DOCSLIB.ORG

Effects of Food-Derived Collagen Peptides on the Expression of Keratin and Keratin-Associated Protein Genes in the Mouse Skin

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Effects of Food-Derived Collagen Peptides on the Expression of Keratin and Keratin-Associated Protein Genes in the Mouse Skin Original Paper Skin Pharmacol Physiol 2015;28:227–235 Received: September 15, 2014 DOI: 10.1159/000369830 Accepted after revision: November 8, 2014 Published online: February 14, 2015 Effects of Food-Derived Collagen Peptides on the Expression of Keratin and Keratin-Associated Protein Genes in the Mouse Skin a a a a a, e Phuong Le Vu Ryo Takatori Taku Iwamoto Yutaka Akagi Hideo Satsu a b d a, c Mamoru Totsuka Kazuhiro Chida Kenji Sato Makoto Shimizu a b c Departments of Applied Biological Chemistry and Animal Resource Sciences, The University of Tokyo, and Department d of Nutritional Science, Tokyo University of Agriculture, Tokyo , Division of Applied Life Sciences, Kyoto Prefectural e University, Kyoto , and Department of Biotechnology, Maebashi Institute of Technology, Maebashi , Japan Key Words were cultured without fibroblasts, suggesting that the pres- Coculture · Collagen · Food-derived collagen peptides · ence of fibroblasts is essential for the effects of Pro-Hyp. Our Gene expression · Keratinocytes · Skin study presents new insights into the effects of CP on the skin, which might link to the hair cycle. © 2015 S. Karger AG, Basel Abstract Oral ingestion of collagen peptides (CP) has long been sug- gested to exert beneficial effects on the skin, but the mo- Introduction lecular events induced by CP on the skin remain unclear. Here, we investigated the effects of oral CP administration The skin is the foremost protective barrier of the body, on gene expression in hairless mouse skin and of prolyl-hy- which acts to prevent environmental harmful factors as droxyproline (Pro-Hyp), a collagen-derived dipeptide, on well as water loss. The outer compartment of the skin is gene expression in a coculture of mouse skin keratinocytes the epidermis, which comprises 4 layers of keratinocytes, and fibroblasts. Using microarray analysis, we found that oral which functions as a physical, biochemical and immuno- administration of CP to hairless mice for 6 weeks induced logical barrier of the skin. Underlying the epidermis is the increased expression of Krtap and Krt genes in the skin. An- dermis, which comprises mainly fibroblasts in an extra- notation analysis using DAVID revealed that a group of the cellular matrix [1] . The current literature indicates that up-regulated genes, Gprc5d, Sprr2a1, Krt27 and Krtap16-7, dermal extracellular matrix remodeling is involved in is associated with the development of the epidermis and the skin homeostasis, aging and wound healing [2] , and that hair cycle. In addition, the presence of Pro-Hyp (200 μM ) in- dermis-epidermis interactions play an indispensable role duced an increase in the expression of Krtap16-7, Krtap15, in the regulation of these processes [3, 4] . Furthermore, Krtap14 and Krtap8-2 in keratinocytes in coculture, partially the molecular signals exchanged between these compart- resembling the in vivo result. The Pro-Hyp-induced up-reg- ments also mediate hair follicle formation and hair cy- ulation of these genes was not observed when keratinocytes cling [5] . © 2015 S. Karger AG, Basel Makoto Shimizu 1660–5527/15/0285–0227$39.50/0 Department of Nutritional Science Tokyo University of Agriculture, Sakura-gaoka E-Mail [email protected] 1-1-1, Setagaya-ku, Tokyo (Japan) www.karger.com/spp E-Mail ms205346 @ nodai.ac.jp Downloaded by: Kyoto University 130.54.110.72 - 3/5/2015 2:07:27 AM Not only is the skin affected by extrinsic factors, it is animal model [13] , and intestinal absorption and tissue also altered by intrinsic aging. Attempts have been made distribution of gelatin hydrolysates, hydrolyzed products to search and analyze functional food compounds that of collagen, were assessed in a study using 14 C-labeled hy- can protect the skin from damage and aging. Among the drolysates [14, 15] . Recent clinical studies have also estab- most studied food substances are polyphenols from vari- lished that oral intake of collagen peptides (CP) reduces ous sources. Oral administration of baicalein (5,6,7-trihy- skin wrinkles and improves biophysical parameters in droxyflavone) and wogonin (5,7-dihydroxy-8-methoxy- aged skin [16, 17] . Furthermore, following the ingestion flavone) extracted from Scutellaria baicalensis roots, for of gelatin hydrolysates, prolyl-hydroxyproline (Pro-Hyp) example, was reported to suppress ultraviolet-induced was significantly increased in human blood, which skin damage [6] . Green tea polyphenols, especially EGCG reached up to 200 μ M in some individuals, among the [(–)-epigallocatechin-3-gallate], was found to have pro- collagen-derived di- and tripeptides and free amino acids tective effects against photocarcinogenesis when topical- [18]. Pro-Hyp was found to have a stimulatory effect on ly applied to hairless mice [7, 8]. In addition, beneficial cell growth of mouse skin fibroblasts, leading to the hy- effects of dietary ceramides, such as glucosylceramides pothesis that it is the key peptide in biological activities of and sphingolipids, in restoring skin functions have been dietary collagen [19] . suggested. Hasegawa et al. [9] reported improved corni- Although oral CP administration was proven to pro- fied envelope formation in the skin following oral admin- tect mouse skin from the UV-induced transepidermal istration of glucosylceramide. Another ceramide deriva- water loss and UV-induced matrix metalloproteinase 1 tive was found to have an inhibitory effect on skin inflam- protein expression [20] , little is known about the effects mation [10] . Apart from polyphenols and ceramides, the of CP on normal (nonirradiated) skin, especially their potent benefits of diet-derived collagen on the skin have effects on gene expression levels in the skin. We per- also been considered [11] . Long-term oral administration formed DNA microarrays to identify the effects of CP of marine collagen hydrolysates was found to exert pro- ingestion on gene expression levels in hairless mouse tective effects on skin aging, which was attributable to the skin under normal conditions (nonirradiated). In addi- antioxidant property of collagen [12] . tion, we addressed the effects of Pro-Hyp on gene ex- Collagens, along with fibrillins, laminins and other pression in a coculture of mouse skin keratinocytes and macromolecules, are synthesized in fibroblasts and se- fibroblasts. creted into the matrix, where they are cross-linked to form a complex network. These proteins characterize the structure of the dermis, and, most importantly, they are Materials and Methods involved in various signaling pathways to maintain skin homeostasis. The biosynthesis process of collagen is initi- Materials Porcine CP mixture (mean molecular weight: 5,000) was ob- ated via the transcription of collagen genes, followed by tained from Nitta Gelatin (Osaka, Japan) and dissolved in distilled the translation into precursor polypeptides. The structure water at 0.02 g/ml. Pro-Hyp was purchased from Bachem (Buben- of these polypeptides is featured by the repeat of Gly-X-Y dorf, Switzerland) and reconstituted in methanol according to the triplets, where X and Y are often proline and hydroxypro- manufacturer’s instructions. Reduced serum medium (MCDB) line. The precursor polypeptides, termed α-chains, are and fetal bovine serum (FBS) were from Sigma (St. Louis, Mo., USA). Collagenase was purchased from Wako (Osaka, Japan). then modified in the rough endoplasmic reticulum and Ham’s F12 medium was from Life Technologies (Tokyo, Japan). the Golgi apparatus. Hydroxylation of prolyl and lysyl Cell matrix type I-A was from Nitta Gelatin. The RNeasy mini kit residues is one of the important modifications which lead for RNA extraction in the in vivo experiment was from Qiagen to the assembly of three α-chains to form a triple helix (Tokyo, Japan). ISOGEN for RNA extraction in the in vitro ex- called procollagen. Once secreted into the extracellular periment was from Nippon Gene (Tokyo, Japan). Cell culture in- serts (12-well plate format) with a polyethylene terephthalate space, the amino and carboxyl extensions of procollagen (PET) membrane and companion 12-well plates were from Becton are removed, followed by the alignment of procollagens Dickinson (Franklin Lakes, N.J., USA). to generate collagen fibers. These fibers are cross-linked with other components of the extracellular matrix, form- Animals and Diets ing a bioactive network [2] . Six-week-old female hairless mice (Hos:HR-1) were purchased from Japan SLC (Shizuoka, Japan) and kept at 25 ° C under a Dietary collagen can be derived from sources such as 12-hour-light/12-hour-dark cycle during the experiment. They fish, porcine and chicken skin, and chicken tendon and were allowed free access to water and normal rodent diet (Labo MR cartilage. Oral intake of collagen was proven safe in an Stock in pellet form; Nosan, Kanagawa, Japan). Following 5 days 228 Skin Pharmacol Physiol 2015;28:227–235 Le Vu/Takatori/Iwamoto/Akagi/Satsu/ DOI: 10.1159/000369830 Totsuka/Chida/Sato/Shimizu Downloaded by: Kyoto University 130.54.110.72 - 3/5/2015 2:07:27 AM of acclimatization, mice were randomly divided into two groups: the control group and the collagen group (n = 5). The CP mixture was administered daily to the collagen group at 0.2 g/kg body Primary mouse weight p.o. whereas an equal volume of sterile water was adminis- skin keratinocytes tered to the control group. The amount of CP administered was Primary mouse based on a previous study by Tanaka et al. [20] . After 6 weeks, mice skin fibroblasts were sacrificed by cervical dislocation. Dorsal skin samples were obtained and snap-frozen in liquid nitrogen. The samples were stored at –80 ° C until analyzed. DNA Microarray Analysis Total RNA was extracted from the dorsal skin samples using the RNeasy mini kit according to the instructions, and the quality was determined using an Agilent 2100 Bioanalyzer. Equal amounts of RNA from 5 mice/group were pooled to normalize individual Skin-like layer differences for microarray analysis. Sense-strand cDNA was syn- thesized using an Ambion wild-type (WT) expression kit follow- ing the manufacturer’s protocol.
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Molecular and Physiological Basis for Hair Loss in Near Naked Hairless and Oak Ridge Rhino-Like Mouse Models: Tracking the Role of the Hairless Gene
    University of Tennessee, Knoxville TRACE: Tennessee Research and Creative Exchange Doctoral Dissertations Graduate School 5-2006 Molecular and Physiological Basis for Hair Loss in Near Naked Hairless and Oak Ridge Rhino-like Mouse Models: Tracking the Role of the Hairless Gene Yutao Liu University of Tennessee - Knoxville Follow this and additional works at: https://trace.tennessee.edu/utk_graddiss Part of the Life Sciences Commons Recommended Citation Liu, Yutao, "Molecular and Physiological Basis for Hair Loss in Near Naked Hairless and Oak Ridge Rhino- like Mouse Models: Tracking the Role of the Hairless Gene. " PhD diss., University of Tennessee, 2006. https://trace.tennessee.edu/utk_graddiss/1824 This Dissertation is brought to you for free and open access by the Graduate School at TRACE: Tennessee Research and Creative Exchange. It has been accepted for inclusion in Doctoral Dissertations by an authorized administrator of TRACE: Tennessee Research and Creative Exchange. For more information, please contact [email protected]. To the Graduate Council: I am submitting herewith a dissertation written by Yutao Liu entitled "Molecular and Physiological Basis for Hair Loss in Near Naked Hairless and Oak Ridge Rhino-like Mouse Models: Tracking the Role of the Hairless Gene." I have examined the final electronic copy of this dissertation for form and content and recommend that it be accepted in partial fulfillment of the requirements for the degree of Doctor of Philosophy, with a major in Life Sciences. Brynn H. Voy, Major Professor We have read this dissertation and recommend its acceptance: Naima Moustaid-Moussa, Yisong Wang, Rogert Hettich Accepted for the Council: Carolyn R.
    [Show full text]
  • Studies on the Proteome of Human Hair - Identifcation of Histones and Deamidated Keratins Received: 15 August 2017 Sunil S
    www.nature.com/scientificreports OPEN Studies on the Proteome of Human Hair - Identifcation of Histones and Deamidated Keratins Received: 15 August 2017 Sunil S. Adav 1, Roopa S. Subbaiaih2, Swat Kim Kerk 2, Amelia Yilin Lee 2,3, Hui Ying Lai3,4, Accepted: 12 January 2018 Kee Woei Ng3,4,7, Siu Kwan Sze 1 & Artur Schmidtchen2,5,6 Published: xx xx xxxx Human hair is laminar-fbrous tissue and an evolutionarily old keratinization product of follicle trichocytes. Studies on the hair proteome can give new insights into hair function and lead to the development of novel biomarkers for hair in health and disease. Human hair proteins were extracted by detergent and detergent-free techniques. We adopted a shotgun proteomics approach, which demonstrated a large extractability and variety of hair proteins after detergent extraction. We found an enrichment of keratin, keratin-associated proteins (KAPs), and intermediate flament proteins, which were part of protein networks associated with response to stress, innate immunity, epidermis development, and the hair cycle. Our analysis also revealed a signifcant deamidation of keratin type I and II, and KAPs. The hair shafts were found to contain several types of histones, which are well known to exert antimicrobial activity. Analysis of the hair proteome, particularly its composition, protein abundances, deamidated hair proteins, and modifcation sites, may ofer a novel approach to explore potential biomarkers of hair health quality, hair diseases, and aging. Hair is an important and evolutionarily conserved structure. It originates from hair follicles deep within the der- mis and is mainly composed of hair keratins and KAPs, which form a complex network that contributes to the rigidity and mechanical properties.
    [Show full text]
  • Table S1. the Clinicopathological Data of the Laryngeal Cancer Cases Involved in the Primary Tissue Culture
    Table S1. The clinicopathological data of the laryngeal cancer cases involved in the primary tissue culture Case Gender Age at Smoking Alcohol Histological type TNM Tumor coding* diagnosis status status staging† differentiation LC01 male 63 Yes Yes Supraglottic squamous cell carcinoma T4N2M0 Moderate LC14 male 73 Yes Yes Supraglottic squamous cell carcinoma T3N2M0 Moderate LC53 male 54 Yes No Supraglottic squamous cell carcinoma T3N2M0 Moderate LC95 male 50 Yes Yes Glottic squmamous cell carcinoma T3N1M0 Poor *LC represents laryngeal cancer. † staged according to Sixth Edition (2002) of the AJCC-UICC TNM Staging System. Table S2. The clinical characteristics of the 149 patients with laryngeal SCC used for ELISA Variable N (%) Variable N(%) Age (years) Disease stage ≤55 58 (38.9) I 33 (22.1) >55 91 (61.1) II 32 (21.5) Median (range) 58 (35-82) III 41 (27.5) IV 41 (27.5) Missing 2 (1.3) Gender T stage* Male 140 (94.0) T1 33 (21.5) Female 9 (6.0) T2 36 (24.2) T3 52 (34.9) T4 26 (17.4) Missing 2 (1.3) Smoking status Lymph node status Ever 124 (83.2) pN0 110 (73.8) Never 11 (7.4) pN+ 37 (24.8) Missing 14 (9.4) Missing 2 (1.3) Alcohol status Tumor differentiation Yes 84 (56.4) well 34 (22.8) No 51(34.2) moderate 78 (52.3) Missing 14 (9.4) poor 24 (16.1) Missing 13 (8.7) Anatomical region Glottis 82 (55.0) Supraglottis 60 (40.3) Subglottis 1 (0.7) Missing 6 (4.0) *staged according to Sixth Edition (2002) of the AJCC-UICC TNM Staging System.
    [Show full text]
  • RSC Advances
    RSC Advances This is an Accepted Manuscript, which has been through the Royal Society of Chemistry peer review process and has been accepted for publication. Accepted Manuscripts are published online shortly after acceptance, before technical editing, formatting and proof reading. Using this free service, authors can make their results available to the community, in citable form, before we publish the edited article. This Accepted Manuscript will be replaced by the edited, formatted and paginated article as soon as this is available. You can find more information about Accepted Manuscripts in the Information for Authors. Please note that technical editing may introduce minor changes to the text and/or graphics, which may alter content. The journal’s standard Terms & Conditions and the Ethical guidelines still apply. In no event shall the Royal Society of Chemistry be held responsible for any errors or omissions in this Accepted Manuscript or any consequences arising from the use of any information it contains. www.rsc.org/advances Page 1 of 8 RSC Advances The Effects of Solvent Composition on the Affinity of a Peptide towards Hair Keratin: Experimental and Molecular Dynamics Data. Egipto Antunes a, Célia F. Cruz a, Nuno G. Azoia a, Artur Cavaco-Paulo a* a CEB – Centre of Biological Engineering, University of Minho, 4710-057 Braga, Portugal Table of Contents Manuscript Accepted Molecular dynamics simulations with a developed hair protofibril model demonstrated capability to improve a peptide uptake by hair shafts. Advances RSC RSC Advances Page 2 of 8 RSC Advances RSCPublishing ARTICLE The Effects of Solvent Composition on the Affinity of a Peptide towards Hair Keratin: Experimental and Cite this: DOI: 10.1039/x0xx00000x Molecular Dynamics Data.
    [Show full text]
  • 140503 IPF Signatures Supplement Withfigs Thorax
    Supplementary material for Heterogeneous gene expression signatures correspond to distinct lung pathologies and biomarkers of disease severity in idiopathic pulmonary fibrosis Daryle J. DePianto1*, Sanjay Chandriani1⌘*, Alexander R. Abbas1, Guiquan Jia1, Elsa N. N’Diaye1, Patrick Caplazi1, Steven E. Kauder1, Sabyasachi Biswas1, Satyajit K. Karnik1#, Connie Ha1, Zora Modrusan1, Michael A. Matthay2, Jasleen Kukreja3, Harold R. Collard2, Jackson G. Egen1, Paul J. Wolters2§, and Joseph R. Arron1§ 1Genentech Research and Early Development, South San Francisco, CA 2Department of Medicine, University of California, San Francisco, CA 3Department of Surgery, University of California, San Francisco, CA ⌘Current address: Novartis Institutes for Biomedical Research, Emeryville, CA. #Current address: Gilead Sciences, Foster City, CA. *DJD and SC contributed equally to this manuscript §PJW and JRA co-directed this project Address correspondence to Paul J. Wolters, MD University of California, San Francisco Department of Medicine Box 0111 San Francisco, CA 94143-0111 [email protected] or Joseph R. Arron, MD, PhD Genentech, Inc. MS 231C 1 DNA Way South San Francisco, CA 94080 [email protected] 1 METHODS Human lung tissue samples Tissues were obtained at UCSF from clinical samples from IPF patients at the time of biopsy or lung transplantation. All patients were seen at UCSF and the diagnosis of IPF was established through multidisciplinary review of clinical, radiological, and pathological data according to criteria established by the consensus classification of the American Thoracic Society (ATS) and European Respiratory Society (ERS), Japanese Respiratory Society (JRS), and the Latin American Thoracic Association (ALAT) (ref. 5 in main text). Non-diseased normal lung tissues were procured from lungs not used by the Northern California Transplant Donor Network.
    [Show full text]
  • The Correlation of Keratin Expression with In-Vitro Epithelial Cell Line Differentiation
    The correlation of keratin expression with in-vitro epithelial cell line differentiation Deeqo Aden Thesis submitted to the University of London for Degree of Master of Philosophy (MPhil) Supervisors: Professor Ian. C. Mackenzie Professor Farida Fortune Centre for Clinical and Diagnostic Oral Science Barts and The London School of Medicine and Dentistry Queen Mary, University of London 2009 Contents Content pages ……………………………………………………………………......2 Abstract………………………………………………………………………….........6 Acknowledgements and Declaration……………………………………………...…7 List of Figures…………………………………………………………………………8 List of Tables………………………………………………………………………...12 Abbreviations….………………………………………………………………..…...14 Chapter 1: Literature review 16 1.1 Structure and function of the Oral Mucosa……………..…………….…..............17 1.2 Maintenance of the oral cavity...……………………………………….................20 1.2.1 Environmental Factors which damage the Oral Mucosa………. ….…………..21 1.3 Structure and function of the Oral Mucosa ………………...….……….………...21 1.3.1 Skin Barrier Formation………………………………………………….……...22 1.4 Comparison of Oral Mucosa and Skin…………………………………….……...24 1.5 Developmental and Experimental Models used in Oral mucosa and Skin...……..28 1.6 Keratinocytes…………………………………………………….….....................29 1.6.1 Desmosomes…………………………………………….…...............................29 1.6.2 Hemidesmosomes……………………………………….…...............................30 1.6.3 Tight Junctions………………………….……………….…...............................32 1.6.4 Gap Junctions………………………….……………….….................................32
    [Show full text]
  • MALE Protein Name Accession Number Molecular Weight CP1 CP2 H1 H2 PDAC1 PDAC2 CP Mean H Mean PDAC Mean T-Test PDAC Vs. H T-Test
    MALE t-test t-test Accession Molecular H PDAC PDAC vs. PDAC vs. Protein Name Number Weight CP1 CP2 H1 H2 PDAC1 PDAC2 CP Mean Mean Mean H CP PDAC/H PDAC/CP - 22 kDa protein IPI00219910 22 kDa 7 5 4 8 1 0 6 6 1 0.1126 0.0456 0.1 0.1 - Cold agglutinin FS-1 L-chain (Fragment) IPI00827773 12 kDa 32 39 34 26 53 57 36 30 55 0.0309 0.0388 1.8 1.5 - HRV Fab 027-VL (Fragment) IPI00827643 12 kDa 4 6 0 0 0 0 5 0 0 - 0.0574 - 0.0 - REV25-2 (Fragment) IPI00816794 15 kDa 8 12 5 7 8 9 10 6 8 0.2225 0.3844 1.3 0.8 A1BG Alpha-1B-glycoprotein precursor IPI00022895 54 kDa 115 109 106 112 111 100 112 109 105 0.6497 0.4138 1.0 0.9 A2M Alpha-2-macroglobulin precursor IPI00478003 163 kDa 62 63 86 72 14 18 63 79 16 0.0120 0.0019 0.2 0.3 ABCB1 Multidrug resistance protein 1 IPI00027481 141 kDa 41 46 23 26 52 64 43 25 58 0.0355 0.1660 2.4 1.3 ABHD14B Isoform 1 of Abhydrolase domain-containing proteinIPI00063827 14B 22 kDa 19 15 19 17 15 9 17 18 12 0.2502 0.3306 0.7 0.7 ABP1 Isoform 1 of Amiloride-sensitive amine oxidase [copper-containing]IPI00020982 precursor85 kDa 1 5 8 8 0 0 3 8 0 0.0001 0.2445 0.0 0.0 ACAN aggrecan isoform 2 precursor IPI00027377 250 kDa 38 30 17 28 34 24 34 22 29 0.4877 0.5109 1.3 0.8 ACE Isoform Somatic-1 of Angiotensin-converting enzyme, somaticIPI00437751 isoform precursor150 kDa 48 34 67 56 28 38 41 61 33 0.0600 0.4301 0.5 0.8 ACE2 Isoform 1 of Angiotensin-converting enzyme 2 precursorIPI00465187 92 kDa 11 16 20 30 4 5 13 25 5 0.0557 0.0847 0.2 0.4 ACO1 Cytoplasmic aconitate hydratase IPI00008485 98 kDa 2 2 0 0 0 0 2 0 0 - 0.0081 - 0.0
    [Show full text]
  • Experimental Eye Research 129 (2014) 93E106
    Experimental Eye Research 129 (2014) 93e106 Contents lists available at ScienceDirect Experimental Eye Research journal homepage: www.elsevier.com/locate/yexer Transcriptomic analysis across nasal, temporal, and macular regions of human neural retina and RPE/choroid by RNA-Seq S. Scott Whitmore a, b, Alex H. Wagner a, c, Adam P. DeLuca a, b, Arlene V. Drack a, b, Edwin M. Stone a, b, Budd A. Tucker a, b, Shemin Zeng a, b, Terry A. Braun a, b, c, * Robert F. Mullins a, b, Todd E. Scheetz a, b, c, a Stephen A. Wynn Institute for Vision Research, The University of Iowa, Iowa City, IA, USA b Department of Ophthalmology and Visual Sciences, Carver College of Medicine, The University of Iowa, Iowa City, IA, USA c Department of Biomedical Engineering, College of Engineering, The University of Iowa, Iowa City, IA, USA article info abstract Article history: Proper spatial differentiation of retinal cell types is necessary for normal human vision. Many retinal Received 14 September 2014 diseases, such as Best disease and male germ cell associated kinase (MAK)-associated retinitis pigmen- Received in revised form tosa, preferentially affect distinct topographic regions of the retina. While much is known about the 31 October 2014 distribution of cell types in the retina, the distribution of molecular components across the posterior pole Accepted in revised form 4 November 2014 of the eye has not been well-studied. To investigate regional difference in molecular composition of Available online 5 November 2014 ocular tissues, we assessed differential gene expression across the temporal, macular, and nasal retina and retinal pigment epithelium (RPE)/choroid of human eyes using RNA-Seq.
    [Show full text]
  • Table S2.A-B. Differentially Expressed Genes Following Activation of OGR1 by Acidic Ph in Mouse Peritoneal Macrophages Ph 6.7 24 H
    Table S2.A-B. Differentially expressed genes following activation of OGR1 by acidic pH in mouse peritoneal macrophages pH 6.7 24 h. A. Gene List, including gene process B. Complete Table (Excel). Rank Symbol Full name Involved in: WT/KO (Reference: Gene Card, NCBI, JAX, Uniprot, Ratio unless otherwise indicated) 1. Cyp11a1 Cholesterol side chain cleavage Cholesterol, lipid or steroid metabolism. enzyme, mitochondrial (Cytochrome Catalyses the side-chain cleavage reaction of P450 11A1) cholesterol to pregnenolone. 2. Sparc Secreted acidic cysteine rich Cell adhesion, wound healing, ECM glycoprotein (Osteonectin, Basement interactions, bone mineralization. Activates membrane protein 40 (BM-40)) production and activity of matrix metalloproteinases. 3. Tpsb2 Tryptase beta-2 or tryptase II (trypsin- Inflammatory response, proteolysis. like serine protease) 4. Inhba Inhibin Beta A or Activin beta-A chain Immune response and mediators of inflammation and tissue repair.2-5 5. Cpe Carboxypeptidase E Insulin processing, proteolysis. 6. Igfbp7 Insulin-like growth factor-binding Stimulates prostacyclin (PGI2) production and protein 7 cell adhesion. Induced by retinoic acid. 7. Clu Clusterin Chaperone-mediated protein folding, positive regulation of NF-κB transcription factor activity. Protects cells against apoptosis and cytolysis by complement. Promotes proteasomal degradation of COMMD1 and IKBKB. 8. Cma1 Chymase 1 Cellular response to glucose stimulus, interleukin-1 beta biosynthetic process. Possible roles: vasoactive peptide generation, extracellular matrix degradation. 9. Sfrp4 Secreted frizzled-related protein 4 Negative regulation of Wnt signalling. Increases apoptosis during ovulation. Phosphaturic effects by specifically inhibiting sodium-dependent phosphate uptake. 10. Ephx2 Bifunctional epoxide hydrolase Cholesterol homeostasis, xenobiotic metabolism by degrading potentially toxic epoxides.
    [Show full text]
  • Pflugers Final
    CORE Metadata, citation and similar papers at core.ac.uk Provided by Serveur académique lausannois A comprehensive analysis of gene expression profiles in distal parts of the mouse renal tubule. Sylvain Pradervand2, Annie Mercier Zuber1, Gabriel Centeno1, Olivier Bonny1,3,4 and Dmitri Firsov1,4 1 - Department of Pharmacology and Toxicology, University of Lausanne, 1005 Lausanne, Switzerland 2 - DNA Array Facility, University of Lausanne, 1015 Lausanne, Switzerland 3 - Service of Nephrology, Lausanne University Hospital, 1005 Lausanne, Switzerland 4 – these two authors have equally contributed to the study to whom correspondence should be addressed: Dmitri FIRSOV Department of Pharmacology and Toxicology, University of Lausanne, 27 rue du Bugnon, 1005 Lausanne, Switzerland Phone: ++ 41-216925406 Fax: ++ 41-216925355 e-mail: [email protected] and Olivier BONNY Department of Pharmacology and Toxicology, University of Lausanne, 27 rue du Bugnon, 1005 Lausanne, Switzerland Phone: ++ 41-216925417 Fax: ++ 41-216925355 e-mail: [email protected] 1 Abstract The distal parts of the renal tubule play a critical role in maintaining homeostasis of extracellular fluids. In this review, we present an in-depth analysis of microarray-based gene expression profiles available for microdissected mouse distal nephron segments, i.e., the distal convoluted tubule (DCT) and the connecting tubule (CNT), and for the cortical portion of the collecting duct (CCD) (Zuber et al., 2009). Classification of expressed transcripts in 14 major functional gene categories demonstrated that all principal proteins involved in maintaining of salt and water balance are represented by highly abundant transcripts. However, a significant number of transcripts belonging, for instance, to categories of G protein-coupled receptors (GPCR) or serine-threonine kinases exhibit high expression levels but remain unassigned to a specific renal function.
    [Show full text]
  • University of Alberta
    University of Alberta T cell-mediated inflammation is stereotyped: mouse delayed-type hypersensitivity reaction and mouse T cell-mediated rejection of renal allografts share common molecular mechanisms by Jeffery M. Venner A thesis submitted to the Faculty of Graduate Studies and Research in partial fulfillment of the requirements for the degree of Master of Science in Experimental Medicine Department of Medicine ©Jeffery M. Venner Fall 2011 Edmonton, Alberta Permission is hereby granted to the University of Alberta Libraries to reproduce single copies of this thesis and to lend or sell such copies for private, scholarly or scientific research purposes only. Where the thesis is converted to, or otherwise made available in digital form, the University of Alberta will advise potential users of the thesis of these terms. The author reserves all other publication and other rights in association with the copyright in the thesis and, except as herein before provided, neither the thesis nor any substantial portion thereof may be printed or otherwise reproduced in any material form whatsoever without the author's prior written permission. Dedicated to those who have inspired me: My family and friends, my teachers and mentors. You laid the foundation – my success is guaranteed ABSTRACT Genome-wide gene expression analysis of diseases has revealed large-scale changes in the expression of thousands of genes (transcripts) representing biological processes. The processes that occur during T cell-mediated rejection (TCMR) of renal allografts in mice and humans have been previously delineated, and they appear to be independent of cytotoxic mechanisms; thus, TCMR is analogous to delayed-type hypersensitivity (DTH).
    [Show full text]