Inflammation, Vol. 42, No. 3, June 2019 ( # 2018) DOI: 10.1007/s10753-018-0934-0 ORIGINAL ARTICLE The Expression of CXCL10/CXCR3 and Effect of the Axis on the Function of T Lymphocyte Involved in Oral Lichen Planus Jiaxiang Fang,1,2 Chen Wang,1,2 Chen Shen,3 Jing Shan,1,2 Xuewei Wang,1,2 Lin Liu,1,2 and Yuan Fan1,2,4 Abstract— The etiology of oral lichen planus (OLP) is still not clear. The purpose of this study was to explore the role of CXC chemokine receptor 3(CXCR3) and its ligand CXC motif chemokine 10(CXCL10) in the pathogenesis of OLP. We examined the expression of CXCR3 and CXCL10 in OLP patients and healthy controls by quantitative real-time PCR, Western blotting, ELISAs, and immunohistochemistry, respectively. Moreover, we detected the effects of CXCL10/CXCR3 axis on T lymphocyte migration, proliferation and apoptosis by Trans- well assays, CCK8 assays, and flow cytometry. We found that the expression of CXCR3 and CXCL10 was significantly increased in OLP patients. In addition, T lymphocyte migration rate of CXCL10 stimulation group was significantly higher than that of control and CXCR3 antagonist groups. After antagonizing CXCR3, the migration ability of T lymphocytes was significantly decreased, and regardless of whether CXCL10 was added in the upper chamber culture medium, the number of migrating cells was similar. The addition of CXCL10 stimulant could stimulate the proliferation of T lymphocytes, but there was no significant difference compared with control group. After antagonizing CXCR3, the proliferation rate of T lymphocytes was significantly reduced. However, there were no significant differences in the apoptosis rates of T lymphocytes between CXCL10 stimulation group, antagonist CXCR3 group, and control group. Due to the change of expression in CXCR3 and CXCL10, and its interaction in mediating the directional migration of peripheral blood T lymphocytes, affecting the proliferation of T lymphocytes, it suggests that CXCL10/CXCR3 axis may be related to the immune mechanism of OLP. KEY WORDS: CXCR3; CXCL10; oral lichen planus; chemokine. Jiaxiang Fang and Chen Wang contributed equally to this work. INTRODUCTION 1 Jiangsu Key Laboratory of Oral Diseases, Nanjing Medical University, Oral lichen planus (OLP) is a chronic inflammatory Nanjing, 210029, China 2 Department of Oral Medicine, Affiliated Hospital of Stomatology, Nanj- oral mucosa disease characterized by a dense, band-like ing Medical University, 136 Hanzhong Road, Nanjing, 210029, China lymphocyte infiltration in the lamina propria associated 3 Department of Special outpatient service, Hangzhou West Dental Hos- with the degeneration of basal keratinocyte [1]. WHO has pital, Hangzhou, 310012, China classified OLP as a premalignant condition [2]witha 4 To whom correspondence should be addressed at Department of Oral malignant transformation rate of 0.1–2% [3, 4]. The etiol- Medicine, Affiliated Hospital of Stomatology, Nanjing Medical Univer- sity, 136 Hanzhong Road, Nanjing, 210029, China. E-mail: ogy and pathogenesis of OLP remain elusive. Previous [email protected] studies have suggested that oral lichen planus should be 799 0360-3997/19/0300-0799/0 # 2018 Springer Science+Business Media, LLC, part of Springer Nature 800 Fang, Wang, Shen, Shan, Wang, Liu, and Fan considered a localized autoimmune disease mediated by T histopathological diagnostic criteria for OLP patients met lymphocytes [5]. The imbalance in two subsets of T-helper the guidelines set forth by the World Health Organization cells, Th1 and Th2 cells, most likely contributes to the in 1978 and van der Meij et al. in 2003 [18]. The non- pathogenesis of OLP [6]. erosive group was defined in accordance with the Wick- It is now well established that the differential expres- ham striae on the oral mucosa with no painful, ulcerated sion of chemokines and chemokine receptors plays an and erythematous areas. The erosive group was mainly essential role in mediating the trafficking of immune cells characterized by painful, ulcerated and erythematous areas, to sites of inflammation within both normal and inflamed which reflected a more destructive phase of the disease. tissue [7]. The chemokine receptor CXCR3 is a class A The pathological biopsy of patients with OLP was seven transmembrane-domain or G protein-coupled recep- taken from a representative area of the oral mucosal tor (GPCR) that is involved primarily in the chemotaxis of lesion, and all biopsies were performed prior to initial certain immune cells, inhibition of angiogenesis, and po- or systemic treatment. All healthy volunteer samples larization of Th1 cells [8–10]. Additionally, CXCR3 is (including the peripheral blood and biopsy tissue) were predominantly expressed by the Th1 cell subset [11]and admitted from orthognathic surgery. All tissue samples is associated with the pathophysiology of Th1-type dis- were immediately frozen in liquid nitrogen and stored at eases. CXCL10 that are produced in response to IFN-γ are − 80 °C until further use. allowed for the accumulation of activated lymphocytes by interacting with its specific receptor CXCR3 [12]. Volunteers for the Experiments Assessing the Effects of An abundance of data demonstrates that the CXCR3/CXCL10 on Cell Function in the Peripheral CXCL10/CXCR3 axis plays important roles in many di- Blood verse autoimmune diseases, including autoimmune en- cephalomyelitis [13], thyroid autoimmune diseases [14], Eighteen patients with OLP (males 8, females 10, Graves’ disease [15], and type 1 diabetes [16]. After bind- 43.00 ± 3.134) were enrolled in this part experiments with ing to CXCR3, CXCL10 mainly participates in the gener- the same diagnostic criteria described above. ation and migration of effector T cells, and induces the None of the healthy controls had oral mucosal dis- directed migration of lymphocytes to specific sites of in- eases or autoimmune disease or had used antibiotics or fection, causing the infiltration of lymphocytes, and ulti- immunologic agents for the past 3 months. In addition, mately producing local immune responses [17]. OLP patients also have no other oral mucosal diseases and However, studies on whether the expression levels of autoimmune diseases, and have not used antibiotics or CXCR3 and CXCL10 have changed and whether the immunologic agents for the past 3 months [19, 20]. CXCL10/CXCR3 axis has an effect on the function of T lymphocytes in patients with OLP are rare. The aims of this The Expression of CXCR3, CXCL10 mRNA in the article are to explore the pathogenesis of OLP by detecting Peripheral Blood and CXCR3 mRNA in the Oral the levels of CXCR3 andCXCL10 and the effect of the Tissue CXCL10/CXCR3 axis on lymphocyte function in the pe- The Isolation of Peripheral Blood T Lymphocytes ripheral blood of OLP patients. T lymphocytes were isolated from the peripheral blood by using Lymphoprep™ separation and an EasySepTM MATERIALS AND METHODS human CD3 positive selection kit (Stemcell Technologies, VAN, Canada) for further experiments. For the PMBC isolation, 10 ml fresh blood was diluted with phosphate- Volunteers for the Experiments Assessing the buffered saline (PBS)(Sigma-Aldrich, Munich, Germany) at Expression of CXCR3/CXCL10 in the Peripheral a 1:1 ratio. Each sample has two tubes containing 5 ml Blood and Oral Tissue diluted blood and 5 ml lymphocyte separation fluid for FortypatientswithOLPand20healthycontrols extracting RNA and protein. Then the tubes were centri- (males 8, females 12, 44.80 ± 2.422) were enrolled in the fuged for 20 min at 2000 rpm. After centrifugation, the buffy study. The OLP patients were divided into two groups, the coat was collected. The plasma was removed and stored at − erosive group and non-erosive group, with 20 patients in 80 °C for further ELISAs. Next, the buffy coat was washed each group (males 8, females 12, 43.50 ± 2.731; males 10, twice with PBS at 1000 rpm for 10 min, and the supernatant females 10, 46.60 ± 2.580). The clinical and was discarded. Finally, we used a human CD3 positive The expression of CXCR3/CXCL10 and effect of the axis in OLP 801 selection kit to isolate the T lymphocytes. The cells were LAS 4000 mini imaging system (GE, New York, USA). placed in an incubator at 37 °C with 5% CO2. The results were analyzed by gray value via Compass software. RNA Extraction and Quantitative Real-time Polymerase Chain Reaction Enzyme-Linked Immunosorbent Assay Total RNAwas extracted from the T lymphocytes and The concentration of CXCL10 was determined by oral tissues by using a Takara reagent kit (Takara, Tokyo, using a human CXCL10 enzyme-linked immunosorbent Japan). The purity and concentration of the RNA were assay (ELISA) kit (Multi Sciences, Hangzhou, Zhejiang, determined by a Unico UV-2000(Unico, Shanghai, China). China) according to the manufacturer’s instructions. The The RNA was reverse-transcribed into cDNA by using a samples were diluted with a 1:1 ratio. Twenty plasma PrimeScript RT reagent kit (Takara, Tokyo, Japan). RT- samples in each group were continuously tested for twice qPCR was performed with a quantitative PCR system times, and three sets of duplicate wells were tested in (ABI 7300, USA) with a SYBR Green reagent. All primers parallel for each group in each time to obtain intra- and were designed and synthesized by the same manufacturer inter-assay coefficients of variation of CXCL10. (Invitrogen, Carlsbad, CA, USA). The following primers Briefly, monoclonal antibodies specific for CXCL10 were used: CXCR3, forward primer: TTGTACCG has been pre-coated onto 96-well microtiter plates. Stand- ATTGCCTACTCCTT and reverse primer: CCCAGAAT ards, samples and biotin-linked detection antibodies spe- GGGAGAGTAAGAAC; CXCL10, forward primer: cific for CXCL10 were pipetted into the wells. CXCL10 AACTGTACGCTGTACCTGCAT and reverse primer: was bound by the immobilized antibody and the detection GCATCGATTTTGCTCCCCTC; and GAPDH, forward antibody following incubation. After washing away any primer: ACCACAGTCCATGCCATCAC and reverse unbound substances, streptavidin-HRP was added. After primer: TCCACCACCCTGTTGCTGTA. The expression washing, the substrate solution was added to the wells.