Scottish Association for Marine Science, Scottish Marine Institute, Oban, Argyll, Scotland – 6 UK

7 2 University of Oxford, Department of Life Sciences, Tinbergen building, South Parks Road, 8 Oxford, OX1 3PS – UK

9 3 The Natural History Museum, Department of Zoology, London, SW7 5BD – UK

10 Abstract

11 The polychaete family polynoid is very large and includes a high diversity of behaviours, 12 including numerous examples of commensal species. The comparison between free-living 13 and commensal behaviours and the evolution of the relationships between commensal species 14 and their hosts are valuable case studies of ecological adaptations. Deep-sea species of 15 Polynoidae were sampled at four seamounts in the Southwest Indian Ridge and twenty 16 specimens from seven species were selected to be analysed. Among them, there were free- 17 living species, living within the three-dimensional framework of cold-water coral reefs, on 18 coral rubble and on mobile sediments, and commensal species, associated with octocorals, 19 hydrocorals (stylasterids), antipatharians and echinoderms (holothurian and ophiuroids). We 20 analysed two mitochondrial (COI, 16S) and two nuclear (18S, 28S) ribosomal genetic 21 markers and their combined sequences were compared with other Genbank sequences to 22 assess the taxonomic relationships within the species under study, and the potential role of 23 hosts in speciation processes. Most basal species of the sub-family Polynoinae are obligate 24 symbionts showing specific morphological adaptations. Obligate and facultative commensal 25 species and free-living species have evolved a number of times, although, according to our 26 results, the obligate coral commensal species appear to be monophyletic.

27 1. Introduction

28 At the end of 2011 a research expedition was undertaken on-board the RRS James Cook 29 (JC066) to investigate the deep-sea fauna of the South West Indian Ocean Ridge (SWIOR),

1

30 an unexplored region which is of particular interest due to its position in relation to major 31 ocean currents, gradients of primary productivity and temperature (Read and Pollard, 2015). 32 The major aims of this expedition were to assess the benthic biodiversity of the region, the 33 impact of environmental drivers, such as primary productivity and temperature, on 34 structuring the benthic communities, and the genetic connectivity along the five SWIOR 35 seamounts (Rogers and Taylor, 2011). Some of the collected coral species harboured 36 commensal species, including crustaceans (mostly isopods and amphipods) and polychaetes 37 (e.g. polynoids, syllids and eunicids). Among them, we selected the Polynoidae, which was 38 the most diverse in terms of species, ecological adaptations and behaviours, allowing us to 39 combine ecological and molecular approaches.

40 Predation, competition and sex recognition are direct inter/intraspecific ways free-living 41 organisms living in the same ecosystem interact. In turn, a symbiotic mode of life (i.e. 42 parasitic, commesalistic or mutualistic) often implies that at least one of the involved partners 43 can no longer be considered a free-living organism (Martin & Britayev, 1998; Buhl- 44 Mortensen and Mortensen, 2004). The species analysed in our study are “commensals”, 45 which are clearly advantaged by the association without harming their hosts. The first attempt 46 of listing commensal relationships of polychaetes and other marine invertebrates date back to 47 the 1950s when no more than 70 species were identified and described. Martin and Britayev 48 (1998), in their review on symbiotic polychaetes, included 292 species of commensals 49 belonging to 28 families, most of them being scale-worms (Annelida, Polynoidae). 50 Nowadays, more than 200 scaleworm species are known to be involved in about 550 51 associations with other marine invertebrates (Britayev et al., 2014). 52 Polynoids are among the most abundant, diverse, widely distributed and versatile polychaetes 53 (Martin et al., 1992). The family includes about 700 species inhabiting different marine 54 habitats from mobile sediments to rocks and coral reefs (Fiege and Barnich, 2009). They are 55 predators/scavengers with the tendency to hide within stones, in burrows, and in tubes and 56 grooves, often provided by their host in obligate symbiotic relationships (Martin and 57 Britayev, 1998). Among symbiotic polynoids, ~41% of the species lives in association with 58 black corals and octocorals, showing a wide range of specificity from monoxenous 59 (associated to one - or a few - hosts) to polyxenous (many different hosts) associations 60 (Pettibone, 1991a, 1991b; Martin and Britayev, 1998; Buhl-Mortensen and Mortensen, 2004), 61 but also with echinoderms and molluscs (Martin and Britayev, 1998). Polyxenous polynoids

2

62 often tend to be associated with hosts belonging to the same taxonomical class or, even, 63 family. Commensal associations could lead to a highly specialised behavioural strategies as, 64 for instance, the development chemically mediated host-recognition both in adults and 65 settling larvae, but also to morphological adaptations, such as the modified scales in the 66 short-bodied, gorgonian/stylasterid coral symbiont Gorgoniapolynoe (Pettibone, 1991a; 67 Martin and Britayev, 1998). 68 In turn, the presences of these polynoids cause an overgrowing of the coral sclerites that form 69 open-ended tunnels where the polynoids remain hidden (Pettibone, 1991a). On the other 70 hand, most known polynoids found as commensal of antipatharian corals are long-bodied 71 polynoids (i.e. with more than 50 segments) having usually reduced elytra that do not cover 72 the body of the worm dorsally (Pettibone, 1991b). These species live within the stiff branches 73 projecting off the central stems of the corals, without causing an overgrowing of the coral 74 structures (i.e. no tunnels). 75 Excluding some rare monoxenous obligate symbiotic species, there is little taxonomical 76 differentiation between commensal and errant scale worms, with same genera including 77 commensal as well free-living species. The “typically” free-living genus Eunoe includes three 78 commensal species, whilst the highly diverse Harmothoe includes about 15 commensal 79 species out of a total of >120 species and the versatile facultative commensal Polyeunoa 80 includes long-bodied highly morphologically variable species often found in association with 81 scleractinian and gorgonian corals, as well as on coarse soft bottoms (Barnich et al., 2012). In 82 contrast, genera such as Arctonoe, Asterophylia, or Australaugeneria are considered 83 exclusively commensal (Martin and Britayev, 1998) involved in obligate relationships that 84 lead to specific morphological adaptations, as it also occurs in the well-known holothurian 85 and crinoids associated species of Gastrolepidia and Paradyte respectively (Martin and 86 Britayev, 1998). 87 The overall lack of information on the symbiotic associations involving polychaetes 88 prevented us speculating on the curious dominance of polynoids as well as on the evolutive 89 reasons explaining the relationships in which they are involved. A recent phylogenetic 90 analysis of the Aphroditiformia based on molecular data (Norlinder et al., 2012) confirmed 91 the monophyly of the order and resolved the relationships between families and sub-families 92 (Barnich and Fiege, 2003; Norlinder et al., 2012; Shields et al. 2013). Molecular approaches 93 have also been useful to investigate the higher taxonomic relationships within the Polynoidae 94 (Wiklund et al., 2005; Norlinder et al., 2012; Shields et al. 2013). However, to the best of our

3

95 knowledge, they have never been used to assess the implications of the symbiosis in the 96 phylogeny of the family, as well as the potential role of hosts in speciation processes. The 97 numerous symbiotic and free-living species of polynoids found during our expedition in four 98 different seamounts was taken as an opportunity to preliminarily assess these questions.

99 Seven species of polynoids, including examples of obligate and facultative commensal as 100 well as free-living species, were chosen for our analysis. The potential phylogenetic 101 similarity between species was discussed in relation to the species behaviour. As a result, we 102 present a provisional study to assess the evolutive relationships across commensal and free- 103 living polynoids based on our data as well as on the available molecular information. About 104 40% of the known polynoid species are commensals. However, to date, only a small fraction 105 has been sequenced. Therefore, more data are required to allow a reliable identification of 106 evolutionary patterns.

107 2. Materials and methods 108 2.1. Study area and sample collections

109 The SWIOR is a major geological feature which extends from the central Indian Ocean to 110 join the Mid-Atlantic Ridge in the Southern Ocean. The central section of this ridge, between 111 33 - 41°S, and 42 – 58 °E, is characterised by the presence of several seamounts (Fig. 1) 112 (Rogers and Taylor, 2011; Letessier et al., 2015).

113 Samples were collected between November-December 2011 using the IFM Geomar Kiel 114 6000 ROV system (using either a mechanic arm or a suction sampler) and a USNEL Box 115 Corer and preserved in ethanol (70-100%). Twenty Polynoidae polychaete specimens 116 belonging to seven species (Table 1) were collected on four of the five seamounts sampled 117 along the SWIOR (Fig. 2). The samples will be deposited at the Natural History Museum of 118 London; the vouchers will reflect the specimen ID code preceded by the museum 119 identification code (NHMUK). The species were, either free-living, living on dead 120 Scleractinia (stony coral) and on sediments, or commensal, living in association with 121 Antipatharia (black corals), Octocorallia (gorgonian corals), Anthoathecata (stylasterids), 122 Phrynophiurida (basket stars) and Elasipodida (sea cucumbers). In species found on different 123 seamounts or in association with different host/substrates, one specimen for each combination 124 was selected for the molecular analysis (Table 1) to assess the potential phylogenetic 125 differences between having either commensal or free-living modes of life.

4

Latitude Longitude Depth ID Species Ecology Hosts/Substrate Seamount (S) (E) (m) JC066_ 3760 Antipathipolyeunoa sp. Polyxenous obligate commensal Anthipatharia coral Atlantis Bank 32° 41.91 57° 17.61 744 JC066_ 104 Gorgoniapolynoe caeciliae Polyxenous obligate commensal Narella sp. (Primnoidae, Octocorallia) Coral 41° 20.76 42° 55.33 1360 Candidella imbricata (Primnoidae, JC066_ 804 Gorgoniapolynoe caeciliae Melville 38° 29.92 46° 45.60 1021 Polyxenous obligate commensal Octocorallia) JC066_3280_X001 Gorgoniapolynoe caeciliae Polyxenous obligate commensal Isididae, (Octocorallia) Melville 38° 30.09 46° 45.83 1300 Acanthogorgia sp. (Acanthogorgiidae, JC066_4277 Gorgoniapolynoe caeciliae Polyxenous obligate commensal Atlantis Bank 32° 41.95 57° 17.73 784 Octocorallia) JC066_133_S001 Gorgoniapolynoe corralophila monoxenous obligate commensal Stylasteridae (hydrocoral) Coral 41° 20.77 42° 55.32 1357 JC066_3219_S001 Gorgoniapolynoe corralophila monoxenous obligate commensal Stylasteridae (hydrocoral) Melville 38° 27.78 46° 45.48 562 JC066_3559 Gorgoniapolynoe corralophila monoxenous obligate commensal Stylasteridae (hydrocorals Middle of What 37° 56.62 50° 27.11 1340 JC066_4279_S001 Gorgoniapolynoe corralophila monoxenous obligate commensal Stylasteridae (hydrocoral) Atlantis Bank 32° 42.01 57° 17.86 894 JC066_219_S001 Polyeunoa laevis Facultative commensal Corallium sp. (Corallidae, Octocorallia) Coral 41° 20.76 42° 55.33 1361 Thouarella sp. (Primnoidae, JC066_111 Polyeunoa laevis Facultative commensal Coral 41° 20.76 42° 55.32 1358 Octocorallia) JC066_477_S001 Polyeunoa laevis Facultative commensal Crinoidea, Echinodermata Coral 41°22.82 42° 51.25 1017 JC066_962_S001 Polyeunoa laevis Facultative commensal Scleractinia, Hexacorallia Coral 41°21.40 42° 55.07 917 JC066_1005_S001 Polyeunoa laevis Facultative commensal Primnoidae ind., Octocorallia Coral 41°21.36 42° 55.11 949 JC066_241_S001 Harmothoe sp. Errant Unknown Coral 41° 20.91 42° 55.25 1202 JC066_793_S001 Harmothoe sp. Errant Unknown Melville 38° 30.09 46° 45.83 1300 JC066_823_S001 Harmothoe sp. Errant Unknown Middle of What 37° 56.62 50° 26.77 1306 JC066_3755_S001 Harmothoe sp. Errant Glass sponge (Hexactinellida) Atlantis Bank 32° 41.97 57˚ 17.77 814 Gorgonocephalidae, Ophiuroidea, JC066_113_S001 Brychionoe sp. Mono/Polyxenous obligate commensal Coral 41° 20.76 42˚ 55.33 1361 Echinodermata Pannychia taylorae, Holothuroidea, JC066_496_S001 Eunoe sp. Mono/Polyxenous obligate commensal Coral 41° 22.81 42˚ 50.80 1343 Echinodermata

Table 1. Polynoinae samples collected along the SWIOR for analysis. The list indicates the specimen ID code, the species and their ecology, host for commensal species, seamount where they were collected with associated metadata. 126

5

127 2.2. Sample analysis

128 The twenty polynoids collected in the SWIOR were identified based on morphological 129 criteria and, their modes of life were logged by direct observations prior to molecular 130 analysis. The new sequences were compared within NCBI GenBank sequences of Polynoinae 131 species whose behavioural information was obtained from the literature.

132 The analysis includes of thirty-eight polynoid species (Table 2), thirty-six belonging to the 133 Polynoinae and one Lepidastheninae, Lepidasthenia elegans (Grube, 1840), and one 134 Branchinotogluminae, Branchinotogluma sandersi (Pettibone, 1985), the last two being 135 considered as outgroups.

6

Species (authority) Ecology Hosts Origin ID 18S 28S 16S CO1 Acholoe squamosa Polyxenous obligate commensal Asteroidea, Echinodermata France SMNH118959 AY839567 JN852850 JN852888 AY839576 (Delle Chiaje, 1827) (Martin and Britayev, 1998) Polyxenous obligate commensal Antipathipolyeunoa sp. Anthipatharia SWIOR JC066_ 3760 KU738169 KU738184 KU738149 KU738202 (Martin and Britayev, 1998) Branchinotogluma sandersi Juan de Errant - SMNH118960 JN852821 JN852851 JN852889 JN852923 (Pettibone, 1985) Fuca Ridge Mono/Polyxenous obligate/ facultative Brychionoe sp. Ophiuroidea, Echinodermata SWIOR JC66_113_S001 KU738182 KU738200 KU738167 – commensal Bylgides elegans Errant - Sweden SMNH118962 JN852822 JN852852 JN852890 JN852924 (Théel, 1879) (Van Guelpen et al., 2005) Bylgides sarsi Errant - Sweden SMNH118961 JN852823 JN852853 JN852891 JN852925 (Malmgren, 1866) (Fauchald, 2015) Eunoe nodosa Errant - Norway SMNH118963 JN852824 JN852854 JN852892 JN852926 (M. Sars, 1861) (Barnich and Fiege, 2010) Mono/Polyxenous obligate/ facultative Eunoe sp. Holothuroidea, Echinodermata SWIOR JC66_496_S001 KU738183 KU738201 KU738168 KU738214 commensal Gastrolepidia clavigera Polyxenous obligate commensal Papua New Holothuroidea, Echinodermata SMNH118964 JN852825 JN852855 JN852893 JN852927 (Schmarda, 1861) (Martin and Britayev, 1998) Guinea Gattyana ciliata Errant - - AY894297 DQ790035 – AY894312 (Moore, 1902) (Moore, 1902) Gattyana cirrhosa Facultative commensal Inside invertebrates host tubes Sweden SMNH118965 JN852826 JN852856 JN852894 JN852928 (Pallas, 1766) (Martin and Britayev, 1998) and burrows Gorgoniapolynoe caeciliae Polyxenous obligate commensal Octocorallia, Hexacorallia SWIOR JC066_ 104 KU738170 KU738185 KU738150 KU738203 (Fauvel, 1913) (Martin and Britayev, 1998) Gorgoniapolynoe caeciliae " Octocorallia, Hexacorallia SWIOR JC066_ 804 KU738171 KU738186 KU738151 KU738204 Gorgoniapolynoe caeciliae " Octocorallia, Hexacorallia SWIOR JC66_3280_X001 – KU738187 KU738152 – Gorgoniapolynoe caeciliae " Octocorallia, Hexacorallia SWIOR JC66_4277 KU738172 KU738188 KU738153 KU738205 Gorgoniapolynoe corralophila Monoxenous obligate commensal Hydrocorallia, Stylasteridae SWIOR JC66_133_S001 KU738173 KU738189 KU738154 KU738206 (Day, 1960) (Martin and Britayev, 1998) Gorgoniapolynoe corralophila " Hydrocorallia, Stylasteridae SWIOR JC66_3219_S001 – KU738190 KU738155 KU738207 Gorgoniapolynoe corralophila " Hydrocorallia, Stylasteridae SWIOR JC66_3559 KU738174 KU738191 KU738156 KU738208 Gorgoniapolynoe corralophila " Hydrocorallia, Stylasteridae SWIOR JC66_4279_S001 KU738175 KU738192 KU738157 KU738209 Harmothoe glabra Errant - England SMNH118967 JN852828 JN852858 JN852896 JN852929 (Malmgren, 1866) (Barnich and Fiege, 2009) Harmothoe imbricata Facultative commensal Asteroidea, Decopoda, other - AY340434 AY340400 AY340463 AY839580 (Linnaeus, 1767) (Martin and Britayev, 1998) polychaeta tubes Harmothoe impar Facultative commensal Holothuroidea, Echinodermata Sweden SMNH118968 JN852829 JN852859 JN852897 JN852930 (Johnson, 1839) (Martin and Britayev, 1998)

7

Harmothoe oculinarum Facultative commensal Other polychaete tubes, e.g. Norway SMNH118969 AY894299 JN852860 JN852898 AY894314 (Storm, 1879) (Buhl-Mortensen et al., 2010) Eunice sp. Harmothoe sp. Errant - SWIOR JC66_241_S001 KU738178 KU738196 KU738163 – Harmothoe sp. Errant - SWIOR JC66_793_S001 KU738179 KU738197 KU738164 – Harmothoe sp. Errant - SWIOR JC66_823_S001 KU738180 KU738198 KU738165 – Harmothoe sp. Errant - SWIOR JC66_3755_S001 KU738181 KU738199 KU738166 – Lepidasthenia elegans Polyxenous obligate commensal Other polychaete tubes France SMNH118973 JN852832 JN852863 JN852901 JN852933 (Grube, 1840) (Martin and Britayev, 1998) Facultative commensal Malmgrenia mcintoshi Inside invertebrates host tubes (Martin and Britayev, 1998 and Sweden SMNH118976 JN852834 JN852866 JN852904 JN852935 (Tebble and Chambers, 1982) and burrows Pettibone, 1993) Melaenis loveni Facultative commensal Other polychaete tubes Svalbard SMNH118977 JN852835 JN852867 JN852905 JN852936 (Malmgren, 1866) (Hansson, 1998) Neopolynoe paradoxa Errant - Norway SMNH118978 JN852836 JN852868 JN852906 JN852937 (Anon, 1888) (Loshamn, 1981) Paradyte crinoidicola Polyxenous obligate commensal Papua New Crinoidea, Echinodermata SMNH118979 JN852837 JN852869 JN852907 JN852938 (Potts, 1910) (Martin and Britayev, 1998) Guinea Polynoe scolopendrina Polyxenous obligate commensal Terebellidae polychaeta England SMNH118981 JN852839 JN852870 JN852909 JN852940 (Savigny, 1822) (Martin and Britayev, 1998) Facultative commensal Corallium sp., Corallidae, Polyeunoa laevis (Martin and Britayev, 1998; SWIOR JC66_219_S001 – – KU738158 KU738210 (McIntosh, 1885) Octocorallia Barnich et al., 2012) Thouarella sp., Primnoidae, Polyeunoa laevis " Octocorallia SWIOR JC66_111 – – KU738159 KU738211

Polyeunoa laevis " Crinoidea, Echinodemata SWIOR JC66_477_S001 KU738176 KU738193 KU738160 KU738212 Polyeunoa laevis " Scleractinia, Hexacorallia SWIOR JC66_962_S001 KU738177 KU738194 KU738161 KU738213 Polyeunoa laevis " Primnoidae ind., Octocorallia SWIOR JC66_1005_S001 – KU738195 KU738162 –

Table 2. Species (authority), indicating their ecology, host for commensal species, origins, Identification code, and GenBank accession numbers. New sequences are set in bold. 136

8

137 2.3. DNA extraction and amplification

138 Approximately 30-50 mg of polychaete tissue was used for the DNA extraction. Samples 139 were previously preserved in ethanol and then frozen. Frozen tissue was aseptically 140 transferred to a 2ml snap-lock tube and a 2-3 mm sterile metal ball was added. The sample 141 was then snap frozen in liquid nitrogen and placed in the tissue lyser (Qiagen) for 2x 30Hz 142 for 30 sec, and repeated as necessary. Disrupted tissue was than suspended in lysis buffer

143 (100 mM Tris HCl pH 8.0, 150 mM NaCl2, 10 mM EDTA), mixed and incubated at room 144 temperature briefly. Sodium dodecyl sulfate was added to give a final concentration of 1% 145 and 100 µg/ml Proteinase K was also added. The tubes were mixed and incubated at 56 °C 146 for 30 mins. 5 M NaCl was added to give a 0.7 M final concentration and mixed thoroughly. 147 CTAB/NaCl (1%f/v) solution was added, mixed and incubated at 65 °C for 1 hour. An equal 148 volume of Chloroform Isoamyl alcohol (24:1) was added and mixed by repeated inversion for 149 30 seconds then centrifuged for 5 mins at 13,000 rpm. The aqueous phase was removed to a 150 clean tube and to this an equal volume of phenol chloroform isoamyl alcohol (25:24:1) was 151 added, mixed by repeated inversion for 30 secs and centrifuged for 5 mins. The aqueous 152 phase was removed to a clean 1.5 ml Eppendorf tube. These two steps were repeated as 153 necessary until the interface was clear. Isopropanol alcohol (100%) was added to 0.6% 154 volume mixed by inversion and the tubes were left to precipitate overnight. The precipitate 155 was collected by centrifugation at 13,000 rpm for 20 mins. The isopropanol was removed and 156 the pellet was washed with 70% ice cold ethanol, and centrifuged at 13,000 rpm for 5 mins. 157 This step was repeated again and the ethanol was then removed and the pellet dried in a DNA 158 Speed Vac (Savant) for 5 mins. The pellet was then re-suspended in 100 µl sterile dH2O. 159 Samples were stored at -20 °C. The oligonucleotide primers used to amplify 16SrRNA, 160 18SrRNA, 28SrRNA and COI mitochondrial genes are listed in Table 3. 161 The PCR was carried out on an MJ Research PTC200 DNA Engine thermocycler and used a 162 25 μl reaction containing a final concentration of 2x Taq master mix buffer (Qiagen) with 0.5 163 µM of each primer. Cycling parameters for 16S, 18S and 28S were as follows: 95 °C for 5 164 mins; 30 cycles of 95 °C for 10 sec; 50 °C for 30 sec; 72 °C for 1.5 mins followed by 72 °C 165 for 10 mins. Cycling parameters for COI sequences, using a ‘dropdown’ protocol, were as 166 follows: 95 °C for 5min, 10 cycles of 95 °C for 10 sec, 60 °C (-1°C per cycle) for 30 sec, 72 167 °C for 1.5 mins, 25 cycles of 95 °C for 10 sec, 50 °C for 30 sec, 72 °C for 10 mins.

9

168 PCR products were analysed by 0.8% (w/v) agarose gel electrophoresis using molecular 169 grade gel (BIOLINE). DNA was electrophoresed by applying a voltage of 5V/cm for 20 mins 170 and stained with 0.5 µl/ml of ethidium bromide and visualised on the Fluorchem FC2 gel 171 docking system (Alpha Innotech). Positive bands were identified and a total of 46 PCR 172 samples were sent for Sanger DNA sequencing (LGC Genomics, Berlin). 173 After receiving the MTP with PCR products LGC Genomics cleaned up the PCR reaction 174 using ExoSAP (ExonucleaseI and Shrimp Alkaline Phospatase) for 30 mins at 37°C. After 175 the clean-up, PCR fragments were checked on an agarose gel and from this the sample 176 volume used for cycle sequencing reaction was decided. For cycle sequencing (40 cycles) 177 LGC used LifeTech (ABI) BigDye 3.1 using the conditions recommended by the supplier. 178 For removing the unincorporated dyes LGC used 96 well clean-up plates (Sephadex gel bed) 179 from EMP Biotech (Berlin). The cleaned up samples were sequenced on ABI 3730XL 180 capillary sequencer. After sequencing run LGC transferred the data to a Linux computer 181 cluster where they did quality clipping using the pregap module of the Staden Package 182 (Roger Staden, Cambridge). 183 Gene Name Sequences Position Reference arL CGCCTGTTTATCAAAAACAT Palumbi (1996) 16S brH CCGGTCTGAACTCAGATCACGT Palumbi (1996) 18SA AYCTGGTTGATCCTGCCAGT 1-20 Medlin et al. (1988) 18S SEK5R ACCTTGTACGACTTTTACTTCCTC 1776-1800 Nygren and Sundberg (2003) F63.2 ACCCGCTGAAYTTAAGCATAT 1-21 Struck et al. (2006) 28S PO28R4 GTTCACCATCTTTCGGGTCCCAAC 1046-1069 Struck et al. (2006) COI-E TATACTTCTGGGTGTCCGAAGAATCA Bely and Wray, 2004 COI HCOI GGTCAACAAATCATAAAGATATTGG Folmer et al., 1994 CO-D TCNGGRTGNCCRAANARYCARAA Gambi et al., 2011

Table 3. PCR and sequencing primers. 184 185 2.4. Alignment and phylogenetic analysis

186 Initial alignments were undertaken using Clustal X with default settings in Geneious 6.1.7 187 (Biomatters Ltd.). Alignments were checked and edited by eye. Genbank Accession numbers 188 for new sequences are also indicated. The alignment was submitted to PartitionFinder 189 (Lanfear et al., 2012) to evaluate the best partition schemes and associated substitution

10

190 models under BIC criteria. Out of 96 schemes a 6-partition model was selected. That partition 191 was tested against user-defined alternative models (for example linking the first two codons 192 of the protein-coding COI gene in one partition); the 6-partition scheme (Table 4) retained the 193 highest scores under BIC.

194 Phylogenies were determined using Bayesian Inference performed in MrBayes 3.2.3 195 (Ronquist et al., 2012) on the CIPRES Web Portal v.1.15 (Miller et al., 2010). The GTR 196 model was selected in MrBayes as it corresponds most closely to the Tamiura-Nei model 197 selected by PartitionFinder. Using the models of evolution listed in Table 1, Meteropolis- 198 coupled Monte Carlo Markov Chains (MCMCMC) were run for 30 million generations (x8 199 chains, temp = 0.15) with trees samples every 1000 generations. The parameters of nucleotide 200 frequencies, substitution rates, gamma shape, and invariant-sites proportion were unlinked 201 across partitions. Convergence was obtained if the standard deviation of partition frequencies 202 was <0.01, the potential scale reduction factor PSRF was ~ 1.00, and the effective samples 203 sizes were >200 and the shape of the stationary posterior-distribution trace of each parameter 204 was a “straight hair caterpillar” (Drummond and Rambaut, 2007) when visualised in Tracer 205 v1.6 (Rambaut and Drummond, 2015). Twenty-five per cent of trees were removed as 206 burnin-in. Remaining trees were summarised into a 50% majority tree in MrBayes and rooted 207 using theoutgroup, Branchinotogluma sandersi (SMNH118960) (Norlinder et al., 2012).

Gene and codon position Partition delineation Best fit model of evolution Model implemented in (1st, 2nd, 3rd) MrBayes COI – 1st 1-588\3 SYM+G SYM+G COI – 2nd 2-588\3 F81 F81 COI – 3rd 3-588\3 TrN+I+G GTR+I+G 16S 589-1012 GTR+I+G GTR+I+G 18S 1013-2704 TrN+I+G GTR+I+G 28S 2705-3626 GTR+I+G GTR+I+G

Table 4. Alignment information and models of evolution 208

209 3. Results

210 The different life history strategies of the Polynoinae have evolved several times. Obligate 211 commensalism was spread across four different clades (Fig. 3, clades A, B, C and D). Clade 212 A (Bayesian posterior probability (BPP) of 1), included G. clavigera and P. crinoidicola, and 213 clade B (BPP= 1), incorporated A. squamosa and P. scolopendrina, both clades being basal in 214 our analysis. All the other species analysed were found in two major sister clades

11

215 characterised by obligate commensal species (clade C, BPP=1) and mostly facultative 216 commensal and errant species (clade D, BPP=0.74), including the new data of the free-living 217 species of Harmothoe species (clade E, BPP=0.96) (species photo in Appendix A.1).

218 Clade C, included Anthipathipolyeunoa sp., Gorgoniapolynoe caeciliae, G. corralophila, all 219 found as obligate commensal on corals (clade Ca, BPP=0.98) and, on a sister group, 220 Brychionoe sp. (JC66_113_S001), found in a commensal relationship with the ophiuroid 221 Gorgonocephalus sp. (Appendix A.2).

222 The new species of Eunoe (JC66_496_S001), found in association with a holothurian, 223 grouped in clade D (BPP= 0.74) within facultative commensals and errant species. Despite 224 their taxonomical differences (Appendix A.3 and A.4), this species of Eunoe was placed in a 225 sister group (BPP= 1) with P. laevis, a facultative commensal.

226 Polyxenous obligate commensal species associated to corals (clade Ca, BPP= 0.96) appear to 227 be monophyletic regardless their morphological differences (e.g. short- and long-bodied 228 polynoid species, Appendix A.5, A.6 and A.7). Clade Ca, supports the similarity (distance ~ 229 0.01) of the two congeneric Gorgoniapolynoe species, G. caeciliae and G. corralophila, 230 found associated with octocoral and hydrocoras hosts, respectively (Table 1) (Appendix A.6 231 and A.7).

12

232 4 Discussion

233 Little is known about the life history and commensal/symbiotic relationships for most species 234 occurring in deep waters. Historically, it was known that deep-water gorgonians often hosted 235 ophiuroids and anemones attached to their surface. However, deep waters have traditionally 236 been sampled by non-selective gears (e.g. trawling) that would result in the dislodgement of 237 the majority of commensal specimens from their hosts. Only the recent use of remote 238 operated vehicles, allowed targeting specific deep-water habitats and species. This may partly 239 explain why the average number of known coral obligate symbionts is two times higher in 240 shallow than in deep water (Buhl-Mortensen and Mortensen, 2004). There are, however, 241 others drivers that could affect this pattern, such as higher food supply in the vicinity of 242 shallow water coral reefs and the contrasting larval dispersal vs. patchy distribution in deep- 243 waters (Buhl-Mortensen et al, 2010).

244 The ability to live in a variety of habitats and substrates (e.g. facultative commensal and free- 245 living species) could represent an ecological adaptation to ensure a higher successful 246 dispersal rate for species with short larval periods (Buhl-Mortensen and Mortensen, 2004). 247 However, many marine benthic species have complex life cycles that include a pelagic larval 248 stage and sessile adults (Strathmann, 2007; Pineda et al., 2010). Hence, to understand their 249 larval dispersal it is not just necessary to know their biology, but also the hydrodynamics of 250 the area they inhabit and the distribution deep-water habitats (Hilário et al., 2015).

251 To the best of our knowledge this is the first attempt to approach the behavioural strategies of 252 the polynoidae from a phylogenetic point of view. Within the sub-family Polynoinae, 253 different life histories have evolved multiple times. The obligate commensal species 254 Gastrolepidia clavigera (on holothurians) and Paradyte crinoidicola (on crinoids) from clade 255 A and Acholoe squamosa (on asteroids) and Polynoe scolopendrina (on polychaetes) from 256 clade B separated earlier from the other Polynoinae species. These obligate associations led 257 to the evolution of unique morphologic adaptations: G. clavigera has ventral sucker-like 258 lobes, whilst P. crinoidicola bears ventral hooks (modified setae), both to hold on to their 259 hosts.

260 Acholoe squamosa is often found on many asteroid species (Barel and Kramers, 1977), 261 showing one of the highest prevalence (75-100%) and intensity among commensal 262 polychaetes (Martin end Britayev, 1998). Interestingly, this species is only able to recognise

13

263 its starfish host when adjacent to it (Davenport, 1953a), which is obviously adequate for 264 shallow waters but not for the deep sea, where the generally low abundances and large 265 distances between suitable habitats tend to reduce the probability of meeting the symbiont 266 with its potential hosts. Polynoe scolopendrina was more selective in choosing the host 267 species than A. squamosa (Davenport, 1953b). However, these conclusions proved to be 268 controversial and more observations are required as each commensal species population can 269 have different prevalence also affected by bathymetric, spatial and temporal variability 270 (Martin and Britayev, 1998). 271 The relationships of the species of Arctonoe (A. vittata, A. fragilis and A. pulchra) with their 272 hosts are other examples of obligate commensalism that is also often referred as a mutualism 273 due to the fact that both the host and the symbiont obtain benefits from the association 274 (Martin and Britayev, 1998). Unfortunately, to date, there are only COI sequences for these 275 species: the COI gene tree (Appendix B) showed a well-defined distinct clade for this genus. 276 However, it was not possible to resolve the phylogenetic relationships with other polynoids, 277 as they are mostly embedded in a large polytomy. 278 279 All other species analysed clustered in two major sister clades including obligate commensal 280 species (clade C) and mostly facultative commensal and free-living species (clade D). Clade 281 ‘Ca’ was particularly interesting because it includes obligate commensal species living on 282 deep-water coral hosts with, despite their morphologic differences (e.g. short- and long- 283 bodies, Appendix A.5, A.6 and A.7), pointing on a possible monophyletic origin. The fact 284 that, in some cases, commensal species responded positively to several taxonomically close 285 hosts (Table 2) could suggest a possible biochemical similarity within both the hosts and the 286 symbionts. We could hypothesise that this genetic similarity in response is driven by the 287 diffusion of “host factors” that, in mutualistic relationships, are very likely responsible for the 288 host recognition by the symbionts, either the migrating or relocating adults or the larvae 289 during settlement (Martin and Britayev, 1998 and references therein). 290 291 Brychionoe sp. (JC66_113_S001), found associated with the ophiuroid Gorgonocephalus sp. 292 (Appendix A.2), was placed within clade C. Taking into account that other congeneric deep- 293 sea species are commensals (Hanley and Burke, 1991), we strongly suggest this species to be 294 an obligate commensal.

14

295 Most commensal relationships we recorded in our study can also be considered 296 kleptoparasitic (Mortensen, 2001) referring to the fact that the worms are stealing the food 297 captured by the coral polyps or branches. However, they also exhibit mutualistic behaviour, 298 since they clean the coral surface and attack invading mobile organisms (Mortensen, 2001). 299 The feeding relationships of parasitic, commensal and mutualistic symbionts with their host 300 is another interesting ecological issue. One of the most remarkable examples of camouflage 301 among marine invertebrates is represented by parasitic gastropods that show adaptations to 302 mimic colour patterns of their hosts (Schiaparelli et al., 2005). In this latter case the 303 homochromy is a result of alimentary behaviour where the symbiont is feeding on the hosts 304 tissues (Fehse, 2001). Branchiosyllis exilis is another example of this behaviour among 305 polychaetes (Martin end Britayev, 1998). Cases of aposematic colouration have been 306 previously noted showing different colour patterns between facultative commensal and free- 307 living polychaetes within the same species (Martin end Britayev, 1998) and also between the 308 same species associated with different hosts. This could be the case Gorgoniapolynoe 309 caeciliae collected in this study showing phenotypical colour differences when associated 310 with Candidella or Acanthogorgia coral species (Appendix A.6). However, this 311 heterochromia was not found on G. caeciliae associated with Corallium sp. and Isididae 312 corals. Several species of Gorgonyapolynoe live inside tunnels or galleries formed by highly 313 modified sclerites of primnoid corals or by an overgrowing of the coenenchymal walls of 314 hydrocoral and gorgonian hosts, which seem to have been caused by the presence of the 315 commensals (Bayer, 1964; Pettibone, 1991a; Eckelbarger et al., 2005; Barnich et al., 2013; 316 Britayev et al., 2014). For these species, it has been hypothesised that the commensal 317 behaviour coupled with high prevalence and wide distribution on the same host (e.g. 318 Gorgoniapolynoe species) can also facilitate successful reproduction (Martin and Britayev, 319 1998; Eckelbarger et al., 2005). This conclusion also reinforces the hypothesis of the possible 320 existence of several commensal “sub-populations”, genetically preadapted to each 321 appropriate host species (Martin and Britayev, 1998).

322 The undescribed species of Eunoe (JC66_496_S001) was found in association with the 323 recently described holothurian Pannychia taylorae (O'Loughlin et al., 2013) (Appendix A.3). 324 This species was placed in a polytomy with free-living and facultative commensal species 325 (clade D). We inferred their potential obligate commensal behaviour from other published 326 data on congeneric species involved in similar associations (Martin and Britayev, 1998;

15

327 Schiaparelli et al., 2010; Shields et al., 2013). However, only two specimens on a single host 328 were sampled and, therefore, more data are necessary for a full assessment. It is interesting to 329 note that the other species of Eunoe (E. nodosa in Fig. 3) was well separated from the Eunoe 330 sp.. However, this was also the case of many other Eunoe species in the COI phylogenetic 331 tree (highlighted in Appendix B), as the genera Eunoe, Harmothoe and Gattyana are often 332 clustering together. These results confirm the complex relationships between this genera both 333 from taxonomical and molecular points of view (Barnich and Fiege, 2003; Norlinder et al., 334 2012) and suggests the need of a taxonomy revision. Moreover, in the COI phylogenetic tree 335 (Appendix B), Eunoe sp. groups together with the congeneric Eunoe bathydomus (Ditlevsen, 336 1917) (as Harmothoe bathydomus in Appendix B); a species also found in association with 337 holothurians on the Mid-Atlantic Ridge (Shields et al., 2013). Similarly to the two Eunoe 338 specimens found on Pannychia taylorae, Shields et al. (2013) recovered two specimens of E. 339 bathydomus from a single holothurian host, while previously only one polynoid per 340 holothurian host was reported (Wesenberg-Lund 1941; Kirkegaard and Billet 1980; 341 Schiaparelli et al. 2010). The occurrence of isolated heterosexual pairs on the same host 342 individual could facilitate the reproduction of these symbionts, especially in the deep sea. 343 Similar findings have been also reported for several crustaceans and a few commensal 344 species of Polynoidae such as Bathynoe cascadiensis (Ruff, 1991) (associated with the 345 starfish Astrocles actinodetus (Fisher, 1917) and Astrolirus panamensis (Ludwig, 1905)), 346 Robertianella synophthalma (McIntosh, 1885) (living in atrial cavities of deep-water 347 hexactinellid sponges of the genus Hyalonema) and G. clavigera (associated with tropical 348 holothuroids) (Martin and Britayev, 1998 and references therein). The relationships of 349 polynoids with holothurian hosts has been considered as kleptoparasitism when the 350 commensal is found close to the host mouth (e.g. Gastrolepidia clavigera), but also as 351 hitchhiking, particularly in relation with reproduction and population dispersion (Schiaparelli 352 et al. 2010).

353 Our specimens of Polyeunoa laevis clustered within clade D. This species is known as a 354 facultative commensal, able to live on several hosts and substrates (Barnich et al., 2012). 355 Polyeunoa laevis is widely distributed in the southern oceans, especially around Antarctica. 356 However, recent studies highlighted the existence of previously unrecognized cryptic 357 lineages and high variability of morphospecies (Barnich et al., 2012; Alvaro et al., 2014). It is 358 interesting to note that our five specimens, all collected on Coral seamount and associated

16

359 with different hosts/substrates (Table 1), had COI gene sequences (highlighted in Appendix 360 B) closely related to an undetermined polynoid larva and another species of P. laevis, both 361 collected in the Ross Sea (GenBank ID GU227131 and KF713377). This underlines the 362 importance of identifying the phylogeographic relationships and distributional patterns of this 363 species (Alvaro et al., 2014). Accordingly, our newly collected specimens could contribute to 364 clarify the taxonomy of this postulated species complex, as well as to assess their 365 phylogeographic evolution.

366 Our study is a preliminary attempt to investigate the potential phylogenetic relationships 367 between symbiotic and free-living species within the polychaete family Polynoidae. 368 However, to assess the possible role of behaviour in speciation processes, more symbiotic 369 species associated to a wider range of hosts, as well as more numerous representatives of the 370 free-living species, need to be analysed using multiple gene sequencing.

371 Acknowledgements

372 Our research was funded by the NERC under the SWIOR project (grant reference: 373 NE/f005563/1). Our thanks go to the captain and the crew of the research vessel ‘James 374 Cook’ and to the GeoMar ROV Kiel 6000 team who collected most of the samples here 375 analysed. Special thanks go also to our colleagues Dr Philipp Boersch-Supan (University of 376 South Florida) and Dr Tom Letessier (Zoological Society of London) whom contributed to 377 drawing the study area map. We also thank the two anonymous reviewers for their great 378 contributions that helped to improve the earlier version of this manuscript. The photos on the 379 Appendix A have been created using the Alan Hadley, Combine Z5 domain image processing 380 software.

381 References 382 383 Alvaro, M.C., Barnich, R., Modica, M.V., Barco, A., Oliverio, M. and Schiaparelli S., 2014. 384 Phylogenetic relationships and phylogeography in Antarctic symbiotic polyxenous 385 polychaetes. . XXXIII SCAR Biennial Meetings and Open Science Conference, Auckland, 386 Agosto 2014. 387 388 Barel, C.D.N. and Kramers, P.G.N., 1977. A survey of the echinoderm associates of the 389 North-EastAtlantic area. Zoologische Verhandelingen. Leiden, 156, 1–159.

17

390 391 Barnich, R., Beuck, L. and Freiwald, A., 2013. Scale worms (Polychaeta: Aphroditiformia) 392 associated with cold-water corals in the eastern Gulf of Mexico. Journal of the Marine 393 Biological Association of the United Kingdom, 93 (8), 2129–2143. 394 395 Barnich, R. and Fiege, D., 2003. The Aphroditoidea (Annelida, Polychaeta) of the 396 Mediterranean Sea, Abhandlungen der Senckenbergischen Naturforschenden Gesellschaft, 397 559, 1–167. 398 399 Barnich, R. and Fiege, D. 2009. Revision of the genus Harmothoe Kinberg, 1856 400 (Polychaeta: Polynoidae) in the Northeast Atlantic. Zootaxa 2104, 1–76. 401 402 Barnich, R. and Fiege, D., 2010. On the distinction of Harmothoe globifera (G.O. Sars, 1873) 403 and some other easily confused polynoids in the NE Atlantic, with the description of a new 404 species of Acanthicolepis Norman in McIntosh, 1900 (Polychaeta, Polynoidae). Zootaxa, 405 2525, 1–18. 406 407 Barnich, R., Gambi. M.C. and Fiege, D., 2012. Revision of the genus Polyeunoa McIntosh, 408 1885 (Polychaeta, Polynoidae). Zootaxa, 3523, 25–38. 409 410 Bayer, F. M. (1964). The genus Corallium (Gorgonacea: Scleraxonia) in the western North 411 Atlantic ocean. Bulletin of Marine Science of the Gulf and Caribbean, 14, 465–478. 412 413 Bely, A.E. and Wray, G.A., 2004. Molecular phylogeny of naidid worms (Annelida: 414 Clitellata) based on cytochrome oxidase I. Molecular Phylogenetics and Evolution, 30, 50– 415 63. 416 417 Buhl-Mortensen, L. and P.B., Mortensen, 2004. Symbiosis in Deep-Water Corals. Symbiosis, 418 37, 33–61. 419 420 Buhl-Mortensen, L., Vanreusel, A., Gooday, A.J., Levin, L.A., Priede, I.G., Buhl- 421 Mortensen, P., Gheerardyn, H., King, N.J. and Raes, M. 2010. Biological structures as a

18

422 source of habitat heterogeneity and biodiversity on the deep ocean margins. Marine 423 Ecology, 31, 21–50. 424 425 Britayev, T.A., Gil, J., Altuna, A., Calvo, M. and Martin D., 2014. New symbiotic 426 associations involving polynoids (Polychaeta, Polynoidae) from Atlantic waters, with 427 redescriptions of Parahololepidella greeffi (Augener, 1918) and Gorgoniapolynoe caeciliae 428 (Fauvel, 1913). Memoirs of Museum Victoria, 71, 27–43. 429 430 Davenport, D., 1953a. Studies in the physiology of commensalism. III. The polynoid genera 431 Acholoe, Gattyana, and Lepidastenia. Journal of the Marine biological Association of the 432 United Kingdom, 32, 161–173. 433 434 Davenport, D., 1953b. Studies in the physiology of commensalism. IV. The polynoid genera 435 Polynoe, Lepidasthenia and Harmothoe. Journal of the Marine biological Association of the 436 United Kingdom, 32, 273–288. 437 438 Ditlevsen H., 1917. Annelids. I. The Danish Ingolf Expedition 4. Copenhagen: Bianco Luno, 439 1–71. 440 441 Drummond, A. and Rambaut, A., 2007. BEAST: Bayesian evolutionary analysis by sampling 442 trees. BMC Evolutionary Biology, 7, 1–8. 443 444 Eckelbarger, K.J., Watling, L. and Fournier, H., 2005. Reproductive biology of the deep-sea 445 polychaete Gorgoniapolynoe caeciliae (Polynoidae), a commensal species associated with 446 octocorals. Journal of the Marine Biological Association of the United Kingdom, 86 (6), 447 1425–1433. 448 449 Fauchald, K., 2015. Bylgides sarsi (Kinberg in Malmgren, 1866). In: Read, G.; Fauchald, K. 450 (Ed.) (2015) World Polychaeta database. Accessed through: World Register of Marine 451 Species at http://www.marinespecies.org/aphia.php?p=taxdetails&id=130735 on 2015-10-13 452

19

453 Fehse, D., 2001. Beiträ ge zur Kenntnis der Ovulidae (Mollusca: Cypraeoidea). VIII. 454 Einleitung zur Familie sowie Katalog, Taxonomie und Bibliographie und Bemerkungen zu 455 verwandten Gruppen. Acta Conchyliorum, 5, 1–51. 456 457 Fiege, D. and Barnich, R., 2009. Polynoidae (Annelida: Polychaeta) associated with cold- 458 water coral reefs of the northeast Atlantic and Mediterranean Sea. Zoosymposia, 2, 149–164. 459 460 Folmer, O., Black, M., Hoeh, W., Lutz, R. and Vrijenhoek, R., 1994. DNA primers for 461 amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan 462 invertebrates. Molecular marine biology and biotechnology, 3, 294–299. 463 464 Gambi, M.C., Schulze, A. and Amato, E., 2011. Record of Lamellibrachia sp. (Annelida: 465 Siboglinidae: Vestimentifera) from a deep shipwreck in the western Mediterranean Sea 466 (Italy). Marine Biodiversity Records, 4:e24. 467 468 Hanley, R.J. and Burke, M., 1991. A new genus and species of scaleworm (Polycheta: 469 Polynoidae) from the Cascade Plateau, Tasman Sea. The Beagle, Records of the Northern 470 Territory Museum of Arts and Sciences, 8(1), 97–102. 471

472 Hansson, H.G., 1998. NEAT (North East Atlantic taxa); South Scandinavian marine 473 Annellida Checklist. Internet pdf Ed., 1998. [http://www.tmbl.gu.se], pp. 40.

474 475 Hilário, A., Metaxas, A., Gaudron, S.M., Howell, K.L., Mercier, A., Mestre, N.C., Ross, R.E. 476 Thurnherr, A.M. and Young, C., 2015. Estimating dispersal distance in the deep sea: 477 challenges and applications to marine reserves. Frontiers in Marine Science, 2 (6), 1–14. 478 479 Kirkegaard, J.B. and Billet, D., 1980. Eunoe laetmogonensis, a new species of polynoid 480 worm, commensal with the bathyal holothurian Laetmogone violacea, in the north-east 481 Atlantic. Steenstrupia, 6, 101–109. 482

20

483 Lanfear, R., Calcott, B., Ho, S.Y.W. and Guindon, S., 2012. PartitionFinder: Combined 484 Selection of Partitioning Schemes and Substitution Models for Phylogenetic Analyses. 485 Molecular Biology and Evolution, 29, 1695–1701. 486 487 Letessier, T.B., De Grave, S., Boersch-Supan, P.H., Kemp, K.M., Brierley, A.S. and Rogers, 488 A.D., 2015. Seamount influences on mid-water shrimps (Decapoda) and gnathophausiids 489 (Lophogastridea) of the South-West Indian Ridge. Deep Sea Research II. 490 doi:10.1016/j.dsr2.2015.05.009 491 492 Loshamn, A.A., 1981. Descriptions of five polynoid species (Polychaeta) from the coasts of 493 Norway and Sweden, including three new species, one new genus and one new generic name. 494 Zoologica Scripta, 10, 5–13. 495 496 Martin, D. and Britayev, T.A. 1998. Symbiotic polychaetes: review of known species. 497 Oceanography and Marine Biology: an Annual Review, 36, 217–340. 498 499 Martin, D., Rosell, D. and Uriz, M.J. 1992. Harmothoe hyalonemae sp. nov. (Polychaeta, 500 Polynoidae), an exclusive inhabitant of different Atlanto-Mediterranean species of 501 Hyalonema (Porifera, Hexactinellida). Ophelia 35, 169–185. 502 503 Medlin, L., Elwood, H.J., Stickel, S. and Sogin, M.L., 1988. The characterization of 504 enzymatically amplified eukaryotic 16S-like rRNA-coding regions. Gene, 71, 491–499. 505 506 Miller, M.A., Pfeiffer, W. and Schwartz T. 2010. Creating the CIPRES Science Gateway for 507 inference of large phylogenetic trees. Proceedings of the Gateway Computing Environments 508 Workshop (GCE). Institute of Electrical and Electronics Engineers (IEEE), Washington, 509 District of Columbia, 1–8. 510 511 Mortensen, P.B., 2001. Aquarium observations on the deep-water coral Lophelia pertusa (L., 512 1758) (Scleractinia) and selected associated invertebrates. Ophelia, 54, 83–104. 513 514 Norlinder, E., Nygren, A., Wiklund, H. and Pleijel, F., 2012. Phylogeny of scale-worms 515 (Aphroditiformia, Annelida), assessed from 18SrRNA, 28SrRNA, 16SrRNA, mitochondrial

21

516 cytochrome c oxidase subunit I (COI), and morphology. Molecular Phylogenetics and 517 Evolution, 65,490–500. 518 519 Nygren, A. and Sundberg, P., 2003. Phylogeny and evolution of reproductive modes in 520 Autolytine (Syllidae, Annelida). Molecular Phylogenetics and Evolution, 29, 235–249. 521 522 O’Loughlin, P.M., Mackenzie, M. and VandenSpiegel, D., 2013. New sea cucumber species 523 from the seamounts on the Southwest Indian Ocean Ridge (Echinodermata: Holothuroidea: 524 Aspidochirotida, Elasipodida, Dendrochirotida). Memoirs of Museum Victoria, 70, 37–50. 525 526 Palumbi, S.R., 1996. Nucleic acid II: the polymerase chain reaction. In: Hillis, D.M., Mable, 527 B.K. (Eds.), Mol. Syst. Sinauer Associates, Sunderland, MA, pp. 205–247. 528 529 Pettibone, M.H., 1991a. Polynoids commensals with gorgonian and stylasterid corals, with a 530 new genus, new combinations, and new species (Polychaeta; Polynoidae; Polynoinae). 531 Proceedings of the Biological Society of Washington, 104, 688–713. 532 533 Pettibone, M.H., 1991b. Polynoid polychaetes commensal with antipatharian corals. 534 Proceedings of the Biological Society of Washington, 96, 714–726. 535 536 Pettibone, M.H., 1993. Scaled Polychaetes (Polynoidae) Associated with Ophiuroids and 537 Other Invertebrates and Review of Species Referred to Malmgrenia McIntosh and Replaced 538 by Malmgreniella Hartman, with Descriptions of New Taxa. Smithsonian Contributions to 539 Zoology, 538, 1–92. 540 541 Pineda, J., Porri, F., Starczak, V. and Blythe, J., 2010. Causes of decoupling between larval 542 supply and settlement and consequences for understanding recruitment and population 543 connectivity. Journal of Experimental Marine Biology and Ecology, 392, 9–21. 544 545 Rambaut, A. and Drummond, A., 2015. Tracer v1.6. 546 547 Read, J. and Pollard, R., 2015. An introduction to the physical oceanography of six 548 seamounts in the southwest Indian Ocean. Deep-Sea Res. II.

22

549 http://dx.doi.org/10.1016/j.dsr2.2015.06.022. 550 551 Rogers, A.D. and Taylor, M.L., 2011. RRS James Cook Cruise JC067. Cruise Report JC066 552 (JC067). 553 https://www.bodc.ac.uk/data/information_and_inventories/cruise_inventory/report/10593. 554 555 Ronquist, F., Teslenko, M., van der Mark, P., Ayres, D.L., Darling, A., Höhna, S., Larget, B., 556 Liu, L., Suchard, M.A. and Huelsenbeck, J.P., 2012. MrBayes 3.2: Efficient Bayesian 557 Phylogenetic Inference and Model Choice across a Large Model Space. Systematic Biology, 558 61, 539–542. 559 560 Schiaparelli, S., Alvaro, M.C., Bohn, J. and Abertelli G., 2010. ‘Hitchhiker’ polynoid 561 polychaetes in cold deep waters and their potential influence on benthic soft bottom food 562 webs. Antarctic Science, 22(4), 399–407. 563 564 Schiaparelli, S., Barucca, M., Olmo, E., Boyer, M. and Canapa A., 2005. Phylogenetic 565 relationships within Ovulidae (Gastropoda: Cypraeoidea) based on molecular data from the 566 16S rRNA gene. Marine Biology, 147, 411–420. 567 568 Shields, M.A. Glover A.G. and Wiklund, H., 2013. Polynoid polychaetes of the Mid-Atlantic 569 Ridge and a new holothurian association. Marine Biology Research, 9 (5-6), 547–553. 570 571 Strathmann, R.R., 2007. Three functionally distinct kinds of pelagic development. Bulletin of 572 Marine Science, 81, 167–179. 573 574 Struck, T.H., Purschke, G. and Halanych, K., 2006. Phylogeny of Eunicida (Annelida) and 575 exploring data congruence using Partition Addition Bootstrap Alteration (PABA) approach. 576 Systematic Biology, 55, 1–20. 577 578 Van Guelpen, L., Pohle, G., Vanden Berghe, E. and Costello M.J., 2005. Marine Species 579 Registers for the North Atlantic Ocean. World Wide Web electronic publication. 580 http://www.marinebiodiversity.ca/nonNARMS/, version 1.0/2005 581

23

582 Wesenberg-Lund E., 1941. Notes on Polychaeta I. 1. Harmothoe bathydomus H. Ditlevsen 583 refound. Videnskabelige Meddelelser fra Dansk naturhistorisk Forening i Köbenhavn, 105, 584 31–32. 585 586 Wiklund, H., Nygren, A., Pleijel, F. and Sundberg, P., 2005. Phylogeny of Aphroditiformia 587 (Polychaeta) based on molecular and morphological data. Molecular Phylogenetics and 588 Evolution, 37, 494–502. 589

590 Figure captions

591 Fig. 1. Map highlighting the locations of five seamounts visited during the RRS James Cook 592 JC066 cruise, where most sampling was undertaken (modified figure from Letessier et al., 593 2015).

594 Fig. 2. Bathymetry maps of the four seamounts showing the location of each sample 595 collection. For sake of clarity, hosts species were shown only when multiple specimens of the 596 same symbiotic species were collected on the same seamount (see details in table 1).

597 Fig. 3 Concatenated phylogenetic tree for the COI, 16SrRNA, 18SrRNA, and 28SrRNA 598 genes showing the phylogenetic relationships between polynoid species (symbiotic and free- 599 livin) with available sequences (newly obtained and extracted from GenBank). Bayesian 600 Posterior Probabilities values are shown. Scale bar, 0.02 substitutions per nucleotide position. 601 NCBI GenBank sequences that were included have species name following by the vouchers 602 when available. The Polynoinae species names are colour and symbol coded: blue (triangle) 603 for obligate commensals, green (star) for facultative commensals and purple (diamond) for 604 errant species.

605

24

Appendix A

1. Harmothoe sp. (JC66_3755_S001 - JC66_823_S001)

2. Brychionoe sp. (JC66_113_S001)

on the ophiuroid Gorgonocephalus sp.

3. Eunoe sp. (JC66_496_S001)

on the holothurian Pannychia taylorae

4. Polyeunoa laevis (JC66_111)

5. Antipathipolyeunoa sp. on black coral (JC066_ 3760)

6. Gorgoniapolynoe caeciliae (JC066_ 804 - JC066_ 104 - JC66_4277)

on Acanthogorgia sp. Candidella imbricata Candidella on

sp. Candidella Candidella on on Acanthogorgia sp.

7. Gorgoniapolynoe corralophila (JC66_3559)

on hydrocorals_stylasteridae

JN852947_Nereis_pelagica_voucher_SMNH118992 GQ473645_Branchipolynoe_symmytilida_isolate_Bsym326 GQ473646_Branchipolynoe_symmytilida_isolate_Bsym327 0.690.69GQ473648_Branchipolynoe_symmytilida_isolate_Bsym329 GQ473647_Branchipolynoe_symmytilida_isolate_Bsym328 JN852923_Branchinotogluma_sandersi_voucher_SMNH118960 JN852939_Paralepidonotus_ampulliferus_voucher_SMNH118980 0.66 JN852922_Thermiphione_sp_EN_2012_voucher_SMNH118982 0.26GU672506_Lepidonotus_squamatus_voucher_WS0197_ 0.6 GU672507_Lepidonotus_squamatus_voucher_WS0198_ 1.24 HM473443_Lepidasthenia_berkeleyae_voucher_BIOUGCANBAMPOL0272 JN852940_Polynoe_scolopendrina_voucher_SMNH118981_ HM473462_Malmgreniella_nigralba_voucher_BIOUGCANBAMPOL0034 0.53 GU227143_Cf_Polynoidae_sp_DH_2009_isolate_42M_ 0.32 KF713373_Antarctinoe_ferox_voucher_Polychaeta1F8_St_95 0.28GU227137_Cf_Polynoidae_sp_DH_2009_isolate_44M_ JN852927_Gastrolepidia_clavigera_voucher_SMNH118964 0.49 AY583698_Paralepidonotus_ampulliferus_AMW196405_ HM473308_Arctonoe_pulchra_voucher_BAMPOL0483 0HM473314_Arctonoe_pulchra_voucher_BIOUGCANBAMPOL0489 1.08 0.09HM473725_Arctonoe_cf_fragilis_CMC_2010_voucher_OM21 0.08HM473320_Arctonoe_vittata_voucher_BAMPOL0178 0.1 0.07HM473726_Arctonoe_cf_vittata_CMC_2010_voucher_OD131 HM473318_Arctonoe_vittata_voucher_BAMPOL0051_ 0.52 HM473299_Arctonoe_fragilis_voucher_BAMPOL0001 0.09HM473300_Arctonoe_fragilis_voucher_BAMPOL0389 JN852935_Malmgreniella_mcintoshi_voucher_SMNH118976 JF905688_Polynoidae_environmental_sample_clone_R2P2DgCO1041510C12 0.47 JN852930_Harmothoe_impar_voucher_SMNH118968_ GQ478987_Harmothoe_imbricata_isolate_spm_57_ Polyeunoa laevis_JC066_219_S001 0.18Polyeunoa laevis_JC066_111 0.43 0.17Polyeunoa laevis_JC066_962_S001 0.21 Polyeunoa laevis_JC066_477_S001 0.18Polyeunoa laevis_JC066_1005_S001 0.32 0.2 GU227131_Cf_Polynoidae_sp_DH_2009_isolate_E3trocho04 0.19KF713377_Polyeunoa_laevis_voucher_Polychaeta1H9_St95 0.97 Eunoe sp_JC066_496_S001 0.49 0.29 JX119015_Harmothoe_bathydomus_voucher_NHMUK201211 JN852924_Bylgides_elegans_voucher_SMNH118962 0.18 JN852925_Bylgides_sarsi_voucher_SMNH118961 0.13 HQ024272_Bylgides_groenlandicus_voucher_CCPOL307 0.24 HM417792_Bylgides_sp_BOLDAAI3805_voucher_BIOUGCANWS0127 0.42 HQ024273_Bylgides_promamme_voucher_NUNAV0268 JN852929_Harmothoe_glabra_voucher_SMNH118967_ HQ023870_Enipo_sp_CMC01_voucher_TBLABR_056_ 0.68 0.54 0.43 HQ023480_Enipo_torelli_voucher_07PROBE_05308 0.76 0.62 HQ024360_Harmothoe_rarispina_CMC03_voucher_BIOUGCANNUNAV_0187 0.31HQ024059_Harmothoe_rarispina_CMC03_voucher_HUNTSPOL0155_ JX503009_Eunoe_oerstedi_isolate_PhB172_ 0.32 HQ024020_Eunoe_oerstedi_CMC02_voucher_HUNTSPOL0386 1.39 0.2 HM473744_Eunoe_spinicirris_voucher_OD90_ 0.38 HM473745_Gattyana_ciliata_voucher_OM171_ 0.18HM473746_Gattyana_ciliata_voucher_OM172_ 0.31 HQ024300_Eunoe_nodosa_CMC01_voucher_NUNAV_0118 0.47 0.44 0.18HQ024302_Eunoe_nodosa_CMC02_voucher_BIOUGCANNUNAV_0261 GU672612_Gattyana_cirrhosa_voucher_WS0070_ 0.58 0.35 HM473794_Polynoidae_sp_CMC07_voucher_BEST_104 0.32 GU672348_Eunoe_sp_BOLDAAG5099_voucher_BIOUGCAN09PROBE_01105 0.26GU672336_Eunoe_sp_BOLDAAG5099_voucher_BIOUGCAN09PROBE_02039 0.27HM473788_Polynoidae_sp_CMC06_voucher_BEST_28 HM473407_Harmothoe_fragilis_voucher_BIOUGCANBAMPOL0417 0.24 HQ023881_Harmothoe_sp_CMC01_voucher_TBLABR_012 0.42 0.29HM473732_Eunoe_depressa_voucher_OM122_ 0.29HM473734_Eunoe_depressa_voucher_OM134_ 0.3HM473733_Eunoe_depressa_voucher_OM133_ HM473731_Eunoe_depressa_voucher_OD152_ HM473329_Bylgides_macrolepidus_voucher_BIOUGCANBC015 JN852936_Melaenis_loveni_voucher_SMNH118977_ 0.89 0.56 JN852937_Neopolynoe_paradoxa_voucher_SMNH118978_ 0.53 GU227139_Cf_Polynoidae_sp_DH_2009_ 1.69 KF713382_Polynoidae_sp_RG_2014 JN852938_Paradyte_crinoidicola_voucher_SMNH118979 Antipathipolyeunoa sp_JC066_ 3760 Gorgoniapolynoe caeciliae_JC066_ 104 0.58 0.37Gorgoniapolynoe caeciliae_JC066_ 804 0.36Gorgoniapolynoe caeciliae_JC066_4277 0.53 Gorgoniapolynoe corralophila_JC066_3219_S001 0.46 Gorgoniapolynoe corralophila_JC066_133_S001 0.43Gorgoniapolynoe corralophila_JC066_3559 0.42Gorgoniapolynoe corralophila_JC066_4279_S001 JN852932_Hyperhalosydna_striata_voucher_SMNH118971_ 0.58 JN852933_Lepidasthenia_elegans_voucher_SMNH118973 0.47 JN852934_Lepidonotus_clava_voucher_SMNH118974 JX503012_Hermilepidonotus_helotypus_isolate_PhB168 0.28JX503010_Hermilepidonotus_helotypus_isolate_PhB170 0.58 JX503011_Hermilepidonotus_helotypus_isolate_PhB169 HM473406_Halosydna_brevisetosa_voucher_BIOUGCANBAMPOL0538 0.68 JN852931_Hermenia_verruculosa_voucher_SMNH118970_ JN852941_Thormora_jukesii_voucher_SMNH118983_ JX119016_Macellicephala_violacea_voucher_NHMUK201212_ JN852921_Iphione_sp_EN-2012_voucher_SMNH118972_ EU555053_Bhawania_heteroseta_

0.2