DOCSLIB.ORG

Cshperspect-RTK-Index 469..478

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Cshperspect-RTK-Index 469..478 Index A endothelial cell-derived tumors, 396 Abl, kinase modulation by SH2 metastasis studies, 394 allosteric activation, 39–40 tumor vascularization, 393–394 inhibition by intramolecular interactions, 38–39 development Acetylcholine receptor (AChR) endothelial cell expression of receptors muscle-specific kinase interactions, 265–268 Tie receptors, 392–393 myasthenia gravis autoantibodies, 271–272 vascular endothelial growth factor AChR. See Acetylcholine receptor receptor, 391–392 Acute myeloid leukemia, Kit role, 217 overview, 387–388 ADAM proteases inhibition for therapy, 396–400 domain structure, 119–120 lymphangiogenesis defects in lymphedema, 375 ephrin cleavage, 312 prospects for study, 400 epidermal growth factor receptor ligand therapeutic angiogenesis, 394–395 shedding role, 120–121 tip and stalk cell expression of receptor shedding tyrosine kinases, 389 stimuli, 121–122 vascular malformations, 396 tetraspanins in spatial control, 122–123 Angiopoietins ADAM10 Ang2 signals in inflammation, 395–396 ephrin proteolysis, 126 angiogenesis role, 391 platelet-derived growth factor receptor functional overview, 287–288 ligand proteolysis, 126 inhibitor therapy, 399–400 ADAM12, ErbB2 expression regulation, 140 knockout mouse, 392–393 ADAM17 (TACE) structure, 288–289 activity regulation in plasma membrane, 122 vascular endothelial growth factor receptor ErbB-4 as substrate, 50–51, 68–69 signaling cross talk, 234 trafficking regulators, 123 Apoptosis, TAM receptors in cell clearance, 373–374 Agrin, Lrp4 binding, 265, 269–270 Atherosclerosis, platelet-derived growth factor Akt receptor role, 214 ephrin receptor signaling, 310–311 Axl. See TAM receptors Grb2 in signaling, 38 insulin receptor signaling, 412–413 insulin resistance defects, 420 B MET signaling, 437 BCR-ABL RET signaling, 280–281 chronic myelogenous leukemia, 17–18 TAM receptor signaling, 371 therapeutic targeting, 18 Alk. See Anaplastic lymphoma kinase Bevacizumab, 235 a-Secretase. See ADAM17 Bioinformatics, tyrosine phosphorylation, 23 AMSH, endosomal sorting role, 86 Breast cancer, RET mutations, 461 Amyotrophic lateral sclerosis, ephA4 mutations, 317 Breathless, Drosophila studies, 343–344 Anaplastic lymphoma kinase (Alk) BY kinases, features, 19 Drosophila function, 347–349 therapeutic targeting, 18 Angiogenesis. See also Angiopoietins; Vascular endo- C thelial growth factor receptor Cad96Ca, Drosophila wound repair, 353 Ang2 signals in inflammation, 395–396 Cancer blood versus lymphatic vasculature, 388–389 angiogenesis cancer endothelial cell-derived tumors, 396 469 Index Cancer (Continued) Diabetes. See Insulin resistance metastasis studies, 394 Diacylglycerol (DAG), insulin resistance role, 420 tumor vascularization, 393–394 Discoid domain receptor (DDR), ephrin receptor mutations, 316–317 Drosophila studies, 350 Kit role Dok-2, PTB domain, 37 acute myeloid leukemia, 217 Dok-7, 42, 270–272 gastrointestinal stromal tumor, 217 Doughnut, Drosophila studies, 352 lung cancer, 217–218 Drosophila melanoma, 217 anaplastic lymphoma kinase function, 347–349 ligand shedding dysregulation, 126–127 Cad96Ca in wound repair, 353 lung cancer epidermal growth factor receptor discoid domain receptor function, 350 mutations and therapeutic targeting, ephrin receptor function, 354 166, 168 epidermal growth factor receptor MET therapeutic targeting in cancer, 443–444 functional overview, 341–342 platelet-derived growth factor receptor tumor cell ligand proteolysis overactivity, 213–214 overview, 116–117 RET mutations. See RET trafficking regulation, 117–118 Ror studies, 328 fibroblast growth factor receptors TAM receptor defects, 378–379 Breathless, 343–345 Caspases, intracellular domain cleavage from receptor Heartless, 342–343 tyrosine kinases, 55 insulin receptor function, 345–347 Cbl neurotrophic receptor kinase function, 349 MET signaling, 439 Offtrack function, 350–351 mutation in cancer, 42 overview of receptor tyrosine kinases and ligands, receptor endocytosis role, 82–83 337–339 SH2 domain, 35 prospects for receptor tyrosine kinase studies, Ceramide, insulin resistance role, 420 356–357 Clathrin-mediated endocytosis. See Endocytosis, Pvr function, 354–356 receptor tyrosine kinases RET function, 353 CMS. See Congenital myasthenic syndrome rhomboids, 116–117, 125 Colony-stimulating factor-1 receptor, intracellular Ror function, 326, 349 domain cleavage by g-secretase, 53–54 Ryk receptors Congenital myasthenic syndrome (CMS), gene Derailed, 351–352 mutations, 42 Derailed 2, 352–353 Crizotinib, receptor tyrosine kinase inhibition, 18 Doughnut, 352 Crk Sevenless in cell fate specification in eye and testes, ephrin receptor signaling, 308 340–341 platelet-derived growth factor receptor Tie-like receptor tyrosine kinase function, 356 binding, 210 Torso role in anterior/posterior patterning and SH2/SH3 domains, 9 metamorphosis, 339–340 signaling complex assembly, 38 DUSP, 141 Cryoelectron microscopy, phosphotyrosine protein structure, 22, 26 E EGFR. See Epidermal growth factor receptor D Endocytosis, receptor tyrosine kinases DAG. See Diacylglycerol clathrin-independent endocytosis, 79–80 DC. See Dendritic cell clathrin-mediated endocytosis, 79 DDR. See Discoid domain receptor cytoplasmic domain sequence motifs, 80 Degenerate peptide library, tyrosine kinase target endosomal sorting. See Endosomal sorting, identification, 22–23 receptor tyrosine kinases Dendritic cell (DC), TAM receptor function, 375–376 half-life range, 77 Derailed miscellaneous mechanisms, 84 Drosophila studies, 351–352 NEDD4 role, 83–84 Wnt signaling, 330–332 pathways, 78–80 Derailed 2, Drosophila studies, 352–353 prospects for study, 88 470 Index receptor ubiquitination role, 80–83 therapeutic targeting, 295 signaling effects Epidermal growth factor receptor (EGFR). cell adhesion regulators, 100 See also specific receptors hypoxia modulation, 99–100 dimerization, 5–8 ligand concentration effects on entry routes endocytosis, 79–84, 99–100 and intracellular fate, 97–99 endosomal sorting, 87 overview, 95–97 family characteristics, 161–163 spatial regulation of internalization, 100–101 history of study, 1, 3–5, 15, 17–18 stress factor modulation, 99 kinase domain activation, 164, 166–167 steps, 77–79 ligand concentration effects on entry routes ubiquitin-binding proteins in CCPs, 84 and intracellular fate, 97–98 Endoplasmic reticulum (ER) ligand proteolysis receptor tyrosine kinase signal modulation, 107–108 ADAMs in ligand shedding, 120–121 unfolded protein response in insulin resistance, 422 Drosophila Endosomal sorting, receptor tyrosine kinases overview, 116–117 coreceptor-modulated sorting of ligand–receptor trafficking regulation, 117–118 complexes, 103 mammalian ligands, 118–119 ESCRT sorting model, 85–86 ligand-dependent sorting, 101–102 ligand-dependent sorting of receptor, 101–102 linkage between intracellular and extracellular multivesicular body sorting model, 85–87 regions, 172–173 overview, 85 lung cancer mutations and therapeutic targeting, receptor-mediated sorting of ligands, 102–103 166, 168 recycling of receptors. See Recycling, receptor negative cooperativity, 171–173 tyrosine kinases phospholipase Cg association, 9 signaling effects phosphorylation sites, 9 compartmentalization of signaling, 107 recycling, 87–88 endoplasmic reticulum in signal modulation, signaling 107–108 cross talk, 9–10, 134–137, 142–143 intracellular signal delivery via endosomes, 105 feedforward loops, 137–138 microvesicle propagation of signals, 108 positive and negative feedback regulation signal amplification, 105–107 overview, 138–139 signaling endosomes, 105 receptor level, 139–140 Ephrin, proteolysis, 126, 298–299, 313 signaling level, 140 Ephrin receptor transcription, 140–142 angiogenesis role, 388 prospects for study, 144–145 Drosophila studies, 354 spatial signal propagation, 143–144 Ephrin receptor transduction, 179, 181 activation ER. See Endoplasmic reticulum kinase, 297–298 ErbB receptors transmembrane domain role, 297 kinase domain activation, 164, 166–167 classification, 305 ligands clustering and activation, 296–298, 307 receptor dimerization induction, 164–165 dephosphorylation, 315 types and processing, 163–164 ephrin-independent activities, 314–315 linkage between intracellular and extracellular functional overview, 292–294, 305–306 regions, 172–173 internalization and proteolysis, 312–314 lung cancer mutations and therapeutic intracellular domain cleavage by g-secretase, 53 targeting, 166, 168 ligand recognition and binding, 294–295 negative cooperativity, 171–173 mutation and disease, 316–317 plasma membrane distribution, 193–197 prospects for study, 299, 317 spatiotemporal organization signaling cluster size studies with conventional ephrin-mediated cis attenuation, 314 microscopy, 181–182 forward signaling, 306–311 fluorescence resonance energy transfer reverse signaling, 311–312 activation and signaling, 188–189 termination, 298–299 protein–protein interactions, 184–186 structure, 305–306 high-resolution imaging, 182–184 471 Index ErbB receptors (Continued) D3 and ligand specificity, 246–247 prospects for study, 189 dimerization, 8 single-molecule studies of protein–protein Drosophila interactions, 186–188 Breathless, 343–345 techniques for study, 179–180 Heartless, 342–343 structure heparan sulfate binding, 250–252 carboxy-terminal tail, 170–171 kinase extracellular juxtamembrane region, 168–169 autophosphorylation, 255–257 intracellular juxtamembrane region, 169–170 regulation mechanism, 253–255 transmembrane domain, 168 Klotho in signaling, 252–253 ErbB1 ligand–receptor contacts, 246 nuclear trafficking
Load more

Recommended publications
  • Abnormal Embryonic Lymphatic Vessel Development in Tie1 Hypomorphic Mice Xianghu Qu, Kevin Tompkins, Lorene E
    © 2014. Published by The Company of Biologists Ltd | Development (2014) 141, 1417 doi:10.1242/dev.108969 CORRECTION Abnormal embryonic lymphatic vessel development in Tie1 hypomorphic mice Xianghu Qu, Kevin Tompkins, Lorene E. Batts, Mira Puri and H. Scott Baldwin There was an error published in Development 137, 1285-1295. Author name H. Scott Baldwin was incomplete. The correct author list appears above. The authors apologise to readers for this mistake. 1417 RESEARCH ARTICLE 1285 Development 137, 1285-1295 (2010) doi:10.1242/dev.043380 © 2010. Published by The Company of Biologists Ltd Abnormal embryonic lymphatic vessel development in Tie1 hypomorphic mice Xianghu Qu1, Kevin Tompkins1, Lorene E. Batts1, Mira Puri2 and Scott Baldwin1,3,* SUMMARY Tie1 is an endothelial receptor tyrosine kinase that is essential for development and maintenance of the vascular system; however, the role of Tie1 in development of the lymphatic vasculature is unknown. To address this question, we first documented that Tie1 is expressed at the earliest stages of lymphangiogenesis in Prox1-positive venous lymphatic endothelial cell (LEC) progenitors. LEC Tie1 expression is maintained throughout embryonic development and persists in postnatal mice. We then generated two lines of Tie1 mutant mice: a hypomorphic allele, which has reduced expression of Tie1, and a conditional allele. Reduction of Tie1 levels resulted in abnormal lymphatic patterning and in dilated and disorganized lymphatic vessels in all tissues examined and in impaired lymphatic drainage in embryonic skin. Homozygous hypomorphic mice also exhibited abnormally dilated jugular lymphatic vessels due to increased production of Prox1-positive LECs during initial lymphangiogenesis, indicating that Tie1 is required for the early stages of normal lymphangiogenesis.
    [Show full text]
  • Discovery of Orphan Receptor Tie1 and Angiopoietin Ligands Ang1 and Ang4 As Novel GAG-Binding Partners
    78 Chapter 3 Discovery of Orphan Receptor Tie1 and Angiopoietin Ligands Ang1 and Ang4 as Novel GAG-Binding Partners 79 3.1 Abstract The Tie/Ang signaling axis is necessary for proper vascular development and remodeling. However, the mechanisms that modulate signaling through this receptor tyrosine kinase pathway are relatively unclear. In particular, the role of the orphan receptor Tie1 is highly disputed. Although this protein is required for survival, Tie1 has been found both to inhibit and yet be necessary for Tie2 signaling. While differing expression levels have been put forth as an explanation for its context-specific activity, the lack of known endogenous ligands for Tie1 has severely hampered understanding its molecular mode of action. Here we describe the discovery of orphan receptor Tie1 and angiopoietin ligands Ang1 and Ang4 as novel GAG binding partners. We localize the binding site of GAGs to the N- terminal region of Tie1, which may provide structural insights into the importance of this interaction regarding the formation of Tie1-Tie2 heterodimerization. Furthermore, we use our mutagenesis studies to guide the generation of a mouse model that specifically ablates GAG-Tie1 binding in vivo for further characterization of the functional outcomes of GAG-Tie1 binding. We also show that GAGs can form a trimeric complex with Ang1/4 and Tie2 using our microarray technology. Finally, we use our HaloTag glycan engineering platform to modify the cell surface of endothelial cells and demonstrate that HS GAGs can potentiate Tie2 signaling in a sulfation-specific manner, providing the first evidence of the involvement of HS GAGs in Tie/Ang signaling and delineating further the integral role of HS GAGs in angiogenesis.
    [Show full text]
  • Src-Family Kinases Impact Prognosis and Targeted Therapy in Flt3-ITD+ Acute Myeloid Leukemia
    Src-Family Kinases Impact Prognosis and Targeted Therapy in Flt3-ITD+ Acute Myeloid Leukemia Title Page by Ravi K. Patel Bachelor of Science, University of Minnesota, 2013 Submitted to the Graduate Faculty of School of Medicine in partial fulfillment of the requirements for the degree of Doctor of Philosophy University of Pittsburgh 2019 Commi ttee Membership Pa UNIVERSITY OF PITTSBURGH SCHOOL OF MEDICINE Commi ttee Membership Page This dissertation was presented by Ravi K. Patel It was defended on May 31, 2019 and approved by Qiming (Jane) Wang, Associate Professor Pharmacology and Chemical Biology Vaughn S. Cooper, Professor of Microbiology and Molecular Genetics Adrian Lee, Professor of Pharmacology and Chemical Biology Laura Stabile, Research Associate Professor of Pharmacology and Chemical Biology Thomas E. Smithgall, Dissertation Director, Professor and Chair of Microbiology and Molecular Genetics ii Copyright © by Ravi K. Patel 2019 iii Abstract Src-Family Kinases Play an Important Role in Flt3-ITD Acute Myeloid Leukemia Prognosis and Drug Efficacy Ravi K. Patel, PhD University of Pittsburgh, 2019 Abstract Acute myelogenous leukemia (AML) is a disease characterized by undifferentiated bone-marrow progenitor cells dominating the bone marrow. Currently the five-year survival rate for AML patients is 27.4 percent. Meanwhile the standard of care for most AML patients has not changed for nearly 50 years. We now know that AML is a genetically heterogeneous disease and therefore it is unlikely that all AML patients will respond to therapy the same way. Upregulation of protein-tyrosine kinase signaling pathways is one common feature of some AML tumors, offering opportunities for targeted therapy.
    [Show full text]
  • Somatic Ephrin Receptor Mutations Are Associated with Metastasis in Primary Colorectal Cancer Running Title
    Author Manuscript Published OnlineFirst on January 20, 2017; DOI: 10.1158/0008-5472.CAN-16-1921 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Uvyr)Thvp ru v rpr hv h r hpvhrq vu rhhv v vh py rphy phpr Svt vyr) 6u ) " #$ % & '$ $( $)*# $ ,$$ - ./ 0 1 " , $'2 / ' - , $$03$, 4, 5$ $ 6 7$ % & 8 8$ 9 6ssvyvhv) . 8 : .2 $ 5 1 $ ; $ ;# < %. 8 : ., , $ ;# $ < -: . $, 8 $ . . 8 ; $ ;# /. 8 : . $; $ ;# < 0= $ 1 2 . , >2,, $ ?&, $ 2 . & $ , $@ ABA%B, $ < 4: . $ $ $ ; $ ;# < 6: .2 $ 5 1 $ .@ $ $ $ = $ ; $ ;# < Downloaded from cancerres.aacrjournals.org on September 26, 2021. © 2017 American Association for Cancer Research. Author Manuscript Published OnlineFirst on January 20, 2017; DOI: 10.1158/0008-5472.CAN-16-1921 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. & 8 * $$ < 9& $8 C 8 < 8$ D< < 8syvp s vr rC & . $@ $, $ ', $E $ . $ 8$:7'@ < % Downloaded from cancerres.aacrjournals.org on September 26, 2021. © 2017 American Association for Cancer Research. Author Manuscript Published OnlineFirst on January 20, 2017; DOI: 10.1158/0008-5472.CAN-16-1921 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. 6i hpC& 8 . . $ $ >? $ <& . # $# . $ $ .464A6 22)2 . $. E<& # $ >?. $ . ). $ . ) . $$ 222 2 < $ $ . @ . <& 8$. $ ., ::)$$@,. ) $ ),@$$<F .8 222 . , $) ,::)$$ ), $E <& 8# # $8 , < - Downloaded from cancerres.aacrjournals.org on September 26, 2021. © 2017 American Association for Cancer Research. Author Manuscript Published OnlineFirst on January 20, 2017; DOI: 10.1158/0008-5472.CAN-16-1921 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. D qpv #$ .$$) $ .. 8 >&5?>?<& . 8@ #$ $#$ # $ 8$ .8 .
    [Show full text]
  • Protein Tyrosine Kinases: Their Roles and Their Targeting in Leukemia
    cancers Review Protein Tyrosine Kinases: Their Roles and Their Targeting in Leukemia Kalpana K. Bhanumathy 1,*, Amrutha Balagopal 1, Frederick S. Vizeacoumar 2 , Franco J. Vizeacoumar 1,3, Andrew Freywald 2 and Vincenzo Giambra 4,* 1 Division of Oncology, College of Medicine, University of Saskatchewan, Saskatoon, SK S7N 5E5, Canada; [email protected] (A.B.); [email protected] (F.J.V.) 2 Department of Pathology and Laboratory Medicine, College of Medicine, University of Saskatchewan, Saskatoon, SK S7N 5E5, Canada; [email protected] (F.S.V.); [email protected] (A.F.) 3 Cancer Research Department, Saskatchewan Cancer Agency, 107 Wiggins Road, Saskatoon, SK S7N 5E5, Canada 4 Institute for Stem Cell Biology, Regenerative Medicine and Innovative Therapies (ISBReMIT), Fondazione IRCCS Casa Sollievo della Sofferenza, 71013 San Giovanni Rotondo, FG, Italy * Correspondence: [email protected] (K.K.B.); [email protected] (V.G.); Tel.: +1-(306)-716-7456 (K.K.B.); +39-0882-416574 (V.G.) Simple Summary: Protein phosphorylation is a key regulatory mechanism that controls a wide variety of cellular responses. This process is catalysed by the members of the protein kinase su- perfamily that are classified into two main families based on their ability to phosphorylate either tyrosine or serine and threonine residues in their substrates. Massive research efforts have been invested in dissecting the functions of tyrosine kinases, revealing their importance in the initiation and progression of human malignancies. Based on these investigations, numerous tyrosine kinase inhibitors have been included in clinical protocols and proved to be effective in targeted therapies for various haematological malignancies.
    [Show full text]
  • Activation of Transmembrane Cell-Surface Receptors Via a Common Mechanism? the ‘‘Rotation Model’’
    Insights & Perspectives Hypotheses Activation of transmembrane cell-surface receptors via a common mechanism? The ‘‘rotation model’’ Ichiro N. Maruyama It has long been thought that transmembrane cell-surface receptors, such as typically consist of an extracellular receptor tyrosine kinases and cytokine receptors, among others, are activated by domain (ECD) and an intracellular ligand binding through ligand-induced dimerization of the receptors. However, domain (ICD) separated by a single transmembrane domain (TMD), with there is growing evidence that prior to ligand binding, various transmembrane the exception of bacterial receptors receptors have a preformed, yet inactive, dimeric structure on the cell surface. such as the aspartate receptor (Tar) Various studies also demonstrate that during transmembrane signaling, ligand and the serine receptor (Tsr), which binding to the extracellular domain of receptor dimers induces a rotation of have another TMD at their amino transmembrane domains, followed by rearrangement and/or activation of termini. Ligand binding to their ECDs often regulates kinases that are either intracellular domains. The paper here describes transmembrane cell-surface integrated into the receptor ICD, or receptors that are known or proposed to exist in dimeric form prior toligand binding, physically associated with the ICD. and discusses how these preformed dimers are activated by ligand binding. Apart from receptors that initiate signaling pathways inside cells via Keywords: tyrosine phosphorylation, there are .cytokine; dimerization; ligand binding; preformed dimer; transmembrane receptors in bacteria, fungi, and plants signaling; tyrosine kinase that phosphorylate histidine residues upon ligand binding. Furthermore, natriuretic peptide receptors, which are receptor-type guanylyl cyclases, Introduction cell membranes to the cytoplasm, and produce cGMP upon peptide binding.
    [Show full text]
  • Structural Basis of Tie2 Activation and Tie2/Tie1 Heterodimerization
    Structural basis of Tie2 activation and Tie2/Tie1 heterodimerization Veli-Matti Leppänena,1, Pipsa Saharinena,b, and Kari Alitaloa,b,1 aWihuri Research Institute, Biomedicum Helsinki, Haartmaninkatu 8, 00290 Helsinki, Finland; and bTranslational Cancer Biology Program, Research Programs Unit, University of Helsinki, 00014 Helsinki, Finland Contributed by Kari Alitalo, March 8, 2017 (sent for review September 28, 2016; reviewed by Joseph Schlessinger and Michel O. Steinmetz) The endothelial cell (EC)-specific receptor tyrosine kinases mice lacking Tie1 develop severe edema around E13.5 because Tie1 and Tie2 are necessary for the remodeling and maturation of compromised microvessel integrity and defects in lymphatic of blood and lymphatic vessels. Angiopoietin-1 (Ang1) growth vasculature and die subsequently (15, 16). Furthermore, Tie1 has factor is a Tie2 agonist, whereas Ang2 functions as a context- critical functions in vascular pathologies, e.g., in tumor angio- dependent agonist/antagonist. The orphan receptor Tie1 modu- genesis and atherosclerosis progression (12, 17). lates Tie2 activation, which is induced by association of angio- In EC monolayers, angiopoietins stimulate Tie receptor trans- cis – trans location to cell–cell junctions for Tie2 trans-association, whereas poietins with Tie2 in and across EC EC junctions in . – Except for the binding of the C-terminal angiopoietin domains in the absence of cell cell adhesion the Tie receptors are an- to the Tie2 ligand-binding domain, the mechanisms for Tie2 chored to the extracellular matrix (ECM) by Ang1-induced Tie2 cis-association (10, 18). Integrins also have been implicated in activation are poorly understood. We report here the structural α β – basis of Ang1-induced Tie2 dimerization in cis and provide Tie2 signaling, and the 5 1 integrin heterodimer enhances Ang1-induced EC adhesion and Tie2 activation (13, 19, 20).
    [Show full text]
  • Supplementary Data ASXL2 Regulates Hematopoiesis in Mice and Its
    Supplementary data ASXL2 regulates hematopoiesis in mice and its deficiency promotes myeloid expansion Supplementary Methods Genomic DNA extraction Genomic DNA was extracted from BM mononuclear cells using a DNA extraction kit (Puregene Gentra System, Minneapolis, MN, USA) according to the manufacturer’s instructions. Genomic DNA was quantified using Qubit Fluorometer (Life Technologies) and DNA integrity was assessed by agarose gel electrophoresis. For samples with low quantity, DNA was amplified using REPLI-g Ultrafast mini kit (Qiagen). Peripheral blood analysis Complete peripheral blood counts were analysed using Abbott Cell-Dyn 3700 hematology analyzer (Abbott Laboratories). Expression analysis of Asxl2 and Asxl1 Transcript levels of Asxl2 and Asxl1 were estimated using quantitative RT-PCR with following primers: Asxl2 primer set 1, ATTCGACAAGAGATTGAGAAGGAG (forward) and TTTCTGTGAATCTTCAAGGCTTAG (reverse); Asxl2 primer set 2, GCCCTTAACAATGAGTTCTTCACT (forward) and TCCACAGCTCTACTTTCTTCTCCT (reverse); Asxl1 primers, GGTGGAACAATGGAAGGAAA (forward) and CTGGCCGAGAACGTTTCTTA (reverse). Asxl2 protein was detected in immunoblot using anti-ASXL2 antibody (Bethyl). In vitro differentiation of bone marrow cells Bone marrow (BM) cells were cultured in IMDM containing 20% FBS and 10 ng/ml IL3, 10 ng/ml IL6, 20 ng/ml SCF and 20 ng/ml GMCSF for two weeks. For FACS analysis, cells were washed, stained with fluorochrome-conjugated antibodies and analysed on FACS LSR II flow cytometer (BD Biosciences) using FACSDIVA software (BD Biosciences). Colony re-plating assay Bone marrow cells were plated in methylcellulose medium containing mouse stem cell factor (SCF), mouse interleukin 3 (IL-3), human interleukin 6 (IL-6) and human erythropoietin (MethoCult GF M3434; StemCell Technologies). Colonies were enumerated after 9-12 days and cells were harvested for re-plating.
    [Show full text]
  • (Erdafitinib), a Functionally Selective Small Molecule FGFR Family Inhibitor
    Author Manuscript Published OnlineFirst on March 24, 2017; DOI: 10.1158/1535-7163.MCT-16-0589 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Discovery and pharmacological characterization of JNJ-42756493 (erdafitinib), a functionally selective small molecule FGFR family inhibitor Timothy P.S. Perera1, Eleonora Jovcheva1, Laurence Mevellec2, Jorge Vialard1, Desiree De Lange1, Tinne Verhulst1, Caroline Paulussen1, Kelly Van De Ven1, Peter King1, Eddy Freyne1, David C. Rees3, Matthew Squires3, Gordon Saxty3, Martin Page1, Christopher W. Murray3, Ron Gilissen1, George Ward3, Neil T. Thompson3, David R. Newell4, Na Cheng5, Liang Xie5, Jennifer Yang5, Suso J. Platero6, Jayaprakash D. Karkera6, Christopher Moy6, Patrick Angibaud2, Sylvie Laquerre6 and Matthew V. Lorenzi6,7. 1Janssen Research and Development, Beerse, Belgium. 2Janssen Research and Development, Val de Reuil, France. 3Astex Pharmaceuticals, Cambridge, United Kingdom. 4Newcastle Cancer Centre, Northern Institute for Cancer Research, Newcastle University, Newcastle upon Tyne, UK. 5Janssen Research and Development, Shanghai, China. 6Janssen Research and Development, Spring House, USA. 7To whom correspondence should be addressed: Matthew V. Lorenzi, Oncology Discovery, Janssen R&D, 1400 McKean Road, Spring House, PA 19477. Phone: 215 793-7356; E-mail: [email protected] Disclosure of Potential Conflicts of Interest: T.P.S. Perera, E. Jovcheva, L. Mevellec, J. Vialard, D. De Lange, T. Verhulst, C. Paulussen, K. Van De Ven, P. King, E. Freyne, M. Page, R. Gilissen, N. Cheng, L. Xie, J. Yang, S.J. Platero, J.D. Karkera, C. Moy, P. Angibaud, S. Laquerre and M.V. Lorenzi are or have been employees of Janssen R&D, and D.C.
    [Show full text]
  • Discovery of a Potent and Selective DDR1 Receptor Tyrosine Kinase Inhibitor
    Discovery of a Potent and Selective DDR1 Receptor Tyrosine Kinase Inhibitor The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters Citation Kim, H., L. Tan, E. L. Weisberg, F. Liu, P. Canning, H. G. Choi, S. A. Ezell, et al. 2013. “Discovery of a Potent and Selective DDR1 Receptor Tyrosine Kinase Inhibitor.” ACS Chemical Biology 8 (10): 2145-2150. doi:10.1021/cb400430t. http://dx.doi.org/10.1021/ cb400430t. Published Version doi:10.1021/cb400430t Citable link http://nrs.harvard.edu/urn-3:HUL.InstRepos:12152819 Terms of Use This article was downloaded from Harvard University’s DASH repository, and is made available under the terms and conditions applicable to Other Posted Material, as set forth at http:// nrs.harvard.edu/urn-3:HUL.InstRepos:dash.current.terms-of- use#LAA Letters pubs.acs.org/acschemicalbiology Terms of Use CC-BY Discovery of a Potent and Selective DDR1 Receptor Tyrosine Kinase Inhibitor † # ‡ § # ‡ # ∥ ‡ # ⊥ # Hyung-Gu Kim, , Li Tan, , , Ellen L. Weisberg, , Feiyang Liu, , , Peter Canning, , ‡ # † ∥ ‡ ∥ ‡ § † Hwan Geun Choi, , Scott A. Ezell, Hong Wu, , Zheng Zhao, Jinhua Wang, , Anna Mandinova, ‡ ⊥ ∥ ‡ † ‡ § James D. Griffin, Alex N. Bullock, Qingsong Liu,*, , Sam W. Lee,*, and Nathanael S. Gray*, , † Cutaneous Biology Research Center, Massachusetts General Hospital and Harvard Medical School, Charlestown, Massachusetts 02129, United States ‡ § Dana Farber Cancer Institute and Department of Biological Chemistry and Molecular Pharmacology, Harvard Medical School, Boston, Massachusetts 02115, United States ∥ High Magnetic Field laboratory, Chinese Academy of Sciences, P.O. Box 1110, Hefei, Anhui, 230031, P. R. China ⊥ Structural Genomics Consortium, University of Oxford, Oxford OX3 7DQ, U.K.
    [Show full text]
  • Eph Receptor Signalling: from Catalytic to Non-Catalytic Functions
    Oncogene (2019) 38:6567–6584 https://doi.org/10.1038/s41388-019-0931-2 REVIEW ARTICLE Eph receptor signalling: from catalytic to non-catalytic functions 1,2 1,2 3 1,2 1,2 Lung-Yu Liang ● Onisha Patel ● Peter W. Janes ● James M. Murphy ● Isabelle S. Lucet Received: 20 March 2019 / Revised: 23 July 2019 / Accepted: 24 July 2019 / Published online: 12 August 2019 © The Author(s) 2019. This article is published with open access Abstract Eph receptors, the largest subfamily of receptor tyrosine kinases, are linked with proliferative disease, such as cancer, as a result of their deregulated expression or mutation. Unlike other tyrosine kinases that have been clinically targeted, the development of therapeutics against Eph receptors remains at a relatively early stage. The major reason is the limited understanding on the Eph receptor regulatory mechanisms at a molecular level. The complexity in understanding Eph signalling in cells arises due to following reasons: (1) Eph receptors comprise 14 members, two of which are pseudokinases, EphA10 and EphB6, with relatively uncharacterised function; (2) activation of Eph receptors results in dimerisation, oligomerisation and formation of clustered signalling centres at the plasma membrane, which can comprise different combinations of Eph receptors, leading to diverse downstream signalling outputs; (3) the non-catalytic functions of Eph receptors have been overlooked. This review provides a structural perspective of the intricate molecular mechanisms that 1234567890();,: 1234567890();,: drive Eph receptor signalling, and investigates the contribution of intra- and inter-molecular interactions between Eph receptors intracellular domains and their major binding partners. We focus on the non-catalytic functions of Eph receptors with relevance to cancer, which are further substantiated by exploring the role of the two pseudokinase Eph receptors, EphA10 and EphB6.
    [Show full text]
  • Amplification of the Human Epidermal Growth Factor Receptor 2 (HER2) Gene Is Associated with a Microsatellite Stable Status in Chinese Gastric Cancer Patients
    387 Original Article Amplification of the human epidermal growth factor receptor 2 (HER2) gene is associated with a microsatellite stable status in Chinese gastric cancer patients He Huang1#, Zhengkun Wang2#, Yi Li2, Qun Zhao3, Zhaojian Niu2 1Department of Gastrointestinal Surgery, The First Hospital of Shanxi Medical University, Shanxi, China; 2Department of Gastrointestinal Surgery, The Affiliated Hospital of Qingdao University, Qingdao, China; 3Department of Gastrosurgery, The Fourth Hospital of Hebei Medical University, Shijiazhuang, China Contributions: I) Conception and design: Z Niu, Q Zhao, H Huang; (II) Administrative support: Z Niu, H Huang, Z Wang; (III) Provision of study materials or patients: All authors; (IV) Collection and assembly of data: Z Wang, Q Zhao; (V) Data analysis and interpretation: Z Niu, H Huang; (VI) Manuscript writing: All authors; (VII) Final approval of manuscript: All authors. #These authors contributed equally to this work. Correspondence to: Zhaojian Niu. Department of Gastrointestinal Surgery, The Affiliated Hospital of Qingdao University, No. 16, Jiangsu Road, Shinan District, Qingdao 260003, China. Email: [email protected]; Qun Zhao. Department of Gastrosurgery, The Fourth Hospital of Hebei Medical University, No. 12 Jiankang Road, Shijiazhuang 050011, China. Email: [email protected]. Background: Gastric cancer (GC) is one of the most common cancers worldwide. However, little is known about the combination of HER2 amplification and microsatellite instability (MSI) status in GC. This study aimed to analyze the correlation of HER2 amplification with microsatellite instability (MSI) status, clinical characteristics, and the tumor mutational burden (TMB) of patients. Methods: A total of 192 gastric cancer (GC) patients were enrolled in this cohort. To analyze genomic alterations (GAs), deep sequencing was performed on 450 target cancer genes.
    [Show full text]