DOCSLIB.ORG

The Expression of CXCL10/CXCR3 and Effect of the Axis on the Function of T Lymphocyte Involved in Oral Lichen Planus

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
The Expression of CXCL10/CXCR3 and Effect of the Axis on the Function of T Lymphocyte Involved in Oral Lichen Planus Inflammation, Vol. 42, No. 3, June 2019 ( # 2018) DOI: 10.1007/s10753-018-0934-0 ORIGINAL ARTICLE The Expression of CXCL10/CXCR3 and Effect of the Axis on the Function of T Lymphocyte Involved in Oral Lichen Planus Jiaxiang Fang,1,2 Chen Wang,1,2 Chen Shen,3 Jing Shan,1,2 Xuewei Wang,1,2 Lin Liu,1,2 and Yuan Fan1,2,4 Abstract— The etiology of oral lichen planus (OLP) is still not clear. The purpose of this study was to explore the role of CXC chemokine receptor 3(CXCR3) and its ligand CXC motif chemokine 10(CXCL10) in the pathogenesis of OLP. We examined the expression of CXCR3 and CXCL10 in OLP patients and healthy controls by quantitative real-time PCR, Western blotting, ELISAs, and immunohistochemistry, respectively. Moreover, we detected the effects of CXCL10/CXCR3 axis on T lymphocyte migration, proliferation and apoptosis by Trans- well assays, CCK8 assays, and flow cytometry. We found that the expression of CXCR3 and CXCL10 was significantly increased in OLP patients. In addition, T lymphocyte migration rate of CXCL10 stimulation group was significantly higher than that of control and CXCR3 antagonist groups. After antagonizing CXCR3, the migration ability of T lymphocytes was significantly decreased, and regardless of whether CXCL10 was added in the upper chamber culture medium, the number of migrating cells was similar. The addition of CXCL10 stimulant could stimulate the proliferation of T lymphocytes, but there was no significant difference compared with control group. After antagonizing CXCR3, the proliferation rate of T lymphocytes was significantly reduced. However, there were no significant differences in the apoptosis rates of T lymphocytes between CXCL10 stimulation group, antagonist CXCR3 group, and control group. Due to the change of expression in CXCR3 and CXCL10, and its interaction in mediating the directional migration of peripheral blood T lymphocytes, affecting the proliferation of T lymphocytes, it suggests that CXCL10/CXCR3 axis may be related to the immune mechanism of OLP. KEY WORDS: CXCR3; CXCL10; oral lichen planus; chemokine. Jiaxiang Fang and Chen Wang contributed equally to this work. INTRODUCTION 1 Jiangsu Key Laboratory of Oral Diseases, Nanjing Medical University, Oral lichen planus (OLP) is a chronic inflammatory Nanjing, 210029, China 2 Department of Oral Medicine, Affiliated Hospital of Stomatology, Nanj- oral mucosa disease characterized by a dense, band-like ing Medical University, 136 Hanzhong Road, Nanjing, 210029, China lymphocyte infiltration in the lamina propria associated 3 Department of Special outpatient service, Hangzhou West Dental Hos- with the degeneration of basal keratinocyte [1]. WHO has pital, Hangzhou, 310012, China classified OLP as a premalignant condition [2]witha 4 To whom correspondence should be addressed at Department of Oral malignant transformation rate of 0.1–2% [3, 4]. The etiol- Medicine, Affiliated Hospital of Stomatology, Nanjing Medical Univer- sity, 136 Hanzhong Road, Nanjing, 210029, China. E-mail: ogy and pathogenesis of OLP remain elusive. Previous [email protected] studies have suggested that oral lichen planus should be 799 0360-3997/19/0300-0799/0 # 2018 Springer Science+Business Media, LLC, part of Springer Nature 800 Fang, Wang, Shen, Shan, Wang, Liu, and Fan considered a localized autoimmune disease mediated by T histopathological diagnostic criteria for OLP patients met lymphocytes [5]. The imbalance in two subsets of T-helper the guidelines set forth by the World Health Organization cells, Th1 and Th2 cells, most likely contributes to the in 1978 and van der Meij et al. in 2003 [18]. The non- pathogenesis of OLP [6]. erosive group was defined in accordance with the Wick- It is now well established that the differential expres- ham striae on the oral mucosa with no painful, ulcerated sion of chemokines and chemokine receptors plays an and erythematous areas. The erosive group was mainly essential role in mediating the trafficking of immune cells characterized by painful, ulcerated and erythematous areas, to sites of inflammation within both normal and inflamed which reflected a more destructive phase of the disease. tissue [7]. The chemokine receptor CXCR3 is a class A The pathological biopsy of patients with OLP was seven transmembrane-domain or G protein-coupled recep- taken from a representative area of the oral mucosal tor (GPCR) that is involved primarily in the chemotaxis of lesion, and all biopsies were performed prior to initial certain immune cells, inhibition of angiogenesis, and po- or systemic treatment. All healthy volunteer samples larization of Th1 cells [8–10]. Additionally, CXCR3 is (including the peripheral blood and biopsy tissue) were predominantly expressed by the Th1 cell subset [11]and admitted from orthognathic surgery. All tissue samples is associated with the pathophysiology of Th1-type dis- were immediately frozen in liquid nitrogen and stored at eases. CXCL10 that are produced in response to IFN-γ are − 80 °C until further use. allowed for the accumulation of activated lymphocytes by interacting with its specific receptor CXCR3 [12]. Volunteers for the Experiments Assessing the Effects of An abundance of data demonstrates that the CXCR3/CXCL10 on Cell Function in the Peripheral CXCL10/CXCR3 axis plays important roles in many di- Blood verse autoimmune diseases, including autoimmune en- cephalomyelitis [13], thyroid autoimmune diseases [14], Eighteen patients with OLP (males 8, females 10, Graves’ disease [15], and type 1 diabetes [16]. After bind- 43.00 ± 3.134) were enrolled in this part experiments with ing to CXCR3, CXCL10 mainly participates in the gener- the same diagnostic criteria described above. ation and migration of effector T cells, and induces the None of the healthy controls had oral mucosal dis- directed migration of lymphocytes to specific sites of in- eases or autoimmune disease or had used antibiotics or fection, causing the infiltration of lymphocytes, and ulti- immunologic agents for the past 3 months. In addition, mately producing local immune responses [17]. OLP patients also have no other oral mucosal diseases and However, studies on whether the expression levels of autoimmune diseases, and have not used antibiotics or CXCR3 and CXCL10 have changed and whether the immunologic agents for the past 3 months [19, 20]. CXCL10/CXCR3 axis has an effect on the function of T lymphocytes in patients with OLP are rare. The aims of this The Expression of CXCR3, CXCL10 mRNA in the article are to explore the pathogenesis of OLP by detecting Peripheral Blood and CXCR3 mRNA in the Oral the levels of CXCR3 andCXCL10 and the effect of the Tissue CXCL10/CXCR3 axis on lymphocyte function in the pe- The Isolation of Peripheral Blood T Lymphocytes ripheral blood of OLP patients. T lymphocytes were isolated from the peripheral blood by using Lymphoprep™ separation and an EasySepTM MATERIALS AND METHODS human CD3 positive selection kit (Stemcell Technologies, VAN, Canada) for further experiments. For the PMBC isolation, 10 ml fresh blood was diluted with phosphate- Volunteers for the Experiments Assessing the buffered saline (PBS)(Sigma-Aldrich, Munich, Germany) at Expression of CXCR3/CXCL10 in the Peripheral a 1:1 ratio. Each sample has two tubes containing 5 ml Blood and Oral Tissue diluted blood and 5 ml lymphocyte separation fluid for FortypatientswithOLPand20healthycontrols extracting RNA and protein. Then the tubes were centri- (males 8, females 12, 44.80 ± 2.422) were enrolled in the fuged for 20 min at 2000 rpm. After centrifugation, the buffy study. The OLP patients were divided into two groups, the coat was collected. The plasma was removed and stored at − erosive group and non-erosive group, with 20 patients in 80 °C for further ELISAs. Next, the buffy coat was washed each group (males 8, females 12, 43.50 ± 2.731; males 10, twice with PBS at 1000 rpm for 10 min, and the supernatant females 10, 46.60 ± 2.580). The clinical and was discarded. Finally, we used a human CD3 positive The expression of CXCR3/CXCL10 and effect of the axis in OLP 801 selection kit to isolate the T lymphocytes. The cells were LAS 4000 mini imaging system (GE, New York, USA). placed in an incubator at 37 °C with 5% CO2. The results were analyzed by gray value via Compass software. RNA Extraction and Quantitative Real-time Polymerase Chain Reaction Enzyme-Linked Immunosorbent Assay Total RNAwas extracted from the T lymphocytes and The concentration of CXCL10 was determined by oral tissues by using a Takara reagent kit (Takara, Tokyo, using a human CXCL10 enzyme-linked immunosorbent Japan). The purity and concentration of the RNA were assay (ELISA) kit (Multi Sciences, Hangzhou, Zhejiang, determined by a Unico UV-2000(Unico, Shanghai, China). China) according to the manufacturer’s instructions. The The RNA was reverse-transcribed into cDNA by using a samples were diluted with a 1:1 ratio. Twenty plasma PrimeScript RT reagent kit (Takara, Tokyo, Japan). RT- samples in each group were continuously tested for twice qPCR was performed with a quantitative PCR system times, and three sets of duplicate wells were tested in (ABI 7300, USA) with a SYBR Green reagent. All primers parallel for each group in each time to obtain intra- and were designed and synthesized by the same manufacturer inter-assay coefficients of variation of CXCL10. (Invitrogen, Carlsbad, CA, USA). The following primers Briefly, monoclonal antibodies specific for CXCL10 were used: CXCR3, forward primer: TTGTACCG has been pre-coated onto 96-well microtiter plates. Stand- ATTGCCTACTCCTT and reverse primer: CCCAGAAT ards, samples and biotin-linked detection antibodies spe- GGGAGAGTAAGAAC; CXCL10, forward primer: cific for CXCL10 were pipetted into the wells. CXCL10 AACTGTACGCTGTACCTGCAT and reverse primer: was bound by the immobilized antibody and the detection GCATCGATTTTGCTCCCCTC; and GAPDH, forward antibody following incubation. After washing away any primer: ACCACAGTCCATGCCATCAC and reverse unbound substances, streptavidin-HRP was added. After primer: TCCACCACCCTGTTGCTGTA. The expression washing, the substrate solution was added to the wells.
Load more

Recommended publications
  • C-X-C Motif Chemokine Ligand 10 Produced by Mouse Sertoli Cells in Response to Mumps Virus Infection Induces Male Germ Cell Apoptosis
    Citation: Cell Death and Disease (2017) 8, e3146; doi:10.1038/cddis.2017.560 OPEN Macmillan Publishers Limited, part of Springer Nature. www.nature.com/cddis Corrected: Correction C-X-C motif chemokine ligand 10 produced by mouse Sertoli cells in response to mumps virus infection induces male germ cell apoptosis Qian Jiang1, Fei Wang1, Lili Shi1, Xiang Zhao1, Maolei Gong1, Weihua Liu1, Chengyi Song2, Qihan Li3, Yongmei Chen1, Han Wu*,1,2 and Daishu Han*,1 Mumps virus (MuV) infection usually results in germ cell degeneration in the testis, which is an etiological factor for male infertility. However, the mechanisms by which MuV infection damages male germ cells remain unclear. The present study showed that C-X-C motif chemokine ligand 10 (CXCL10) is produced by mouse Sertoli cells in response to MuV infection, which induces germ cell apoptosis through the activation of caspase-3. CXC chemokine receptor 3 (CXCR3), a functional receptor of CXCL10, is constitutively expressed in male germ cells. Neutralizing antibodies against CXCR3 and an inhibitor of caspase-3 activation significantly inhibited CXCL10-induced male germ cell apoptosis. Furthermore, the tumor necrosis factor-α (TNF-α) upregulated CXCL10 production in Sertoli cells after MuV infection. The knockout of either CXCL10 or TNF-α reduced germ cell apoptosis in the co-cultures of germ cells and Sertoli cells in response to MuV infection. Local injection of MuV into the testes of mice confirmed the involvement of CXCL10 in germ cell apoptosis in vivo. These results provide novel insights into MuV-induced germ cell apoptosis in the testis.
    [Show full text]
  • Critical Role of CXCL4 in the Lung Pathogenesis of Influenza (H1N1) Respiratory Infection
    ARTICLES Critical role of CXCL4 in the lung pathogenesis of influenza (H1N1) respiratory infection L Guo1,3, K Feng1,3, YC Wang1,3, JJ Mei1,2, RT Ning1, HW Zheng1, JJ Wang1, GS Worthen2, X Wang1, J Song1,QHLi1 and LD Liu1 Annual epidemics and unexpected pandemics of influenza are threats to human health. Lung immune and inflammatory responses, such as those induced by respiratory infection influenza virus, determine the outcome of pulmonary pathogenesis. Platelet-derived chemokine (C-X-C motif) ligand 4 (CXCL4) has an immunoregulatory role in inflammatory diseases. Here we show that CXCL4 is associated with pulmonary influenza infection and has a critical role in protecting mice from fatal H1N1 virus respiratory infection. CXCL4 knockout resulted in diminished viral clearance from the lung and decreased lung inflammation during early infection but more severe lung pathology relative to wild-type mice during late infection. Additionally, CXCL4 deficiency decreased leukocyte accumulation in the infected lung with markedly decreased neutrophil infiltration into the lung during early infection and extensive leukocyte, especially lymphocyte accumulation at the late infection stage. Loss of CXCL4 did not affect the activation of adaptive immune T and B lymphocytes during the late stage of lung infection. Further study revealed that CXCL4 deficiency inhibited neutrophil recruitment to the infected mouse lung. Thus the above results identify CXCL4 as a vital immunoregulatory chemokine essential for protecting mice against influenza A virus infection, especially as it affects the development of lung injury and neutrophil mobilization to the inflamed lung. INTRODUCTION necrosis factor (TNF)-a, interleukin (IL)-6, and IL-1b, to exert Influenza A virus (IAV) infections cause respiratory diseases in further antiviral innate immune effects.2 Meanwhile, the innate large populations worldwide every year and result in seasonal immune cells act as antigen-presenting cells and release influenza epidemics and unexpected pandemic.
    [Show full text]
  • Ncomms1239.Pdf
    ARTICLE Received 10 Nov 2010 | Accepted 15 Feb 2011 | Published 15 Mar 2011 DOI: 10.1038/ncomms1239 Inflammation driven by tumour-specific Th1 cells protects against B-cell cancer Ole Audun Werner Haabeth1, Kristina Berg Lorvik1, Clara Hammarström2, Ian M. Donaldson3,4, Guttorm Haraldsen2, Bjarne Bogen1 & Alexandre Corthay1 The immune system can both promote and suppress cancer. Chronic inflammation and proinflammatory cytokines such as interleukin (IL)-1 and IL-6 are considered to be tumour promoting. In contrast, the exact nature of protective antitumour immunity remains obscure. Here, we quantify locally secreted cytokines during primary immune responses against myeloma and B-cell lymphoma in mice. Strikingly, successful cancer immunosurveillance mediated by tumour-specific CD4 + T cells is consistently associated with elevated local levels of both proinflammatory (IL-1α, IL-1β and IL-6) and T helper 1 (Th1)-associated cytokines (interferon-γ (IFN-γ), IL-2 and IL-12). Cancer eradication is achieved by a collaboration between tumour- specific Th1 cells and tumour-infiltrating, antigen-presenting macrophages. Th1 cells induce secretion of IL-1β and IL-6 by macrophages. Th1-derived IFN-γ is shown to render macrophages directly cytotoxic to cancer cells, and to induce macrophages to secrete the angiostatic chemokines CXCL9/MIG and CXCL10/IP-10. Thus, inflammation, when driven by tumour- specific Th1 cells, may prevent rather than promote cancer. 1 Centre for Immune Regulation, Institute of Immunology, University of Oslo and Oslo University Hospital Rikshospitalet, PO Box 4950 Nydalen, 0424 Oslo, Norway. 2 Department of Pathology, Institute of Pathology, Oslo University Hospital Rikshospitalet and University of Oslo, PO Box 4950 Nydalen, 0424 Oslo, Norway.
    [Show full text]
  • Establishment of HIV-1 Latency in Resting CD4+ T Cells Depends on Chemokine-Induced Changes in the Actin Cytoskeleton
    Establishment of HIV-1 latency in resting CD4+ T cells depends on chemokine-induced changes in the actin cytoskeleton Paul U. Camerona,b,c,1, Suha Salehb,1, Georgina Sallmannb, Ajantha Solomonb, Fiona Wightmanb, Vanessa A. Evansb, Genevieve Boucherd, Elias K. Haddadd,Rafick-Pierre Sekalyd, Andrew N. Harmane, Jenny L. Andersonf, Kate L. Jonesf, Johnson Makf,g, Anthony L. Cunninghame, Anthony Jaworowskib,c,f, and Sharon R. Lewina,b,f,2 aInfectious Diseases Unit, Alfred Hospital, Melbourne, Victoria 3004, Australia; Departments of bMedicine and cImmunology, Monash University, Melbourne 3004, Australia; dLaboratoire d’Immunologie, Centre de Recherche de Centre Hospitalier de L’Universitie de Montreal, Saint-Luc, Quebec, Canada; eWestmead Millenium Research Institute, Westmead 2145, Australia; fCentre for Virology, Burnet Institute, Melbourne 3004, Australia; and gDepartment of Biochemistry and Molecular Biology, Department of Microbiology, Monash University, Clayton 3800, Australia Edited by Malcolm A. Martin, National Institute of Allergy and Infectious Diseases, Bethesda, MD, and approved August 23, 2010 (received for review March 8, 2010) Eradication of HIV-1 with highly active antiretroviral therapy mokines, in addition to CXCR4 ligands may facilitate HIV-1 + (HAART) is not possible due to the persistence of long-lived, entry and integration in resting CD4 T cells and that this was latently infected resting memory CD4+ T cells. We now show that mediated via activation of actin. + HIV-1 latency can be established in resting CD4+ T cells infected We now show that the exposure of resting CD4 T cells to with HIV-1 after exposure to ligands for CCR7 (CCL19), CXCR3 the chemokines CCL19, CXCL10, and CCL20, all of which fi (CXCL9 and CXCL10), and CCR6 (CCL20) but not in unactivated regulate T-cell migration, allows for ef cient HIV-1 nuclear lo- + calization and integration of the HIV-1 provirus, that this oc- CD4 T cells.
    [Show full text]
  • Expression and Analysis of CXCL8 and CXCL10 Chemokines In
    erial D act is b ea o s c e y s M Mycobacterial Diseases Rawat et al., Mycobact Dis 2016, 6:2 DOI: 10.4172/2161-1068.1000208 ISSN: 2161-1068 Research an open access journal Expression and Analysis of CXCL8 and CXCL10 Chemokines in Human Skin Lesions Infected with M.leprae Krishan Dutta Rawat1, Mamta Chahar1, PVJ Reddy1, Nalini Srivastava2, U.D.Gupta1, M. Natrajan1, V.M. Katoch3, Kiran Katoch1 and D.S. Chauhan1* 1National JALMA Institute for Leprosy & Other Mycobacterial Diseases Tajganj, Agra, U.P, India 2SOS in Biotechnology, Jiwaji University, Gwalior, M.P, India. 3Department of Health Research, Indian Council of Medical Research, Ansari Nagar, New Delhi, India *Corresponding author: Chauhan DS, Microbiology & Molecular biology Lab, National JALMA Institute for Leprosy and Other Mycobacterial Diseases, (ICMR) Tajganj, Agra-282001, Tel: (0562) 2331751-4; Fax: +91-562-2331755; E-mail: [email protected] Rec date: February 02, 2016; Acc date: May 19, 2016; Pub date: May 24, 2016 Copyright: © 2016 Rawat KD, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Abstract This study is focused to analyze the expression profile of CXCL8 and CXCL10 chemokines genes and to address the contribution of these chemokines in late phase of M.leprae infection in human skin lesion samples. In this study skin biopsy samples from leprosy patients (n=35) were collected including BL-LL=12, BB=14, BT=8 and healthy volunteers (n=3).
    [Show full text]
  • Expression and Regulation of Chemokines in Murine and Human Type 1 Diabetes Suparna A
    ORIGINAL ARTICLE Expression and Regulation of Chemokines in Murine and Human Type 1 Diabetes Suparna A. Sarkar,1 Catherine E. Lee,1 Francisco Victorino,1,2 Tom T. Nguyen,1 Jay A. Walters,1 Adam Burrack,1,2 Jens Eberlein,1 Steven K. Hildemann,3 and Dirk Homann1,2,4 fl – More than one-half of the ~50 human chemokines have been in ammation (1 3), and multiple chemokines and chemokine associated with or implicated in the pathogenesis of type 1 receptors have emerged as pertinent contributors to the diabetes, yet their actual expression patterns in the islet environ- natural history of various autoimmune disorders, including ment of type 1 diabetic patients remain, at present, poorly defined. type 1 diabetes; potential biomarkers; and possible drug Here, we have integrated a human islet culture system, murine targets (4–8). In fact, work conducted over the past 20 models of virus-induced and spontaneous type 1 diabetes, and the years has implicated more than one-half of all human and/ histopathological examination of pancreata from diabetic organ or rodent chemokines in the pathogenesis of type 1 diabetes donors with the goal of providing a foundation for the informed and/or its complications, although much of the work pub- selection of potential therapeutic targets within the chemokine/ receptor family. Chemokine (C-C motif) ligand (CCL) 5 (CCL5), lished to date on human type 1 diabetes and chemokines CCL8, CCL22, chemokine (C-X-C motif) ligand (CXCL) 9 (CXCL9), remains limited to genetic association studies and che- CXCL10, and chemokine (C-X3-C motif) ligand (CX3CL) 1 (CX3CL1) mokine/receptor analyses in peripheral blood (9–23).
    [Show full text]
  • Human CXCL4/PF4 Immunoassay Quantikine
    Quantikine® ELISA Human CXCL4/PF4 Immunoassay Catalog Number DPF40 For the quantitative determination of human Platelet Factor 4 (PF4) concentrations in cell culture supernates, serum, and platelet-poor plasma. This package insert must be read in its entirety before using this product. For research use only. Not for use in diagnostic procedures. TABLE OF CONTENTS SECTION PAGE INTRODUCTION ....................................................................................................................................................................1 PRINCIPLE OF THE ASSAY ..................................................................................................................................................2 LIMITATIONS OF THE PROCEDURE ................................................................................................................................2 TECHNICAL HINTS ................................................................................................................................................................2 MATERIALS PROVIDED & STORAGE CONDITIONS ..................................................................................................3 OTHER SUPPLIES REQUIRED ............................................................................................................................................3 PRECAUTIONS ........................................................................................................................................................................4 SAMPLE
    [Show full text]
  • Baseline CXCL10 and CXCL13 Levels Are Predictive Biomarkers for Tumor Necrosis Factor Inhibitor Therapy in Patients with Moderat
    Han et al. Arthritis Research & Therapy (2016) 18:93 DOI 10.1186/s13075-016-0995-0 RESEARCH ARTICLE Open Access Baseline CXCL10 and CXCL13 levels are predictive biomarkers for tumor necrosis factor inhibitor therapy in patients with moderate to severe rheumatoid arthritis: a pilot, prospective study Bobby Kwanghoon Han1*, Igor Kuzin2, John P. Gaughan3, Nancy J. Olsen4 and Andrea Bottaro2 Abstract Background: TNF inhibitors have been used as a treatment for moderate to severe RA patients. However, reliable biomarkers that predict therapeutic response to TNF inhibitors are lacking. In this study, we investigated whether chemokines may represent useful biomarkers to predict the response to TNF inhibitor therapy in RA. Methods: RA patients (n = 29) who were initiating adalimumab or etanercept were recruited from the rheumatology clinics at Cooper University Hospital. RA patients were evaluated at baseline and 14 weeks after TNF inhibitor therapy, and serum levels of CXCL10, CXCL13, and CCL20 were measured by ELISA. Responders (n = 16) were defined as patients who had good or moderate response at week 14 by EULAR response criteria, and nonresponders (n = 13) were defined as having no response. Results: Responders had higher levels of baseline CXCL10 and CXCL13 compared to nonresponders (p =0.03 and 0.002 respectively). There was no difference in CCL20 levels. CXCL10 and CXCL13 were highly correlated with each other, and were higher in seropositive RA patients. CXCL10 and CXCL13 levels were decreased after TNF inhibitor therapy in responders. Baseline additive levels of CXCL10 + 13 were correlated with changes in DAS score at 14 weeks after TNF inhibitor therapy (r = 0.42, p = 0.03), and ROC curve analyses for predictive ability of CXCL10 + 13 showed an AUC of 0.83.
    [Show full text]
  • Glial Cell Activation, Recruitment, and Survival of B-Lineage Cells Following MCMV Brain Infection James R
    Lokensgard et al. Journal of Neuroinflammation (2016) 13:114 DOI 10.1186/s12974-016-0582-y RESEARCH Open Access Glial cell activation, recruitment, and survival of B-lineage cells following MCMV brain infection James R. Lokensgard*, Manohar B. Mutnal, Sujata Prasad, Wen Sheng and Shuxian Hu Abstract Background: Chemokines produced by reactive glia drive migration of immune cells and previous studies from our laboratory have demonstrated that CD19+ B cells infiltrate the brain. In this study, in vivo and in vitro experiments investigated the role of reactive glial cells in recruitment and survival of B-lineage cells in response to (murine cytomegalovirus) MCMV infection. Methods: Flow cytometric analysis was used to assess chemokine receptor expression on brain-infiltrating B cells. Real-time RT-PCR and ELISA were used to measure chemokine levels. Dual-immunohistochemical staining was used to co-localize chemokine production by reactive glia. Primary glial cell cultures and migration assays were used to examine chemokine-mediated recruitment. Astrocyte: B cell co-cultures were used to investigate survival and proliferation. Results: The chemokine receptors CXCR3, CXCR5, CCR5, and CCR7 were detected on CD19+ cells isolated from the brain during MCMV infection. In particular, CXCR3 was found to be elevated on an increasing number of cells over the time course of infection, and it was the primary chemokine receptor expressed at 60 days post infection Quite different expression kinetics were observed for CXCR5, CCR5, and CCR7, which were elevated on the highest number of cells early during infection and decreased by 14, 30, and 60 days post infection Correspondingly, elevated levels of CXCL9, CXCL10, and CXCL13, as well as CCL5, were found within the brains of infected animals, and only low levels of CCL3 and CCL19 were detected.
    [Show full text]
  • The Pro-Inflammatory Chemokines CXCL9, CXCL10 and CXCL11 Are
    viruses Article The Pro-Inflammatory Chemokines CXCL9, CXCL10 and CXCL11 Are Upregulated Following SARS-CoV-2 Infection in an AKT-Dependent Manner Victoria Callahan 1, Seth Hawks 2, Matthew A. Crawford 3 , Caitlin W. Lehman 2 , Holly A. Morrison 2 , Hannah M. Ivester 4, Ivan Akhrymuk 2, Niloufar Boghdeh 1, Rafaela Flor 1, Carla V. Finkielstein 5 , Irving Coy Allen 2,6,7, James Weger-Lucarelli 2,7, Nisha Duggal 2,7, Molly A. Hughes 3 and Kylene Kehn-Hall 1,2,7,* 1 National Center for Biodefense and Infectious Diseases, School of Systems Biology, George Mason University, Manassas, VA 20110, USA; [email protected] (V.C.); [email protected] (N.B.); mfl[email protected] (R.F.) 2 Department of Biomedical Science and Pathobiology, Virginia-Maryland College of Veterinary Medicine, Virginia Polytechnic Institute and State University, Blacksburg, VA 24060, USA; [email protected] (S.H.); [email protected] (C.W.L.); [email protected] (H.A.M.); [email protected] (I.A.); [email protected] (I.C.A.); [email protected] (J.W.-L.); [email protected] (N.D.) 3 Division of Infectious Diseases and International Health, Department of Medicine, University of Virginia, Charlottesville, VA 22908, USA; [email protected] (M.A.C.); [email protected] (M.A.H.) Citation: Callahan, V.; Hawks, S.; 4 Graduate Program in Translational Biology, Medicine and Health, Virginia Polytechnic Institute and State Crawford, M.A.; Lehman, C.W.; University, Roanoke, VA 24061, USA; [email protected] 5 Morrison, H.A.; Ivester, H.M.; Integrated Cellular Responses Laboratory, Department of Biological Sciences and Center for Drug Discovery, Akhrymuk, I.; Boghdeh, N.; Flor, R.; Fralin Biomedical Research Institute, Virginia Polytechnic Institute and State University, Roanoke, VA 24016, USA; fi[email protected] Finkielstein, C.V.; et al.
    [Show full text]
  • Fas Ligand Promotes an Inducible TLR-Dependent Model of Cutaneous Lupus-Like Inflammation
    University of Massachusetts Medical School eScholarship@UMMS University of Massachusetts Medical School Faculty Publications 2018-06-11 Fas ligand promotes an inducible TLR-dependent model of cutaneous lupus-like inflammation Purvi Mande University of Massachusetts Medical School Et al. Let us know how access to this document benefits ou.y Follow this and additional works at: https://escholarship.umassmed.edu/faculty_pubs Part of the Dermatology Commons, Immune System Diseases Commons, Immunity Commons, Immunopathology Commons, Rheumatology Commons, and the Skin and Connective Tissue Diseases Commons Repository Citation Mande P, Zirak B, Ko W, Taravati K, Bride KL, Brodeur TB, Deng AC, Dresser KA, Jiang Z, Ettinger R, Fitzgerald KA, Rosenblum MD, Harris JE, Marshak-Rothstein A. (2018). Fas ligand promotes an inducible TLR-dependent model of cutaneous lupus-like inflammation. University of Massachusetts Medical School Faculty Publications. https://doi.org/10.1172/JCI98219. Retrieved from https://escholarship.umassmed.edu/faculty_pubs/1581 This material is brought to you by eScholarship@UMMS. It has been accepted for inclusion in University of Massachusetts Medical School Faculty Publications by an authorized administrator of eScholarship@UMMS. For more information, please contact [email protected]. Fas ligand promotes an inducible TLR- dependent model of cutaneous lupus–like inflammation Purvi Mande, … , John E. Harris, Ann Marshak-Rothstein J Clin Invest. 2018;128(7):2966-2978. https://doi.org/10.1172/JCI98219. Research Article Autoimmunity Dermatology Toll-like receptors TLR7 and TLR9 are both implicated in the activation of autoreactive B cells and other cell types associated with systemic lupus erythematosus (SLE) pathogenesis. However, Tlr9–/– autoimmune-prone strains paradoxically develop more severe disease.
    [Show full text]
  • CXCR3 Ligands in Disease and Therapy Katrien Van Raemdonck1
    CORE Metadata, citation and similar papers at core.ac.uk Provided by Lirias CXCR3 ligands in disease and therapy Katrien Van Raemdonck1, Philippe E. Van den Steen2, Sandra Liekens3, Jo Van Damme1, Sofie Struyf1 1 Laboratory of Molecular Immunology 2 Laboratory of Immunobiology ³ Laboratory of Virology and Chemotherapy University of Leuven (KU Leuven), Department of Microbiology and Immunology, Rega Institute for Medical Research, Leuven, Belgium Corresponding author Prof. Jo Van Damme Laboratory of Molecular Immunology, Rega Institute for Medical Research, University of Leuven (KU Leuven), Minderbroedersstraat 10, 3000 Leuven, Belgium Tel: + 32 16 337342 Fax: + 32 16 337340 [email protected] ABSTRACT Chemokines, binding their various G protein-coupled receptors, lead the way for leukocytes in health and inflammation. Yet chemokine receptor expression is not limited to leukocytes. Accordingly, chemokines are remarkably pleiotropic molecules involved in a range of physiological as well as pathological processes. For example, the CXCR3 chemokine receptor is expressed on activated T lymphocytes, dendritic cells and natural killer cells, but also fibroblasts and smooth muscle, epithelial and endothelial cells. In men, these cells express either CXCR3A, its splice variant CXCR3B or a balanced combination of both. The CXCR3 ligands, activating both receptor variants, include CXCL4, CXCL4L1, CXCL9, CXCL10 and CXCL11. Upon CXCR3A activation these ELR-negative CXC chemokines mediate chemotactic and proliferative responses, for example in leukocytes. In contrast, CXCR3B induces anti-proliferative and anti-migratory effects, as exemplified by angiostatic effects on endothelial cells. Taken together, the unusual and versatile characteristics of CXCR3 and its ligands form the basis for their pertinent involvement in a myriad of diseases.
    [Show full text]