DOCSLIB.ORG

Expression of Angiopoietin-TIE System Components in Angiosarcoma

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Expression of Angiopoietin-TIE System Components in Angiosarcoma Modern Pathology (2013) 26, 1032–1040 1032 & 2013 USCAP, Inc All rights reserved 0893-3952/13 $32.00 Expression of angiopoietin-TIE system components in angiosarcoma Darya Buehler1, Patrick Rush1, Jason R Hasenstein2, Stephanie R Rice2, Gholam Reza Hafez1, B Jack Longley3 and Kevin R Kozak2 1Department of Pathology, University of Wisconsin School of Medicine and Public Health, Madison, WI, USA; 2Department of Human Oncology, University of Wisconsin School of Medicine and Public Health, Madison, WI, USA and 3Department of Dermatology, University of Wisconsin School of Medicine and Public Health, Madison, WI, USA Angiosarcoma is an aggressive malignancy of endothelial differentiation. Potential roles of the endothelial angiopoietin-tunica interna endothelial cell kinase (ANGPT-TIE) system in angiosarcoma diagnosis, pathogenesis, prognosis and treatment are undefined. To examine the expression and prognostic significance of angiopoietin-1, angiopoietin-2, TIE1 and TEK (TIE2) proteins in angiosarcoma, we immunohistochemically evaluated clinically annotated human angiosarcoma samples. Correlations of protein expression with overall survival and pathological features were explored. The cohort included 51 patients diagnosed with angiosarcoma at the age of 30–86 years (median 67). The 5-year overall survival was 45% with a median of 26 months. Moderate to strong expression of angiopoietin-1, TIE1 and TEK (TIE2) was identified in the majority of angiosarcomas and moderate to strong expression of angiopoietin-2 was observed in 42% of angiosarcomas. Increased angiopoietin-1 expression correlated with improved survival. Non-significant trends toward longer survival were also observed with increased TIE1 and TEK (TIE2) expression. Increased expression of angiopoietin-2, TIE1 and TEK (TIE2) was associated with vasoformative architecture. No differences in expression of these proteins were observed when patients were segregated by age, gender, presence or absence of metastases at diagnosis, primary tumor location, radiation association or the presence of necrosis. We conclude that components of the ANGPT-TIE system are commonly expressed in angiosarcomas. Reduced expression of these proteins is associated with non- vasoformative and clinically more aggressive lesions. Modern Pathology (2013) 26, 1032–1040; doi:10.1038/modpathol.2013.43; published online 5 April 2013 Keywords: angiosarcoma; angiopoietin; sarcoma; TEK; TIE Angiosarcoma is an aggressive soft tissue sarcoma Given the vascular differentiation of angiosarco- of endothelial differentiation. Current therapies mas, recent interest has turned to therapies that are woefully inadequate. Patients presenting with target endothelium-restricted signaling pathways. localized disease have a 5-year overall survival of Vascular endothelial growth factors (VEGFs) and o60%. Those presenting with metastatic disease their receptors are expressed in angiosarcoma.7–14 fare far worse with median survival generally o1 Moreover, activating mutations in KDR (VEGFR-2), year.1–5 The poor survival of patients with the major pro-angiogenic VEGF receptor, have been metastatic disease is largely attributable to limited reported in a small subset of angiosarcomas.15 systemic therapy options. Reported response rates Consequently, the therapeutic use of anti-VEGF with conventional cytotoxic chemotherapy are agents has been explored in this disease. The highly variable, however, they are generally similar pan-VEGF receptor tyrosine kinase inhibitor, to the disappointing response rates seen in other sorafenib, has modest single-agent activity in soft tissue sarcomas (ie, 20–30%).6 angiosarcoma.16,17 Similarly, the humanized anti- VEGF monoclonal antibody, bevacizumab, elicits objective responses in a minority of angiosarcoma 18,19 Correspondence: Professor KR Kozak, MD, PhD, Department of patients. Human Oncology, University of Wisconsin School of Medicine The ANGPT-TIE pathway is largely confined to and Public Health, Wisconsin Institute for Medical Research, vasculature and consists of two tyrosine kinase 1111 Highland Avenue, Madison, WI 53705, USA. E-mail: [email protected] receptors, TIE1 and TEK (TIE2), and three Received 12 September 2012; revised 7 January 2013; accepted 8 corresponding ligands, angiopoietins-1, -2 and -4. January 2013; published online 5 April 2013 Although considerable context-dependent altera- www.modernpathology.org ANGPT-TIE system in angiosarcoma D Buehler et al 1033 tions in function have been observed, generally, chemotherapy. After confirmation of the diagnosis, angiopoietin-1 acts as a TEK (TIE2) receptor agonist the most representative viable areas of the formalin- and angiopoietin-2 as a TEK (TIE2) receptor antago- fixed paraffin-embedded angiosarcomas were formatted nist. The TIE1 receptor has no known ligand and into a 4.5 Â 2 Â 1cm3 recipient tissue microarray appears to function primarily as a TEK (TIE2) in triplicate 1.0 mm cores using the MTA-1 receptor antagonist through interference of angio- manual tissue microarrayer (Beecher Instruments, poietin-1 receptor interaction.20 Angiopoietin-1 has Sun Prairie, WI, USA). The 11 angiosarcoma cases a key role in maintaining the integrity of existing previously reported to express TEK (TIE2) in whole- vessels and enhances endothelial cell survival, mount tissue sections were included in the tissue proliferation and migration in some settings.21–25 microarray.29 In five cases (two breast, two head and Angiopoietin-2 appears to have a critical role in neck, and one Stewart–Treves), limited tumor tissue vascular remodeling and angiogenesis.26 The necessitated use of only two tissue cores. Sections functions of the more recently described ligand, were cut (5 mm) and standard H&E and CD31 stained angiopoietin-4, are less well understood and its slides were examined to verify the presence expression is largely limited to the lung.27 of viable angiosarcoma. Little information is available regarding the expression of ANGPT-TIE pathway components in 12,15,28 human angiosarcoma samples. Recently, after Immunohistochemistry identifying TEK (TIE2) expression in 11 human angiosarcomas, we reported that TEK (TIE2) inhibi- Tissue sections (5 mm) were cut using traditional tion delayed angiosarcoma growth in two murine water bath technique and dried overnight at room models of the disease.29 To examine potential roles temperature. Slides were deparaffinized in subse- for ANGPT-TIE pathway components in angio- quent xylene and ethanol incubations followed by sarcoma diagnosis, pathogenesis, prognosis and heat induced epitope retrieval using the Lab Vision treatment, we assessed the expression of angio- PT module (Thermo Fisher Scientific, Fremont, CA, poietin-1, angiopoietin-2, TIE1 and TEK (TIE2) by USA) with Lab Vision citrate buffer pH 6.0 at 98 1C immunohistochemistry in 51 clinically annotated for 20 min without boiling. All staining was per- human angiosarcoma samples. formed at room temperature using the Lab Vision 360 automated staining system. Biocare Medical (Concord, CA, USA) reagents were used except Materials and methods where noted. Endogenous peroxidase was blocked for 5 min with Peroxidazed 1. Nonspecific protein Patients and Angiosarcoma Specimens binding was inhibited by a 10-min (angiopoietin-2, The study was approved by the Institutional TIE1, TEK (TIE2)) or 30 min (angiopoietin-1) block Review Board. Patients were identified using a with Sniper. For angiopoietin-1, nonspecific avidin surgical pathology database that spanned the years binding was blocked using the Avidin Biotin kit, 1987–2012. Candidate paraffin blocks were col- incubating 15 min for each reagent. Primary anti- lected and the angiosarcoma diagnosis was con- bodies were diluted with DaVinci Green Antibody firmed by a pathologist with specific interest in soft Diluent (angiopoietin-2, TIE1, TEK (TIE2)) or tissue and skin tumors (GRH and BJL). The presence Renaissance background reducing diluent (angio- or absence of necrosis was noted. Tumor architec- poietin-1). Slides were incubated with primary tural pattern was assessed according to Shon et al30 antibodies for 60 min as follows: angiopoietin-1 as follows: vasoformative (475% of tumor forming (goat anti-angiopoietin-1 IgG, 1:50, R&D Systems, vascular channels with identifiable lumina), non- Minneapolis, MN, USA), angiopoietin-2 (mouse vasoformative (475% of tumor demonstrating anti-angiopoietin-2 IgG, 1:50, Santa Cruz Biotech- architecturally solid epithelioid or spindle cell nology, Santa Cruz, CA, USA), TIE1 (mouse anti- morphology without vascular channels) or mixed. TIE1 IgG, 1:300, R&D Systems), TEK (goat anti-TEK Patient records were accessed for age at diagnosis, IgG, 1:50, R&D Systems). For angiopoietin-2 and sex, disease distribution at diagnosis, date of last TIE1 stains, slides were subsequently incubated for follow-up or death, primary site and tumor size. 20 min with probe and HRP-polymer from mouse Clinical notes and radiation records were reviewed. HRP-Polymer kit. For TEK (TIE2), similar incuba- Angiosarcomas were deemed radiation associated if tions were performed with the goat HRP-polymer they occurred within or adjacent to prior radiation kit. For angiopoietin-1, primary incubation was fields. followed by incubation for 15 min with biotinylated swine anti-goat IgG (1:50, Invitrogen, Carlsbad, CA, USA) followed by a 15-min streptavidin-HRP treat- Tissue Microarray Construction ment. Betazoid DAB and Mayer’s hematoxylin were each incubated for 1 min. Slides were washed with Fifty-one
Load more

Recommended publications
  • Abnormal Embryonic Lymphatic Vessel Development in Tie1 Hypomorphic Mice Xianghu Qu, Kevin Tompkins, Lorene E
    © 2014. Published by The Company of Biologists Ltd | Development (2014) 141, 1417 doi:10.1242/dev.108969 CORRECTION Abnormal embryonic lymphatic vessel development in Tie1 hypomorphic mice Xianghu Qu, Kevin Tompkins, Lorene E. Batts, Mira Puri and H. Scott Baldwin There was an error published in Development 137, 1285-1295. Author name H. Scott Baldwin was incomplete. The correct author list appears above. The authors apologise to readers for this mistake. 1417 RESEARCH ARTICLE 1285 Development 137, 1285-1295 (2010) doi:10.1242/dev.043380 © 2010. Published by The Company of Biologists Ltd Abnormal embryonic lymphatic vessel development in Tie1 hypomorphic mice Xianghu Qu1, Kevin Tompkins1, Lorene E. Batts1, Mira Puri2 and Scott Baldwin1,3,* SUMMARY Tie1 is an endothelial receptor tyrosine kinase that is essential for development and maintenance of the vascular system; however, the role of Tie1 in development of the lymphatic vasculature is unknown. To address this question, we first documented that Tie1 is expressed at the earliest stages of lymphangiogenesis in Prox1-positive venous lymphatic endothelial cell (LEC) progenitors. LEC Tie1 expression is maintained throughout embryonic development and persists in postnatal mice. We then generated two lines of Tie1 mutant mice: a hypomorphic allele, which has reduced expression of Tie1, and a conditional allele. Reduction of Tie1 levels resulted in abnormal lymphatic patterning and in dilated and disorganized lymphatic vessels in all tissues examined and in impaired lymphatic drainage in embryonic skin. Homozygous hypomorphic mice also exhibited abnormally dilated jugular lymphatic vessels due to increased production of Prox1-positive LECs during initial lymphangiogenesis, indicating that Tie1 is required for the early stages of normal lymphangiogenesis.
    [Show full text]
  • Discovery of Orphan Receptor Tie1 and Angiopoietin Ligands Ang1 and Ang4 As Novel GAG-Binding Partners
    78 Chapter 3 Discovery of Orphan Receptor Tie1 and Angiopoietin Ligands Ang1 and Ang4 as Novel GAG-Binding Partners 79 3.1 Abstract The Tie/Ang signaling axis is necessary for proper vascular development and remodeling. However, the mechanisms that modulate signaling through this receptor tyrosine kinase pathway are relatively unclear. In particular, the role of the orphan receptor Tie1 is highly disputed. Although this protein is required for survival, Tie1 has been found both to inhibit and yet be necessary for Tie2 signaling. While differing expression levels have been put forth as an explanation for its context-specific activity, the lack of known endogenous ligands for Tie1 has severely hampered understanding its molecular mode of action. Here we describe the discovery of orphan receptor Tie1 and angiopoietin ligands Ang1 and Ang4 as novel GAG binding partners. We localize the binding site of GAGs to the N- terminal region of Tie1, which may provide structural insights into the importance of this interaction regarding the formation of Tie1-Tie2 heterodimerization. Furthermore, we use our mutagenesis studies to guide the generation of a mouse model that specifically ablates GAG-Tie1 binding in vivo for further characterization of the functional outcomes of GAG-Tie1 binding. We also show that GAGs can form a trimeric complex with Ang1/4 and Tie2 using our microarray technology. Finally, we use our HaloTag glycan engineering platform to modify the cell surface of endothelial cells and demonstrate that HS GAGs can potentiate Tie2 signaling in a sulfation-specific manner, providing the first evidence of the involvement of HS GAGs in Tie/Ang signaling and delineating further the integral role of HS GAGs in angiogenesis.
    [Show full text]
  • Src-Family Kinases Impact Prognosis and Targeted Therapy in Flt3-ITD+ Acute Myeloid Leukemia
    Src-Family Kinases Impact Prognosis and Targeted Therapy in Flt3-ITD+ Acute Myeloid Leukemia Title Page by Ravi K. Patel Bachelor of Science, University of Minnesota, 2013 Submitted to the Graduate Faculty of School of Medicine in partial fulfillment of the requirements for the degree of Doctor of Philosophy University of Pittsburgh 2019 Commi ttee Membership Pa UNIVERSITY OF PITTSBURGH SCHOOL OF MEDICINE Commi ttee Membership Page This dissertation was presented by Ravi K. Patel It was defended on May 31, 2019 and approved by Qiming (Jane) Wang, Associate Professor Pharmacology and Chemical Biology Vaughn S. Cooper, Professor of Microbiology and Molecular Genetics Adrian Lee, Professor of Pharmacology and Chemical Biology Laura Stabile, Research Associate Professor of Pharmacology and Chemical Biology Thomas E. Smithgall, Dissertation Director, Professor and Chair of Microbiology and Molecular Genetics ii Copyright © by Ravi K. Patel 2019 iii Abstract Src-Family Kinases Play an Important Role in Flt3-ITD Acute Myeloid Leukemia Prognosis and Drug Efficacy Ravi K. Patel, PhD University of Pittsburgh, 2019 Abstract Acute myelogenous leukemia (AML) is a disease characterized by undifferentiated bone-marrow progenitor cells dominating the bone marrow. Currently the five-year survival rate for AML patients is 27.4 percent. Meanwhile the standard of care for most AML patients has not changed for nearly 50 years. We now know that AML is a genetically heterogeneous disease and therefore it is unlikely that all AML patients will respond to therapy the same way. Upregulation of protein-tyrosine kinase signaling pathways is one common feature of some AML tumors, offering opportunities for targeted therapy.
    [Show full text]
  • Protein Tyrosine Kinases: Their Roles and Their Targeting in Leukemia
    cancers Review Protein Tyrosine Kinases: Their Roles and Their Targeting in Leukemia Kalpana K. Bhanumathy 1,*, Amrutha Balagopal 1, Frederick S. Vizeacoumar 2 , Franco J. Vizeacoumar 1,3, Andrew Freywald 2 and Vincenzo Giambra 4,* 1 Division of Oncology, College of Medicine, University of Saskatchewan, Saskatoon, SK S7N 5E5, Canada; [email protected] (A.B.); [email protected] (F.J.V.) 2 Department of Pathology and Laboratory Medicine, College of Medicine, University of Saskatchewan, Saskatoon, SK S7N 5E5, Canada; [email protected] (F.S.V.); [email protected] (A.F.) 3 Cancer Research Department, Saskatchewan Cancer Agency, 107 Wiggins Road, Saskatoon, SK S7N 5E5, Canada 4 Institute for Stem Cell Biology, Regenerative Medicine and Innovative Therapies (ISBReMIT), Fondazione IRCCS Casa Sollievo della Sofferenza, 71013 San Giovanni Rotondo, FG, Italy * Correspondence: [email protected] (K.K.B.); [email protected] (V.G.); Tel.: +1-(306)-716-7456 (K.K.B.); +39-0882-416574 (V.G.) Simple Summary: Protein phosphorylation is a key regulatory mechanism that controls a wide variety of cellular responses. This process is catalysed by the members of the protein kinase su- perfamily that are classified into two main families based on their ability to phosphorylate either tyrosine or serine and threonine residues in their substrates. Massive research efforts have been invested in dissecting the functions of tyrosine kinases, revealing their importance in the initiation and progression of human malignancies. Based on these investigations, numerous tyrosine kinase inhibitors have been included in clinical protocols and proved to be effective in targeted therapies for various haematological malignancies.
    [Show full text]
  • Structural Basis of Tie2 Activation and Tie2/Tie1 Heterodimerization
    Structural basis of Tie2 activation and Tie2/Tie1 heterodimerization Veli-Matti Leppänena,1, Pipsa Saharinena,b, and Kari Alitaloa,b,1 aWihuri Research Institute, Biomedicum Helsinki, Haartmaninkatu 8, 00290 Helsinki, Finland; and bTranslational Cancer Biology Program, Research Programs Unit, University of Helsinki, 00014 Helsinki, Finland Contributed by Kari Alitalo, March 8, 2017 (sent for review September 28, 2016; reviewed by Joseph Schlessinger and Michel O. Steinmetz) The endothelial cell (EC)-specific receptor tyrosine kinases mice lacking Tie1 develop severe edema around E13.5 because Tie1 and Tie2 are necessary for the remodeling and maturation of compromised microvessel integrity and defects in lymphatic of blood and lymphatic vessels. Angiopoietin-1 (Ang1) growth vasculature and die subsequently (15, 16). Furthermore, Tie1 has factor is a Tie2 agonist, whereas Ang2 functions as a context- critical functions in vascular pathologies, e.g., in tumor angio- dependent agonist/antagonist. The orphan receptor Tie1 modu- genesis and atherosclerosis progression (12, 17). lates Tie2 activation, which is induced by association of angio- In EC monolayers, angiopoietins stimulate Tie receptor trans- cis – trans location to cell–cell junctions for Tie2 trans-association, whereas poietins with Tie2 in and across EC EC junctions in . – Except for the binding of the C-terminal angiopoietin domains in the absence of cell cell adhesion the Tie receptors are an- to the Tie2 ligand-binding domain, the mechanisms for Tie2 chored to the extracellular matrix (ECM) by Ang1-induced Tie2 cis-association (10, 18). Integrins also have been implicated in activation are poorly understood. We report here the structural α β – basis of Ang1-induced Tie2 dimerization in cis and provide Tie2 signaling, and the 5 1 integrin heterodimer enhances Ang1-induced EC adhesion and Tie2 activation (13, 19, 20).
    [Show full text]
  • Supplementary Data ASXL2 Regulates Hematopoiesis in Mice and Its
    Supplementary data ASXL2 regulates hematopoiesis in mice and its deficiency promotes myeloid expansion Supplementary Methods Genomic DNA extraction Genomic DNA was extracted from BM mononuclear cells using a DNA extraction kit (Puregene Gentra System, Minneapolis, MN, USA) according to the manufacturer’s instructions. Genomic DNA was quantified using Qubit Fluorometer (Life Technologies) and DNA integrity was assessed by agarose gel electrophoresis. For samples with low quantity, DNA was amplified using REPLI-g Ultrafast mini kit (Qiagen). Peripheral blood analysis Complete peripheral blood counts were analysed using Abbott Cell-Dyn 3700 hematology analyzer (Abbott Laboratories). Expression analysis of Asxl2 and Asxl1 Transcript levels of Asxl2 and Asxl1 were estimated using quantitative RT-PCR with following primers: Asxl2 primer set 1, ATTCGACAAGAGATTGAGAAGGAG (forward) and TTTCTGTGAATCTTCAAGGCTTAG (reverse); Asxl2 primer set 2, GCCCTTAACAATGAGTTCTTCACT (forward) and TCCACAGCTCTACTTTCTTCTCCT (reverse); Asxl1 primers, GGTGGAACAATGGAAGGAAA (forward) and CTGGCCGAGAACGTTTCTTA (reverse). Asxl2 protein was detected in immunoblot using anti-ASXL2 antibody (Bethyl). In vitro differentiation of bone marrow cells Bone marrow (BM) cells were cultured in IMDM containing 20% FBS and 10 ng/ml IL3, 10 ng/ml IL6, 20 ng/ml SCF and 20 ng/ml GMCSF for two weeks. For FACS analysis, cells were washed, stained with fluorochrome-conjugated antibodies and analysed on FACS LSR II flow cytometer (BD Biosciences) using FACSDIVA software (BD Biosciences). Colony re-plating assay Bone marrow cells were plated in methylcellulose medium containing mouse stem cell factor (SCF), mouse interleukin 3 (IL-3), human interleukin 6 (IL-6) and human erythropoietin (MethoCult GF M3434; StemCell Technologies). Colonies were enumerated after 9-12 days and cells were harvested for re-plating.
    [Show full text]
  • (Erdafitinib), a Functionally Selective Small Molecule FGFR Family Inhibitor
    Author Manuscript Published OnlineFirst on March 24, 2017; DOI: 10.1158/1535-7163.MCT-16-0589 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Discovery and pharmacological characterization of JNJ-42756493 (erdafitinib), a functionally selective small molecule FGFR family inhibitor Timothy P.S. Perera1, Eleonora Jovcheva1, Laurence Mevellec2, Jorge Vialard1, Desiree De Lange1, Tinne Verhulst1, Caroline Paulussen1, Kelly Van De Ven1, Peter King1, Eddy Freyne1, David C. Rees3, Matthew Squires3, Gordon Saxty3, Martin Page1, Christopher W. Murray3, Ron Gilissen1, George Ward3, Neil T. Thompson3, David R. Newell4, Na Cheng5, Liang Xie5, Jennifer Yang5, Suso J. Platero6, Jayaprakash D. Karkera6, Christopher Moy6, Patrick Angibaud2, Sylvie Laquerre6 and Matthew V. Lorenzi6,7. 1Janssen Research and Development, Beerse, Belgium. 2Janssen Research and Development, Val de Reuil, France. 3Astex Pharmaceuticals, Cambridge, United Kingdom. 4Newcastle Cancer Centre, Northern Institute for Cancer Research, Newcastle University, Newcastle upon Tyne, UK. 5Janssen Research and Development, Shanghai, China. 6Janssen Research and Development, Spring House, USA. 7To whom correspondence should be addressed: Matthew V. Lorenzi, Oncology Discovery, Janssen R&D, 1400 McKean Road, Spring House, PA 19477. Phone: 215 793-7356; E-mail: [email protected] Disclosure of Potential Conflicts of Interest: T.P.S. Perera, E. Jovcheva, L. Mevellec, J. Vialard, D. De Lange, T. Verhulst, C. Paulussen, K. Van De Ven, P. King, E. Freyne, M. Page, R. Gilissen, N. Cheng, L. Xie, J. Yang, S.J. Platero, J.D. Karkera, C. Moy, P. Angibaud, S. Laquerre and M.V. Lorenzi are or have been employees of Janssen R&D, and D.C.
    [Show full text]
  • Discovery of a Potent and Selective DDR1 Receptor Tyrosine Kinase Inhibitor
    Discovery of a Potent and Selective DDR1 Receptor Tyrosine Kinase Inhibitor The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters Citation Kim, H., L. Tan, E. L. Weisberg, F. Liu, P. Canning, H. G. Choi, S. A. Ezell, et al. 2013. “Discovery of a Potent and Selective DDR1 Receptor Tyrosine Kinase Inhibitor.” ACS Chemical Biology 8 (10): 2145-2150. doi:10.1021/cb400430t. http://dx.doi.org/10.1021/ cb400430t. Published Version doi:10.1021/cb400430t Citable link http://nrs.harvard.edu/urn-3:HUL.InstRepos:12152819 Terms of Use This article was downloaded from Harvard University’s DASH repository, and is made available under the terms and conditions applicable to Other Posted Material, as set forth at http:// nrs.harvard.edu/urn-3:HUL.InstRepos:dash.current.terms-of- use#LAA Letters pubs.acs.org/acschemicalbiology Terms of Use CC-BY Discovery of a Potent and Selective DDR1 Receptor Tyrosine Kinase Inhibitor † # ‡ § # ‡ # ∥ ‡ # ⊥ # Hyung-Gu Kim, , Li Tan, , , Ellen L. Weisberg, , Feiyang Liu, , , Peter Canning, , ‡ # † ∥ ‡ ∥ ‡ § † Hwan Geun Choi, , Scott A. Ezell, Hong Wu, , Zheng Zhao, Jinhua Wang, , Anna Mandinova, ‡ ⊥ ∥ ‡ † ‡ § James D. Griffin, Alex N. Bullock, Qingsong Liu,*, , Sam W. Lee,*, and Nathanael S. Gray*, , † Cutaneous Biology Research Center, Massachusetts General Hospital and Harvard Medical School, Charlestown, Massachusetts 02129, United States ‡ § Dana Farber Cancer Institute and Department of Biological Chemistry and Molecular Pharmacology, Harvard Medical School, Boston, Massachusetts 02115, United States ∥ High Magnetic Field laboratory, Chinese Academy of Sciences, P.O. Box 1110, Hefei, Anhui, 230031, P. R. China ⊥ Structural Genomics Consortium, University of Oxford, Oxford OX3 7DQ, U.K.
    [Show full text]
  • Amplification of the Human Epidermal Growth Factor Receptor 2 (HER2) Gene Is Associated with a Microsatellite Stable Status in Chinese Gastric Cancer Patients
    387 Original Article Amplification of the human epidermal growth factor receptor 2 (HER2) gene is associated with a microsatellite stable status in Chinese gastric cancer patients He Huang1#, Zhengkun Wang2#, Yi Li2, Qun Zhao3, Zhaojian Niu2 1Department of Gastrointestinal Surgery, The First Hospital of Shanxi Medical University, Shanxi, China; 2Department of Gastrointestinal Surgery, The Affiliated Hospital of Qingdao University, Qingdao, China; 3Department of Gastrosurgery, The Fourth Hospital of Hebei Medical University, Shijiazhuang, China Contributions: I) Conception and design: Z Niu, Q Zhao, H Huang; (II) Administrative support: Z Niu, H Huang, Z Wang; (III) Provision of study materials or patients: All authors; (IV) Collection and assembly of data: Z Wang, Q Zhao; (V) Data analysis and interpretation: Z Niu, H Huang; (VI) Manuscript writing: All authors; (VII) Final approval of manuscript: All authors. #These authors contributed equally to this work. Correspondence to: Zhaojian Niu. Department of Gastrointestinal Surgery, The Affiliated Hospital of Qingdao University, No. 16, Jiangsu Road, Shinan District, Qingdao 260003, China. Email: [email protected]; Qun Zhao. Department of Gastrosurgery, The Fourth Hospital of Hebei Medical University, No. 12 Jiankang Road, Shijiazhuang 050011, China. Email: [email protected]. Background: Gastric cancer (GC) is one of the most common cancers worldwide. However, little is known about the combination of HER2 amplification and microsatellite instability (MSI) status in GC. This study aimed to analyze the correlation of HER2 amplification with microsatellite instability (MSI) status, clinical characteristics, and the tumor mutational burden (TMB) of patients. Methods: A total of 192 gastric cancer (GC) patients were enrolled in this cohort. To analyze genomic alterations (GAs), deep sequencing was performed on 450 target cancer genes.
    [Show full text]
  • Vasculogenic Mimicry in Breast Cancer: Clinical Relevance and Drivers
    cells Review Vasculogenic Mimicry in Breast Cancer: Clinical Relevance and Drivers Gabriela Morales-Guadarrama 1 , Rocío García-Becerra 2, Edgar Armando Méndez-Pérez 1, Janice García-Quiroz 1 , Euclides Avila 1 and Lorenza Díaz 1,* 1 Departamento de Biología de la Reproducción, Instituto Nacional de Ciencias Médicas y Nutrición Salvador Zubirán, Ciudad de México 14080, Mexico; [email protected] (G.M.-G.); [email protected] (E.A.M.-P.); [email protected] (J.G.-Q.); [email protected] (E.A.) 2 Departamento de Biología Molecular y Biotecnología, Instituto de Investigaciones Biomédicas, Universidad Nacional Autónoma de México, Ciudad de México 04510, Mexico; [email protected] * Correspondence: [email protected]; Tel.: +52-(55)-5487-0900 Abstract: In solid tumors, vasculogenic mimicry (VM) is the formation of vascular structures by cancer cells, allowing to generate a channel-network able to transport blood and tumor cells. While angiogenesis is undertaken by endothelial cells, VM is assumed by cancer cells. Besides the par- ticipation of VM in tumor neovascularization, the clinical relevance of this process resides in its ability to favor metastasis and to drive resistance to antiangiogenic therapy. VM occurs in many tumor types, including breast cancer, where it has been associated with a more malignant phenotype, such as triple-negative and HER2-positive tumors. The latter may be explained by known drivers of VM, like hypoxia, TGFB, TWIST1, EPHA2, VEGF, matrix metalloproteinases, and other tumor microenvironment-derived factors, which altogether induce the transformation of tumor cells to a Citation: Morales-Guadarrama, G.; mesenchymal phenotype with a high expression rate of stemness markers.
    [Show full text]
  • Tyrosine Kinases As Targets for the Treatment of Rheumatoid Arthritis Christina D’Aura Swanson, Ricardo T
    REVIEWS Tyrosine kinases as targets for the treatment of rheumatoid arthritis Christina D’Aura Swanson, Ricardo T. Paniagua, Tamsin M. Lindstrom and William H. Robinson Abstract | As critical regulators of numerous cell signaling pathways, tyrosine kinases are implicated in the pathogenesis of several diseases, including rheumatoid arthritis (RA). In the absence of disease, synoviocytes produce factors that provide nutrition and lubrication for the surrounding cartilage tissue; few cellular infiltrates are seen in the synovium. In RA, however, macrophages, neutrophils, T cells and B cells infiltrate the synovium and produce cytokines, chemokines and degradative enzymes that promote inflammation and joint destruction. In addition, the synovial lining expands owing to the proliferation of synoviocytes and infiltration of inflammatory cells to form a pannus, which invades the surrounding bone and cartilage. Many of these cell responses are regulated by tyrosine kinases that operate in specific signaling pathways, and inhibition of a number of these kinases might be expected to provide benefit in RA. D’Aura Swanson, C. et al. Nat. Rev. Rheumatol. 5, 317–324 (2009); doi:10.1038/nrrheum.2009.82 Introduction Rheumatoid arthritis (RA) is an autoimmune synovitis that tyrosine kinases (RTKs) and non­receptor tyrosine kinases affects 0.5% of the population and can result in disability (non­rTKs).3 In addition to an extracellular ligand­binding owing to joint destruction.1 A number of cellular responses domain and a membrane­spanning domain, RTKs usually are thought to be involved in the pathogenesis of RA. An possess an intracellular cytoplasmic domain that contains adaptive autoimmune response mediated by T cells and a kinase core and regulatory sequences.
    [Show full text]
  • Structural Basis of Tie2 Activation and Tie2/Tie1 Heterodimerization
    Structural basis of Tie2 activation and Tie2/Tie1 heterodimerization Veli-Matti Leppänena,1, Pipsa Saharinena,b, and Kari Alitaloa,b,1 aWihuri Research Institute, Biomedicum Helsinki, Haartmaninkatu 8, 00290 Helsinki, Finland; and bTranslational Cancer Biology Program, Research Programs Unit, University of Helsinki, 00014 Helsinki, Finland Contributed by Kari Alitalo, March 8, 2017 (sent for review September 28, 2016; reviewed by Joseph Schlessinger and Michel O. Steinmetz) The endothelial cell (EC)-specific receptor tyrosine kinases mice lacking Tie1 develop severe edema around E13.5 because Tie1 and Tie2 are necessary for the remodeling and maturation of compromised microvessel integrity and defects in lymphatic of blood and lymphatic vessels. Angiopoietin-1 (Ang1) growth vasculature and die subsequently (15, 16). Furthermore, Tie1 has factor is a Tie2 agonist, whereas Ang2 functions as a context- critical functions in vascular pathologies, e.g., in tumor angio- dependent agonist/antagonist. The orphan receptor Tie1 modu- genesis and atherosclerosis progression (12, 17). lates Tie2 activation, which is induced by association of angio- In EC monolayers, angiopoietins stimulate Tie receptor trans- cis – trans location to cell–cell junctions for Tie2 trans-association, whereas poietins with Tie2 in and across EC EC junctions in . – Except for the binding of the C-terminal angiopoietin domains in the absence of cell cell adhesion the Tie receptors are an- to the Tie2 ligand-binding domain, the mechanisms for Tie2 chored to the extracellular matrix (ECM) by Ang1-induced Tie2 cis-association (10, 18). Integrins also have been implicated in activation are poorly understood. We report here the structural α β – basis of Ang1-induced Tie2 dimerization in cis and provide Tie2 signaling, and the 5 1 integrin heterodimer enhances Ang1-induced EC adhesion and Tie2 activation (13, 19, 20).
    [Show full text]