Hexokinase 2 Is Targetable for HK1 Negative, HK2 Positive Tumors from a Wide Variety of Tissues of Origin

Journal of Nuclear Medicine, published on August 30, 2018 as doi:10.2967/jnumed.118.212365

Shili Xu1, Arthur Catapang1, Hanna M. Doh1, Nicholas A. Bayley1, Jason T. Lee1,2,3,

Daniel Braas1,4, Thomas G. Graeber1,2,3,4, Harvey R. Herschman1,2,3,5,6*

1Department of Molecular and Medical Pharmacology

2Crump Institute for Molecular Imaging

3Jonsson Comprehensive Cancer Center

4UCLA Metabolomics Center

5Department of Biological Chemistry

6Molecular Biology Institute

David Geffen School of Medicine, University of California Los Angeles, Los Angeles, California 90095, USA

*Correspondence: Harvey R. Herschman. 341 Boyer Hall, UCLA, 611 Charles E. Young Drive East, Los Angeles CA, 90095. Phone: 310-825-8735. Fax: 310-825-1447. Email: [email protected]

First author: Shili Xu, postdoctoral fellow. 329 Boyer Hall, UCLA, 611 Charles E. Young Drive East, Los Angeles CA, 90095. Phone: 310-825-8745. Email: [email protected]

Running Title: HK2 Is Targetable for HK1-HK2+ Tumors

Financial Disclosure: No potential conflicts of interest relevant to this article exist.

Word count: 4997

ABSTRACT

Although absent in most adult tissues, hexokinase 2 (HK2) is expressed in a majority of

tumors and contributes to increased glucose consumption and to in vivo tumor 18F-FDG

PET signaling. Methods: Both HK2 knockdown and knockout approaches were used to investigate the role of HK2 in cancer cell proliferation, in vivo xenograft tumor progression and 18F-FDG tumor accumulation. BioProfiler analysis monitored cell culture glucose consumption and lactate production; 18F-FDG PET/CT monitored in vivo tumor glucose

accumulation. Cancer Cell Line Encyclopedia data were analyzed for HK1 and HK2

expression. Results: Neither cell proliferation in culture nor xenograft tumor progression

are inhibited by HK2 knockdown or knockout in cancer cells that express HK1 and HK2.

However, cancer subsets from a variety of tissues of origin express only HK2, but not

HK1. In contrast to HK1+HK2+ cancers, HK2 knockdown in HK1-HK2+ cancer cells results

in inhibition of cell proliferation, colony formation and xenograft tumor progression.

Moreover, HK1KOHK2+ cancer cells are susceptible to HK2 inhibition, in contrast to their

isogenic HK1+HK2+ parental cells. Conclusions: HK1 and HK2 expression are

redundant in tumors; either can provide sufficient aerobic glycolysis for tumor growth;

despite a reduction in 18F-FDG PET signal. Therapeutic HK2 inhibition is likely to be

restricted to HK1-HK2+ tumor subsets, but stratification of tumors that express HK2, but

not HK1, should identify tumors treatable with emerging HK2 specific inhibitors.

Key words: Warburg Effect, hexokinase 2, hexokinase 1, glycolysis, targeted therapy.

INTRODUCTION

Increased aerobic glycolysis – the Warburg Effect (1) – has been associated with

cancer for 90 years. The hexokinases (HKs), the first enzymes committed to glycolysis,

convert glucose to glucose-6-phosphate (G6P). There are four HK isoforms, HK1-HK4

(2). Most adult tissues express only HK1. Muscle and adipose tissue use HK2 for glycolysis, liver and pancreatic β cells express HK4 (also called glucokinase) and do not express HK1 or HK2. In contrast to normal tissues, many tumors express both HK1 and

HK2. Elevated hexokinase activity as a driver of tumor glycolysis was reported in the late

1970’s (3); however, it was ~30 years later until HK2 expression was identified in most cancers (4). No cancer therapy based on interventions directed at elevated tumor glycolysis is approved for clinical use.

Development of the positron-emitting glucose analogue 18F-fluorodeoxyglucose

(18F-FDG) (5) and positron emission tomography (PET) technology (6) led, in the late

1970’s/early 1980’s, to 18F-FDG-PET clinical applications to study, non-invasively,

glucose metabolism in the brain (7), heart (8) and cancer (9). HK2 is a likely major

contributor to the increased conversion of 18F-FDG to 18F-FDG-6P in most tumors. 18F-

FDG PET oncologic clinical imaging has played a major role in cancer diagnosis,

metastasis detection, monitoring disease progression, and both selection and

modification of therapeutic protocols.

Cell culture and xenograft tumor data from human breast (10), lung (10),

pancreatic (11), and prostate (12) cancer and glioblastoma (13) have been interpreted to

suggest selective HK2 inhibition has potential to be a near-globally effective cancer

therapeutic. Moreover, global HK2 deletion in adult mice is tolerated (10). These data

have stimulated intense interest in development of selective HK2 inhibitors for cancer

therapy. Enthusiasm has been substantially elevated by description of small-molecule

inhibitors with preference for HK2 over HK1 (14). However, no laboratory has directly compared the roles of HK1 and HK2 in tumor progression and 18F-FDG PET imaging.

Here we find that HK1+HK2+ cancers can tolerate HK2 silencing. While HK1+HK2+

xenograft tumor progression is unaffected by HK2 deletion, 18F-FDG PET signal is

significantly reduced. Moreover, subsets of cancers from a variety of tissues of origin express HK2 but not HK1, and are sensitive to HK2 silencing-induced inhibition of cell

proliferation in culture and suppression of xenograft tumor growth.

MATERIALS AND METHODS

Cell Lines. H460, CFPAC1, U87, PC3, Hep3B and HepG2 were from the American Type

Culture Collection. UMUC3, 253J, T24, 5637, SW780, and HT1197 were from Dr. Mark

Day (University of Michigan). Huh7, JHH7, and JHH5 were from Dr. Dennis Slamon

(UCLA). RPMI8226, OPM2, H929, and U266 were from Dr. Sherie Morrison (UCLA). HLF,

JHH6, and SNU398 were from Ionis Pharmaceuticals. All cells were maintained in

RPMI1640+10% FBS, 37 °C, 5% CO2/95% air. Mycoplasma contamination was routinely analyzed using MycoAlert (Lonza).

Antibodies. HK1 (#2024), HK2 (#2867), and GAPDH (#5174) antibodies were from Cell

Signaling Technology.

Doxycycline (DOX)-Inducible shRNA Knockdown. shRNAs (shHK2-1:

GGATGTGTGTGAACATGGAATTTCAAGAGAATTCCATGTTCACACACATCC; shHK2-

2: CTTCATGGATAAGCTACAAATTTCAAGAGAATTTGTAGCTTATCCATGAAG; shHK2-3:

CCAAAGACATCTCAGACATTGTTCAAGAGACAATGTCTGAGATGTCTTTGG; shHK2-

4: CCGTAACATTCTCATCGATTTTTCAAGAGAAAATCGATGAGAATGTTACGG; shHK2-5:

CACGATGAAATTGAACCTGGTTTCAAGAGAACCAGGTTCAATTTCATCGTG; shCtrl:

TAGCGACTAAACACATCAATTCAAGAGATTGATGTGTTTAGTCGCTA) were used for doxycycline (DOX)-inducible knockdown as described (15).

CRISPR Cas9 HK2 and HK1 Knockout. HK2 gRNA (TGACCACATTGCCGAATGCC) and HK1 gRNA (AGATGTTGCCAACATTCGTA) were used for HK1 and HK2 knockout as described (16).

Colony Formation Assay. 1,000 cells/well were seeded in 6-well plates in presence or absence of DOX (25 ng/mL). Media were refreshed every three days. After 15-20 days, colonies were stained with 2% crystal violet (17).

Glucose Consumption and Lactate Production. 3×105 cells were seeded in 6-well plates in triplicate. After 24 hours media were refreshed. Media from a well with no cells was used as a control. After 24 h, 1 ml of medium from each sample was analyzed in the

Bioprofile Analyzer (Nova Biomedical). Values were normalized to cell number and time interval.

Medium Metabolite Measurements. Metabolites were measured as described (15) after

24 hr cell culture.

Subcutaneous Xenograft Tumor Growth. Cells (Hep3B, 5×106; H460, 1×106; CFPAC1,

2 ×106) were implanted subcutaneously in nu/nu mice (Jackson Laboratory). Tumor volume was assessed by Vernier caliper measurement (D × d2/2; D and d are longest and shortest tumor diameters). For DOX-induced HK2 knockdown studies xenograft tumors were allowed to grow to 200 mm3. Mice were then randomly assigned to two groups treated with control or DOX diet (625 mg DOX per kg diet).

Cell Proliferation. Cell growth was assessed with a 3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide (MTT) assay (18).

Tumor Glucose Consumption by 18F-FDG PET/CT. Animals without fasting were warmed on a heating pad for 30 min, anesthetized with 2% isoflurane in oxygen, and injected via tail vein with 3.7 MBq of clinical-grade 18F-FDG. Mice were maintained under

anesthesia in a heated induction chamber during the 1-h biodistribution period prior to imaging. PET/CT scans were conducted on a G8 instrument (Sofie Biosciences) with a

600-s PET acquisition, and maximum-likelihood expectation maximization reconstruction, with a 50-s CT acquisition and Feldkamp reconstruction. PET/CT images were co- registered, and tumor region-of-interest (ROI) was analyzed using AMIDE software.

Statistical Analysis. Student’s t-test was used for statistical analysis, P value was determined by Prism 5 (GraphPad Software). Differences were considered statistically significant at P < 0.05. Differential expression analysis between HK1+HK2+ and HK1-HK2+ liver cancer cell lines was conducted using the limma R package (19).

RESULTS

HK2 knockdown has no significant effect on proliferation in culture or tumor

xenograft progression for HK1+HK2+ cancer cells. Previous studies reported breast

(10), lung (10), pancreatic (11), prostate (12) cancer cells and glioblastoma cells (13) are

sensitive to HK2 knockdown both for proliferation in culture and for xenograft tumor

progression. In a search for the cancer type(s) most sensitive to HK2 inhibition, we used one cell line from each of these studies to examine shHK2 modulation of cell proliferation.

All four cell lines were reported to respond to HK2 knockdown-induced growth inhibition in cell culture and in xenograft tumors. Like most cancers these four cell lines express both HK1 and HK2 (Supplementary Fig. 1A and B).

The previous studies (10-13) studying the role of HK2 in cancer progression used different HK2 shRNAs and shRNA expression systems. To compare our experiments with these published studies we (i) designed two additional shHK2 sequences (shHK2-1 and

shHK2-2), and (ii) used shHK2-1, shHK2-2 and the most effective shHK2 sequence from

each of the individual studies (termed shHK2-3 (10), shHK2-4 (11,12), and shHK2-5 (13))

(Supplementary Fig. 2A and B), to identify the optimal shHK2 for comparisons across cells of different tumor origin. To avoid selecting resistant cells in response to constitutive

HK2 knockdown, we used a doxycycline (DOX)-inducible system to compare side-by-side

HK2 knockdown effects. In all four cell lines, shHK2-1 demonstrated the best HK2 knockdown efficacy (Supplementary Fig. 2C). HK2 knockdown did not affect HK1 protein levels (Supplementary Fig. 2C). However, no shHK2 had a significant effect on cell proliferation (Fig. 1A) or colony formation (Supplementary Fig. 3) for any of the four cell lines.

HK2 shRNAs were reported to inhibit subcutaneous xenograft tumor growth for

H460 (10), U87 (13), CFPAC1 (11), and PC3 (12) cells. We established H460/shHK2-

1DOX xenografts. When tumors reached 200 mm3 (day 0), mice were switched to DOX or

vehicle diets (Fig. 1B). HK2 knockdown had no significant effect on H460/shHK2-1DOX xenograft tumor growth, despite suppression of tumor HK2 expression, demonstrated in tumor extracts following sacrifice (Fig. 1B, inserted panel).

HK2 knockout has no significant effect on HK1+HK2+ cancer cell proliferation or

xenograft tumor progression. Studies (10-13) were published before CRISPR Cas9

gene inactivation technology became widely used. As an orthogonal approach to examine

the role of HK2 in HK1+HK2+ cancer cell growth, we used CRISPR Cas9 to knockout HK2

in H460, U87, CFPAC1 and PC3 cells (Supplementary Fig. 4A). HK2 knockout did not

alter HK1 protein levels (Supplementary Fig. 4A). Consistent with our shHK2 knockdown

data (Fig. 1A, Supplementary Fig. 3), HK2 knockout did not significantly affect cell

proliferation (Fig. 2A) or colony formation (Supplementary Fig. 4B). It is important to note

that FDG, a glucose analogue and effective inhibitor for both HK1 and HK2, reduced

proliferation of all the cell lines (Supplementary Fig. 4c), indicating the growth of these cells is dependent on hexokinase activity.

Although HK2 knockout did not affect HK1+HK2+ cancer cell proliferation or colony

formation, HK2 knockout reduced glucose consumption, compared to WT isogenic cells,

by 65% in H460 cells, 44% in U87 cells, 35% in CFPAC1 cells, and 30% in PC3 cells (Fig.

2B). Lactate production in HK1-HK2+ isogenic cells showed a reduction similar to that for

glucose consumption: 73% in H460, 42% in U87, 38% in CFPAC1, and 31% in PC3 (Fig.

2B).

We then examined the effect of HK2 knockout on H460 (lung cancer) and CFPAC1

(pancreatic cancer) tumor growth. H460 (10) and CFPAC1 (11) xenograft growth were

reported to be suppressed by HK2 shRNAs. However, we observed no significant

differences in growth rates between WT and HK1+HK2KO isogenic tumors (Fig. 3). At the

end of the experiments tumors were collected (Fig. 3, inserted panels) and weighed. No

significant differences in tumor weight between WT and isogenic HK2 knockout tumors

were detectable for either H460 or CFPAC1 xenografts (Supplementary Fig. 5A).

Absence of detectable HK2 protein in HK2KO H460 and CFPAC1 tumors was confirmed

(Supplementary Fig. 5B); HK1 expression was not altered by HK2 knockout.

HK2 knockout in HK1+HK2+ tumors reduces 18F-FDG PET signal in vivo

To determine whether glucose metabolism is reduced in HK1+HK2KO xenograft

tumors when compared to parental HK1+HK2+ tumors, we compared, by microPET analysis (5,6), 18F-FDG uptake in isogenic HK1+HK2+ and HK1+HK2KO H460 xenografts.

Individual mice were injected with both HK1+HK2KO and HK1+HK2+ H460 cells, on opposite flanks, to eliminate all experimental variables (e.g., injected 18F-FDG dose,

mouse health, mouse activity, etc.) except for tumor hexokinase genotypes. The 18F-FDG

PET scan data quantification indicates a 50% reduction in HK1+HK2KO tumors. We also

isolated tumors after microPET scans and measured radioactivity by well counting; there

was a 50% reduction in HK1+HK2KO tumors compared to WT tumors (Supplementary Fig.

6).

HK1 or HK2 alone are sufficient to support cancer cell proliferation and xenograft

tumor progression. We suggest either HK1 or HK2 expression alone is sufficient to

support cancer cell proliferation and xenograft tumor progression. To test this hypothesis,

we knocked out HK1 in H460 cells (Supplementary Fig. 7A). Growth arrest in the absence

of glucose indicates all three isogenic cell lines (HK1+HK2+, HK1KOHK2+ and HK1+HK2KO) require glycolysis for proliferation (Fig. 5A); however, in the presence of glucose neither absence of HK2 nor HK1 inhibits cell proliferation (Fig. 5A) or colony formation

(Supplementary Figs. 4B and 7B). Like HK2 deletion in H460 cells, HK1 deletion has no significant effect on tumor progression; either HK1 or HK2 expression is sufficient for optimal tumor cell xenograft progression (Fig. 5B). Although HK1 or HK2 knockout reduced glycolysis rates, HK1KO or HK2KO cells did not increase utilization of other

nutrients in cell culture media to maintain their proliferation ability (Supplementary Fig.

7D). These data indicate (i) either HK2- or HK1-driven glycolysis alone in tumors is

sufficient to support xenograft tumor progression and (ii) that the acquired HK2 up-

regulation of aerobic glycolysis in cancer (the Warburg effect) can be redundant for

cancer progression in many tumors that express high levels of HK1.

Tumor subsets originating from a wide variety of tissues express HK2, but not HK1.

The preceding data demonstrate that HK2 expression is redundant for HK1+HK2+ cancer

progression and suggest that, in contrast to current proposals, selective pharmacologic

HK2 inhibition in HK1+HK2+ tumors is not likely to be a viable cancer therapeutic approach.

However, tumors expressing HK2, but no/very low HK1, would be susceptible to targeted

HK2 inhibition. Six percent of the cell lines characterized in the Cancer Cell Line

Encyclopedia (CCLE) data base (20) express relatively high HK2 and low HK1 mRNA

levels (Fig. 6A). While the HK1- percentages for tumors of different origins varies

substantially, a wide variety of different tumor types have member subsets that are HK1-

HK2+ (Fig. 6B); multiple myeloma (54% are HK1-) and liver cancer (38% are HK1-) in particular (Supplementary Figs. 8A and B).

We confirmed that cell lines from liver cancer, bladder cancer, and multiple myeloma within the chosen HK1-HK2+ mRNA boundaries (Fig. 6A) are HK1-HK2+ at the protein levels. (Fig. 6C). JHH5 and H929 are particularly notable; they are at the HK1 mRNA expression uppermost boundary (Fig. 6A and C). Moreover, examination of the

TCGA database (http://www.cbioportal.org) suggests over 80% of HK2+ liver cancers

have no/very low HK1 expression (Supplementary Fig. 9). Because normal liver

expresses only HK4, examination of the ratio of HK1-HK2+ versus HK1+HK2+ tumors will

not be affected by “normal” liver tissue contamination in liver tumor biopsies.

Examining RNASeq data for liver cancer cell lines in the CCLE collection revealed

that HK1-HK2+ cell lines share similar gene expression profiles and HK1+HK2+ cell lines also share similar gene expression profiles. However, the shared gene expression profiles of HK1-HK2+ and HK1+HK2+ cell lines differ from one another (Fig. 6D,

Supplementary Table 1).

HK2 knockdown suppresses proliferation of HK1-HK2+ cancer cells regardless of

tissue of origin. To test the suggestion that HK2 inhibition will suppress growth in HK1-

HK2 + cancers from a variety of tissues, we examined the consequences of DOX-induced

shRNA HK2 knockdown in HK1-HK2+ and HK1+HK2+ liver, bladder and multiple myeloma

cancer cell lines from the CCLE collection (Supplementary Fig. 10A). For all HK1-HK2+ cancer cells, regardless of tissue of origin, cell proliferation (Fig. 7A) and colony formation

(Supplementary Fig. 10B) were inhibited by HK2 knockdown. In contrast, inhibition of HK2 expression did not modulate proliferation or colony formation in HK1+HK2+ cell lines.

To extend our comparison of cell proliferation and xenograft progression between

HK1-HK2+ and HK1+HK2+ tumor cells using isogenic cells, we established DOX-inducible

shHK2 in H460/HK1KOHK2+ isogenic cells (H460HK1KOHK2+/shHK2DOX cells)

(Supplementary Fig. 10C). Cell proliferation and colony formation are suppressed by HK2 silencing in H460HK1KOHK2+/shHK2DOX cells (Supplementary Figs. 10D and E).

Although neither HK2 knockdown (Fig. 1B) nor knockout (Fig. 3) can reduce

HK1+HK2+ tumor progression, our cell culture data suggest HK2 silencing in HK1-HK2+

tumors will suppress progression in vivo. To examine this suggestion, Hep3B (HK1-HK2+) xenograft progression was examined in the presence or absence of HK2 silencing.

ShHK2 expression was induced by dietary shift when Hep3B/shHK2DOX tumors reached

200 mm3. DOX-induced shRNA HK2 knockdown reduced tumor growth by 39% (Fig. 7B,

left panel). Similarly, although HK2 knockdown has no effect on HK1+HK2+ H460 xenograft progression (Fig. 1B), when HK2 is silenced in isogenic H460

HK1KOHK2+/shHK2DOX cells by DOX-induced shHK2, xenograft progression is significantly reduced (Fig. 7B, right panel).

DISCUSSION

Upregulated aerobic glycolysis (the Warburg Effect) been exploited with clinical

18F-FDG PET imaging for tumor diagnosis, for tumor prognosis, and for choice, evaluation and modification of therapeutic modalities. The most prominent hypotheses for the

function(s) of cancer cell aerobic glycolysis are supply of energy, reducing equivalents,

and/or glucose carbon to build intermediates to support cancer progression (21). However,

most glycolytically consumed glucose carbon is converted in tumor cells to released lactic

acid (22); carbon mass in cancer cells comes predominantly from imported amino acids

(23). How the Warburg Effect benefits cancer is still inconclusive (24).

While most normal tissues do not express HK2 (2), HK2 is expressed by most

cancers and contributes to the upregulation of cancer aerobic glycolysis. Previous HK2

shRNA knockdown studies in HK1+HK2+ cell lines from breast (10), lung (10), prostate

(12), pancreatic (11), and brain (13) tumors reported HK2 knockdown inhibited cancer

cell proliferation in culture and xenograft tumor progression, and suggested HK2 as a

potential global cancer therapeutic target. However, using both those same shHK2

sequences (11-14) and shHK2 sequences we designed that have greater efficacy in

reducing HK2 levels, we did not observe significant differences in cell proliferation, colony

formation, or xenograft tumor growth in these cancer cells when HK2 expression was

silenced, despite substantial differences in glucose consumption.

Using an orthogonal approach, we generated isogenic HK1+HK2KO clones using

CRISPR Cas9 technology and did not observe significant effects on colony formation, cell

culture proliferation, or xenograft tumor progression. However, glucose consumption in

cell culture and microPET imaging of 18F-FDG accumulation in vivo were similarly

reduced, suggesting (i) HK2 is redundant in cancer cells that express high levels of HK1,

(ii) HK1+HK2+ tumor cells have an excess, unneeded capacity for aerobic glycolysis and

(iii) although a useful tool for non-invasive measurements of tumor pharmacodynamics of

HK2 inhibitors, 18F-FDG PET imaging would have limitations in predicting therapeutic

outcomes of HK2 inhibitors in HK1+HK2+ tumors.

Our observations are consistent with a study that identified genes essential for

cancer cell growth and/or survival in HK1+HK2+ human CML KBM7 cells using a genome-

wide screen (25). Neither HK1 nor HK2 was identified as an essential gene, suggesting

their redundancy in cells that express both hexokinases. In contrast, HK2 is an essential

gene in Jiyoye cells, a lymphoma cell line that expresses only low levels of HK1 (25). We

conclude that, in cancers where both HK1 and HK2 are expressed, HK1 and HK2 can

compensate each other for cell proliferation and tumor progression. Consequently,

targeting HK2 would not be an effective therapy in HK1+HK2+ cancers.

In examining the CCLE collection, we find a significant subset (6%) of cancer cells do not express HK1, with particularly high frequencies in multiple myelomas and liver cancers. In contrast to results for HK1+HK2+ cancer cells, proliferation, colony formation

and xenograft progression of HK1-HK2+ tumor cells originating from a variety of tissues of

origin are suppressed by HK2 silencing. Moreover, WT H460 (HK1+HK2+) cells, resistant to HK2 silencing inhibition of both proliferation in culture and xenograft tumor progression, can be converted to sensitivity to HK2 silencing when HK1 is deleted to create isogenic

HK1KOHK2+ H460 cells.

Examination of the TCGA database suggests that over 80% of HK2+ liver cancers

have no/very low HK1 expression. However, because of potential contamination by

normal tissue expressing HK1 for other tumor types, biopsy samples will have to be

assayed by single cell analyses (e.g., single cell RNASeq, immunohistochemistry, flow

cytometry), to determine the frequencies of HK1-HK2+ versus HK1+HK2+ cancer cohorts

in tissues of most origins.

No HK-targeted therapies have entered clinical cancer treatment, largely due to (i)

lack of selective HK2 inhibitors, and (ii) lack of identification of cancer type(s) most

sensitive to HK2 blockade. Molecular metabolic characterization of HK isoform

expression, rather than tissue of origin, will guide the potential use of HK2-targeted cancer

therapy for HK1-HK2+ cancers. We suggest that selective pharmacologic HK2 inhibitors

will be promising agents for management of HK1-HK2+ cancers. However, our data also

suggest that monotherapy with selective HK2 inhibitors will not eradicate HK1-HK2+ cancers; these cancers are likely to use other sources, e.g. oxidative phosphorylation, for energy (ATP) production to maintain survival. Combining agents targeting these other energy generation sources with HK2 inhibition, as precision therapies, may achieve synthetic lethality in HK1-HK2+ cancers and be tolerated by normal tissues that express

HK1. Stratification of patients with HK1-HK2+ cancers, particularly in multiple myeloma and liver cancer, would identify individuals for synergistic combination therapies involving

selective HK2 inhibitors.

CONCLUSION

Our data suggest a potential discrepancy between tumor 18F-FDG PET signal and tumor progression in HK1+HK2+ versus HK1-HK2+ tumors. Although therapeutic HK2+ inhibition

is likely to be restricted to HK1-HK2+ tumor subsets, stratification of tumors of many

different origins that express HK2, but not HK1, should identify tumors targetable with

emerging selective HK2 inhibitors.

FINANCIAL DISCLOSURE

No potential conflicts of interest relevant to this article exist.

ACKNOWLEDGEMENT

We thank Drs. Caius Radu and Sotirios Tetradis for comments and advice. Shili Xu is a

DoD Horizon Awardee (W81XWH-16-1-0162). Harvey Herschman is supported by the

Crump and Phelps Family Foundations. We thank Dr. Mark Day and Mrs. Kathleen Day

(University of Michigan), Dr. Sherie Morrison (UCLA) and Ionis Pharmaceuticals for cell lines for this study.

REFERENCES: 1. Warburg O, Wind F, Negelein E. The metabolism of tumors in the body. J Gen

Physiol. 1927;8:519-530.

2. Wilson JE. Isozymes of mammalian hexokinase: structure, subcellular localization and metabolic function. J Exp Biol. 2003;206:2049-2057.

3. Bustamante E, Pedersen PL. High aerobic glycolysis of rat hepatoma cells in culture: role of mitochondrial hexokinase. Proc Natl Acad Sci U S A. 1977;74:3735-

3739.

4. Mathupala SP, Ko YH, Pedersen PL. Hexokinase II: cancer's double-edged

sword acting as both facilitator and gatekeeper of malignancy when bound to

mitochondria. Oncogene. 2006;25:4777-4786.

5. Som P, Atkins HL, Bandoypadhyay D, et al. A fluorinated glucose analog, 2-

fluoro-2-deoxy-D-glucose (F-18): nontoxic tracer for rapid tumor detection. J Nucl Med.

1980;21:670-675.

6. Czernin J, Phelps ME. Positron emission tomography scanning: current and

future applications. Annu Rev Med. 2002;53:89-112.

7. Kuhl DE, Engel J, Jr., Phelps ME, Kowell AP. Epileptic patterns of local cerebral

metabolism and perfusion in man: investigation by emission computed tomography of

18F-fluorodeoxyglucose and 13N-ammonia. Trans Am Neurol Assoc. 1978;103:52-53.

8. Schelbert HR, Henze E, Phelps ME, Kuhl DE. Assessment of regional

myocardial ischemia by positron-emission computed tomography. Am Heart J.

1982;103:588-597.

9. Yonekura Y, Benua RS, Brill AB, et al. Increased accumulation of 2-deoxy-2-

[18F]Fluoro-D-glucose in liver metastases from colon carcinoma. J Nucl Med.

1982;23:1133-1137.

10. Patra KC, Wang Q, Bhaskar PT, et al. Hexokinase 2 is required for tumor

initiation and maintenance and its systemic deletion is therapeutic in mouse models of cancer. Cancer Cell. 2013;24:213-228.

11. Anderson M, Marayati R, Moffitt R, Yeh JJ. Hexokinase 2 promotes tumor growth and metastasis by regulating lactate production in pancreatic cancer. Oncotarget.

2017;8:56081-56094.

12. Wang L, Xiong H, Wu F, et al. Hexokinase 2-mediated Warburg effect is required

for PTEN- and p53-deficiency-driven prostate cancer growth. Cell Rep. 2014;8:1461-

1474.

13. Wolf A, Agnihotri S, Micallef J, et al. Hexokinase 2 is a key mediator of aerobic

glycolysis and promotes tumor growth in human glioblastoma multiforme. J Exp Med.

2011;208:313-326.

14. Lin H, Zeng J, Xie R, et al. Discovery of a novel 2,6-disubstituted glucosamine

series of potent and selective hexokinase 2 inhibitors. ACS Med Chem Lett.

2016;7:217-222.

15. Krall AS, Xu S, Graeber TG, Braas D, Christofk HR. Asparagine promotes cancer

cell proliferation through use as an amino acid exchange factor. Nat Commun.

2016;7:11457.

16. Sanjana NE, Shalem O, Zhang F. Improved vectors and genome-wide libraries for CRISPR screening. Nat Methods. 2014;11:783-784.

17. Xu S, Adisetiyo H, Tamura S, et al. Dual inhibition of survivin and MAOA synergistically impairs growth of PTEN-negative prostate cancer. Br J Cancer.

2015;113:242-251.

18. Xu S, Oshima T, Imada T, et al. Stabilization of MDA-7/IL-24 for colon cancer

therapy. Cancer Lett. 2013;335:421-430.

19. Ritchie ME, Phipson B, Wu D, et al. limma powers differential expression

analyses for RNA-sequencing and microarray studies. Nucleic Acids Res. 2015;43:e47.

20. Barretina J, Caponigro G, Stransky N, et al. The Cancer Cell Line Encyclopedia

enables predictive modelling of anticancer drug sensitivity. Nature. 2012;483:603-607.

21. Schulze A, Harris AL. How cancer metabolism is tuned for proliferation and

vulnerable to disruption. Nature. 2012;491:364-373.

22. Lunt SY, Vander Heiden MG. Aerobic glycolysis: meeting the metabolic

requirements of cell proliferation. Annu Rev Cell Dev Biol. 2011;27:441-464.

23. Hosios AM, Hecht VC, Danai LV, et al. Amino acids rather than glucose account

for the majority of cell mass in proliferating mammalian cells. Dev Cell. 2016;36:540-

549.

24. Liberti MV, Locasale JW. The Warburg effect: how does it benefit cancer cells?

Trends Biochem Sci. 2016;41:211-218.

25. Wang T, Birsoy K, Hughes NW, et al. Identification and characterization of

essential genes in the human genome. Science. 2015;350:1096-1101.

Fig. 1. HK2 shRNA knockdown has no significant effect on cell proliferation in culture or xenograft tumor progression in HK1+HK2+ cancer cell lines. (A) HK2 shRNA knockdown

has no detectable significant effect on cell proliferation for HK1+HK2+ cancer cell lines.

H460, U87, CFPAC1, and PC3 cells with the indicated DOX-inducible shRNAs integrated

in the genome were cultured with or without DOX for seven days. Error bars, SD. (B)

DOX-induced HK2 shRNA knockdown has no detectable significant effect on

subcutaneous HK1+HK2+ H460/shHK2-1DOX xenograft tumor progression. After tumors

reached > 200 mm3 tumor-bearing mice were placed on control or DOX-supplemented

diets for 15 days (n=5/group). Error bars, SE. NS, not significant. Tumors were collected

on Day 15 and extracts were analyzed for HK1 and HK2 expression by Western blotting.

Fig. 2. CRISPR Cas9 HK2 gene knockout has no significant effect on cell proliferation in

HK1+HK2+ cancer cell lines. (A) HK2 knockout has no significant effect on cancer cell proliferation in culture. WT and HK2KO isogenic H460, U87, CFPAC1 and PC3 cells were

cultured for five days. Media were refreshed on day 3. Error bars, SD. (B) HK2 knockout

reduces glucose consumption and lactate production. Error bars, SD. *, P < 0.05. **, P <

0.01. ***, P < 0.001. ***, P < 0.0001.

Fig. 3. CRISPR Cas9 HK2 gene knockout has no detectable significant effect on

HK1+HK2+ xenograft tumor progression. Tumor volumes were measured twice weekly for

13 days (H460) or 25 days (CFPAC1) (n=5/group). Error bars, SE. Inserts: Appearance of tumors collected at the experiment conclusions. H460 tumors were collected on Day

13. CFPAC1 tumors were collected on Day 25.

Fig. 4. HK2 contributes to 18F-FDG PET signals in xenograft HK1+HK2+ tumors. Mice

bearing H460/WT tumors on their left flanks and H460/HK2KO tumors on their right flanks

(n = 3), were subjected to 18F-FDG PET scans. Left, a representative microPET image.

Right, Mean values of PET signal intensity quantifications for H460/WT and H460/HK2KO tumors. Error bars, SE. *, P < 0.05.

Fig. 5. HK1 or HK2 alone can sustain cancer cell proliferation and tumor progression. (A)

H460/WT, H460/HK1KOHK2+, and H460/HK1+HK2KO isogenic cells depend on glucose

and proliferate at similar rates in cell culture. Indicated H460 isogenic cells were cultured

with or without 10 mM glucose for 72 h. Error bars, SD. (B) Neither HK1 nor HK2 gene

knockout has a detectable effect on H460 tumor xenograft progression (n=5/group). Error

bars, SE. NS, not significant. Tumors were collected at Day 13, and tumor extracts were

analyzed by Western blot for HK1 and HK2 expression.

Fig. 6. Subsets of cancers express low or undetectable HK1 levels. (A) HK1-HK2+ cancer cell lines present in the CCLE collection (http://oasis-genomics.org). HK1 and HK2 mRNA expression of 935 cell lines are shown. Each data point represents a cell line. The box indicates “HK1-HK2+” cell lines, defined as HK2 >1 TPM and HK1 <10 TPM. TPM;

transcripts per million. Representative cancer cell lines are highlighted and labeled. (B)

Percentages of HK1-HK2+ CCLE cancer cell lines in cancers from different tissues of

origin. The HK1-HK2+ property is defined as HK2 >1 TPM and HK1 <10 TPM. (C)

Validation of HK1 and HK2 protein levels in representative CCLE cell lines. HK1 and HK2

protein levels in lysates prepared from indicated liver cancer, bladder cancer, and multiple

myeloma cell lines highlighted in panel (A) were examined by Western blot. (D)

Differential gene expression profiles of HK1-HK2+ and HK1+HK2+ liver cancer cell lines.

All liver cancer cell lines in the CCLE dataset were analyzed for differential gene

expression. 685 genes with significant differences (P < 0.05) between the two populations

are shown.

Fig. 7. HK2 knockdown reduces cell proliferation in culture and xenograft tumor progression in HK1-HK2+ cancers from a variety of tissues. (A) DOX-induced HK2

knockdown reduces cell proliferation in culture in HK1-HK2+ cells, but not in HK1+HK2+

cells. Cells with integrated shHK2-1DOX were treated with 25 ng/ml DOX for seven days in the cell proliferation assay. Error bars, SD. (B) HK2 shRNA knockdown reduces HK1-

HK2+ xenograft tumor progression. After tumors reached >200 mm3, mice were placed on control or DOX-supplemented diets to induce shHK2-1 expression in (left)

Hep3B/shHK2DOX xenograft tumors or (right) H460HK1KOHK2+/shHK2DOX xenograft

tumors for indicated periods (n=5/group). Error bars, SE. Xenograft tumors were collected

on the last day of treatment and tumor extracts were analyzed for HK1 and HK2

expression. Lysates from H460/HK2KO cells were included as a positive control for HK1

expression and a negative control for HK2 expression. *, P < 0.05. **, P < 0.01. ***, P <

0.001. ****, P < 0.0001. NS, not significant.

Supplementary Figure Legends

Supplementary Fig. 1. HK1 and HK2 mRNA and protein expression in cancer cells. (A)

HK1 and HK2 mRNA expression for the 935 cell lines in the Cancer Cell Line

Encyclopedia (CCLE) dataset. Each blue data point represents a cell line. H460, PC3,

U87, and CFPAC1 cells are shown in red. TPM, transcripts per million. (B) Both HK1 and

HK2 proteins are expressed in H460, PC3, U87, and CFPAC1 cells.

Supplementary Fig. 2. DOX-inducible shRNA HK2 knockdown. (A) Location of the five shRNA sequences proposed to target the HK2 mRNA. shHK2-1, shHK2-2, shHK2-3, and shHK2-4 target the coding sequence of the HK2 mRNA. shHK2-5 targets the 3’ untranslated region of the HK2 mRNA. (B) Sequencing of the shRNAs was performed by

Laragen Inc (Culver City, CA). (C) HK2 knockdown efficacy of the five shHK2 sequences.

Stable H460, U87, CFPAC1, and PC3 isogenic cells with indicated DOX-inducible

2 shRNAs integrated in the genomes were generated using lentivirus. The isogenic cells were cultured with or without DOX (25 ng/mL) for three days prior to analysis of HK1 and

HK2 protein levels by Western blotting.

Supplementary Fig. 3. HK2 shRNA knockdown has no detectable significant effect on colony formation in HK1+HK2+ cancer cell lines. H460, U87, CFPAC1, and PC3 isogenic cells with indicated DOX-inducible shRNAs integrated in the genomes were cultured with or without DOX (25 ng/ml) for 15-20 days, until colonies formed.

Supplementary Fig. 4. HK1+HK2+ cancer cell proliferation is not affected by HK2 deletion. (A) Generation of HK2 knockout isogenic cell lines. HK2 knockout using the

CRISPR Cas9 method was performed in H460, U87, CFPAC1, and PC3 cells. Two HK2 knockout clones were established from each parental cell line. Cell lysates were

5 assayed for HK1 and HK2 expression by Western Blotting. (B) HK2 knockout has no significant effect on cancer cell colony formation when compared to the parental

HK1+HK2+ WT cancer cells. Indicated isogenic cells were cultured in 6-well plates until colonies formed. Cell culture medium was refreshed every 3 days. (C) FDG inhibits cell growth of H460, U87, CFPAC1, and PC3 cells. Cells were treated with FDG at the indicated concentrations for 72 h. Error bars, SD.

Supplementary Fig. 5. CRISPR Cas9 HK2 gene knockout has no significant effect on xenograft tumor progression for HK1+HK2+ cancer cells. (A) HK2 knockout has no

significant effect on tumor weight. H460/WT and H460/HK2KO tumors collected on Day

13 and CFPAC1/WT and CFPAC1/HK2KO tumors collected on Day 25 were weighed.

Horizontal lines indicate mean values with SD. (B) Confirmation of HK2 gene knockout in xenograft tumors. Lysates of tumors collected at the conclusions of the experiments were analyzed for HK1 and HK2 levels by Western blotting.

Supplementary Fig. 6. HK2 contributes to 18F-FDG accumulation in xenograft

HK1+HK2+ tumors. H460/WT tumors and H460/HK2KO tumors (n=3) were isolated from xenografts immediately following 18F-FDG microPET scan. Tumor radioactivity was measured and normalized to tumor weight. Error bars, SE. **, P < 0.01.

Supplementary Fig. 7. HK1 or HK2 alone can sustain cancer cell proliferation and tumor progression. (A) Generation of HK1 knockout H460 cells. HK1 knockout cells were generated using the CRISPR Cas9 method. Two HK1 knockout isogenic clones were established. Western blotting of HK1 and HK2 expression from lysates of H460 WT and

the two H460 HK1KO cells are shown. (B) HK1 knockout has no detectable effect on colony formation in H460 cells. (C) HK1 knockout reduces glucose consumption and lactate production when compared to the parental HK1+HK2+ H460/WT cells. Error bars,

SD. (D) Changes in extracellular nutrient levels during a 24-h incubation with H460

isogenic cells. Values are shown as percent change in comparison with nutrient

measurements from identical medium incubated on plates lacking cells. Negative bars

indicate nutrient consumption and positive bars indicate nutrient accumulation. Error bar,

SD. *, P < 0.05. **, P < 0.01. ***, P < 0.001. ****, P < 0.0001.

Supplementary Fig. 8. HK1-HK2+ cell line subsets in multiple myeloma and liver cancer.

Distributions of (A) multiple myeloma cell lines and (B) liver cancer cell lines in the CCLE

dataset with respect to HK1 and HK2 expression.

Supplementary Fig. 9. 80% of HK2+ liver cancers are HK1-HK2+. HK1 and HK2 mRNA expression profiles of HK2+ liver cancers in the TCGA_Liver Cancer dataset. HK1+ and

HK2+ are defined by RSEM > 1,000. Data were obtained from the cBioPortal

(http://www.cbioportal.org). RSEM, RNA-Seq by Expectation Maximization.

Supplementary Fig. 10. HK2 knockdown reduces cell proliferation in culture and xenograft tumor progression in HK1-HK2+ cancers from a variety of tissues of origin. (A)

DOX-induced shRNA HK2 knockdown in representative cell lines. The shHK2-1 sequence was used to knockdown HK2 in the indicated liver cancer, bladder cancer, and multiple myeloma cell lines from the CCLE dataset. HK1 and HK2 protein levels were analyzed by Western blotting after a 3-day DOX treatment (25 ng/ml). (B) DOX-induced

HK2 knockdown reduces colony formation in HK1-HK2+ cell lines, but not in HK1+HK2+

cell lines. Cells with integrated shHK2-1DOX were treated with 25 ng/ml DOX for 12-15 days until colonies were formed. (C) DOX-induced shHK2-1DOX HK2 knockdown in HK1-

HK2+ H460HK1KOHK2+ cells. A stable H460HK1KOHK2+/shHK2DOX isogenic cell line was

established, and DOX-induced shHK2-1 HK2 knockdown was confirmed by Western

blotting. (D) Cell proliferation and (E) colony formation in culture were both reduced by

DOX-induced shHK2-1 HK2 knockdown in H460HK1KOHK2+/shHK2DOX cells. ****, P <

0.0001.

Supplementary Table 1. Results output from limma differential expression analysis. Rows correspond to genes and columns report (from left to right): log2 fold change between HK1+HK2+ and HK1-HK2+ liver cancer cell lines, t-statistic, p-value, FDR-adjusted p-value, and b-statistic of log-odds. logFC t P.Value adj.P.Val B RP11-486A14.1 -7.397869166 -14.32599165 2.26E-11 4.35E-07 10.9389893 TUBA1A 5.701991358 8.188978169 1.59E-07 0.000763763 7.606118746 TBX4 -6.933608143 -9.779074417 1.10E-08 0.000106314 7.545482358 EPS8L3 -11.5978194 -8.281188525 1.35E-07 0.000763763 6.955235994 HNF4A -10.97872235 -7.428732944 6.36E-07 0.002038755 5.808832567 AKT3 8.255750678 7.548497305 5.08E-07 0.001956217 5.705883422 STARD10 -3.117898552 -7.047165522 1.31E-06 0.003245446 5.524389015 CIDEB -8.318829187 -6.859279557 1.89E-06 0.003637987 4.795906339 ICAM4 -6.837920786 -7.033086114 1.35E-06 0.003245446 4.661481282 IHH -9.477228856 -6.887744912 1.79E-06 0.003637987 4.657066316 MPST -2.051511139 -6.647506866 2.87E-06 0.004244424 4.583541164 ORM1 -11.12549968 -6.677644553 2.70E-06 0.004244424 4.576704593 HGD -9.129587349 -6.547399211 3.50E-06 0.004809105 4.377481274 NALCN 7.487439988 6.786127323 2.18E-06 0.003816441 4.205931711 ORM2 -11.65221689 -6.308735942 5.65E-06 0.006370791 3.906496267 HS1BP3-IT1 -6.256685276 -6.509029942 3.78E-06 0.004845999 3.843924498 RGN -8.568362944 -6.256170605 6.29E-06 0.006370791 3.819407262 ENTPD2 -7.503451856 -6.279443658 6.00E-06 0.006370791 3.720341527 TM4SF5 -10.857609 -6.203451 7.00E-06 0.006738396 3.705861357 TMEM141 -2.108001768 -6.178480714 7.37E-06 0.006753254 3.676206243 SERPINA1 -8.900797427 -6.061699355 9.36E-06 0.006931072 3.662412602 FAM109A -1.752382847 -6.106623559 8.54E-06 0.006908821 3.616539951 CCL20 -10.56387972 -6.102187603 8.62E-06 0.006908821 3.553836321 TST -2.216762181 -6.029380648 1.00E-05 0.007095997 3.477866605 CEBPA-AS1 -7.505943166 -6.108559572 8.50E-06 0.006908821 3.468848347 TANC2 5.496817303 5.934988259 1.22E-05 0.007095997 3.442487104 ZEB2 7.916507491 6.074831457 9.12E-06 0.006931072 3.356362981 UBLCP1 1.291493765 5.978357265 1.11E-05 0.007095997 3.354224461 CTC-277H1.7 5.557357173 6.342525705 5.28E-06 0.006350025 3.325256668 EPB41L4B -2.999904764 -5.851796227 1.45E-05 0.007524772 3.223697633 ABCC6P2 -6.354389308 -5.99059649 1.08E-05 0.007095997 3.16362269 RBMS3 7.965351493 5.984600612 1.10E-05 0.007095997 3.131523304 SLC2A4 -6.389745054 -5.937546015 1.21E-05 0.007095997 3.108509358 SYT7 -7.804644679 -5.789965447 1.65E-05 0.00769994 2.983769935 TTC38 -1.952085839 -5.83609072 1.50E-05 0.007570849 2.964488511 SERTAD4 9.857442194 5.88069828 1.36E-05 0.007489791 2.934106592 TM6SF2 -6.290962558 -5.954898377 1.17E-05 0.007095997 2.875638812 NIN 1.656969836 5.787134535 1.66E-05 0.00769994 2.831504468 NAP1L4P1 -5.630758448 -5.894264628 1.32E-05 0.007489791 2.80709743 BNC2 9.102795275 5.772940849 1.71E-05 0.00769994 2.78914602 SLC35D1 -1.413705497 -5.757951791 1.76E-05 0.00769994 2.783139728 AS3MT -3.717325293 -5.59089676 2.50E-05 0.008363528 2.773548846 CYBRD1 7.180538507 5.65135222 2.20E-05 0.008153417 2.772262536 MBL2 -8.11004244 -5.767751015 1.72E-05 0.00769994 2.703708823 AMICA1 -8.259744794 -5.739154371 1.83E-05 0.00783176 2.643666769 HK1 6.403931396 5.538012862 2.80E-05 0.008982675 2.638452052 KANK4 -8.705130137 -5.615106132 2.38E-05 0.008173544 2.621501548 KIAA1161 -2.528328619 -5.618281318 2.36E-05 0.008173544 2.610207535 OIT3 -7.791957768 -5.716974276 1.92E-05 0.007856211 2.609120223 SHOX2 6.591689838 5.677731571 2.08E-05 0.007989856 2.587959767 ZFPM1 -3.094716951 -5.497782542 3.05E-05 0.009149321 2.583685098 TEC 5.194302591 5.671009392 2.11E-05 0.007989856 2.570110521 NID1 -2.228612156 -5.705844719 1.96E-05 0.007874722 2.542806048 IQGAP2 -7.864250805 -5.483577448 3.14E-05 0.009149321 2.533634972 KARSP2 -5.603629415 -5.8528884 1.44E-05 0.007524772 2.514730516 AGFG2 -1.986998183 -5.587668557 2.52E-05 0.008363528 2.508103055 GLI3 8.863023796 5.625541792 2.33E-05 0.008173544 2.502192579 LINC00574 -5.506531744 -5.726002279 1.88E-05 0.007856211 2.473315951 HPN-AS1 -5.432103901 -5.794156892 1.63E-05 0.00769994 2.41188743 LINC01091 -5.647122388 -5.670165523 2.12E-05 0.007989856 2.377974832 SGMS2 3.299191523 5.383505249 3.89E-05 0.009970319 2.35701298 DOCK10 10.10241445 5.517560638 2.93E-05 0.008983773 2.345787682 EFNA2 -6.023386647 -5.395109036 3.80E-05 0.009877656 2.307277176 SULT1E1 -7.432970723 -5.491026015 3.10E-05 0.009149321 2.252750084 AQP7 -6.528261877 -5.558576936 2.68E-05 0.008744749 2.246894304 C1orf168 -6.280694764 -5.633862261 2.29E-05 0.008173544 2.245486485 CDIP1 -2.000670451 -5.477503614 3.19E-05 0.009149321 2.242604294 ANXA1 4.775398103 5.51499805 2.94E-05 0.008983773 2.238173188 TRIM10 -6.700887064 -5.439215857 3.46E-05 0.009368624 2.236794834 SOCS3 3.638060423 5.313314185 4.53E-05 0.010020102 2.210511235 RP11-706O15.5 -4.278979228 -5.322178268 4.44E-05 0.010020102 2.195532564 HSD11B2 -8.16313957 -5.352570841 4.16E-05 0.009970319 2.159364235 CIDEC -7.213165378 -5.4429994 3.43E-05 0.009368624 2.133226382 NFATC2 -4.040313371 -5.271567772 4.95E-05 0.010358653 2.128541087 PROX1-AS1 -6.655818713 -5.524242446 2.88E-05 0.008983773 2.108560292 CCDC109B 4.334977908 5.299196902 4.67E-05 0.010089577 2.106406238 CDHR2 -7.567622436 -5.312980425 4.53E-05 0.010020102 2.095390389 SEMA3C 4.624853226 5.288672346 4.77E-05 0.01020598 2.080764753 ISX -9.211595835 -5.352822782 4.16E-05 0.009970319 2.071766524 PLIN5 -6.819332231 -5.357718807 4.12E-05 0.009970319 2.010351542 CBLC -7.137019162 -5.432641378 3.51E-05 0.00936914 2.00905328 NOTCH2 1.840146455 5.449434182 3.38E-05 0.009368624 2.006705012 TCAF1 -1.439814953 -5.444988921 3.41E-05 0.009368624 1.990471407 PROX1 -9.774533767 -5.2332554 5.38E-05 0.01089696 1.990335711 SPDL1 1.499612179 5.400653843 3.75E-05 0.009877656 1.980462961 CAMSAP3 -6.659345082 -5.200313525 5.78E-05 0.01089696 1.975424618 ITGAL -6.921633889 -5.314199067 4.52E-05 0.010020102 1.972464569 ZNF365 7.921956631 5.342856739 4.25E-05 0.009970319 1.969255841 SLC30A4 6.230457189 5.315340884 4.51E-05 0.010020102 1.964061628 MYH14 -5.937875635 -5.193929129 5.86E-05 0.01089696 1.96089608 GATA2-AS1 -4.454216892 -5.1752741 6.10E-05 0.010979699 1.883790752 WNT9A 6.255469858 5.280735002 4.86E-05 0.010267768 1.837603311 ID1 -2.769540195 -5.353057894 4.16E-05 0.009970319 1.832836641 ZG16 -6.285896036 -5.368048321 4.03E-05 0.009970319 1.815430339 SEMA4G -3.656826678 -5.199733953 5.78E-05 0.01089696 1.814529904 KLHL25 -1.40322396 -5.174647438 6.11E-05 0.010979699 1.801820511 RP11-379B8.1 -5.633289536 -5.234785259 5.36E-05 0.01089696 1.750541304 PFKP 5.838342837 5.131869545 6.70E-05 0.011406299 1.731349622 XPNPEP2 -5.634844225 -5.347177464 4.21E-05 0.009970319 1.724989581 CHST9 -7.109762073 -5.101569769 7.15E-05 0.011765082 1.718485319 PCSK6 -6.002506386 -5.06908599 7.68E-05 0.012137621 1.714746443 DOK4 -2.533649186 -5.194355208 5.85E-05 0.01089696 1.696316485 APOA4 -7.369986764 -5.231184362 5.40E-05 0.01089696 1.693356877 ANTXR1 5.247785935 5.050808518 7.99E-05 0.012154635 1.672325432 SERPINA7 -8.015366867 -5.180726844 6.03E-05 0.010979699 1.665693416 CASC19 -5.433265671 -5.304328832 4.62E-05 0.010089577 1.661926356 RHOU -4.880856034 -5.043846622 8.11E-05 0.012154635 1.638934273 DSTYK 1.413522205 5.165812486 6.22E-05 0.011079573 1.637224412 HTR7P1 5.224247281 5.204703021 5.72E-05 0.01089696 1.620296019 TSPAN17 1.407780014 5.194012095 5.85E-05 0.01089696 1.613777411 CREB3L3 -9.413944929 -5.036148735 8.25E-05 0.012154635 1.602948543 SERTAD4-AS1 7.517230984 5.154339111 6.38E-05 0.011079573 1.595309013 AGXT -7.945203973 -5.117130353 6.92E-05 0.011572097 1.581768477 ADGRD1 -8.574150471 -5.046573204 8.06E-05 0.012154635 1.578415398 ZNF444 -1.294907212 -5.191288962 5.89E-05 0.01089696 1.5665535 CYTH3 1.990460263 5.149376808 6.45E-05 0.011079573 1.557654723 TRERF1 6.229102918 5.015961284 8.62E-05 0.012460098 1.498175244 COL27A1 -2.555877467 -5.152346353 6.41E-05 0.011079573 1.492397574 RP11-539L10.2 -4.357759566 -5.217136002 5.57E-05 0.01089696 1.487602729 RP11-223I10.1 -4.92198405 -5.221327604 5.52E-05 0.01089696 1.486016149 HULC -9.650616958 -5.0132214 8.67E-05 0.012460098 1.480125277 MTMR6 1.2602832 5.096123029 7.24E-05 0.011804203 1.475419329 EFNA1 -2.936707017 -5.011802483 8.70E-05 0.012460098 1.456120178 MOGAT3 -8.861650532 -5.008020321 8.77E-05 0.012460098 1.453465534 QSOX1 4.112357453 5.073260928 7.61E-05 0.012137621 1.434776983 ZBTB18 2.094725098 5.034629692 8.27E-05 0.012154635 1.402578313 TEAD1 1.392126785 5.160868054 6.29E-05 0.011079573 1.39848436 PLA2G12B -9.822587107 -4.950385097 9.94E-05 0.013408219 1.371474969 COPS8 0.806475846 5.118917143 6.89E-05 0.011572097 1.367146996 PLXNB1 -3.119593354 -5.081637493 7.47E-05 0.012079306 1.356220476 POU2AF1 -6.545534861 -5.060497644 7.82E-05 0.012137621 1.356102401 LINC00870 -5.409108444 -5.104497483 7.11E-05 0.011765082 1.333097052 SERPINA10 -7.041897819 -4.91564317 0.0001073 0.014120064 1.330237799 FAM3B -7.1899135 -5.00259408 8.87E-05 0.012460098 1.325212908 EPB41L5 -1.679260697 -5.05167613 7.97E-05 0.012154635 1.297039839 CACFD1 -1.620801352 -4.981313022 9.29E-05 0.012867599 1.288348428 MAN1A1 -4.25040019 -5.060923126 7.81E-05 0.012137621 1.28490362 CTD-3080P12.3 -6.948469366 -5.00038295 8.92E-05 0.012460098 1.259807899 NR2F6 -1.575269309 -5.038572354 8.20E-05 0.012154635 1.250955684 SLC26A3 -5.36460131 -5.06524232 7.74E-05 0.012137621 1.248978424 SLC13A5 -8.237129207 -4.88909675 0.000113725 0.014286701 1.228646688 ATP8A2 7.193046225 4.968530409 9.56E-05 0.013137383 1.201941825 INSR -1.665870781 -4.999365589 8.94E-05 0.012460098 1.198411687 MGAT5B 8.631496948 4.886655249 0.000114335 0.014286701 1.194677347 BHLHA15 -6.719297752 -4.934690197 0.000102919 0.013753223 1.178982116 RNF182 8.300354537 4.878042689 0.000116515 0.014372389 1.167698098 LZTS3 -1.832729898 -4.949492404 9.96E-05 0.013408219 1.128212229 NPHP3 1.094572092 4.912515887 0.000108037 0.014120064 1.100079389 TMEM52 -5.599194412 -4.831153035 0.000129145 0.015532148 1.08419308 FOXA2 -7.059845613 -4.74935097 0.000154615 0.017874996 1.072678913 UNC93A -7.446392378 -4.766936277 0.000148739 0.017346631 1.037945681 AC099684.1 -5.600877504 -4.911125721 0.000108366 0.014120064 1.036840443 HP -8.151863978 -4.823763402 0.000131259 0.015688355 1.036726418 ABL2 1.282359804 4.960787656 9.72E-05 0.013266769 1.021460554 RTKN -2.370544725 -4.904678285 0.000109908 0.014120064 1.007959698 SLC41A1 1.931005207 4.896513194 0.000111891 0.014168244 1.005875209 ABAT -5.880836307 -4.707181554 0.000169685 0.018447711 0.992245094 SLC19A2 -1.5399238 -4.855317755 0.000122471 0.014915877 0.961391827 HRG -5.472649336 -4.880270098 0.000115947 0.014372389 0.946527432 RP11-166P13.4 -5.550920272 -4.860285917 0.000121143 0.0148481 0.942086768 EFNA5 7.6441159 4.73446646 0.000159772 0.017874996 0.93240676 WDR54 2.341329819 4.727427401 0.000162272 0.017945962 0.918938852 WWP1 -1.01829742 -4.907978529 0.000109116 0.014120064 0.915730304 TRIM15 -7.024683112 -4.685375695 0.000178055 0.01872297 0.907681673 F11R -2.630572457 -4.904018744 0.000110067 0.014120064 0.902199923 GLI2 9.722260819 4.71959822 0.000165099 0.018154249 0.889099971 SLC22A7 -6.310442416 -4.793289411 0.000140356 0.016569815 0.885223894 GCDH -1.087909499 -4.813462139 0.000134265 0.015948576 0.855792692 RP11-620J15.3 2.530210644 4.640398554 0.000196667 0.019813967 0.854630102 BCAS1 -6.834820153 -4.661956302 0.000187512 0.019295637 0.846732041 SERPINA11 -6.954363283 -4.745949628 0.000155778 0.017874996 0.81384386 LINC00565 6.116187603 4.736127479 0.000159188 0.017874996 0.80638559 VMP1 1.134160194 4.896418493 0.000111915 0.014168244 0.802652735 HNF1A -4.792310066 -4.641527258 0.000196177 0.019813967 0.79941846 CACNG8 7.070352454 4.686956083 0.000177434 0.01872297 0.777425247 CYP19A1 -6.174060597 -4.682079851 0.000179356 0.018757279 0.774365931 TMEM150A -1.728264883 -4.731311116 0.000160888 0.017895758 0.768247271 LONRF2 7.602846929 4.657469498 0.000189381 0.019384329 0.744756056 RP11-932O9.9 4.93936081 4.742977554 0.000156802 0.017874996 0.734173774 TAF9B 1.299213292 4.771691065 0.00014719 0.017270614 0.727759165 CNRIP1 9.910765182 4.642705469 0.000195666 0.019813967 0.715480326 FOXA1 -5.727938103 -4.580404325 0.000224609 0.021187026 0.710138462 IL1R2 -5.865758853 -4.631439131 0.000200605 0.019898121 0.701367288 SLC46A3 5.871675255 4.608629832 0.000210994 0.020300764 0.699889762 NAT8 -7.984948011 -4.615115584 0.000207985 0.020287096 0.695903928 THSD1 4.966052824 4.622520915 0.000204603 0.020190688 0.695763996 XBP1 -1.514037651 -4.845776417 0.000125063 0.015135808 0.688670565 SERPINA5 -8.485750593 -4.556397832 0.000236889 0.021915632 0.6853768 LINC01111 4.868226384 4.738447875 0.000158376 0.017874996 0.681195533 TTBK1 -5.007327851 -4.69544139 0.00017414 0.01872297 0.629635134 ZSCAN2 -1.516828677 -4.634971062 0.000199043 0.019845516 0.625490615 MAP3K12 2.578795375 4.550834429 0.00023983 0.021970183 0.603503698 RP11-35N6.1 -6.688083216 -4.636085493 0.000198553 0.019845516 0.601326584 SLC25A12 3.376306109 4.533339142 0.000249324 0.022245207 0.593309495 FTOP1 -4.927118995 -4.665201856 0.000186171 0.019295637 0.579396108 RP11-297L17.2 -6.201270342 -4.609711087 0.000210489 0.020300764 0.570838737 DYNC2H1 5.740378568 4.512596191 0.000261076 0.02278351 0.570558365 TCAF1P1 -1.809424572 -4.60402466 0.000213157 0.020406834 0.569490538 CPN1 -9.458975048 -4.509554119 0.000262846 0.02278351 0.540748195 GLTPD2 -6.995893797 -4.499549853 0.000268753 0.02306094 0.533471657 PPFIBP2 -2.72768197 -4.565917818 0.00023194 0.02159119 0.518360973 CHD7 -1.703105848 -4.737998561 0.000158533 0.017874996 0.513535453 ABCC6P1 -8.297912264 -4.476671713 0.000282771 0.023451178 0.506480903 ABCC6 -7.308452043 -4.455737394 0.000296247 0.023822748 0.479496634 DSC2 -4.182340939 -4.474219136 0.000284317 0.023451178 0.466588102 ST3GAL4 1.700313666 4.548821884 0.000240904 0.021970183 0.458766245 SOAT2 -8.762448659 -4.472767278 0.000285236 0.023451178 0.458314233 TFR2 -8.638867169 -4.493217384 0.000272561 0.023105235 0.457968234 CTB-50L17.14 -5.655374862 -4.56671407 0.000231531 0.02159119 0.457782343 HRC -6.769263997 -4.549164605 0.000240721 0.021970183 0.452982205 TMPRSS6 -6.519853716 -4.456619861 0.000295666 0.023822748 0.441474625 CAMSAP2 1.297564129 4.688923438 0.000176665 0.01872297 0.426850104 SHISA4 6.888673817 4.46904052 0.00028761 0.023451178 0.424529391 BAIAP2L2 -6.634456499 -4.4312549 0.000312833 0.024704709 0.419254969 COL6A2 5.153436978 4.512904772 0.000260897 0.02278351 0.40757452 AKR1D1 -6.376651991 -4.50572439 0.000265091 0.022875112 0.402390274 ELOVL5 0.877733037 4.708210405 0.0001693 0.018447711 0.385533694 F11 -6.708427916 -4.469289653 0.000287451 0.023451178 0.379104627 FAM114A2 1.745850421 4.469294567 0.000287448 0.023451178 0.376597321 MOCS1 -1.309687716 -4.53266216 0.000249699 0.022245207 0.374330142 APOA1 -15.48775777 -4.400968567 0.000334658 0.025160713 0.360858747 EIF2AK2 1.008613544 4.663346033 0.000186936 0.019295637 0.358530344 APOC3 -10.21807008 -4.408454926 0.000329124 0.025160713 0.352877185 CSNK1A1 0.670782163 4.693504878 0.000174886 0.01872297 0.352390247 ZXDA 4.731201751 4.433552892 0.000311237 0.024704709 0.34966539 NIPSNAP1 -1.624285741 -4.690104893 0.000176204 0.01872297 0.347281196 ARID3A -3.467755009 -4.613898646 0.000208546 0.020287096 0.342601604 REEP6 -2.646075209 -4.495808679 0.000270996 0.023074223 0.34120244 AQP4 -4.436760479 -4.465671029 0.000289773 0.023527862 0.340789985 CTAGE3P -4.759370207 -4.520681311 0.00025643 0.022739552 0.336468915 RP11-116D2.1 -6.255139341 -4.498063651 0.000269642 0.02306094 0.332975744 AGT -9.413596236 -4.376619416 0.000353316 0.025656109 0.316090083 NANOGP1 -5.314978608 -4.489115824 0.000275057 0.023214533 0.273783837 NFIB 3.208797802 4.404429193 0.000332088 0.025160713 0.250751939 FRYL 1.146880738 4.585720913 0.000221978 0.021086048 0.234705298 CUL4B 1.520353172 4.613472787 0.000208743 0.020287096 0.222267547 PRR26 -4.694376116 -4.354990128 0.000370771 0.026220618 0.22204412 CCND3 2.018712246 4.534908835 0.000248457 0.022245207 0.220702384 SLC7A9 -6.118505347 -4.401551514 0.000334224 0.025160713 0.217328299 PLP2 4.909475992 4.409455951 0.000328391 0.025160713 0.21549224 AC069368.3 4.458380293 4.412766175 0.000325979 0.025160713 0.184412435 KIF12 -6.588286366 -4.309702751 0.000410192 0.027456288 0.182791667 ESPN -9.778141759 -4.317096706 0.000403478 0.027290539 0.174236438 EPHB4 -1.923884031 -4.584777094 0.000222443 0.021086048 0.173570678 PLG -7.099950363 -4.372449838 0.000356615 0.025701689 0.159401351 RP11-503C24.6 -6.402961865 -4.359247333 0.000367268 0.026082596 0.143552836 C4BPA -8.405132038 -4.291572274 0.000427136 0.027583545 0.125480839 APOC1P1 -4.996241749 -4.397828639 0.000337007 0.025160713 0.11791105 KRT18P59 4.377186988 4.405521098 0.000331282 0.025160713 0.115170688 MPZL3 -5.918023681 -4.274036866 0.000444196 0.027871157 0.11388729 MAL2 -4.942617055 -4.353516803 0.000371991 0.026220618 0.112287723 ACAA1 -1.291464942 -4.538079913 0.000246715 0.022245207 0.105307997 PIAS3 1.418085344 4.482037425 0.000279418 0.023451178 0.095925573 PKLR -7.839400278 -4.31630801 0.000404189 0.027290539 0.092849296 ITGB1BP1 1.086220343 4.51775612 0.000258101 0.022782748 0.083470271 RP11-168L7.1 -4.630414729 -4.387939546 0.000344515 0.025303415 0.08328726 MTSS1 -3.239054613 -4.366014331 0.000361768 0.025975784 0.077192665 IDS 2.563113109 4.511446189 0.000261743 0.02278351 0.074175991 SMOC1 -5.752774934 -4.254085944 0.000464443 0.028108659 0.074053176 ASPHD2 3.045563468 4.273577148 0.000444652 0.027871157 0.065896533 CORO2A -3.377564985 -4.359181063 0.000367322 0.026082596 0.064757046 A1CF -10.06258993 -4.248700477 0.000470067 0.02823344 0.061670741 CCR6 -8.262864543 -4.275249455 0.000442994 0.027871157 0.058969924 AC114730.3 -5.922402611 -4.302260631 0.000417063 0.027484764 0.051556901 DMXL1 0.91883507 4.470306705 0.000286801 0.023451178 0.049501093 MEP1A -9.604907054 -4.2564574 0.000461989 0.028108659 0.048826895 IQGAP1 1.205406477 4.565295879 0.00023226 0.02159119 0.046222697 SLC9A5 4.106604761 4.285718252 0.000432757 0.027586149 0.045450895 GAB3 5.125446158 4.305792192 0.000413788 0.027484764 0.044692637 LINC01116 5.57920661 4.29154413 0.000427163 0.027583545 0.037936643 RP11-366L5.1 -4.573957722 -4.34805489 0.00037655 0.026445098 0.036809459 FETUB -5.4485683 -4.323129715 0.000398082 0.027164154 0.020559828 SLC17A2 -5.556570191 -4.33778074 0.000385279 0.026765097 0.01954431 SCARB1 -1.756758748 -4.538361643 0.000246561 0.022245207 0.018878675 CCDC7 3.660411057 4.271620097 0.000446601 0.027902381 0.011404551 CFAP36 1.671009175 4.373543248 0.000355747 0.025701689 0.005546346 RP11-299G20.2 -3.092341303 -4.218519808 0.000502875 0.028475477 0.001576338 ADAMTSL4 -2.645703556 -4.324208903 0.000397124 0.027164154 -0.005077629 SH3GL3 5.54608173 4.324303491 0.000397041 0.027164154 -0.009170006 RHBG -7.8006908 -4.240088666 0.000479202 0.02846075 -0.017251144 GPR155 3.354401256 4.215403694 0.000506391 0.028475477 -0.017785634 RP11-528A4.2 -5.877152666 -4.289910288 0.000428724 0.027586149 -0.018531574 ZHX2 -2.299261486 -4.397383187 0.000337342 0.025160713 -0.021413946 TMPRSS2 -6.110960336 -4.219022954 0.000502309 0.028475477 -0.023969939 LINC00883 4.395892386 4.21693042 0.000504665 0.028475477 -0.024006181 ZNF462 4.909872377 4.203234237 0.000520362 0.028691456 -0.028035603 GYLTL1B -6.741880996 -4.211767398 0.000510525 0.028475477 -0.02823283 VTN -9.253767675 -4.198146867 0.000526316 0.028854436 -0.038465008 EFCAB12 -3.568356867 -4.228887363 0.000491352 0.028475477 -0.040117643 EGFR-AS1 -5.796413664 -4.211943443 0.000510324 0.028475477 -0.04408157 FUT6 -5.570609797 -4.280939755 0.0004374 0.027687115 -0.052313484 PREX1 4.585103351 4.201270889 0.000522652 0.028735387 -0.060815586 DPP4 -3.192673628 -4.421976774 0.000319362 0.024981608 -0.065346373 RBP5 -5.537339665 -4.184408616 0.000542742 0.029100396 -0.07148074 DQX1 -5.253596676 -4.219820137 0.000501415 0.028475477 -0.072012799 ENPP7 -4.80896372 -4.295959881 0.000422972 0.027583545 -0.072649652 DRC7 -4.971611744 -4.286911269 0.000431605 0.027586149 -0.076171 TMEM82 -5.46346452 -4.28405083 0.000434371 0.027586149 -0.077787328 LIN28B -7.369463727 -4.181794931 0.000545925 0.029100396 -0.084295186 ZBTB16 -6.258977027 -4.260476996 0.000457858 0.028108659 -0.08572695 F13B -6.082076764 -4.25689741 0.000461535 0.028108659 -0.099602469 USP48 0.66776102 4.454415561 0.000297119 0.023822748 -0.107294736 CTD-2292P10.4 4.805814932 4.254022449 0.000464509 0.028108659 -0.107413847 TMEM255B 6.901784446 4.209009133 0.000513684 0.028541552 -0.111344072 GNG11 7.288541074 4.182370285 0.000545223 0.029100396 -0.112687875 DCLK2 6.410084068 4.183965068 0.000543281 0.029100396 -0.114974664 ZCRB1 0.837912215 4.426937947 0.000315854 0.024808054 -0.118760343 TTC6 -6.006448856 -4.175122844 0.000554136 0.029166893 -0.12473549 PADI1 7.304131095 4.214224518 0.000507728 0.028475477 -0.128276415 CD70 8.647120738 4.177881126 0.000550727 0.029166893 -0.130027729 APOC4 -4.560016876 -4.2652149 0.000453037 0.028031478 -0.130430408 SLC51B -8.024725193 -4.168486993 0.000562426 0.029409678 -0.136498657 KCTD12 7.011238286 4.166388306 0.000565073 0.029468047 -0.138168343 ECE2 -1.387144605 -4.298302214 0.000420766 0.027540108 -0.152504857 PSMD9 0.757546436 4.398258372 0.000336685 0.025160713 -0.152696794 AFAP1L1 6.648952167 4.150522955 0.000585499 0.029997259 -0.157200191 SERPINA4 -8.444371507 -4.152339732 0.000583122 0.029997259 -0.157975597 C8B -5.772609927 -4.230349647 0.000489749 0.028475477 -0.160272022 SLC25A42 -1.794578862 -4.247838631 0.000470973 0.02823344 -0.16247138 RPH3AL -2.58526029 -4.174626972 0.000554751 0.029166893 -0.164135019 RP11-407N17.3 -6.617245883 -4.133700199 0.000607968 0.030781627 -0.168065904 NR3C1 2.150779011 4.384639093 0.000347058 0.025393276 -0.170349215 TJP2 -1.769350255 -4.448243829 0.000301227 0.024051881 -0.171560872 CTD-2269F5.1 5.786289047 4.213289448 0.000508791 0.028475477 -0.1761164 EXOC3L4 -6.226134854 -4.13026864 0.000612657 0.030781627 -0.1852288 GCH1 -2.199449211 -4.21699807 0.000504589 0.028475477 -0.193432184 AMT -3.50710177 -4.183321811 0.000544064 0.029100396 -0.204295625 GPX8 4.713205178 4.145164996 0.000592563 0.03016584 -0.206398464 EFNA4 -1.691770068 -4.176179192 0.000552828 0.029166893 -0.208590707 SHF -4.133115899 -4.111676235 0.000638702 0.031115282 -0.212103306 UBA3 0.758574309 4.392509637 0.000341024 0.025239733 -0.217982703 DUSP9 -7.902731973 -4.116531696 0.000631795 0.030988197 -0.218794293 RUFY2 1.230467266 4.267254557 0.000450977 0.028031478 -0.219466329 LRRIQ1 4.326205034 4.214140302 0.000507824 0.028475477 -0.225718245 MRC2 7.482684337 4.106043526 0.00064681 0.031272758 -0.226347141 RRAGC 1.272293635 4.329187998 0.000392737 0.027164154 -0.233098143 MIA2 -5.504515819 -4.12259761 0.000623271 0.030988197 -0.233954242 CAMK1D 5.150282199 4.100839029 0.000654393 0.031432547 -0.234272443 VWA7 -2.725485633 -4.099624428 0.000656176 0.031432547 -0.236462276 FAM129A 11.05753533 4.114744793 0.000634328 0.030988197 -0.241639273 TRIM7 4.951509711 4.117006858 0.000631123 0.030988197 -0.242049271 RP11-680F8.3 4.016821185 4.183129803 0.000544297 0.029100396 -0.245206046 MARVELD3 -5.859103368 -4.099303013 0.000656648 0.031432547 -0.255442137 BEND3 -1.423796775 -4.242470051 0.000476658 0.028397311 -0.255782049 PJA2 1.07429455 4.394651622 0.000339401 0.025216556 -0.257108821 MVB12B -1.869759449 -4.227391042 0.000492999 0.028475477 -0.258008998 TMEM150B -5.646819247 -4.163095703 0.000569253 0.02960575 -0.25909351 DSTN 1.613343496 4.430650618 0.000313254 0.024704709 -0.262446648 CEP55 1.344022033 4.379300461 0.000351212 0.025599861 -0.262792045 CDC42EP3 7.458786428 4.085283835 0.000677596 0.032115697 -0.265145897 CCDC74A 4.327764703 4.107536446 0.000644651 0.031272758 -0.265167311 MYO5A 1.8828394 4.316358236 0.000404143 0.027290539 -0.271158831 LYSMD2 5.663576881 4.10658471 0.000646026 0.031272758 -0.277229258 FRAT2 -2.378756659 -4.218123262 0.000503321 0.028475477 -0.278059095 APOC1 -5.625531132 -4.131393212 0.000611117 0.030781627 -0.282271776 PEA15 1.624721794 4.404886506 0.00033175 0.025160713 -0.288503939 MBOAT2 6.540281904 4.076346409 0.000691299 0.032571095 -0.29576196 FAM151A -6.736202666 -4.101306719 0.000653708 0.031432547 -0.297837398 RNF217 2.514223743 4.148135317 0.000588636 0.030045421 -0.302137781 TAT -5.491706346 -4.121880049 0.000624273 0.030988197 -0.304949444 ARL6IP5 1.575061038 4.326929443 0.000394721 0.027164154 -0.318631215 SLC9A9 6.107277801 4.137306171 0.00060308 0.030620231 -0.320055266 ZDHHC2 1.751873667 4.227427412 0.000492959 0.028475477 -0.321317331 TTBK2 1.180571569 4.2221799 0.000498776 0.028475477 -0.323194113 OXER1 -6.960074286 -4.070484539 0.000700438 0.032714857 -0.335343578 STAMBPL1 4.009993196 4.051400165 0.000731039 0.033099726 -0.336919205 PLLP -6.120846739 -4.048932686 0.000735092 0.033134908 -0.338289627 CTD-2545H1.2 -5.920058586 -4.088991062 0.000671992 0.032007772 -0.342777423 TMEM14B 1.294737921 4.344313866 0.000379705 0.02656971 -0.343764438 CLIC4 1.101576096 4.390752907 0.000342362 0.025241634 -0.344128349 NDRG2 -3.145519769 -4.185074556 0.000541934 0.029100396 -0.344877153 MAP3K11 -1.122289146 -4.36372091 0.000363623 0.026011883 -0.346395817 PRAP1 -6.559031768 -4.069098239 0.000702617 0.032737166 -0.346791225 MTHFS -0.916121392 -4.265668647 0.000452578 0.028031478 -0.348100788 KLF15 -7.586754914 -4.05316562 0.000728153 0.033046796 -0.350213625 C8orf4 -7.050822115 -4.055169774 0.00072489 0.033046796 -0.353575196 BBX 1.101727205 4.338436165 0.000384717 0.026765097 -0.354242343 FRAT1 -3.837117281 -4.040486072 0.000749139 0.033369645 -0.358713729 DHCR24 -1.627137413 -4.402699298 0.00033337 0.025160713 -0.359749874 KIF13B -1.960549121 -4.302398818 0.000416935 0.027484764 -0.361141088 IFT172 1.166267845 4.245209931 0.000473748 0.028311599 -0.37497184 HMGCS2 -8.169450764 -4.043453361 0.000744174 0.033369645 -0.381438882 ARG1 -6.524600572 -4.080966029 0.000684182 0.03234817 -0.383136784 AGMAT -7.642393207 -4.028162534 0.000770118 0.033496056 -0.384451169 IQSEC2 5.689793644 4.03323485 0.000761413 0.033468349 -0.387506941 HNF4A-AS1 -4.438854211 -4.117465923 0.000630474 0.030988197 -0.389607129 RP5-1024N4.4 -4.30705663 -4.117787148 0.000630021 0.030988197 -0.390720639 SERPINC1 -7.720568947 -4.056707544 0.000722396 0.033046796 -0.390778529 SEC22C 0.807306751 4.303526074 0.000415887 0.027484764 -0.394717619 CBR3 6.704290557 4.034231405 0.000759714 0.033468349 -0.394726394 HNF1A-AS1 -5.932509196 -4.075712317 0.000692282 0.032571095 -0.398812884 C8A -6.714869445 -4.064641857 0.000709667 0.032827219 -0.403741289 FEZ2 1.046613175 4.291703857 0.000427011 0.027583545 -0.407214665 C1QL1 6.181782504 4.029433946 0.000767927 0.033496056 -0.416137068 NAV1 7.45233194 4.007132878 0.000807289 0.034171077 -0.42169309 TMC7 -2.609933566 -4.067236635 0.000705553 0.03279459 -0.425093647 CHDH -6.435193217 -4.01679729 0.000789988 0.034008378 -0.426733082 FAM26E 6.622924598 4.025570109 0.000774606 0.033496056 -0.428304336 SMLR1 -9.502900367 -4.006754531 0.000807974 0.034171077 -0.429842966 RP11-452K12.4 -4.026542719 -4.073788355 0.000695272 0.032574556 -0.42985517 LINC00839 6.492821414 4.01275712 0.000797175 0.034147789 -0.432471913 LINC01420 4.050729394 4.007039274 0.000807458 0.034171077 -0.432974801 GAL3ST1 -5.538661737 -3.9973999 0.000825096 0.034441056 -0.446753557 KDF1 -6.075800133 -4.0536274 0.0007274 0.033046796 -0.448016079 BCR -1.155284303 -4.308903802 0.000410924 0.027456288 -0.449548897 NAV3 8.084137078 3.998359274 0.000823324 0.034441056 -0.45457357 AMZ2 1.11450731 4.260814686 0.000457513 0.028108659 -0.475317591 RP11-395G23.3 6.687556051 4.000966991 0.000818525 0.034390544 -0.480256029 KIF3A 1.815582087 4.073487526 0.000695741 0.032574556 -0.48647748 RP11-380J14.1 7.720984434 4.010803688 0.000800673 0.034162652 -0.496790152 SPOCK2 -4.789486227 -3.970763023 0.000875871 0.035482911 -0.497383756 HPR -5.892372589 -4.03683555 0.000755293 0.033468349 -0.500287939 S1PR1 7.867228892 4.004213587 0.000812589 0.034215869 -0.502804539 FBN3 -6.947581069 -3.980740818 0.000856494 0.035141841 -0.505538671 AC108142.1 7.939098261 3.983091337 0.000851993 0.035055772 -0.509310389 GNG10 1.068480305 4.256140301 0.000462316 0.028108659 -0.513117429 UPK3A -5.251440935 -4.036295536 0.000756208 0.033468349 -0.514871087 RIPK1 0.961052498 4.232803145 0.00048707 0.028475477 -0.518402273 RP11-713M15.2 -6.340500756 -3.972405025 0.000872652 0.035482911 -0.525409287 MORN2 1.682477657 4.034344514 0.000759522 0.033468349 -0.525689032 CEBPA -7.948373071 -3.952458296 0.000912567 0.036282084 -0.534168074 GPRASP2 2.233358747 3.988459087 0.000841801 0.034882863 -0.538553626 HSD17B4 -0.760133069 -4.284707425 0.000433735 0.027586149 -0.541426374 RP11-379B18.5 5.180423978 4.004793228 0.000811534 0.034215869 -0.542875319 DAGLA -1.572841192 -4.161016781 0.000571907 0.029663641 -0.543633607 OPLAH -2.165751289 -4.121138081 0.000625311 0.030988197 -0.553544382 VCL 1.689350161 4.29978328 0.000419377 0.027540108 -0.553781947 CRB3 -7.355312773 -3.939408865 0.000939665 0.036901971 -0.557988195 CYP3A7 -4.942704209 -4.011988095 0.00079855 0.034147789 -0.558412802 PTPN14 1.900191648 4.250835154 0.00046783 0.028220834 -0.559652807 DYNC1H1 0.642076064 4.314480526 0.000405841 0.027306267 -0.560847904 STX2 1.123925936 4.193696336 0.000531582 0.029060325 -0.565186457 NMU 6.944479243 3.967042265 0.000883208 0.035555601 -0.577539982 LINC00460 6.283038538 3.961712491 0.000893826 0.035833122 -0.579541457 SOWAHB -6.480106365 -3.947804032 0.000922141 0.036486498 -0.582744555 RASD1 -5.969283818 -3.927080537 0.000966005 0.037705528 -0.584795588 PPP1R18 2.371018368 4.208146221 0.000514676 0.028541552 -0.585061207 PML 1.390842696 4.187632747 0.000538842 0.029100396 -0.588462247 ODAM -5.960164942 -3.971507866 0.000874409 0.035482911 -0.590583622 SH3BP1 -2.675876838 -4.114635744 0.000634483 0.030988197 -0.591243949 RP11-977G19.5 3.902130245 3.955566156 0.00090623 0.036104721 -0.599586867 LINC00479 -4.375056392 -3.982786624 0.000852575 0.035055772 -0.606949794 FYTTD1 0.91270595 4.218269161 0.000503157 0.028475477 -0.613004437 HAMP -7.748579583 -3.937546124 0.000943598 0.036980962 -0.61377737 RP11-130L8.2 -4.299075033 -3.988534726 0.000841658 0.034882863 -0.617113437 FZD5 -2.51898166 -4.172881328 0.000556923 0.029201257 -0.618130214 GRPR 5.920383364 3.969748193 0.000877866 0.035489026 -0.620769143 SLC22A9 -8.481214106 -3.920990111 0.000979288 0.037893357 -0.621642367 SLC6A4 -7.144928506 -3.93539203 0.000948167 0.037084498 -0.624598048 SERPIND1 -8.637262381 -3.903319405 0.001018874 0.038269465 -0.632034453 NDNL2 1.117770534 4.029683628 0.000767497 0.033496056 -0.632408675 ZFP36L2 -1.351808425 -4.215156954 0.00050667 0.028475477 -0.634052173 CALCOCO1 1.465483384 4.152561991 0.000582832 0.029997259 -0.634527418 TMCC2 4.247762451 3.898402538 0.001030171 0.038269465 -0.6457074 SLC5A9 -8.484797397 -3.897325392 0.001032663 0.038288106 -0.646429181 TIMP2 2.157313909 4.235388439 0.000484263 0.028475477 -0.64775039 FGFR3 -4.89099095 -4.041280691 0.000747806 0.033369645 -0.653010357 TMOD2 5.273147824 3.898756965 0.001029353 0.038269465 -0.65327011 UCA1 -5.926149881 -3.898697841 0.001029489 0.038269465 -0.655421951 RP11-268J15.5 4.661706088 3.915909964 0.000990509 0.037893357 -0.66068878 IFI27L2 3.539014411 3.900810528 0.001024623 0.038269465 -0.660763354 TRIM24 -1.658384084 -4.203583607 0.000519955 0.028691456 -0.671509611 FGFR4 -5.033276243 -4.065104567 0.000708932 0.032827219 -0.680366323 ATP7B -2.766628041 -4.055011598 0.000725147 0.033046796 -0.686616117 KISS1R -6.201117567 -3.892743697 0.001043328 0.038414958 -0.689233666 MYO1A -7.853579564 -3.890286822 0.001049092 0.038452728 -0.689901406 BSPRY -5.343950033 -3.908348211 0.001007449 0.038269465 -0.693607634 SLC6A12 -4.780595019 -3.873764049 0.001088695 0.039085358 -0.700780871 ITGA3 5.195328835 4.094827018 0.000663265 0.031670474 -0.703632347 HDAC9 5.990148393 3.861214694 0.001119769 0.039428284 -0.713438864 SULT2A1 -9.178503018 -3.860810299 0.001120785 0.039428284 -0.716606829 SLC35E4 3.145693213 3.862083377 0.00111759 0.039428284 -0.717536105 RNF145 1.132430881 4.182415086 0.000545169 0.029100396 -0.718426516 DEGS1 1.251606762 4.178957601 0.000549402 0.029166893 -0.722172599 APOA5 -6.026878325 -3.906223928 0.001012259 0.038269465 -0.728773708 SLC30A10 -8.68857795 -3.852056298 0.001143005 0.039630367 -0.734454871 PLCB1 -2.80957787 -4.025776073 0.000774249 0.033496056 -0.736793459 RP11-351J23.2 -5.702564731 -3.899262432 0.001028186 0.038269465 -0.740897461 LAD1 -8.265470795 -3.848227536 0.001152862 0.039828581 -0.74121066 LCN10 -5.513378319 -3.90303512 0.001019524 0.038269465 -0.744854611 PSORS1C1 5.976074145 3.87839918 0.001077437 0.039045407 -0.748318864 GAPLINC 3.776009992 3.911507805 0.001000335 0.038117732 -0.756778229 C11orf63 6.52080298 3.874025232 0.001088057 0.039085358 -0.760863419 C9orf9 2.253457272 3.835299313 0.001186775 0.040635415 -0.763397602 CLIP4 4.051954306 3.892234123 0.001044521 0.038414958 -0.764228808 PTPN6 -4.149788956 -3.855510466 0.001134186 0.039521724 -0.764878155 FOSL2 2.25176676 4.150038624 0.000586134 0.029997259 -0.768865875 ELK4 0.744286224 4.125955798 0.000618602 0.03091885 -0.77040742 STK10 1.56538011 4.062758855 0.000712667 0.032886956 -0.776595535 SSTR5 -6.064397273 -3.863243392 0.001114686 0.039428284 -0.777090513 RBP2 -7.072416357 -3.855738781 0.001133605 0.039521724 -0.783776253 MMD -2.075972324 -4.126432717 0.000617942 0.03091885 -0.78381973 FSIP1 4.203889691 3.867214522 0.001104803 0.039428284 -0.787761178 ALDOB -4.558824449 -3.887325667 0.001056082 0.038562028 -0.78976016 NMB -3.288381665 -3.83894993 0.001177099 0.040375954 -0.790557347 UNC13C -5.490529182 -3.874651703 0.00108653 0.039085358 -0.794386365 SYN3 -5.398202679 -3.840719725 0.001172436 0.04032448 -0.800516668 BAD 1.242842223 4.042553599 0.000745676 0.033369645 -0.805321921 CUEDC1 1.666214967 4.060708027 0.00071595 0.032959385 -0.805347673 BTBD9 1.305410395 3.918015898 0.000985842 0.037893357 -0.806500087 MMP11 -4.051990032 -3.857237559 0.001129801 0.039521724 -0.806605755 SMPDL3A -1.911370895 -3.918792703 0.000984126 0.037893357 -0.809188586 FCER1G -5.440417352 -3.869384501 0.00109944 0.039397628 -0.809693656 AFF4 0.75650684 4.155707697 0.000578743 0.029937518 -0.823358 AP000344.3 -5.501994137 -3.858907857 0.001125577 0.039521724 -0.82727675 ALG13 0.895179144 4.048830994 0.00073526 0.033134908 -0.827424186 ANKRD30B 5.257723374 3.849120454 0.001150556 0.039820398 -0.832138739 AP000344.4 -4.792305913 -3.862203297 0.001117289 0.039428284 -0.833545745 MAP3K14 2.754635376 3.94719703 0.000923397 0.036486498 -0.840519012 PBX3 1.87828592 3.943093094 0.000931934 0.036748356 -0.843376283 NUGGC -4.075080539 -3.853899439 0.001138291 0.039538138 -0.84679436 GPR63 5.740016245 3.815109833 0.001241739 0.041483989 -0.846807808 RAMP2-AS1 -5.289622779 -3.816343456 0.001238309 0.041441341 -0.851007336 ADORA2A -3.455180504 -3.812336097 0.001249486 0.041598371 -0.851973321 RP11-532F6.3 4.207780301 3.854890223 0.001135764 0.039521724 -0.852548276 C3orf67 3.662335523 3.793995008 0.001301942 0.042535278 -0.857014059 ABCB4 -6.672931821 -3.794623537 0.001300109 0.042535278 -0.85873701 TBC1D32 3.032668372 3.78658569 0.001323752 0.042896992 -0.862969664 BDH1 -4.359706732 -3.786448067 0.00132416 0.042896992 -0.880662796 FOXP4-AS1 -3.920143855 -3.803365629 0.001274873 0.042151858 -0.890129617 HIVEP3 5.625455165 3.777544447 0.001350859 0.043252198 -0.891659796 MGAT4A -4.97988831 -3.821364577 0.001224444 0.041409458 -0.898952746 DSP -2.932830893 -4.132577009 0.000609499 0.030781627 -0.900266673 KIF3C 2.04386487 3.985887526 0.000846668 0.034962318 -0.900328917 GLIS2 1.393875384 3.963908035 0.000889437 0.035731595 -0.900650799 OLFML2B 6.229400593 3.809257932 0.00125814 0.041742048 -0.904322334 CUEDC2 1.196384929 4.019384282 0.000785421 0.033887557 -0.904942637 RP11-37C7.3 3.195000027 3.787125443 0.001322151 0.042896992 -0.906058902 KAZALD1 -2.239504816 -3.817081404 0.001236261 0.041441341 -0.912680169 CCDC170 -4.933753405 -3.803900146 0.001273346 0.042151858 -0.914894764 SERPINI1 -5.128167097 -3.756620096 0.001415735 0.044907001 -0.919038015 CAMK4 7.668399228 3.778158337 0.001349001 0.043252198 -0.924665484 RGS7 6.113326333 3.790058745 0.001313484 0.042767119 -0.933610084 PIPOX -6.759366431 -3.749320573 0.00143909 0.045227254 -0.934125809 CEP290 1.036721093 3.999585149 0.000821064 0.034422085 -0.936086448 MAP7D1 1.563122017 4.08642605 0.000675864 0.032112723 -0.937645427 C1orf106 -5.100068503 -3.810207793 0.001255463 0.041725177 -0.941845925 RP11-747H7.3 -4.522690549 -3.798762221 0.0012881 0.042514195 -0.944861368 SHROOM2 -4.713816655 -3.753046113 0.001427122 0.045019861 -0.945069329 RP11-100E13.1 4.544242625 3.795371846 0.001297929 0.042535278 -0.956919677 UQCRFS1P1 -2.884222942 -3.739553973 0.001470941 0.045801483 -0.957545888 TFAP2A 4.873226516 3.748079846 0.001443098 0.045227254 -0.959429134 RIMKLBP2 3.800699836 3.782283482 0.001336582 0.04314331 -0.962125377 CTSE -7.385101537 -3.744973457 0.001453181 0.045395398 -0.962848572 POLK 1.218597623 3.960479075 0.000896302 0.035857655 -0.969734582 CTD-2020K17.1 5.671281869 3.769059906 0.0013768 0.044009563 -0.976030325 AFM -4.134399021 -3.779913736 0.001343702 0.043238892 -0.979486491 TMEM158 6.612991827 3.727255161 0.001512051 0.046557985 -0.980781467 MTMR2 0.905281432 4.033013598 0.000761791 0.033468349 -0.994069629 GABBR1 3.919862662 3.748761581 0.001440894 0.045227254 -1.000443399 HCFC2 1.507741045 3.816890916 0.001236789 0.041441341 -1.007566332 IFT81 1.28015496 3.893453491 0.001041668 0.038414958 -1.013105421 IFI16 9.893139041 3.705619726 0.001587165 0.047721589 -1.022695324 TTC21A 3.248203034 3.71740349 0.001545805 0.047140917 -1.024742784 TRIM31 -6.179129603 -3.709942474 0.001571866 0.047633729 -1.030642282 ACOT9 1.388616503 4.012020656 0.000798492 0.034147789 -1.040138818 EPHX2 -5.469705475 -3.70236531 0.001598781 0.047921089 -1.046201386 DGAT2 -2.841334318 -3.863007403 0.001115277 0.039428284 -1.046476157 AXL 6.628640161 3.754897794 0.001421211 0.044907001 -1.04756004 ROBO3 5.302505442 3.693231934 0.001631834 0.048458914 -1.048976675 ZSWIM5 -5.22885777 -3.694407944 0.00162754 0.048406109 -1.048999776 ANKS4B -8.734121038 -3.689068643 0.001647125 0.048612927 -1.051317848 MGRN1 -0.736361544 -4.026616215 0.000772792 0.033496056 -1.05231158 SLC35F3 7.184418802 3.708978179 0.001575266 0.047661706 -1.052675851 TMC6 -4.346758711 -3.795296003 0.00129815 0.042535278 -1.052689054 C2orf54 -6.23487578 -3.710300838 0.001570604 0.047633729 -1.054028492 GYG2 -2.536046366 -3.917125593 0.000987812 0.037893357 -1.056331092 FAM102B 2.167359915 3.832403222 0.001194507 0.040729972 -1.057820101 NAGPA -1.053366124 -3.916210591 0.000989841 0.037893357 -1.062029882 KRT23 -9.044718886 -3.68370971 0.001667018 0.048825613 -1.062771518 CX3CL1 -7.138262526 -3.689278429 0.001646351 0.048612927 -1.063197247 ZNF25 3.634053837 3.684143722 0.001665398 0.048825613 -1.063803033 PIK3CG 5.287823686 3.728354967 0.001508328 0.046557985 -1.066555921 BCL2L14 -4.389105914 -3.722601878 0.001527901 0.046743094 -1.07457476 PTRF 2.457437293 4.05336151 0.000727833 0.033046796 -1.075251997 C1orf210 -5.927227227 -3.71268411 0.001562239 0.047491572 -1.077335285 IER5 1.766294627 3.911886801 0.000999486 0.038117732 -1.079653483 NCOR2 1.071287772 4.046821817 0.000738578 0.033206665 -1.083527623 TMEM74B -3.416311426 -3.674903556 0.001700228 0.049160252 -1.083636062 FAM13B 1.362170189 3.941036253 0.000936242 0.036842741 -1.087318907 CPB2 -8.421928869 -3.670707844 0.001716281 0.049160252 -1.087508987 ZNF436 1.128974856 3.816519216 0.001237821 0.041441341 -1.089550752 FBLN1 -3.796682841 -3.993681914 0.000832002 0.03465415 -1.093871302 POMP 0.691896367 4.027938147 0.000770506 0.033496056 -1.097525777 REEP5 1.111789577 4.008371075 0.000805051 0.034171077 -1.102725977 MCTP1 6.942903159 3.670542099 0.001716918 0.049160252 -1.108351324 REEP3 1.034327308 3.987860565 0.000842932 0.034882863 -1.108996281 SLC9B2 -1.482800166 -3.84282676 0.00116691 0.040241649 -1.109028544 GRHL1 -1.794320976 -3.720508955 0.001535084 0.046888302 -1.111362008 ERMARD 1.593837946 3.76160217 0.001400011 0.044603342 -1.121635214 DACT2 -6.256873339 -3.661950004 0.001750277 0.049530276 -1.122974673 AC007879.7 6.585451652 3.66859349 0.001724428 0.049160252 -1.125695736 LCN15 -6.718292435 -3.673609941 0.001705161 0.049160252 -1.127767788 LY6K 6.623236678 3.669839696 0.001719622 0.049160252 -1.128100565 CD47 1.897912467 3.924060562 0.000972569 0.0378849 -1.130805121 CLRN3 -6.470768956 -3.658708206 0.00176303 0.049672029 -1.132657752 SALL1 -5.064220445 -3.690292532 0.001642615 0.048612927 -1.133850498 LEFTY1 -4.465981714 -3.684384556 0.0016645 0.048825613 -1.134984525 C2orf72 -5.642458492 -3.706095862 0.001585473 0.047721589 -1.137823651 CDH1 -5.839738711 -3.695241078 0.001624505 0.048390633 -1.139260252 PON1 -5.120737415 -3.674437562 0.001702003 0.049160252 -1.142938154 LINC01443 4.43433347 3.688144256 0.00165054 0.048639102 -1.146539425 SOX9-AS1 -4.116018501 -3.685096861 0.001661846 0.048825613 -1.150842735 GOLGA8S 3.89515418 3.663989279 0.001742302 0.049396048 -1.150863943 FAM160B1 1.053500649 3.916881837 0.000988352 0.037893357 -1.150981557 ERGIC2 0.727596603 3.956553655 0.000904225 0.036099606 -1.167268757 RSRP1 1.369015273 3.90084334 0.001024548 0.038269465 -1.171221229 PPP2R5C 0.891083194 3.977397067 0.00086294 0.0353078 -1.174298571 BCAM -2.82552849 -3.967066041 0.000883161 0.035555601 -1.175586639 RP11-351J23.1 -4.4155908 -3.663818857 0.001742967 0.049396048 -1.175817368 STXBP3 0.8260166 3.920038345 0.000981381 0.037893357 -1.177560272 TBL1Y -4.687446123 -3.655158489 0.001777101 0.049922266 -1.1981793 UQCRQ 0.704484336 3.949238283 0.00091918 0.036469648 -1.225540051 DYNC1I2 0.840552907 3.976741403 0.000864209 0.0353078 -1.230896192 SLC35D2 -1.264578777 -3.901093067 0.001023974 0.038269465 -1.25853003 MATN3 -3.34430236 -3.743348241 0.001458484 0.045487224 -1.269352588 GAB1 -1.504517239 -3.778675773 0.001347437 0.043252198 -1.277655293 RNF14 1.105311333 3.862565795 0.001116382 0.039428284 -1.282899322 SLC43A1 -4.554925463 -3.705676279 0.001586964 0.047721589 -1.284970835 ATF7IP2 -2.14215162 -3.671989256 0.001711362 0.049160252 -1.28566091 GATA4 -1.924509234 -3.793038302 0.001304738 0.042554369 -1.300419411 CUL2 0.851233014 3.899501778 0.001027635 0.038269465 -1.310064389 YWHAQ 0.821346589 3.971679088 0.000874074 0.035482911 -1.310987426 STRN 1.133817103 3.874666134 0.001086494 0.039085358 -1.31468659 TMX3 1.20674719 3.886310068 0.00105849 0.038576756 -1.317280417 HPRT1 1.143436248 3.888877753 0.001052413 0.038501095 -1.328747738 OGFRL1 2.348762551 3.865378937 0.001109361 0.039428284 -1.329815911 GRAMD4 -1.269103332 -3.823450077 0.001218731 0.041288821 -1.337662127 ERCC1 1.207396729 3.861091903 0.001120078 0.039428284 -1.337974948 PKD2 1.237398146 3.813689157 0.001245701 0.041544228 -1.340015124 CAPN2 3.612227305 3.893642135 0.001041228 0.038414958 -1.345033578 TBC1D9B 0.69213046 3.921351614 0.000978495 0.037893357 -1.347938644 NR6A1 -2.653130615 -3.696969794 0.001618225 0.04827831 -1.368260277 SS18 0.958940972 3.891575186 0.001046065 0.038414958 -1.369091421 NPEPPS 0.838056937 3.907123493 0.001010219 0.038269465 -1.374606008 NOTCH2NL 1.632642505 3.755141177 0.001420436 0.044907001 -1.378270909 FAM83H -3.683485193 -3.723558627 0.001524629 0.046743094 -1.378338189 SCRN3 1.042986949 3.759118693 0.001407827 0.044778214 -1.384682975 RECQL 0.873867225 3.875451732 0.001084582 0.039085358 -1.387207425 UBTD1 1.587913178 3.67881559 0.001685394 0.049076135 -1.396949179 STC2 3.887681994 3.840314392 0.001173502 0.04032448 -1.400712415 CEP97 1.094032799 3.702939161 0.001596726 0.047921089 -1.412609142 NCAPG2 0.711248745 3.878484229 0.001077231 0.039045407 -1.425497699 MAT2B 1.071122252 3.831888746 0.001195886 0.040729972 -1.439151455 CLSTN3 -2.618777655 -3.796332658 0.001295136 0.042535278 -1.439448047 CRTAP 1.636369377 3.878775995 0.001076526 0.039045407 -1.44099752 MSRB3 2.318621087 3.726505786 0.001514592 0.046557985 -1.463839519 RHOQ 1.415026204 3.798018344 0.00129025 0.042514195 -1.478166442 MICB 1.827193594 3.667467622 0.001728782 0.049168192 -1.479070208 GNAI3 0.71170788 3.857258005 0.001129749 0.039521724 -1.487316857 POLR3E -0.889944587 -3.823723816 0.001217984 0.041288821 -1.488725928 XRN1 0.898164966 3.781647304 0.00133849 0.04314331 -1.49434716 ARV1 1.21279434 3.656565773 0.001771509 0.049837946 -1.496481833 LIG4 1.056018942 3.659242624 0.001760922 0.049672029 -1.50539927 TSPAN6 -1.065801621 -3.820177781 0.001227707 0.041441341 -1.507748972 OPTN 1.732920636 3.81722996 0.001235849 0.041441341 -1.511605206 MOGS -0.921537191 -3.832057961 0.001195432 0.040729972 -1.519141181 SEPHS2 -1.332847783 -3.829399972 0.001202579 0.040885557 -1.561892291 FRMD6 2.699511255 3.728320262 0.001508446 0.046557985 -1.572607087 MMGT1 1.063885665 3.731882026 0.001496452 0.046386036 -1.592422303 SLAIN2 0.881917937 3.75631226 0.001416712 0.044907001 -1.594122802 SLC7A2 -3.10244363 -3.68292045 0.001669968 0.04883768 -1.599843376 CPT2 -0.824588489 -3.672539414 0.001709255 0.049160252 -1.616976136 PPP3CB 0.974370368 3.731734948 0.001496946 0.046386036 -1.619367967 CSGALNACT2 1.577754917 3.669001612 0.001722853 0.049160252 -1.630019171 TWSG1 1.993930016 3.722700394 0.001527564 0.046743094 -1.632936646 PLD1 -1.655690738 -3.697889111 0.001614896 0.048253785 -1.654139378 CDC42BPB 0.782904483 3.784761232 0.001329178 0.042987165 -1.654526623 TTC1 0.788066389 3.726636295 0.001514149 0.046557985 -1.690193188 ARHGEF10L -2.09604643 -3.677366589 0.001690873 0.049076135 -1.699541023 PRKCD -0.991539276 -3.676255958 0.001695085 0.049124282 -1.717310221 RPL26L1 0.976859021 3.67820914 0.001687685 0.049076135 -1.721430896 NCKAP1 0.727901346 3.766860949 0.001383604 0.044153706 -1.734632324 STK38 0.914331285 3.701388924 0.001602282 0.047951348 -1.736407417 PPP2CA 0.52015703 3.752095376 0.001430167 0.045042068 -1.741042862 POP7 -0.659069878 -3.689973443 0.00164379 0.048612927 -1.750654636 CENPV -1.699810411 -3.677479571 0.001690446 0.049076135 -1.764921547 PICALM 0.733844899 3.73645801 0.001481183 0.046045899 -1.76990076 TCEAL4 1.372330788 3.677748118 0.001689429 0.049076135 -1.78464234 TMEM14C 0.907417304 3.713760857 0.001558474 0.047452087 -1.787563395 TNPO1 0.771130896 3.745442768 0.001451653 0.045395398 -1.788463041 MRPL24 0.82615857 3.670608137 0.001716665 0.049160252 -1.791019188 TYRO3 -1.279999199 -3.667200399 0.001729817 0.049168192 -1.825596026 PON2 -1.10182336 -3.706150952 0.001585277 0.047721589 -1.83902158 PFN2 1.119561942 3.660268966 0.001756879 0.049644087 -1.919691189