DOCSLIB.ORG

Relationships Among the Genera Ashbya, Eremothecium, Holleya and Nematospora Determined from Rdna Sequence Divergence

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Relationships Among the Genera Ashbya, Eremothecium, Holleya and Nematospora Determined from Rdna Sequence Divergence Journal of Industrial Microbiology, (1995) 14, 523-530 © 1995 Society for Indus rial Microbiology 0169-4146/95/$12.00 Relationships among the genera Ashbya, Eremothecium, Holleya and Nematospora determined from rDNA sequence divergence Cletus P. Kurtzman Microbial Properties Research, National Center for Agricultural Utilization Research, Agricultural Research Service, US Department of Agriculture, Peoria, Illinois 61604, USA (Received 15 July 1994; accepted 8 January 1995) Key words: Ashbya; Eremothecium; Holleya; Nematospora; rD A; Molecular systematics SUMMARY Species of the genera Ashbya, Eremothecium, Holleya, and ematospora were compared from extent of divergence in a S8G-nucleotide region near the 5' end of the large subunit (26S) ribosomal DA gene. The four genera are closely related and comprise a subclade of the hemiascomycetes. Because the taxa show little divergence, it is proposed that all be placed in the genus Eremothecium. The family Eremotheciaceae, fam. nov., is proposed. TRODUCTIO mixture of eight (minor component) and nine (major component) isoprene units. The genera Ashbya Guilliermond, Eremothecium Borzi, Classification of the foregoing taxa has been complicated Holleya Yamada, Metschnikowia Kamienski, and Nemato­ by the perception [22] that genera which commonly form bud­ spora Peglion are characterized by needled-shaped ascospores ding yeast cells (Holleya, Metschnikowia, Nematospora) are that may be linear or falcate. Ascospores of Nematospora dif­ phylogenetically separate from genera that do not ordinarily fer further and are appended with a long flagellum-like ter­ form budding cells (Ashbya, Eremothecium). Phylogenetic minal extension of cell wall material. With the exception of analysis of ribosomal R A/ribosomal DA (rRNA/rD A) Metschnikowia, the taxa are pathogenic to a variety of plant nucleotide sequence divergence in selected genera of asco­ species [3], and Ashbya and Eremothecium are used worldwide mycetous yeasts and yeastlike fungi has indicated that the bud­ for production of riboflavin (vitamin B 2) [10,33]. ding yeasts and yeastlike fungi represent a group of taxa that Batra [3] and von Arx et al. [29] discussed the phenotypic is separate from the filamentous ascomycetes [2,4,7,13,14,31]. similarities of Ashbya, Eremothecium and Nematospora and In an extension of these studies, Kurtzman and Robnett [17] suggested that the three taxa might be congeneric. Another compared partial sequences of large and small subunit rR As genus in this complex is Spermophthora Ashby & owell. from the type species of all cultivatable genera of asco­ There is no extant type material from Spermophthora, and mycetous yeasts and yeastlike fungi. Results from this study strains of the taxon have not been isolated since its original demonstrated that all budding yeasts and yeastlike fungi are description. Von Arx et al. [29] suggested that Spermophthora members of a clade separate from the filamentous ascomy­ gossypii Ashby & Nowell, the only known species of Sper­ cetes. The analysis also demonstrated that Ashbya, Eremothec­ mophthora, represented a contaminated specimen of Eremo­ ium, Holleya and Nematospora represent closely related mem­ thecium (Crebrothecium Routien) ashbyi (Guilliermond ex bers of a subclade that is phylogenetically separate from the Routien) Batra. Holleya sinecauda (Holley) Yamada was first subclade that includes the genus Metschnikowia. While the described as Nematospora sinecauda Holley [9]. Yamada [34] separation of the two subclades from one another and from all transferred N. sinecauda to the new genus Holleya because, other yeast genera was strongly supported (bootstrap mlike Nematospora coryli Peglion, which has ascospores with values = 100%), there were insufficient phylogenetically long terminal appendages and coenzyme Q with either five or <;ix isoprene units, N. sinecauda forms shorter ascospores with­ informative sites to resolve branching order within the sub­ out terminal appendages and produces coenzyme Q with a clade comprised of Ashbya, Eremothecium, Holleya and Nem­ atospora. In the present study, these four genera were reexamined from comparisons of additional nucleotide sequences. The This paper is dedicated to Professor Herman Jan Phaff in honor of resulting analysis has been used as the basis for redefining the his 50 years of active research which still continues. systematics of this group. Correspondence to: Dr c.P. Kurtzman, National Center for Agricul­ tural Utilization Research, 1815 . University Street, Peoria, IL 61604, USA. Molecular systematics of Eremothecium CP Kurtzman 524 MATERIALS AD METHODS GGTCCGTGTTTCAAGACGG) [24]. Amplification was for 36 PCR cycles with annealing at 52 DC, extension at 72 DC for Organisms and culture conditions 2 min, and denaturation at 94 DC for 1 min. The amplified The strains studied are listed in Table 1, and all are main­ DA was purified with Geneclean II (Bio 101, La Jolla, CA, tained in the Agricultural Research Service Culture Collection USA) according to the manufacturer's instructions. Visualiz­ (RRL), ational Center for Agricultural Utilization ation of the amplified DA was performed following Gene­ Research, Peoria, IL, USA. Cells for DNA extraction were clean treatment by electrophoresis in 1.5% agarose in grown for approximately 48 h at 25 DC in 50 ml YM broth 1 X TAE buffer (0.04 M Tris-acetate, 0.001 M EDTA, pH 8.0) [32] on a rotary shaker at 200 r.p.m. and harvested by centri­ and then staining with ethidium bromide (8 X 10-5 fLg ILl-i). fugation. After the cells were washed once with distilled water, Both strands of the rD A regions compared wert they were resuspended in 2 ml distilled water and 1 ml of the sequenced using the ABI Taq DyeDeoxyTM Terminator Cycle suspension was pipetted into a microfuge tube. After centrifug­ Sequencing Kit (Applied Biosystems Inc., Foster City, CA, ation, excess water was decanted and the packed cells were USA). Four sequencing reactions were required for each D A. lyophilized overnight and stored in a freezer until used. Primers for these reactions were the external primers L-l and L-4, and the internal primers L-2 (5'- DNA isolation, PCR and sequencing reactions CTCTCTTTTCAAAGTTCTTTTCATCT) and L-3 (5'- DA isolation for PCR was performed using a modified AGATGAAAAGAACTTTGAAAAGAGAG) [24]. version of the SDS protocol of Raeder and Broda [26]. The Sequence data were visually aligned using QEdit 2.15 lyophilized cell mass was broken apart in a 1.5-ml microfuge (SemWare, Marietta, GA, USA). The sequences of Saccharo­ tube with a pipette tip, and ca. 0.5 ml of 0.5-mm glass beads myces cerevisiae Meyen ex Hansen (a non-mycelial species) were added to the microfuge tube. The tube was shaken for and Cephaloascus fragrans Hanawa (a mycelial species) were 20 min on a wrist-action shaker at maximum speed. This treat­ used as references. Phylogenetic relationships were determined ment fractured about 25% of the cells. The cells were sus­ from the program PAUP, version 3.1.1 [28] using the branch­ pended in 1 ml of extraction buffer (200 mM Tris-HCl, and-bound search option followed by bootstrap analysis (1000 pH 8.4; 200 mM NaCI; 25 mM EDTA, pH 8.0; 0.5% SDS) replications). An alternative analysis used the heuristic search and extracted with phenol-chloroform and chloroform. DA option of PAUP. was precipitated from the aqueous phase by adding 0.54 vol­ ume isopropanol and pelleted for ca. 2 min in a microfuge at RESULTS AND DISCUSSIO 10000 r.p.m. The pellet was washed gently with 70% ethanol, resuspended in 100 ILl TE buffer (10 mM Tris-HCI; 1 mM Asci and ascospores of Ashbya, Eremothecium, Holleya EDTA, pH 8.0) and dissolved by incubation at 55 DC for 1 h and Nematospora are illustrated in Figs 1-5. Ascospores often to overnight. Dilute DA samples for PCR were prepared by form as two interleaved groups within the asci and, at maturity, adding 4 j.d of the genomic stocks to 1 ml TEll0 buffer. ascus walls deliquesce. The ascospores of all taxa are elon­ A divergent domain at the 5' end of the 26S rD A gene gated and needle-like; those of E. ashbyi are notably falcate [5] was symmetrically amplified using primers L-l (5'- whereas ascospores of N. coryli are appended with a long, GCATATCAATAAGCGGAGGAAAAG) and L-4 (5'- whip-like extension of wall material. Ascospores of Eremo- TABLE I Key characteristics of the strains examined Species Strain no. Coenzyme Q Bud Source of (major component) formation isolate RRL CBS Ashbya gossypii Y-1056a 109.51 6 Unknown Y-1810 Cotton boll, Trinidad Eremothecium ashbyi Y-1363a 6 Cotton boll? Y-7249 Cotton boll, South Africa Eremothecium cymbalariae Y-17582a 270.75 7 Brachynema germari, Iran Holleya sinecauda Y-I7231 b 8199 9 + Oriental mustard, Canada Nematospora coryli Y-12970b 2608 5 Hazel nut Y-1618 2599 6 + Cotton boll, as N. phaseoli Saccharomyces cerevisiae Y-12632b 1171 6 + Beer Cephaloascus fragrans Y-6742b 121.29 7 Unknown a Authentic strain. There is no known type strain. b Type strain. Molecular systematics of Eremothecium CP Kur zman 525 10 pm Figs 1-5. Asci and ascospores. a) Asci with immature ascospores. b) Mature ascospores released following deliquescence of ascus walls. 1) Ashbya gossypii. 2) Eremothecium ashhyi. 3) Nematospora coryli. 4) Eremothecium cymbalariae. 5) Holleya sinecauda. The IO-fLm marker bar applies to all Figures. Molecular systematics of Eremothecium CP Kurtzman 526 theeium are one-celled, but those of Ashbya, Holleya and Nem­ which D. hansenii (Zopf) Lodder & Kreger-van Rij is assigned atospora are usually two-celled. Holleya typically produces [16,18]. Hoelzer and Melnick [8] noted a lack of phylogenetic eight ascospores per ascus but the number may be double that resolution among closely related animal species and suggested for Nematospora. The other taxa usually form in excess of that this may reflect that cladogenesis does not always occur eight ascospores per ascus with as many as 32 sometimes through a series of bifurcations.
Load more

Recommended publications
  • Genome Scale Metabolic Modeling of the Riboflavin Overproducer Ashbya Gossypii
    Chalmers Publication Library Genome Scale Metabolic Modeling of the Riboflavin Overproducer Ashbya gossypii This document has been downloaded from Chalmers Publication Library (CPL). It is the author´s version of a work that was accepted for publication in: Biotechnology and Bioengineering (ISSN: 0006-3592) Citation for the published paper: Ledesma-Amaro, R. ; Kerkhoven, E. ; Revuelta, J. (2014) "Genome Scale Metabolic Modeling of the Riboflavin Overproducer Ashbya gossypii". Biotechnology and Bioengineering, vol. 111(6), pp. 1191-1199. http://dx.doi.org/10.1002/bit.25167 Downloaded from: http://publications.lib.chalmers.se/publication/200098 Notice: Changes introduced as a result of publishing processes such as copy-editing and formatting may not be reflected in this document. For a definitive version of this work, please refer to the published source. Please note that access to the published version might require a subscription. Chalmers Publication Library (CPL) offers the possibility of retrieving research publications produced at Chalmers University of Technology. It covers all types of publications: articles, dissertations, licentiate theses, masters theses, conference papers, reports etc. Since 2006 it is the official tool for Chalmers official publication statistics. To ensure that Chalmers research results are disseminated as widely as possible, an Open Access Policy has been adopted. The CPL service is administrated and maintained by Chalmers Library. (article starts on next page) ARTICLE Genome Scale Metabolic Modeling of the
    [Show full text]
  • Genome Diversity and Evolution in the Budding Yeasts (Saccharomycotina)
    | YEASTBOOK GENOME ORGANIZATION AND INTEGRITY Genome Diversity and Evolution in the Budding Yeasts (Saccharomycotina) Bernard A. Dujon*,†,1 and Edward J. Louis‡,§ *Department Genomes and Genetics, Institut Pasteur, Centre National de la Recherche Scientifique UMR3525, 75724-CEDEX15 Paris, France, †University Pierre and Marie Curie UFR927, 75005 Paris, France, ‡Centre for Genetic Architecture of Complex Traits, and xDepartment of Genetics, University of Leicester, LE1 7RH, United Kingdom ORCID ID: 0000-0003-1157-3608 (E.J.L.) ABSTRACT Considerable progress in our understanding of yeast genomes and their evolution has been made over the last decade with the sequencing, analysis, and comparisons of numerous species, strains, or isolates of diverse origins. The role played by yeasts in natural environments as well as in artificial manufactures, combined with the importance of some species as model experimental systems sustained this effort. At the same time, their enormous evolutionary diversity (there are yeast species in every subphylum of Dikarya) sparked curiosity but necessitated further efforts to obtain appropriate reference genomes. Today, yeast genomes have been very informative about basic mechanisms of evolution, speciation, hybridization, domestication, as well as about the molecular machineries underlying them. They are also irreplaceable to investigate in detail the complex relationship between genotypes and phenotypes with both theoretical and practical implications. This review examines these questions at two distinct levels offered by the broad evolutionary range of yeasts: inside the best-studied Saccharomyces species complex, and across the entire and diversified subphylum of Saccharomycotina. While obviously revealing evolutionary histories at different scales, data converge to a remarkably coherent picture in which one can estimate the relative importance of intrinsic genome dynamics, including gene birth and loss, vs.
    [Show full text]
  • Oxylipin Distribution in Eremothecium
    1 Oxylipin distribution in Eremothecium by Ntsoaki Joyce Leeuw Submitted in accordance with the requirements for the degree Magister Scientiae in the Department of Microbial, Biochemical and Food Biotechnology Faculty of Natural and Agricultural Sciences University of the Free State Bloemfontein South Africa Supervisor: Prof J.L.F. Kock Co- supervisors: Dr C.H. Pohl Prof P.W.J. Van Wyk November 2006 2 This dissertation is dedicated to the following people: My mother (Nkotseng Leeuw) My brother (Kabelo Leeuw) My cousins (Bafokeng, Lebohang, Mami, Thabang and Rorisang) Mr. Eugean Malebo 3 ACKNOWLEDGEMENTS I wish to thank and acknowledge the following: ) God, to You be the glory for the things You have done in my life. ) My family (especially my mom) – for always being there for me when I’m in need. ) Prof. J.L.F Kock for his patience, constructive criticisms and guidance during the course of this study. ) Dr. C.H. Pohl for her encouragement and assistance in the writing up of this dissertation. ) Mr. P.J. Botes for assistance with the GC-MS. ) Prof. P.W.J. Van Wyk and Miss B. Janecke for assistance with the CLSM and SEM. ) My fellow colleagues (especially Chantel and Desmond) for their assistance, support and encouragement. ) Mr. Eugean Malebo for always being there when I needed you. 4 CONTENTS Page Title page I Acknowledgements II Contents III CHAPTER 1 Introduction 1.1 Motivation 2 1.2 Definition and classification of yeasts 3 1.3 Classification of Eremothecium and related genera 5 1.4 Pathogenicity 12 1.5 Oxylipins 13 1.5.1 Definition
    [Show full text]
  • The Phylogeny of Plant and Animal Pathogens in the Ascomycota
    Physiological and Molecular Plant Pathology (2001) 59, 165±187 doi:10.1006/pmpp.2001.0355, available online at http://www.idealibrary.com on MINI-REVIEW The phylogeny of plant and animal pathogens in the Ascomycota MARY L. BERBEE* Department of Botany, University of British Columbia, 6270 University Blvd, Vancouver, BC V6T 1Z4, Canada (Accepted for publication August 2001) What makes a fungus pathogenic? In this review, phylogenetic inference is used to speculate on the evolution of plant and animal pathogens in the fungal Phylum Ascomycota. A phylogeny is presented using 297 18S ribosomal DNA sequences from GenBank and it is shown that most known plant pathogens are concentrated in four classes in the Ascomycota. Animal pathogens are also concentrated, but in two ascomycete classes that contain few, if any, plant pathogens. Rather than appearing as a constant character of a class, the ability to cause disease in plants and animals was gained and lost repeatedly. The genes that code for some traits involved in pathogenicity or virulence have been cloned and characterized, and so the evolutionary relationships of a few of the genes for enzymes and toxins known to play roles in diseases were explored. In general, these genes are too narrowly distributed and too recent in origin to explain the broad patterns of origin of pathogens. Co-evolution could potentially be part of an explanation for phylogenetic patterns of pathogenesis. Robust phylogenies not only of the fungi, but also of host plants and animals are becoming available, allowing for critical analysis of the nature of co-evolutionary warfare. Host animals, particularly human hosts have had little obvious eect on fungal evolution and most cases of fungal disease in humans appear to represent an evolutionary dead end for the fungus.
    [Show full text]
  • Comparative Genomics of Biotechnologically Important Yeasts Supplementary Appendix
    Comparative genomics of biotechnologically important yeasts Supplementary Appendix Contents Note 1 – Summary of literature on ascomycete yeasts used in this study ............................... 3 CUG-Ser yeasts ................................................................................................................................................................ 3 Other Saccharomycotina ............................................................................................................................................. 5 Taphrinomycotina ....................................................................................................................................................... 10 Note 2 – Genomes overview .................................................................................................11 Yeast culturing, identification, DNA and total RNA extraction ................................................................. 12 Genome sequencing and assembly ....................................................................................................................... 12 Transcriptome sequencing and assembly ......................................................................................................... 13 Table S1. Genome statistics ..................................................................................................................................... 14 Table S2. Annotation statistics ..............................................................................................................................
    [Show full text]
  • Ashbya Gossypii
    A role of actin-regulatory proteins in the formation of needle-shaped spores in the filamentous fungus Ashbya gossypii Dissertation zur Erlangung des akademischen Grades Doctor rerum naturalium (Dr. rer. nat.) Fachbereich Biologie/Chemie der Universität Osnabrück vorgelegt von Manuela Lickfeld Osnabrück, im März 2012 Table of contents 1 Summary 1 2 Introduction 3 2.1 Ashbya gossypii - a model for the investigation of cell biological processes 3 2.2 Sporulation in ascomycetes 7 2.3 The role of actin in spore development 11 2.4 Aims of this study 14 3 Results 21 3.1 A Bnr-like formin links actin to the spindle pole body during sporulation in the 23 filamentous fungus Ashbya gossypii M. Kemper, L. Mohlzahn, M. Lickfeld, C. Lang, S. Wählisch & H.P. Schmitz, (2011) Molecular Microbiology 80: 1276-1295 3.2 Selection of STOP-free sequences from random mutagenesis for 51 ދloss of interactionތ two-hybrid studies Lickfeld, M. & H.P. Schmitz, (2011) Yeast 28: 535-545. 3.3 A network involving Rho-type GTPases, a Paxillin and a Formin homolog 65 regulates spore length and spore wall integrity in the filamentous fungus Ashbya gossypii Lickfeld, M. & H.P. Schmitz, (2012) manuscript submitted 3.4 Dissection of Rho-GTPase function in polar growth and sporulation of 111 Ashbya gossypii Lickfeld, M. & H.P. Schmitz, (2012) manuscript in preparation 4 Concluding remarks 141 5 Appendix 145 5.1 The AgPXL1 deletion and overexpression strains show septation defects 145 5.2 AgPrk1 is essential in A. gossypii 146 6 Abbreviations 149 7 Anlage 1 151 8 Danksagung 153 1 Summary 1 Summary Spore formation is an essential step in the fungal life cycle that contributes to the dispersal of the organism and also to survival under harsh environmental conditions.
    [Show full text]
  • Genome Sequence of the Lignocellulose-Bioconverting and Xylose-Fermenting Yeast Pichia Stipitis
    ARTICLES Genome sequence of the lignocellulose-bioconverting and xylose-fermenting yeast Pichia stipitis Thomas W Jeffries1,2,8, Igor V Grigoriev3,8, Jane Grimwood4, Jose´ M Laplaza1,5, Andrea Aerts3, Asaf Salamov3, Jeremy Schmutz4, Erika Lindquist3, Paramvir Dehal3, Harris Shapiro3, Yong-Su Jin6, Volkmar Passoth7 & Paul M Richardson3 Xylose is a major constituent of plant lignocellulose, and its fermentation is important for the bioconversion of plant biomass to fuels and chemicals. Pichia stipitis is a well-studied, native xylose-fermenting yeast. The mechanism and regulation of xylose metabolism in P. stipitis have been characterized and genes from P. stipitis have been used to engineer xylose metabolism in Saccharomyces cerevisiae. We have sequenced and assembled the complete genome of P. stipitis. The sequence data have revealed unusual aspects of genome organization, numerous genes for bioconversion, a preliminary insight into regulation of central metabolic pathways and several examples of colocalized genes with related functions. http://www.nature.com/naturebiotechnology The genome sequence provides insight into how P. stipitis regulates its redox balance while very efficiently fermenting xylose under microaerobic conditions. Xylose is a five-carbon sugar abundant in hardwoods and agri- RESULTS cultural residues1, so its fermentation is essential for the economic The 15.4-Mbp genome of P. stipitis was sequenced using a shotgun conversion of lignocellulose to ethanol2. Pichia stipitis Pignal (1967) is approach and finished to high quality (o1 error in 100,000). The a haploid, homothallic, hemiascomycetous yeast3,4 that has the eight chromosomes range in size from 3.5 to 0.97 Mbp, as previously highest native capacity for xylose fermentation of any known reported16.
    [Show full text]
  • Six Key Traits of Fungi: Their Evolutionary Origins and Genetic Bases LÁSZLÓ G
    Six Key Traits of Fungi: Their Evolutionary Origins and Genetic Bases LÁSZLÓ G. NAGY,1 RENÁTA TÓTH,2 ENIKŐ KISS,1 JASON SLOT,3 ATTILA GÁCSER,2 and GÁBOR M. KOVÁCS4,5 1Synthetic and Systems Biology Unit, Institute of Biochemistry, HAS, Szeged, Hungary; 2Department of Microbiology, University of Szeged, Szeged, Hungary; 3Department of Plant Pathology, Ohio State University, Columbus, OH 43210; 4Department of Plant Anatomy, Institute of Biology, Eötvös Loránd University, Budapest, Hungary; 5Plant Protection Institute, Center for Agricultural Research, Hungarian Academy of Sciences, Budapest, Hungary ABSTRACT The fungal lineage is one of the three large provides an overview of some of the most important eukaryotic lineages that dominate terrestrial ecosystems. fungal traits, how they evolve, and what major genes They share a common ancestor with animals in the eukaryotic and gene families contribute to their development. The supergroup Opisthokonta and have a deeper common ancestry traits highlighted here represent just a sample of the with plants, yet several phenotypes, such as morphological, physiological, or nutritional traits, make them unique among characteristics that have evolved in fungi, including po- all living organisms. This article provides an overview of some of larized multicellular growth, fruiting body development, the most important fungal traits, how they evolve, and what dimorphism, secondary metabolism, wood decay, and major genes and gene families contribute to their development. mycorrhizae. However, a great deal of other important The traits highlighted here represent just a sample of the traits also underlie the evolution of the taxonomically characteristics that have evolved in fungi, including polarized and phenotypically hyperdiverse fungal kingdom, which multicellular growth, fruiting body development, dimorphism, could fill up a volume on its own.
    [Show full text]
  • Ashbya Gossypii Beyond Industrial Riboflavin Production
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Universidade do Minho: RepositoriUM JBA-06974; No of Pages 13 Biotechnology Advances xxx (2015) xxx–xxx Contents lists available at ScienceDirect Biotechnology Advances journal homepage: www.elsevier.com/locate/biotechadv Research review paper Ashbya gossypii beyond industrial riboflavin production: A historical perspective and emerging biotechnological applications Tatiana Q. Aguiar 1,RuiSilva1, Lucília Domingues ⁎ CEB − Centre of Biological Engineering, University of Minho, 4710-057 Braga, Portugal article info abstract Article history: The filamentous fungus Ashbya gossypii has been safely and successfully used for more than two decades in the Received 28 May 2015 commercial production of riboflavin (vitamin B2). Its industrial relevance combined with its high genetic similar- Received in revised form 28 September 2015 ity with Saccharomyces cerevisiae together promoted the accumulation of fundamental knowledge that has been Accepted 4 October 2015 efficiently converted into a significant molecular and in silico toolbox for its genetic engineering. This synergy has Available online xxxx enabled a directed and sustained exploitation of A. gossypii as an industrial riboflavin producer. Although there is fl Keywords: still room for optimizing ribo avin production, the recent years have seen an abundant advance in the explora- Ashbya gossypii tion of A. gossypii for other biotechnological applications, such as the production of recombinant proteins, single Physiology cell oil and flavour compounds. Here, we will address the biotechnological potential of A. gossypii beyond ribofla- Metabolism vin production by presenting (a) a physiological and metabolic perspective over this fungus; (b) the molecular Genetic engineering toolbox available for its manipulation; and (c) commercial and emerging biotechnological applications for this Riboflavin industrially important fungus, together with the approaches adopted for its engineering.
    [Show full text]
  • A New Entrez Database Transitioning from Locuslink to Entrez
    NCBI News National Center for Biotechnology Information National Library of Medicine National Institutes of Health Spring 2004 Department of Health and Human Services Transitioning from LocusLink to Entrez Gene Cancer Chromosomes: a New Entrez Database A gene-based view of annotated The Entrez Gene help document genomes is essential to capitalize on provides tips to ease the transition Three databases, the NCI/NCBI the increase in the sequencing and for LocusLink users to the current SKY (Spectral Karyotyping)/M- analysis of model genomes. The Entrez Gene database. FISH (Multiplex-FISH) and CGH Entrez Gene database has been (Comparative Genomic The default display format for developed to supply key connections Hybridization) Database, the NCI Entrez Gene is the graphics display between maps, sequences, expression Mitelman Database of Chromosome shown in Figure 1 for BMP7, which profiles, structure, function, homolo- Aberrations in Cancer, and the NCI resembles the traditional view of a gy data, and the scientific literature. Recurrent Chromosome Aberrations LocusLink record. The array of col- Unique identifiers are assigned to in Cancer databases are now integrat- ored boxes at the head of LocusLink genes with defining sequence, genes ed into NCBI’s Entrez system as the reports that provide links to gene- with known map positions, and “Cancer Chromosomes” database. related resources is replaced by the genes inferred from phenotypic Cancer Chromosomes supports “Links” menu in Gene, which information. These gene identifiers searches for cytogenetic, clinical, or includes additional links, such as are tracked, and functional informa- reference information using the flexi- those to Books, GEO, UniSTS, and tion is added when available.
    [Show full text]
  • Table of Contents (PDF)
    Contents DECEMBER 2011 • VOLUME 1 • ISSUE 7 • www.g3journal.org INVESTIGATIONS AND AUTHOR SUMMARIES 523–530 High-Resolution SNP/CGH Microarrays Reveal the Accumulation of Loss of Heterozygosity in Commonly Used Candida albicans Strains Darren Abbey, Meleah Hickman, David Gresham, and Judith Berman To quickly detect large-scale genome changes, we designed a high-resolution microarray that simultaneously detects single nucleotide polymorphism (SNP) alleles and independently measures copy number variation (CNV) loci by comparative genome hybridization (CGH) at 40,000 loci in the genome of Candida albicans, a fungal resident and pathogen of humans. By analyzing the SNPs as a function of chromosome copy number, we assembled a haplotype map, which assigns specific SNPs to specific chromosome homologs. Using the array and map, we detected genetic alterations that appeared in common lab strains and found that strain fitness generally decreases with increasing numbers of genome alterations. 531–538 Transposon-Mediated Transgenesis in the Short-Lived African Killifish Nothobranchius furzeri, a Vertebrate Model for Aging Dario Riccardo Valenzano, Sabrina Sharp, and Anne Brunet This study is the first report of transgenesis in the African killifish Nothobranchius furzeri, an extremely short-lived vertebrate species that is a promising model for aging research. Using the Tol2 transposase system, we generated stable lines of transgenic fish that express green fluorescent protein under the control of two different promoters. We also report successful integration of the transgene in the genome, and transmission through the germline. Our results pave the way for the use of N. furzeri as a genetically-tractable model system to study the mechanisms of vertebrate aging and longevity.
    [Show full text]
  • A Comparative Genomic Investigation of Niche Adaptation in Fungi”
    The Pennsylvania State University The Graduate School Huck Institute of the Life Sciences A COMPARATIVE GENOMIC INVESTIGATION OF NICHE ADAPTATION IN FUNGI A Dissertation in Integrative Biosciences by Venkatesh Moktali © 2013 Venkatesh Moktali Submitted in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy August 2013 ! The dissertation of Venkatesh Moktali was reviewed and approved* by the following: Seogchan Kang Professor of Plant Pathology and Environmental Microbiology Dissertation Advisor Chair of Committee David M. Geiser Professor of Plant Pathology and Environmental Microbiology Kateryna Makova Professor of Biology Anton Nekrutenko Associate Professor of Biochemistry and Molecular Biology Yu Zhang Associate Professor of Statistics Peter Hudson Department Head, Huck Institute of the Life Sciences *Signatures are on file in the Graduate School ! ! Abstract The Kingdom Fungi has a diverse array of members adapted to very disparate and the most hostile surroundings on earth: such as living plant and/or animal tissues, soil, aquatic environments, other microorganisms, dead animals, and exudates of plants, animals and even nuclear reactors. The ability of fungi to survive in these various niches is supported by the presence of key enzymes/proteins that can metabolize extraneous harmful factors. Characterization of the evolution of these key proteins gives us a glimpse at the molecular mechanisms underpinning adaptations in these organisms. Cytochrome P450 proteins (CYPs) are among the most diversified protein families, they are involved in a number of processed that are critical to fungi. I evaluated the evolution of Cytochrome P450 proteins (CYPs) in order to understand niche adaptation in fungi. Towards this goal, a previously developed database the fungal cytochrome P450 database (FCPD) was improved and several features were added in order to allow for systematic comparative genomic and phylogenomic analysis of CYPs from numerous fungal genomes.
    [Show full text]