Fidelity Consequences of the Impaired Interaction Between DNA

DNA Repair 29 (2015) 23–35

Contents lists available at ScienceDirect

DNA Repair

j ournal homepage: www.elsevier.com/locate/dnarepair

Fidelity consequences of the impaired interaction between DNA

polymerase epsilon and the GINS complex

a,1 b a c a

Marta Garbacz , Hiroyuki Araki , Krzysztof Flis , Anna Bebenek , Anna E. Zawada ,

a a,∗∗ a,∗

Piotr Jonczyk , Karolina Makiela-Dzbenska , Iwona J. Fijalkowska

Institute of Biochemistry and Biophysics, Polish Academy of Sciences, Laboratory of Mutagenesis and DNA Repair, Pawinskiego 5A, Warsaw 02-106, Poland

National Institute of Genetics, Division of Microbial Genetics, 1111 Yata, Mishima, Shizuoka 411-8540, Japan

Institute of Biochemistry and Biophysics, Polish Academy of Sciences, Department of Molecular Biology, Pawinskiego 5A, Warsaw 02-106, Poland

r t i c l e i n f o a b s t r a c t

Article history: DNA polymerase epsilon interacts with the CMG (Cdc45-MCM-GINS) complex by Dpb2p, the non-

Received 28 October 2014

catalytic subunit of DNA polymerase epsilon. It is postulated that CMG is responsible for targeting of Pol

Received in revised form 3 February 2015 ␧

to the leading strand. We isolated a mutator dpb2-100 allele which encodes the mutant form of Dpb2p.

Accepted 4 February 2015

We showed previously that Dpb2-100p has impaired interactions with Pol2p, the catalytic subunit of Pol

Available online 16 February 2015 ␧

. Here, we present that Dpb2-100p has strongly impaired interaction with the Psf1 and Psf3 subunits

of the GINS complex. Our in vitro results suggest that while dpb2-100 does not alter Pol ␧’s biochemical

Keywords:

properties including catalytic efﬁciency, processivity or proofreading activity – it moderately decreases

Fidelity of replication

the ﬁdelity of DNA synthesis. As the in vitro results did not explain the strong in vivo mutator effect of

DNA polymerase epsilon

the dpb2-100 allele we analyzed the mutation spectrum in vivo. The analysis of the mutation rates in the

GINS complex

DNA polymerase zeta dpb2-100 mutant indicated an increased participation of the error-prone DNA polymerase zeta in repli-

␨

DNA polymerase delta cation. However, even in the absence of Pol activity the presence of the dpb2-100 allele was mutagenic,

DNA leading strand indicating that a signiﬁcant part of mutagenesis is Pol ␨-independent. A strong synergistic mutator effect

observed for transversions in the triple mutant dpb2-100 pol2-4 rev3 as compared to pol2-4 rev3 and

dpb2-100 rev3 suggests that in the presence of the dpb2-100 allele the number of replication errors is

enhanced. We hypothesize that in the dpb2-100 strain, where the interaction between Pol ␧ and GINS is

weakened, the access of Pol ␦ to the leading strand may be increased. The increased participation of Pol

␦

on the leading strand in the dpb2-100 mutant may explain the synergistic mutator effect observed in

the dpb2-100 pol3-5DV double mutant.

license (http://creativecommons.org/licenses/by-nc-nd/4.0/).

1. Introduction processes. The most widely accepted model of the replication fork

assumes that once DNA synthesis has been initiated, the work at the

Spontaneous errors arising during DNA replication are one of replication fork is divided mainly among three DNA polymerases

the main sources of mutations in genomic DNA. Those can have [1,2]. Pol ␣ is responsible for the synthesis of short RNA–DNA

both positive and negative consequences, being, on one hand, the primers. Pol ␧ and Pol ␦ extend those primers on the leading and

source of diversity required for evolution and on the other the cause lagging strands, respectively [3–11]. An alternative model assumes

of inherited disorders. that Pol ␧ performs the replication of the leading strand near the

The assembly and activation of the replisome take place at replication origins but then is replaced by Pol ␦ that completes the

replication origins and they are complex and tightly controlled replication [12].

Pol ␧ is a four-subunit complex consisting of Pol2p, Dpb2p,

Dpb3p and Dpb4p ([13–18]; reviewed in [19,20]). Two sub-

∗ units, Pol2p and Dpb2p, are essential [14,21]. Pol2p has the DNA

Corresponding author. Tel.: +48 22 592 1113; fax: +48 22 592 2190.

∗∗ polymerase and the 3 → 5 exonuclease activities located in the

Corresponding author.

E-mail addresses: [email protected] (K. Makiela-Dzbenska), N-terminal domain while its C-terminal domain carries conserved

ﬁ[email protected], [email protected] (I.J. Fijalkowska). zinc-ﬁnger motifs [22,23]. The C-terminal part of Pol2p is essen-

Present address: National Institute of Environmental Health Sciences, National

tial for yeast viability, whereas the N-terminal part is dispensable

Institute of Health, Genome Integrity and Structural Biology Laboratory, 111 T.W.

[24–26]. Dpb2p plays a crucial role during the initiation of DNA

Alexander Drive, Research Triangle Park, NC 27713, USA.

http://dx.doi.org/10.1016/j.dnarep.2015.02.007

24 M. Garbacz et al. / DNA Repair 29 (2015) 23–35

replication ([14,27–29]; reviewed in [30,31]). It has been estab- In the current study we investigated the mutator phenotype of

lished recently that the interaction between Dpb2p and Psf1p, a the dpb2-100 allele (L284P, T345A). Using an in vitro approach we

subunit of the GINS complex, is required for the assembly of the analyzed whether the mutated Dpb2-100 subunit could directly

CMG helicase during the initiation of DNA replication and helps to affect the enzymatic properties of Pol ␧, such as its catalytic efﬁ-

integrate Pol ␧ into the replisome [28,29,32,33]. Additionally, it was ciency, processivity or ﬁdelity. Additionally, we show that Pol ␧

shown that Dpb2p interacts also with Psf3p [33]. Dpb3p and Dpb4p complex isolated from the dpb2-100 strain contains substoichio-

are not essential but have been shown to be involved in the Pol ␧ metric amounts of the Dpb2 subunit. However, the reduced content

binding to dsDNA and to improve its processivity [34–37]. of Dpb2p does not affect the processivity, exonuclease activity or

In the budding yeast Pol ␦ consists of three subunits: Pol3p, binding to DNA by Pol ␧. A moderate decrease of the ﬁdelity of DNA

Pol31p and Pol32p [38]. Pol3p has the DNA polymerase and the synthesis by Pol ␧ containing a reduced amount of Dpb2-100p has

3 → 5 exonuclease activities [39], while Pol31p is an essential been observed under conditions of an imbalanced ratio of dNTPs.

subunit which stabilizes the holoenzyme and binds the third, We also analyzed in vivo the rates and speciﬁcity of errors arising

nonessential Pol32 subunit [38]. in dpb2-100 mutant strain. We conﬁrmed an increased partici-

It has been suggested that in conditions that render the repli- pation of Pol ␨ in DNA replication in the dpb2-100 mutant [50].

some unstable, for example due to mutations in replication-related However, even in the absence of Pol ␨ activity (in rev3 strains)

genes, the main replicase may be replaced by an error-prone DNA the presence of the dpb2-100 allele elevates the mutation rate, indi-

polymerase such as Pol ␨ [40], which has low processivity and no cating that a signiﬁcant part of mutagenesis is Pol ␨-independent.

→

3 5 exonuclease activity [41]. Pol ␨ has been proposed as the Based on a strong synergistic effect between the dpb2-100 and pol2-

fourth polymerase at the replication fork, the access of which to 4 defects observed for the rate of particular types of Can mutations,

the 3 -OH primer terminus would remain highly controlled [12]. we postulate that both the dpb2-100 and pol2-4 alleles inﬂuence

Initially, Rev3 and Rev7 were considered as the only components mechanisms, which compete for the same replication errors.

of DNA Pol ␨ [41]. However, the two non-catalytic subunits of Pol ␦, Assuming that the interaction between Pol ␧ and CMG complex

Pol31 and Pol32, were recently found to form a complex with Rev3 is important for proper functioning of the replisome [32] we tested,

and Rev7 [42,43]. This suggests that the two subunits common to using two-hybrid system, the interaction between Dpb2-100p and

Pol ␦ and Pol ␨ may facilitate the exchange between the two poly- Psf1 or Psf3 subunits of the GINS complex. We found that the pres-

merases at the replication fork [44,45]. Because Pol ␨ is very efﬁcient ence of the dpb2-100 mutant signiﬁcantly decreases the interaction

in extending primer termini, it could take over replication when the of Dpb2p with Psf1p and Psf3p.

main replicase has a problem with primer extension. Such a poly- Finally, a synergistic mutator effect of the dpb2-100 and the pol3-

merase switch may result in so-called defective-replisome-induced 5DV (Pol ␦ with inactive proofreading) alleles may suggest that in

mutagenesis (DRIM) [46]. the dpb2-100 strain the Pol ␦ holoenzyme may participate in the

It is well established that mutations in catalytic subunits of leading strand replication correcting errors made by Pol ␧ and/or

replicases can affect the level of spontaneous mutagenesis, but by low ﬁdelity Pol ␨.

the role of non-catalytic subunits in this process remains unclear.

A few years ago we found that Dpb2p, a non-catalytic subunit

␧

of DNA Pol , is important for faithful replication of genomic 2. Materials and methods

DNA [47,48]. It has been established that the C-terminus of

Dpb2p is important for its interaction with Pol2p [49]. Isolated 2.1. Media and strains

in our laboratory dpb2 mutants exhibit temperature-sensitivity

and mutator phenotype [47,48]. We observed a strong syner- Yeast were grown in standard media [51]. Yeast complete

gistic mutator effect between the mutant alleles of DPB2 and medium was prepared as described [33,47]. The yeast strains

msh6 mutation suggesting that dpb2-dependent errors aris- used in this study are listed in Table 1. Strains for Pol ␧ puriﬁ-

ing during DNA replication are substrates for mismatch repair cation were derived from a protease-deﬁcient yeast strain YRT1

system. with the DPB3 gene replaced with DPB3-PP-5FLAG (a PreScission

Table 1

Yeast strains used in this study.

Name Genotype Source

YRT1 MATa prc1–407 prb1–1122 pep4–3 leu2 trp1 ura3–52 gal2 dpb3::DPB3-PP-5FLAG Tsubota et al. [54]

Y190 MATa trp1-901 his3-200 leu2-3,112 ura3-52 ade2-101 lys2-801 gal4 gal80 cyh2 Harper et al. [58]

LYS2::GAL1UAS-HIS3-TATA box-HIS3 URA3::GAL1UAS-GAL1TATA box-lacZ

I(-2)I-7B-YUNI300 MATa CAN1 his7-2 leu2::kanMX4 ura3 trp1-289 ade2-1 lys2GG2899-2900 Pavlov et al. (2002)

SC91 As I(-2)I-7B-YUNI300 but DPB2::pKF120 (DPB2 CaURA3 HIS3) Jaszczur et al. [47]

SC94 As SC91 but pol2-4 Jaszczur et al. [47]

SC146 As I(-2)I-7B-YUNI300 but dpb2::pKF117derivative (dpb2-100 CaURA3 HIS3) Jaszczur et al. [47]

SC148 As SC146 but pol2-4 Jaszczur et al. [47]

SC228 As SC91 but DPB2::pKF120-CaURA3-HIS3 Jaszczur et al. [47]

SC234 As SC146 but dpb2::pKF117derivative -CaURA3-HIS3 (dpb2-100) Jaszczur et al. [47]

SC377 As SC91 but rev3::LEU2 Kraszewska et al. [50]

SC378 As SC94 but rev3::LEU2 Kraszewska et al. [50]

SC381 As SC146 but rev3::LEU2 Kraszewska et al. [50]

SC382 As SC148 but rev3::LEU2 Kraszewska et al. [50]

SC641 As YRT1 but [pMG29 (DPB2 URA3)] This study

SC673 As SC641 but dpb2::kanMX4 [pMG29 (DPB2 URA3)] This study

SC674 As SC673 but [pMG30-000 (DPB2 LEU2)] This study

SC675 As SC673 but [pMG30-100 (dpb2-100 LEU2)] This study

SC793, SC794 As SC91 but rnh201-::HPH This study

SC795, SC796 As SC146 but rnh201-::HPH This study

SC228 pol3-5DV As SC228 but pol3-5DV This study

SC234 pol3-5DV As SC234 but pol3-5DV This study

M. Garbacz et al. / DNA Repair 29 (2015) 23–35 25

protease – PP-recognition site located between the C-terminus To create the ADGAL4-DPB2 fusion, the full-length DPB2 ORF

of Dpb3p and the FLAG tag, kindly provided by Prof. H. Araki). was isolated as 2106-bp BamHI-Esp3I fragment from pKF134 [47]

The YRT1 strain was transformed with pMG29 (see Plasmid and cloned into the BamHI/SalI-linearized pKF80 [47] yielding a

constructions) which carried DPB2 under the heterologous plasmid named pKF138. pKF138 (pKF80-DPB2) was converted to

MET15 promoter and CYC1 terminator, giving SC641 strain. pKF80-100 by SacI–StuI digestion and by replacing the 1352-bp

Next, the chromosomal DPB2 allele was disrupted with the excised sequence of DPB2 with SacI–StuI fragment of the same

dpb2::kanMX4 cassette cut out from pKF111 with Bsp120I and length from pMG30-100. The BamHI-EcoRV 3165-bp fragment of

XbaI, giving SC673 strain. Transformants were selected on YPDA the resulting pKF80-100 and of pKF138 plasmids were cloned into

medium supplemented with G-418 (200 ␮g/ml). The integra- BamHI-EcoRV digested pKF263 by replacing the 1815-bp fragment.

tion of the cassette into the DPB2 locus was conﬁrmed by PCR The two-hybrid plasmid pKF263 is based on ADGAL4-containning

(primer pairs: tTEF: 5 CGTATGTGAATGCTGGTC3 , Dpb2 down: pACT2 vector (Clontech) and was obtained by replacing the multi-

5 GAATACTGGCTTACCGAG3 as well as with: Dpb2 up: ple cloning site of NcoI/XhoI-digested pACT2 with a synthetic linker

5 CACCGACTGCAACAGATG3 , pTEF: 5 GTCAAGACTGTCAAGGAG3 ). bearing restriction sites placed in-frame according to ADGAL4. The

Then pMG29 bearing DPB2 under the heterologous promoter and new polylinker is also generally compatible with the pRS series

terminator was replaced with a centromeric vector pMG30-000 of yeast vectors [53]. Consequently, vectors for two-hybrid system

or pMG30-100 (bearing, respectively, DPB2 or dpb2-100 under containing the dpb2-100 and DPB2 alleles in fusion with a sequence

the control of DPB2 promoter and terminator) using plasmid encoding Gal4 transcription activation domain (AD GAL4) – pAZ100

shufﬂe technique, to give SC674 and SC675 yeast strains, respec- and pPJ99, respectively – were obtained. Plasmids with genes cod-

+ +

tively. Leu Ura transformants were selected and toothpicked ing the GINS subunits were as described in [33].

◦

twice onto 5-FOA plates at 23 C. Strains for spontaneous muta-

tion spectra analysis were I (−2) I-7B-YUNI300 derivatives

2.3. Puriﬁcation of DNA Pol ␧

[47,50]. Strains carrying the pol3-5DV allele were constructed

by transformation of I (−2) I-7B-YUNI300 derivatives car-

␧

Pol was puriﬁed utilizing a combination of afﬁnity and ion

rying the wild type DPB2 or dpb2-100 allele with a cassette

exchange chromatography according to the procedure described

(Eco52I-linearized pY19 plasmid, kindly provided by D. Gor-

+ previously [54]. Please see the details in supplementary data S1.

denin) introducing the pol3-5DV mutation. Ura transformants

◦

were selected and toothpicked twice onto 5-FOA plates at 23 C.

The presence of pol3-5DV allele was conﬁrmed by sequencing.

2.4. DNA polymerase assay

Strains carrying rnh201-::HPH cassette were constructed by

transformation of SC91 or SC146. The presence of the rnh201-

DNA polymerase activity was determined by measuring incor-

::HPH cassette was conﬁrmed by two PCR reactions using the 32

poration of ␣-[ P] dCTP into trichloroacetic-insoluble material.

following pairs of primers: 5 CAAAGCAGATTAACGAATTGACAG3 ,

Activated calf thymus DNA was used as the template. A typical

5 ACCTTGCGTCATCGTAGGAG3 and 5 CAAAGCAGATTAACGAATT

reaction (50 ␮l) contained 50 mM Tris–HCl pH 7.7, 100 ␮g/ml BSA,

GACAG3 , 5 GTCAAGACTGTCAAGGAG3 . The presence of the

2 mM DTT, 10 mM MgCl2, 100 ␮g/ml activated calf thymus DNA,

2513-bp and 497-bp products, respectively, indicated that 32

10% glycerol, 80 ␮M dNTPs, 15 nM ␣-[ P] dCTP (3000 Ci/mmol)

rnh201-::HPH cassette substituted the chromosomal RNH201

and 0.67 pmol of Pol ␧. Reactions were incubated for 15 min at

gene. ◦ ◦

30 C or 23 C and stopped by the addition of 150 ␮l of 50 mM

sodium pyrophosphate, 25 mM EDTA, 50 ␮g/ml salmon sperm

DNA, followed by 1.3 ml of 10% trichloroacetic acid. After overnight

◦

2.2. Plasmid constructions

incubation at 4 C the acid-precipitated material was collected by

ﬁltration through Whatman GF/C ﬁlters. Filters were washed 4

All plasmids were constructed according to standard protocols

times with 2 ml of 1 M HCl, 0.05 M sodium pyrophosphate, rinsed

as described by Sambrook et al. [52] and propagated in E. coli DH5˛.

with ethanol, dried and radioactivity was counted. One unit of

Construction of the pKF193 plasmid was multi-step. First, the

enzyme activity incorporates 1 nmol of total nucleotide/h [13].

PMET25-DPB2-Ni ·c.s.-TEV·c.s.-His·tag-TCYC1 cassette (c.s. denotes

sequence encoding a particular cleavage site) was introduced

2.5. Gel mobility shift assay

into pRS413 (HIS3//CEN6/ARSH4). The selectable marker HIS3 was

replaced with URA3 from pRS316, using respective NsbI-NsbI frag-

DNA-binding mixture (10 ␮l) contained 25 mM HEPES pH

ments, yielding pMG29.

7.6, 10% glycerol, 200 mM sodium acetate pH 7.8, 1 mM DTT,

The cassette for disruption of the DPB2 gene was isolated from

200 ␮g/ml BSA, 50 ␮M dGTP, 50 ␮M dTTP, 5 nM 5 -[ P]-labeled

DNA of BY4743 dpb2::kanMX4/DPB2 strain (EUROSCARF accession

DNA (58-nt:76-nt or 58-nt:k58-nt) and an indicated amount

no. Y25590) by the gap-repair method using EcoRI/StuI-linearized

of Pol ␧ or Pol ␧ . The DNA sequences were:

pKF106 [47]. Homologous recombination took place in both pro- Dpb2p Dpb2-100p

76-mer, 5 GTCACTGTTACCGTGACAGGTAAGCAGTCCGCTGAT-

moter and terminator sequences of DPB2 resulting in two kinds

CATCGTGCGATCAATGCAGGCTATGCCGCATCGTGACCTG 3 , 58-

of plasmids depending on which allele was rescued. The plasmid

mer, 5 CAGGTCACGATGCGGCATAGCCTGCATTGATCGCACGAT-

containing the PDPB2-kanMX4-TDPB2 cassette was named pKF111

GATCAGCGGACTGCTTAC 3 , k58-mer, 5 GTCACTGTTACCGTGACAG

and could be distinguished from one bearing the wild-type DPB2

GTAAGCAGTCCGCTGATCATCGTGCGATCAATGCAGGCTATGCCGCAT

gene (named pKF112; isogenic to pKF107, [47]) by conferring the

◦

CGTGACCTG 3 . The mixtures were incubated at 23 C for 30 min,

kanamycin resistance in E. coli cells. Both plasmids were veriﬁed by

sequencing. mixed with 2.5 ␮l of loading buffer (25 mM HEPES pH 7.6, 50%

glycerol) and loaded on non-denaturing 4% polyacrylamide gel.

Centromeric plasmids with pRS315 backbone carrying DPB2

◦

Electrophoresis was performed at 5.5 V/cm for 2.5 h at 4 C in

or dpb2-100 under the homologous DPB2 promoter and termina-

25 mM HEPES pH 7.6, 0.1 mM EDTA pH 8.0. The gel was dried

tor sequences were derivatives of pKF107 and pJK1, respectively

◦

at 80 C for 45 min and placed against a phosphorimaging plate

[47]. The 4232-bp NsbI-NsbI fragment of pRS315 (containing LEU2

which was then scanned using a Fuji Phosphoimager FLA7000 and

marker) was ligated with the 5279-bp NsbI-NsbI fragment of

quantiﬁed using Multi-Gauge V3.0 software.

pKF107 or pJK1 to give pMG30-000 and pMG30-100, respectively.

26 M. Garbacz et al. / DNA Repair 29 (2015) 23–35

2.6. Processivity assay 2.9. Determination of mutation rates

A typical reaction mixture (15 ␮l) contained 40 mM Tris–HCl To determine spontaneous mutation rates, 10–20 independent

pH 7.5, 8 mM magnesium acetate, 1% glycerol, 125 mM sodium cultures of each yeast strain (two or three independent isolates)

acetate, 1 mM DTT, 200 ␮g/ml BSA, 1 mM ATP, 100 ␮M dNTPs, were inoculated in 2–20 ml of liquid SD medium supplemented

6.3 nM RFC, 63 nM PCNA, 169 nM RPA, 5 nM primer-template with required amino acids and nucleobases. Cultures were grown

32 ◦

duplex (5 -[ P]-labeled 51 nt: 5 ATACGACTCACTATAGGGC- at 23 C to the stationary phase and propagated as described previ-

GAATTGGGTACCGGGCCCCCCCTCGAGGTCGA-3 annealed to ssDNA ously [47]. The mutation rates were calculated using the equation:

␧ ␧ f f of pBluescript II SK (+)) and 0.5 nM Pol Dpb2p or Pol Dpb2-100p. The = /ln(N ), where is the mutation rate per replication, is

◦

reaction was performed at 25 C for 1, 2, 4 or 8 min, stopped by the mutant frequency and N is the total population size [56].

adding 15 ␮l of stop solution (90% formamide, 50 mM EDTA, 0.1% Median values of the mutation rates and 95% conﬁdence inter-

◦

xylene cyanol, 0.1% bromophenol blue), denatured for 5 min at 99 C vals for the medians were calculated with the use of STATISTICA

and cooled on ice. Reaction products were resolved in 8% denatur- 6.0 software. To determine the p-values for signiﬁcance of differ-

ing polyacrylamide gel. Dried gel was exposed against phosphor ences of the mutation rates between strains the Mann–Whitney U

imaging plates (Fuji) and signal quantiﬁed using a Typhoon imag- non-parametric test was used.

ing system and ImageQuant software (GE Healthcare). Sequencing

products of identical template using Sequenase Version2.0 DNA 2.10. CAN1 mutation spectra analysis

Sequencing Kit (USB Corporation) were used as molecular weight

marker. The termination probability at each template position The spontaneous-mutation frequency and rates in strains

was measured according to the equation: Tp = N/sum ≥ N where selected for the analysis of mutation spectra was determined as

Tp – termination probability, N – intensity of a band at N, previously [33,50]. CAN1 locus was ampliﬁed by PCR using the DNA

≥ sum N – a sum of intensities of a band at N and all longer as a template and primers MG CANFF – 5 AAGAGTGGTTGCGAACA-

bands. GAG3 and MG CANRR – 5 GGAGCAAGATTGTTGTGGTG3 . Primers

CAN 1666 – 5 ATATTTGACAGGGAACAAGT3 , CAN 1963 5 GATG-

GCTCTTGGAACGGA3 , CAN 2241 5 TGTCAAGGACCACCAAAG3 and

CAN 2465 5 GTAACTCGTCACGAGAGA3 were used to determine

2.7. Exonuclease activity assay

the nucleotide sequence of the PCR amplicon. Mutations were iden-

tiﬁed using BioEdit – sequence alignment and analysis program.

The 3 → 5 exonuclease activity of Pol ␧ was determined accord-

Statistical signiﬁcance of differences between two spectra were

ing to the protocol described in Aksenova et al. [37]. The reaction

determined with using Monte Carlo method. Please see the sup-

mixture (50 ␮l) contained 40 mM Tris–HCl pH 7.5, 125 mM sodium

32 plementary data S2.2 for further details.

acetate, 1 mM DTT, 200 ␮g/ml BSA, 2.5 nM 5 -[ P]-labeled DNA-

substrate 58-nt:76-nt (DNA sequence as above) and 0.83 nM Pol

␧ ◦ 2.11. Two-hybrid analysis

. Reaction mixtures were preincubated for 15 min at 25 C and

magnesium acetate was added to a ﬁnal concentration of 8 mM

◦ Two-hybrid analysis was performed according to Fields and

to start the reaction. Reaction was performed at 25 C. At 1, 2, 4,

Song [57] with the Y190 strain as a host [58]. Interactions

8, 16 or 32 min 7-␮l sample was taken and mixed with the same

were assessed using plate assay with 5-bromo-4-chloro-3-

volume of stop buffer (90% formamide; 50 mM EDTA; 0.1% xylene

␤ d

◦ indolyl- - -galactopiranoside (X-gal) and a quantitative in vitro

cyanol, 0.1% bromophenol blue), denatured for 5 min at 99 C and

␤-galactosidase assay with o-nitrophenyl ␤-galactoside (ONPG) as

cooled on ice. DNA was analyzed in 10% polyacrylamide urea dena-

substrate [59]. For ␤-galactosidase assay yeast strains were grown

turing gel. Dried gel was exposed against a phosphor imaging plates ◦

for 1 day at 23 C in SD medium supplemented with required amino

(Fuji) and signal quantiﬁed using a Typhoon imaging system and

acids and nucleotides. Cultures were diluted 10-fold with fresh SD

ImageQuant software (GE Healthcare). The efﬁciency of exonucle-

medium and incubated for additional 48 h.

ase activity was determined according to the equation: Ex = Id/It,

where Ex – exonuclease efﬁciency, Id – intensity of all bands below

3. Results

substrate (products of degradation), It – intensity of all bands in a

lane.

We have previously isolated several temperature-sensitive

mutant alleles of DPB2 encoding the non-catalytic subunit of Pol

␧ holoenzyme in the yeast S. cerevisiae [47,48]. The mutants were

2.8. Fidelity of in vitro DNA synthesis by DNA polymerase epsilon

signiﬁcantly affected in spontaneous mutagenesis.

– gap ﬁlling assay

In this study we investigated further the mechanisms of the

mutator effect of defective Dpb2p. We chose the dpb2-100 allele

The frequency of nucleotide misincorporation of Pol ␧ was

[47] as it is the strongest mutator.

determined in a forward mutation assay using a 407-nt target

sequence in M13mp2 DNA [55]. Gapped M13mp2 was prepared as

3.1. Puriﬁcation, activity and enzymatic properties of wild type

described by Bebenek and Kunkel [55]. Reaction mixtures (100 ␮l)

and mutant Pol ␧

contained: 44 nM Pol ␧, 0.5 nM M13mp2 gapped DNA substrate,

2 mM DTT, 10% glycerol, 50 mM Tris–HCl pH 7.5, 100 ␮g/ml BSA,

We wanted to investigate whether the mutations in the Dpb2p

8 mM MgCl , 1 mM dNTPs. In imbalanced nucleotide pool exper-

2 subunit inﬂuence the ﬁdelity of replication by the direct impact

iments three dNTPs were at 20 ␮M each and the fourth (dCTP

on biochemical properties of Pol ␧. We puriﬁed the wild type and

or dTTP) at 2 mM. The mutant frequency (MF) estimated after

the mutant version of Pol ␧ holoenzyme and characterized them in

color veriﬁcation was corrected by subtracting the frequency of

vitro. We studied the enzymes’ binding to DNA and their activity,

mutants obtained after transfection with control gapped DNA (the

processivity and ﬁdelity of replication.

−4

background observed for this assay was 21 × 10 ). All mutant fre-

The Dpb2 subunit is composed of 689 amino acids. We changed

quencies presented in Table 3 are obtained after subtracting the

two amino acids in the middle part of the protein (L284P, T345A)

background level.

[47]. To analyze whether the mutated variant of Dpb2p changes

M. Garbacz et al. / DNA Repair 29 (2015) 23–35 27

Table 2

In vitro DNA polymerase activity of Pol ␧ variants.

Pol ␧ activity [U/mg Pol2p]

◦ ◦

Variant of Pol ␧/temperature 23 C 30 C

Pol ␧Dpb2p 3720 5058

Pol ␧Dpb2-100p 4419 5058

Incorporation of [␣- P]dCTP into activated calf thymus DNA was measured as

described in Section 2.

◦

of the mutant strain, we measured the in vitro activity at the 23 C

◦

and 30 C (Table 2). Both Pol ␧ variants exhibited similar activity and

utilized activated DNA as a template-primer efﬁciently, which indi-

␧

cated that the catalytic activity of Pol Dpb2-100p was not affected

by the Dpb2p defect at neither temperature (Table 2).

Pol ␧ binds both ss- and dsDNA [35,54]. The DNA-binding prop-

erties of the two variants were analyzed by the gel mobility shift

assay with P-labeled dsDNA (58-nt:58-nt) or dsDNA with a single

stranded overhang (56-nt:76-nt). Two forms of Pol ␧ exhibit similar

␧

DNA binding efﬁciency. However, at the higher Pol Dpb2-100p con-

centrations two shifted bands with different mobilities are visible

which may suggest that more than one polymerase complex can be

␧

bound to the same DNA template molecule. In contrast, Pol Dpb2p

is shifted into a single band at all enzyme concentrations (Fig. 2).

Processivity is a crucial parameter of replicative polymerases

and Pol ␧ has been previously shown to have a very high intrinsic

processivity. Interestingly, the two non-essential small subunits,

Dpb3 and Dpb4, are important for the processivity of Pol ␧ [37]. To

␧

check whether processivity is compromised in the Pol Dpb2-100p

complex, we compared the processivity of DNA synthesis by wild

type Pol ␧ with its mutant form when copying a circular ssDNA

plasmid BlueScript SK II. The reactions were performed under con-

ditions of primer-template excess (1:10 molar ratio of polymerase

to primer), such that only a small percentage of primers were

extended (see Section 2 and description for Fig. 3). The results for

the two Pol ␧ variants were similar – both incorporated at least

250 nucleotides – indicating that the deﬁciency of the Dpb2 sub-

unit did not compromise the processivity (Fig. 3). To improve the

processivity of the polymerases we added RPA, RFC and PCNA to the

reaction. It was previously shown that these factors may affect the

processivity of Pol ␧ [60–62]. As the distribution of the products

synthesized by both enzymes was similar and their processivity

comparable one can thus conclude that the interaction with PCNA

and loading of Pol ␧ on the 3 OH primer end are not substantially

␧

affected in the Pol Dpb2-100p enzyme.

Finally, the exonuclease activity of the wild type and mutant

Pol ␧ was compared by assessing their ability to degrade 5 - P-

labeled primer strand of an oligonucleotide template-primer (58-

nt:76-nt). The reaction was carried out in the absence of dNTPs. The

mutant Pol ␧ variant did not degrade the primer strand with lower

Fig. 1. Stoichiometry of subunits of Pol ␧ variants puriﬁed from the DPB2 and dpb2-

efﬁciency (Fig. 4).

100 strains. Pol ␧ holoenzyme was puriﬁed from the DPB2 and dpb2-100 strains

To sum up, the lack of the Dpb2 subunit in ∼90% of Pol ␧

expressing Dpb3p-FLAG as described in Section 2. Peak fractions from the ResourceQ

column were separated in 5–20% gradient polyacrylamide gel with SDS and stained complexes and the presence of a mutant Dpb2-100p one in the

with Coomassie Brilliant Blue. remaining 10% seem not to affect the DNA polymerizing or exonu-

clease activities, interactions with PCNA or DNA.

the enzymatic properties of Pol ␧ we puriﬁed the wild type and the

␧

mutant variant of Pol from yeast expressing it at a native level 3.2. Effect of Dpb2p deﬁciency on the ﬁdelity of Pol ␧ holoenzyme

(without overexpression). The stoichiometry of the Pol ␧ subunits

in the wild type enzyme (Pol2p:Dpb2p:Dpb3p:Dpb4p) was 1:1:1:1, To investigate whether the deﬁciency of Dpb2p affects the

as reported earlier [37]. In contrast, in the mutated variant of Pol ﬁdelity of Pol ␧ we compared the action of the wild type Pol ␧

␧

the Dpb2p subunit was present at approximately 1/10 of its nor- and Pol Dpb2-100p in a gap-ﬁlling assay. In this in vitro assay, poly-

mal level (the Pol2p:Dpb2p:Dpb3p:Dpb4p ratio was 1:0.1:1:1.2) merase ﬁlls in a 407-nt gap in dsDNA of M13mp2 bacteriophage.

(Fig. 1). Errors in the DNA synthesis manifest as colorless or light blue

␧

We compared the DNA polymerase activity of the two Pol vari- plaques [55]. This assay allows detection of both base substitut-

ants using activated calf thymus DNA as template/primer. Because ions as well as frameshift errors. We ﬁrst compared the ﬁdelity of

the presence of the dpb2-100 allele causes temperature-sensitivity both polymerases in the gap-ﬁlling in a reaction containing equal

28 M. Garbacz et al. / DNA Repair 29 (2015) 23–35

Fig. 2. DNA binding by Pol ␧Dpb2p and Pol ␧Dpb2-100p. DNA-binding properties of both forms of Pol ␧ were analyzed using gel mobility shift assay (A). On the graphs (B) there are

indicated averages from independent experiments. Two shifted products visible at the highest concentration of Pol ␧Dpb2-100p may correspond to one or more Pol ␧ molecules

bound per oligonucleotide substrate.

concentrations of each nucleotide (1 mM dNTPs, Table 3). Pol ␧ vari- committed by either variant of Pol ␧ were rather low, we rea-

ants ﬁlled in the 407-nt gap efﬁciently, what was observed using soned that provoking the enzyme to commit more errors due to

agarose gel electrophoresis (data not shown). The lacZ mutant fre- imbalanced dNTPs pool in reaction could perhaps allow visualizing

quencies (MF) obtained after transfection of E. coli cells with these differences between the wild type Pol ␧ HE and mutant variant.

−4

reaction products for wild type Pol ␧ (27 × 10 ) and the mutated Therefore, we conducted the assay with an imbalanced ratio of

−4

␧ × Pol Dpb2-100p (26.8 10 ) were similar to the background lacZ dNTPs, a condition known to provoke replication errors. In imbal-

−4

mutation frequency for uncopied M13mp2 phage DNA (21 × 10 ). anced dNTPs pool conditions, concentration of dCTP or dTTP were

The mutant frequencies obtained after gap-ﬁlling were corrected 100-fold higher comparing to the concentration of the other three

by subtracting the background level (e.g., MF for Pol ␧ HE was cal- nucleotides, therefore the rate of polymerization and mismatch

−4 −4 −4

culated as 27 × 10 − 21 × 10 = 6 × 10 ). Such corrected values extension should be increased and proofreading compromised [64].

are presented in Table 3. With the dCTP excess we observed a moderate (1.9-fold) but

−4

␧ ␧ × As Pol is a highly accurate enzyme owing in part to its proof- statistically signiﬁcant mutator effect of Pol Dpb2-100p (64.0 10

−4

reading activity [63], the use of its exonuclease-proﬁcient form comparing to 33.0 × 10 , p = 0.03, Table 3). With the dTTP excess

in the assay could have impeded demonstration of its possible the mutator effect was smaller (1.6-fold) and statistically insignif-

−4 −4

defect due to the dpb2-100 mutation. Since the overall error rates icant (28.0 × 10 vs. 17.6 × 10 , p = 0.83, Table 3). Based on the

Table 3

−

The lacZ mutation frequency in products of M13 phage gap ﬁlling by DNA Pol ␧ variants in vitro.

−4

Experiment Variant of Pol ␧ Plaques Mutant frequency (×10 ) Fold

Total Mutants

Dpb2p 35,854 97 6.0

1 mM dNTPs 1.0

Dpb2-100p 35,471 95 5.8

␮

20 M dNTPs Dpb2p 40,135 217 33.0

1.9×#

+2 mM dCTP Dpb2-100p 50,802 432 64.0

20 ␮M dNTPs Dpb2p 45,085 174 17.6

1.6×

+2 mM dTTP Dpb2-100p 46,625 230 28.3

−

The lacZ mutant frequencies were calculated as described in [55].

Statistically signiﬁcant difference, p = 0.03 (p values were calculated using non-parametric Mann–Whitney-U test).

M. Garbacz et al. / DNA Repair 29 (2015) 23–35 29

Fig. 4. Exonuclease activity of Pol ␧Dpb2p and Pol ␧Dpb2-100p. The 3 → 5 exonucle-

ase activity of Pol ␧Dpb2p and Pol ␧Dpb2-100p was determined using a 5 -[ P]-labeled

duplex DNA (58–76-nt oligonucleotides) as a substrate. Reactions were stopped

at indicated time points. Degradation products generated by Pol ␧Dpb2p and Pol

␧

Dpb2-100p were separated in 10% denaturing polyacrylamide gel and radioactive

bands visualized as described in Section 2.

3.4. Characterization of Can mutations in dpb2-100 strains

To investigate the inﬂuence of Dpb2-100p on spontaneous

mutagenesis we determined spectra of Can mutations in four

strains bearing the dpb2-100 allele (dpb2-100, dpb2-100 rev3,

dpb2-100 pol2-4 and dpb2-100 pol2-4 rev3) and compared with

that of isogenic strains carrying the DPB2 allele (WT, rev3, pol2-4

Fig. 3. Processivity of DNA synthesis by Pol ␧Dpb2p and Pol ␧Dpb2-100p. Processivity

of DNA synthesis was analyzed with using primer extension assay. The substrate, and pol2-4 rev3 ) as controls. To establish the speciﬁcity and

5 -[ P]-labeled 51-mer annealed to ssDNA of pBluescript II SK (+), were extended possible mechanisms of mutagenesis in the analyzed strains we

by Pol ␧Dpb2p and Pol ␧Dpb2-100p as described in Section 2. In this experiment we

estimated the rates and percentage of each individual class or

used a signiﬁcant excess of DNA substrate over the polymerase ([E]:[S] 1:10) such

type of mutation. We used the CAN1 assay because the CAN1

that only less than 20% of primers were extended. Termination probability at 4 and

gene provides a large forward mutagenesis target (1773 bp) and

8 min time points were similar for analyzed DNA products therefore we assume they

represented condition closed to a single hit. allows detection of a variety of mutational events, including base

substitutions, frameshifts, insertions, inversions, larger deletions

and complex rearrangements. Such a wide spectrum of mutational

events can be detected since any mutation that inactivates the

obtained results we conclude that Dpb2p deﬁciency may affect the

arginine permease encoded by the CAN1 gene will prevent the

ﬁdelity of Pol ␧, but the effect is very moderate.

uptake of the toxic canavanine into the cell. Table 5A presents

the distribution of particular classes of mutations for the 834

sequenced Can mutants (location of the mutations in the CAN1

3.3. Errors in dpb2-100 strain are not due to increased sequence is shown in Supplementary data S2.1).

incorporation of ribonucleotides by Pol ␧

Table 4

The increased number of errors in the dpb2-100 mutant could be

Mutation rates in the dpb2-100 and dpb2-100 rnh201 strains.

caused by an increased incorporation of ribonucleotides, since Pol

R −7 a

Yeast strain Can (×10 ) Relative rate

␧ has previously been shown to incorporate ribonucleotides efﬁ-

ciently [65–68]. To check this possibility, we investigated whether DPB2 RNH201 6.3 (5.4–8.7) 1

DPB2 rnh201- 18.6 (15.0–20.9) 2.9

the deletion of rnh201 (a component of RER–ribonucleotide exci-

dpb2-100 RNH201 40.0 (29.5–56.9) 6.3

sion repair) disturbs the removal of ribonucleotides from DNA,

dpb2-100 rnh201- 46.0 (38.3–58.4) 7.3

increasing the rate of mutations in the dpb2-100 strain. No such

Relative rate is the rate in a given strain divided by the corresponding rate in

effect was observed (Table 4), indicating that the analyzed dpb2-100

the DPB2 RNH201 strain; 95% conﬁdence intervals are shown in parentheses;

mutation is unlikely to affect the rate of incorporation of ribonu-

p value was >0.05 for dpb2-100 RNH201 vs. dpb2-100 rnh201, calculated using

␧

cleotides by Pol . non-parametric Mann–Whitney-U test.

30 M. Garbacz et al. / DNA Repair 29 (2015) 23–35

Table 5A

CAN1 mutation spectra in diverse yeast strains.

Strain/mutation DPB2 rev3 dpb2-100 dpb2-100 rev3 pol2-4 pol2-4 rev3 dpb2-100 pol2-4 dpb2-100 pol2-4 class rev3

a b

Base 2.3 (71/70%) 0.5 (62/56%) 26.3 (63/80%) 11.2 (60/70%) 14.9 (101/83%) 14.8 (100/78%) 234.7 (65/90%) 74.8 (55/68%)

substitutions

Indels 0.8 (26/25%) 0.4 (48/44%) 5.4 (13/16%) 4.8 (26/30%) 3.1 (21/17%) 4.2 (29/22%) 21.7 (6/8%) 35.2 (26/32%)

Complex 0.2 (5/5%) <0.1 (<1) 1.3 (3/4%) <0.2 (<1) <0.1 (<1) <0.2 (<1) 3.6 (1/1%) <1.3 (<1)

Total 3.3 (102/100%) 0.93 (110/100%) 33.0 (79/100%) 16.0 (86/100%) 18.0 (122/100%) 19.0 (129/100%) 260.0 (72/100%) 110.0 (81/100%)

a R 7

Rates [Can /10 cells] for particular types of mutations were calculated as described previously (for reference see Supplementary data S2.2). p values are presented in

Supplementary data S2.2.

Number and percentage of events for speciﬁc classes of mutations are shown in brackets.

Complex mutations are deﬁned as multiple changes within short DNA stretches (up to 6 nt).

3.4.1. The dpb2-100 allele mutator activity 22-fold and indels 12-fold. In particular, the rate of transversions

␨

3.4.1.1. rev3 . Pol activity signiﬁcantly increases the frequency increased 27-fold and that of transitions - 14.5-fold (Table 5B). The

of spontaneous mutations [33,46,50,69–73]. The overall rate of obtained data indicate that the mutant form of Dpb2p elevates the

Can mutations is 3.7-fold lower in the rev3 strain than in the rates of all types of mutations in rev3 background.

wild-type (Table 5A). The mutation types attributed to Pol ␨ activity

(compromised in the rev3 strain) were affected the most. The rate

3.4.2. The synergy between dpb2-100 and pol2-4

of transversions was reduced 5.5-fold and transitions 3-fold. Anal-

3.4.2.1. pol2-4. DNA polymerase errors are a combined result of

ysis of the most characteristic of Pol ␨ mutational events shows that

nucleotide misincorporation by the polymerase and subsequent

−7 −7

the rate of GC → CG drops 10-fold (from 0.3 × 10 to 0.03 × 10 )

proofreading. The pol2-4 allele encodes an impaired polymerase

in the rev3 strain. While complex mutations, deﬁned as multiple

lacking the 3 → 5 exonuclease proofreading activity [63,77,78].

mutations within DNA stretches ≤6 nt, were absent in the rev3

Tables 5 show results of experiments performed in the pol2-4

strain (Table 5B). These results are in agreement with earlier reports

background. The pol2-4 mutation alone elevated the mutation

−

on Pol ␨-dependent mutagenesis [33,46,50,71,74–76]. 7

rate in CAN1 5.4-fold (from 3.3 × 10 in wild type strain to

−7

18 × 10 in pol2-4). Base substitutions were enhanced 6.5-fold

3.4.1.2. dpb2-100. The dpb2-100 strain exhibited a strong muta- and indels 3.9-fold. In particular, transitions increased 3.6-fold

−7 −7

tor phenotype, showing a 10-fold higher CAN1 mutation rate than (from 1.2 × 10 to 4.5 × 10 ) and transversions 8.7-fold (from

−7 −7 −7 −7

the wild type strain (33 × 10 vs. 3.3 × 10 , Table 5A). Almost all 1.1 × 10 to 10.3 × 10 ). The mutation spectrum for the pol2-4

classes of mutations were enhanced: base substitutions 11.4-fold strain determined here was similar to that reported by Aksenova

−7 −7 −7

(from 2.3 × 10 to 26.3 × 10 ) and indels 7-fold (from 0.8 × 10 et al. [37]. When the rev3 defect was combined with the pol2-

−7

to 5.4 10 ) (Table 5A). In particular, transitions were elevated 9- 4, no statistically signiﬁcant change was observed in the mutation

−7 −7

fold (from 1.2 × 10 to 10.9 × 10 ), transversions 14-fold (from spectrum (Tables 5A and 5B and Supplementary data S2.2).

−7 −7

1.1 × 10 to 15.5 × 10 ) and 1-bp additions, 2-bp additions, 1-

bp deletions and 2-bp deletions – 13-fold, 8-fold, 6-fold and 2-fold,

3.4.2.2. pol2-4 and dpb2-100 vs. pol2-4 dpb2-100. To further study

respectively (Table 5B). Complex mutations were increased 6.5-fold

the mechanism of dpb2-100-related mutagenesis, we investigated

in the dpb2-100 strain.

the relation between the 3 → 5 proofreading activity of Pol ␧ and

the defect in Dpb2p in mutation avoidance (between the pol2-4

3.4.1.3. dpb2-100 vs. dpb2-100 rev3. To determine the contri- and dpb2-100 alleles). We found the synergistic effect of the two

−7 −7

bution of Pol ␨ to the ﬁdelity of replication in the dpb2-100 strain defects on the CAN1 mutation rate (18 × 10 and 33 × 10 in

−7

we compared the spectra of mutations in the dpb2-100 strain in strains with single defects vs. 260 × 10 in pol2-4-dpb2-100). Inter-

the presence and in the absence of Pol ␨. The lack of a functional estingly, the two defects had the synergistic effect for all types of

Pol ␨ decreased the mutation rate 2-fold in the dpb2-100 rev3 base substitutions except GC → CG (Table 5B). For indels, the effect

−7 −7 −7

strain when compared to dpb2-100; the rates of base substitutions was also synergistic (21.7 × 10 vs. 5.4 x 10 and 3.1 × 10 for

−7 −7

decreased from 26.3 × 10 to 11.2 × 10 , and complex mutations dpb2-100 and pol2-4, respectively) indicating that both the dpb2-

were not found in the dpb2-100 rev3 spectrum (Table 5A). The 100 and pol2-4 alleles inﬂuence mechanisms which compete for

strongest difference between the two spectra was the absence of the same replication errors.

GC → CG transversions in the dpb2-100 rev3 strain. Among indels,

both insertions and deletions were moderately decreased in the

3.4.2.3. pol2-4 rev3 and dpb2-100 rev3 vs. pol2-4 dpb2-100

dpb2-100 rev3 strain (Table 5B). Based on the obtained muta-

rev3 . A comparative analysis of mutation rates and spectra in

tion spectra, we conclude that the presence of the dpb2-100 allele

three strains in which the error-prone Pol ␨ is inactive is an excel-

increases the participation of the error prone Pol ␨ in DNA repli-

lent method to analyze both the relationship between the dpb2-100

cation. However, a signiﬁcant fraction (50%) of mutagenesis in the

and pol2-4 alleles and their inﬂuence on spontaneous mutagene-

dpb2-100 is independent of the Pol ␨ activity. Inactivation of DNA

sis. Both the pol2-4 and dpb2-100 alleles are strong mutators when

polymerase eta (␩) (by disruption of RAD30 gene) did not decrease

combined with rev3 as they each increase the mutation rate ∼20-

Can mutagenesis in dpb2-100 rev3 strains (see Supplementary

fold. In the triple mutant strain pol2-4 dpb2-100 rev3 these alleles −

data S3). 7

act synergistically (CAN1 mutation rate ∼110 × 10 in the triple

−7 −7

mutant vs. 16 × 10 in dpb2-100 rev3 and 19 × 10 in pol2-

3.4.1.4. dpb2-100 rev3 vs. rev3. To evaluate the inﬂuence of 4 rev3). A synergistic effect is observed for transversions, for

−7 −7 −7

mutated Dpb2 subunit on the level of spontaneous mutagenesis in AT → TA (20.9 × 10 vs. 0.2 × 10 and 2.5 × 10 , respectively)

−7 −7 −7

the case when Pol ␨ does not contribute to the ﬁdelity, we compared or AT → CG (9.9 × 10 vs. 0.7 × 10 and 0.4 × 10 , respectively).

−7 −7

the mutation spectra of the dpb2-100 rev3 and rev3 strains. The The same is true for 1-bp insertions (18.7 × 10 vs. 1.7 × 10 and

−7

presence of the dpb2-100 allele increased the overall mutation rate 1.3 × 10 in dpb2-100 pol2-4 rev3, dpb2-100 rev3 and pol2-4

−7 −7

18-fold in the rev3 background, base substitutions were increased rev3, respectively) and 1-bp deletions (12.1 × 10 vs. 2.0 × 10

M. Garbacz et al. / DNA Repair 29 (2015) 23–35 31

Table 5B

Rates of various types of base substitutions, indels and complex mutations.

Type of DPB2 rev3 dpb2-100 dpb2-100 rev3 pol2-4 pol2-4 rev3 dpb2-100 pol2-4 dpb2-100 pol2-4 mutation/strain rev3

a b

Transitions 1.2 (37/36%) 0.4 (42/38%) 10.9 (26/33%) 5.8 (31/36%) 4.5 (31/25%) 4.8 (32/25%) 83.1 (23/32%) 15.4 (11/14%)

AT → GC 0.4 (12/12%) 0.1 (11/10%) 2.5 (6/8%) 2.8 (15/17%) 1.6 (11/9%) 1.5 (10/8%) 36.1 (10/14%) 9.9 (7/9%)

GC → AT 0.8 (25/25%) 0.3 (31/28%) 8.4 (20/25%) 3.0 (16/19%) 2.9 (20/16%) 3.2 (22/17%) 46.9 (13/18%) 5.5 (4/5%)

Transversions 1.1 (34/33%) 0.2 (20/18%) 15.5 (37/47%) 5.4 (29/34%) 10.3 (70/57%) 10.1 (68/53%) 151.7 (42/58%) 59.4 (44/54%)

AT → CG 0.1 (4/4%) 0.01 (1/1%) 1.7 (4/5%) 0.7 (4/5%) 0.9 (6/5%) 0.4 (3/2%) 10.8 (3/4%) 9.9 (7/9%)

AT → TA 0.1 (3/3%) 0.01 (1/1%) 2.5 (6/8%) 0.2 (1/1%) 2.7 (18/15%) 2.5 (17/13%) 32.5 (9/13%) 20.9 (15/19%)

→

GC TA 0.6 (17/17%) 0.1 (15/14%) 6.7 (16/20%) 4.5 (24/28%) 5.8 (39/32%) 6.8 (47/36%) 104.7 (29/40%) 29.7 (22/27%)

GC → CG 0.3 (10/10%) 0.03 (3/3%) 4.6 (11/14%) <0.2 (<1) 1.1 (7/6%) 0.2 (1/1%) 3.6 (1/1%) <1.4 (<1)

a b

Insertions 0.2 (5/5%) 0.1 (14/13%) 2.1 (5/6%) 2.4 (13/15%) 1.4 (10/8%) 1.3 (9/7%) 21.7 (6/8%) 22.0 (16/20%)

+1 0.1 (3/3%) 0.03 (3/3%) 1.3 (3/4%) 1.7 (9/10%) 1.3 (9/7%) 1.3 (9/7%) 21.7 (6/8%) 18.7 (14/17%)

≥

2 0.1 (2/2%) 0.1 (11/10%) 0.8 (2/3%) 0.7 (4/5%) 0.2 (1/1%) <0.1 (<1) <3.6 (<1) 2.2 (2/2%)

Deletions 0.7 (21/21%) 0.3 (34/31%) 3.3 (8/10%) 2.4 (13/15%) 1.6 (11/9%) 3.0 (20/16%) <3.6 (<1) 13.2 (10/12%)

−1 0.5 (14/14%) 0.1 (10/9%) 2.9 (7/9%) 2.0 (11/13%) 1.1 (7/6%) 1.7 (12/9%) <3.6 (<1) 12.1 (9/11%)

≥2 0.2 (7/7%) 0.2 (24/22%) 0.4 (1/1%) 0.4 (2/2%) 0.5 (4/3%) 1.1 (8/6%) <3.6 (<1) 1.1 (1/1%)

Complex 0.2 (5/5%) <0.1 (<1) 1.3 (3/4%) <0.2 (<1) <0.1 (<1) <0.2 (<1) 3.6 (1/1%) <1.3 (<1)

Total 3.3 (102/100%) 0.93 (110/100%) 33.0 (79/100%) 16.0 (86/100%) 18.0 (122/100%) 19.0 (129/100%) 260.0 (72/100%) 110.0 (81/100%)

a R 7

Rates [Can /10 cells] for particular types of mutations were calculated as described previously (for reference see Supplementary data S2.2). p values are presented in

Supplementary data S2.2;

Number and percentage of events for speciﬁc classes of mutations are shown in brackets.

Complex mutations are deﬁned as multiple changes within short DNA stretches (up to 6 nt).

Table 5C

Relative mutation rates of particular types of mutations in diverse rev3 yeast strains.

Type of mutations/strain rev3 dpb2-100 rev3 pol2-4 rev3 dpb2-100 pol2-4 rev3

Base substitutions 1.0 22 30 150

Transitions 1.0 14 12 38

AT → GC 1.0 28 15 99

GC → AT 1.0 10 10 18

Transversions 1.0 27 50 297

→

AT CG 1.0 70 40 990

AT → TA 1.0 20 250 2090

GC → TA 1.0 45 68 297

Indels 1.0 12 10 88

Insertions 1.0 24 13 220

+1 1.0 56 43 623

Deletions 1.0 8 10 44

−1 1.0 20 17 121

Total 1.0 18 21 122

Relative mutation rate is the rate in a given strain divided by the corresponding rate in the POL2 DPB2 rev3 strain. GC → CG mutations were excluded from the analysis

due to very low rate in the dpb2-100 rev3 strain.

−7

and 1.7 10 , Table 5B). To visualize better the synergy between Dpb2-100p with Psf1p or Psf3p is signiﬁcantly reduced compared

the dpb2-100 and pol2-4 alleles we present calculations of the rel- to the wild-type Dpb2p.

ative mutation rates in the rev3 background in Table 5C. For the Previously, we showed that the wild-type and mutant form of

dpb2-100 rev3, pol2-4 rev3 and dpb2-100 pol2-4 rev3 strains the Dpb2 fusion proteins used in two hybrid assay were expressed

they are 18, 21 and 122 times higher than in rev3. at similar levels in S. cerevisiae cells [47].

3.5. Two-hybrid analysis of protein–protein interactions between

Dpb2p and the GINS complex

Table 6

Protein–protein interactions between Dpb2p/Dpb2-100p and GINS subunits.

Genetic, two-hybrid analyses and in vitro functional complexes

␤

analysis have suggested that the physical interaction between the Two-hybrid plasmids (GAL4 fusion) -Galactosidase

activity (in vitro

CMG complex and DNA Pol ␧ holoenzyme is crucial for proper

assay)b

functioning of the replisome and is maintained through a contact

◦

AD BD 23 C

between the GINS subunits and Dpb2p [28,32,33,79].

DPB2 PSF1 65 (±34)

To test whether the mutated variant of Dpb2p affects the inter-

dpb2-100 PSF1 10 (±1)

action of Pol ␧ with Psf1p or Psf3p (the GINS subunits) we used the

DPB2 PSF3 37 (±17)

yeast two-hybrid system. The usefulness of this system for studying dpb2-100 PSF3 0.9 (±0.2)

protein-protein interactions within the GINS complex and between a

The Y190 strain was transformed with plasmids carrying DPB2 and the GINS

particular GINS subunits and Dpb2p was shown in the previous

subunits coding sequences. Interactions between Dpb2p or Dpb2-100p and the GINS

studies [28,33]. Results presented in Table 6 conﬁrmed the ear- subunits were determined using the lacZ genetic reporter. In vitro ␤-galactosidase

assay was performed as described by Rose et al. [59].

lier observation that Psf1 and Psf3 GINS fusion proteins are able

␤-Galactosidase-speciﬁc activities were calculated as nmols of o-nitrophenyl ␤-

to interact with Dpb2p. Subsequently, we measured the relative

galactoside (ONPG) hydrolyzed per min. per mg of protein. The values given present

strength of the protein-protein interactions using the Dpb2-100

averages of 5 yeast transformants; (±) – standard deviations are given in parenthe-

and Psf1 or Psf3 fusion proteins. Data presented in Table 6 indi- ses.

◦

cate that at the permissive temperature (23 C) the interaction of AD, Gal4p transcriptional activation domain; BD, Gal4p DNA-binding domain.

32 M. Garbacz et al. / DNA Repair 29 (2015) 23–35

Table 7

Mutation rates in the dpb2-100 and dpb2-100 pol3-5DV strains.

R −7 a + −8 a

Yeast strain Can (×10 ) Relative rate Trp (×10 ) Relative rate

DPB2 POL3 5.8 (4.6–7.1) 1 2.1 (1.7–2.5) 1

dpb2-100 POL3 34.9 (31.2–46.1) 6.0 15.8 (11.8–18.7) 7.5

DPB2 pol3-5DV 33.5 (26.2–63.0) 5.8 11.0 (7–15.7) 5.2

dpb2-100 pol3-5DV 112.0 (110.0–157.3) 19.3 48.5 (41.5–58.0) 23.3

Relative rate is the rate in a given strain divided by the corresponding rate in the DPB2 POL3 strain; 95% conﬁdence intervals are shown in parentheses.

Statistically signiﬁcant effect is observed for all comparisons, p < 0.003 (p values were calculated using non-parametric Mann–Whitney-U test).

3.6. Mutator effects of dpb2-100 in strains defective in Pol Analysis of the Pol ␧ complex puriﬁed from strains carrying

proofreading the dpb2-100 mutant allele showed an altered stoichiometry com-

paring to the wild type holoenzyme. Interestingly, the impaired

␧

As the interaction between CMG (GINS) complex with Pol is Pol Dpb2-100p complex had normal in vitro polymerase activity,

maintained through Dpb2 subunit, the mutations that disturb this processivity and exonuclease activity. These data are consistent

connection in dpb2-100 strain may inﬂuence the functioning of Pol with earlier results from yeast and H. sapiens cells, where puri-

␧

on the leading strand. Although, it is generally considered that ﬁed Pol2/Dpb3/Dpb4 complexes devoid of Dpb2p had biochemical

␧ ␦

Pol and Pol act on separate strands there were studies suggest- properties indistinguishable from those of the wild-type Pol ␧

ing that exonucleases of both Pol ␧ and Pol ␦ can act to the same [49,86].

pool of replication errors [77,80]. To investigate the putative inter- In the in vitro gap-ﬁlling assay, when an imbalanced pool of

␦

␧

play between the impaired proofreading activity of Pol and the dNTPs was used, the Pol Dpb2-100p variant committed about 2 times

Dpb2-100p defect, we constructed a double mutant dpb2-100 pol3- as many errors as did the wild type Pol ␧. While statistically signif-

5DV. In newer literature the pol3-5DV allele [81] is often referred icant, the mechanism underlying this small reduction of in vitro

→

to as pol3-D520V, because it leads to D520 V amino acid change Pol ␧ ﬁdelity may be insufﬁcient to explain the observed strong

→

[82] which inactivates the intrinsic 3 5 exonuclease activity of increase (∼16-fold) in mutation rate in vivo in the dpb2-100 rev3

␦ ␦

Pol3p (catalytic subunit of Pol ) and thus Pol proofreading no strain. However, we cannot exclude that in the dpb2-100 strain the

longer contributes to error removal [83]. If the mutator activities impaired interactions of Pol ␧ with other replisome components,

of the dpb2-100 and pol3-5DV alleles are components of indepen- which are not present in the reaction in vitro, decrease the ﬁdelity

dent pathways, one should observe their simple additive effect. of replication in vivo.

Alternatively, if the two mutations affect two different mechanisms As the in vitro results did not explain the strong in vivo mutator

acting on the same pool of errors, the synergistic relationship of effect of the dpb2-100 allele, we decided to analyze the muta-

the mutation rates will be observed in the double mutant. Finally, tion spectrum in vivo. All types of mutations (base substitutions,

␦

if the dpb2-100 defect impairs the proofreading by Pol , the level indels and complex mutations) were markedly stimulated by the

of mutagenesis in the dpb2-100 pol3-5DV strain should be the same dpb2-100 defect. The analysis of the mutation rates conﬁrmed an

as in a strain carrying only the pol3-5DV allele. increased participation of the error-prone Pol ␨ in replication in

The dpb2-100 and pol3-5DV alleles showed the synergistic rela- the dpb2-100 mutant [50]. However, even in the absence of Pol ␨

tionship (Table 7). The relative rate of Can mutations in the activity (in rev3 strains) the presence of the dpb2-100 allele was

dpb2-100 strain was increased 6.0-fold as compared to the DPB2 strongly mutagenic, indicating that a signiﬁcant part of mutagene-

control strain. The pol3-5DV mutation alone increased the muta- sis is Pol ␨-independent.

tion rate 5.8-fold compared to the wild type. Interestingly, in the To observe directly the mutations committed by Pol ␧, we ana-

dpb2-100 pol3-5DV strain the mutation rate was enhanced about 20 lyzed the mutation spectra in strains lacking the proofreading

times comparing to that of the isogenic wild type strain (Table 7). activity of Pol ␧ (pol2-4) [77,78]. Both in the presence (REV3) and

The similar synergistic effect was observed for the Trp mutation in the absence (rev3) of Pol ␨ activity, a strong synergistic effect

rate (trp1-289 – nonsense mutation) (7.5, 5.2 and 23.3 in dpb2-100, was observed for the rate of Can mutations between the dpb2-100

pol3-5DV and dpb2-100 pol3-5DV mutants respectively, Table 7). and the pol2-4 defects. The comparison of the mutation speciﬁcity

These results strongly suggest a functional interaction between the and the relative error rates in the dpb2-100 rev3 and pol2-4 rev3

␧ ␦

mutant form of Dpb2 subunit of Pol and Pol . strains revealed that the strongest relative increase in mutagenesis

is observed for transversions. A strong synergistic mutator effect

observed for transversions in the triple mutant dpb2-100 pol2-4

4. Discussion rev3 as compared to pol2-4 rev3 and dpb2-100 rev3 suggests

that in the presence of the dpb2-100 allele the number of replication

␧

Dpb2p, an essential, non-catalytic subunit of Pol holoenzyme errors is enhanced. These results indicate that both the dpb2-100

seems to take part in diverse processes, because mutations in the and pol2-4 alleles inﬂuence the mechanisms which compete for the

DPB2 gene have various phenotypic effects, causing disturbances same replication errors.

in the DNA replication initiation, S-phase progression, increased The simplest explanation of the observed synergistic muta-

mutability, impaired interaction between the catalytic Pol2 subunit tor effect in the dpb2-100 pol2-4 rev3 strain is that Dpb2-100p

and Dpb2p or dumbbell cell morphology [18,47,84]. Interestingly, changes the ﬁdelity of Pol ␧. However, there are limited data show-

it was also reported that Dpb2p is important for the interaction ing the inﬂuence of the non-catalytic proteins of replisome on the

␧

between Pol and the GINS complex and therefore targeting Pol ﬁdelity of DNA polymerases [87–90].

␧

to the leading strand [28,32,33,79,85]. In this study we investi- The impaired interaction between Pol ␧ and CMG complex

gated the mechanism of the mutator effect of the dpb2-100 allele in the dpb2-100 strain may inﬂuence the ﬁdelity of the leading

and its impact on the interplay between yeast DNA polymerases strand by changing the functional interplay within the replisome.

and the ﬁdelity of DNA replication. Physiological in vivo data were From our data we cannot exclude that the increased number

␧

compared with in vitro characteristics of the Pol Dpb2-100p com- of errors observed in the dpb2-100 rev3 strain is the result of

plex. increased misinsertion rate or increased extension of errors by Pol

M. Garbacz et al. / DNA Repair 29 (2015) 23–35 33

␧. Interestingly, it was shown, in the Bacillus subtilis cells, that the polymerase [25]. Of course, the relationship between DNA poly-

ﬁdelity of DnaE polymerase is improved by primase and helicase merases and their proofreading is complex and the impact of other

via allosteric effects induced by direct protein–protein interactions processes affecting the ﬁdelity of replication must be considered as

that lower the efﬁciency of nucleotide mis-incroporation and/or well [103,104].

the efﬁciency of extension of mispairs [91]. Someone may speculate that the increased participation of Pol

␦

It is worth noting that signiﬁcant differences in error rates were on the leading strand may be responsible for the mutator phe-

observed when the pol2-4 msh6 mutational spectra in vivo were notype of the dpb2-100 rev3 if the ﬁdelity of Pol ␦ and Pol ␧ is

compared with the exonuclease deﬁcient Pol ␧ in vitro. Therefore, not equal. Several data indeed suggest that the error rate of Pol ␦ is

it has been proposed that errors occurring during DNA synthesis by higher than Pol ␧ [78,105–107]. Therefore, the increased participa-

Pol ␧ in vivo may be prevented by an additional accessory protein tion of Pol ␦ on the leading strand may cause spontaneous mutator

[63]. phenotype.

Since the proofreading by Pol ␧ itself is not compromised in the How the Dpb2-100 mutant protein inﬂuences the ﬁdelity of

mutated variant of Dpb2p, as evident from our in vitro data, it is DNA replication still has to be investigated. We believe that the

possible that other mechanisms responsible for increased errors dpb2-100 mutant is an excellent tool to investigate participation of

extension or impaired errors removal (e.g. proofreading activity particular DNA polymerases on the leading strand and its functional

of Pol ␦) do not operate sufﬁciently in the dpb2-100 strain (dis- relationship with other proteins of the replisome.

cussed below). Impairment of proofreading should result mainly in

the increase of transversions because it was shown that proofread-

Conﬂict of interest

ing corrects transversions more efﬁciently than transitions [63,92].

Additionally, Schaaper [93] has shown in the E. coli system that the

The authors have no conﬂict of interest.

correction efﬁciency by proofreading varies also among transver-

sions (the correction efﬁciency of AT → TA, AT → CG, GC → TA and

Acknowledgement

GC → CG errors is 1540-, 290-, 140- and 60-fold, respectively).

Interestingly, similar pattern of transversions was observed in the

The authors thank Katarzyna Bebenek, (NIEHS, NC, USA), Ewa

dpb2-100 rev3 and in dpb2-100 pol2-4 rev3 strain (Table 5C).

Sledziewska-Gojska and Zygmunt Ciesla (IBB PAS, Poland) for crit-

In vitro studies [79,85] showed that the interaction of Pol ␧

ical reading of the manuscript and helpful discussions. We are

with the CMG complex (Cdc45, Mcm2-7, GINS) is important for

also grateful to Polina Shcherbakova, Youri Pavlov (University of

delivering of Pol ␧ to the leading strand. The authors proposed

Nebraska, Omaha, USA) and Dmitry Gordenin (NIEHS, NC, USA)

that through this interaction CMG selects Pol ␧ over Pol ␦ for the

for providing S. cerevisiae strains, Joanna Kraszewska for construc-

leading strand replication. The authors suggest that the interac-

tion of rad30 strains, Aleksandra Michalska for excellent technical

tion of Dpb2p, the non-catalytic subunit of Pol ␧ with Psf1p may

assistance and Scott Lujan for help in statistical analysis (NIEHS, NC,

be responsible for selective delivery of Pol ␧ to the leading strand.

USA).

Recently, we showed that Dpb2p not only interacts with the Psf1p

This work was supported by the Ministry of Science and Higher

but also with the Psf3 subunit [33]. Our two-hybrid analysis shows

Education, Poland [N N301 333439]; Foundation for Polish Science

that mutation in the Dpb2 subunit signiﬁcantly impairs interaction

co ﬁnanced from European Union – Regional Development Fund

with both Psf1 and Psf3 subunits of the GINS complex. Therefore,

[TEAM/2011-8/1] (“New players involved in the maintenance of

we hypothesize that in the dpb2-100 strain, when the interaction

genomic stability”); and NIG Collaborative Research [2009-A, 2011-

between Pol ␧ and GINS is weakened, the access of Pol ␨ and Pol ␦

A72, 2012-A9].

to the leading strand may be increased. The increased participation

of Pol ␦ on the leading strand in the dpb2-100 mutant may explain

the synergistic mutator effect observed in the dpb2-100 pol3-5DV Appendix A. Supplementary data

double mutant. The issue whether Pol ␦ can proofread errors made

␧ ␨

by Pol and/or by Pol in the dpb2-100 strains needs to be further Supplementary data associated with this article can be

investigated. found, in the online version, at http://dx.doi.org/10.1016/j.dnarep.

For many years, the contribution of individual polymerases 2015.02.007.

(Pol ␧ and Pol ␦) to the replication of the leading and lagging

DNA strands has remained controversial. Numerous data sug- References

gested that each polymerase replicates only one DNA strand

[4,7,77,81,83,92,94–98], but results indicating that the replica- [1] U. Hübscher, DNA replication fork proteins, Methods Mol. Biol. 521 (2009)

19–33.

tive polymerases can substitute for each other and participate

[2] T.A. Kunkel, Balancing eukaryotic replication asymmetry with replication

in the replication of both DNA strands were also presented

ﬁdelity, Curr. Opin. Chem. Biol. 5 (2011) 620–626.

[12,77,98–100]. [3] J. Syvaoja, S. Suomensaari, C. Nishida, J.S. Goldsmith, G.S. Chui, S. Jain, S. Linn,

Both the pol2-4 and pol3-01 mutations, inactivating the proof- DNA polymerases alpha, delta, and epsilon: three distinct enzymes from HeLa

cells, Proc. Natl. Acad. Sci. U.S.A. 87 (1990) 6664–6668.

reading activity of Pol ␧ and Pol ␦, respectively, show a mutator

[4] A. Morrison, H. Araki, A.B. Clark, R.K. Hamatake, A. Sugino, A third essential

effect [22,77,80]. Interestingly, a combination of the pol3-01 and

DNA polymerase in S. cerevisiae, Cell 62 (1990) 1143–1151.

pol2-4 alleles results in a synergistic increase of the mutation rate [5] T.A. Kunkel, P.M. Burgers, Dividing the workload at a eukaryotic replication

fork, Trends Cell Biol. 18 (2008) 521–527.

providing a most compelling argument in favor of a cooperation

[6] B. Stillman, DNA polymerases at the replication fork in eukaryotes, Mol. Cell

of these two polymerases in replication [77]. The observed syner-

30 (2008) 259–260.

→

gism suggests that the two 3 5 exonuclease activities compete [7] Z.F. Pursell, I. Isoz, E.B. Lundstrom, E. Johansson, T.A. Kunkel, Yeast DNA poly-

merase ␧ participates in leading-strand DNA replication, Science 317 (2007)

for replication errors committed by either polymerase. A strong

127–130.

argument for the ability of Pol ␦ to replace Pol ␧ is the fact that

[8] S.A. Nick McElhinny, D.A. Gordenin, C.M. Stith, P.M. Burgers, T.A. Kunkel, Divi-

in vitro replication of a plasmid with SV40 replication origin can sion of labor at the eukaryotic replication fork, Mol. Cell 30 (2008) 137–144.

[9] P.M. Burgers, Polymerase dynamics at the eukaryotic DNA replication fork, J.

proceed in the presence of Pol ␣ and Pol ␦ alone, without participa-

Biol. Chem. 284 (2009) 4041–4045.

tion of Pol ␧ [101]. Additionally, yeast mutants carrying deletion of

[10] I. Miyabe, T.A. Kunkel, A.M. Carr, The major roles of DNA polymerases epsilon

␧

the Pol catalytic domain display severe growth defects [102] but and delta at the eukaryotic replication fork are evolutionarily conserved, PLoS

Genet. 7 (2011) e1002407.

are not lethal, indicating that Pol ␧ can be replaced by another DNA

34 M. Garbacz et al. / DNA Repair 29 (2015) 23–35

[11] A.A. Larrea, S.A. Lujan, S.A. Nick McElhinny, P.A. Mieczkowski, M.A. Resnick, [39] M. Simon, L. Giot, G. Faye, The 3 to 5 exonuclease activity located in the DNA

D.A. Gordenin, T.A. Kunkel, Genome-wide model for the normal eukaryotic polymerase delta subunit of Saccharomyces cerevisiae is required for accurate

DNA replication fork, Proc. Natl. Acad. Sci. U.S.A. 107 (2010) 17674–17679. replication, EMBO J. 10 (1991) 2165–2170.

[12] Y.I. Pavlov, P.V. Shcherbakova, DNA polymerases at the eukaryotic fork-20 [40] M.R. Northam, P. Garg, D.M. Baitin, P.M. Burgers, P.V. Shcherbakova, A novel

years later, Mutat. Res. 685 (2010) 45–53. function of DNA polymerase zeta regulated by PCNA, EMBO J. 25 (2006)

[13] R.K. Hamatake, H. Hasegawa, A.B. Clark, K. Bebenek, T.A. Kunkel, A. Sug- 4316–4325.

ino, Puriﬁcation and characterization of DNA polymerase II from the yeast [41] J.R. Nelson, C.W. Lawrence, D.C. Hinkle, Thymine-thymine dimer bypass by

Saccharomyces cerevisiae. Identiﬁcation of the catalytic core and a possible yeast DNA polymerase zeta, Science 272 (1996) 1646–1649.

holoenzyme form of the enzyme, J. Biol. Chem. 265 (1990) 4072–4083. [42] R.E. Johnson, L. Prakash, S. Prakash, Pol31 and Pol32 subunits of yeast DNA

␦

[14] H. Araki, R.K. Hamatake, L.H. Johnston, A. Sugino, DPB2, the gene encod- polymerase are also essential subunits of DNA polymerase ␨, Proc. Natl.

ing DNA polymerase II subunit B, is required for chromosome replication in Acad. Sci. U.S.A. 109 (2012) 12455–12460.

Saccharomyces cerevisiae, Proc. Natl. Acad. Sci. U.S.A. 88 (1991) 4601–4605. [43] A.V. Makarova, J.L. Stodola, P.M. Burgers, A four-subunit DNA polymerase ␨

[15] A. Sugino, Yeast DNA polymerases and their role at the replication fork, Trends complex containing Pol ␦ accessory subunits is essential for PCNA-mediated

Biochem. Sci. 203 (1995) 319–323. mutagenesis, Nucleic Acids Res. 40 (2012) 11618–11626.

[16] T. Ohya, S. Maki, Y. Kawasaki, A. Sugino, Structure and function of the fourth [44] S. Prakash, R.E. Johnson, L. Prakash, Eukaryotic translesion synthesis DNA

␧

subunit (Dpb4p) of DNA polymerase in Saccharomyces cerevisiae, Nucleic polymerases: speciﬁcity of structure and function, Annu. Rev. Biochem. 74

Acids Res. 28 (2000) 3846–3852. (2005) 317–353.

[17] H. Pospiech, J.E. Syvaoja, DNA polymerase epsilon – more than a polymerase, [45] A.G. Baranovskiy, A.G. Lada, H.M. Siebler, Y. Zhang, Y. Pavlov, T.H. Tahirov, DNA

Sci. World J. 3 (2003) 87–104. polymerase ␦ and ␨ switch by sharing accessory subunits of DNA polymerase

␦

[18] O. Chilkova, B.H. Jonsson, E. Johansson, The quaternary structure of DNA , J. Biol. Chem. 287 (2012) 17281–17287.

polymerase ␧ from Saccharomyces cerevisiae, J. Biol. Chem. 278 (2003) [46] M.R. Northam, H.A. Robinson, O.V. Kochenova, P.V. Shcherbakova, Participa-

14082–14086. tion of DNA polymerase ␨ in replication of undamaged DNA in Saccharomyces

[19] M. Hogg, E. Johansson, DNA polymerase ␧, in: S. McNeill (Ed.), The eukaryotic cerevisiae, Genetics 184 (2010) 27–42.

replisome: a guide to protein structure and function, Subcellular biochemistry [47] M. Jaszczur, K. Flis, J. Rudzka, J. Kraszewska, M.E. Budd, P. Polaczek, J.L.

62 (2012) 237–257 (Springer). Campbell, P. Jonczyk, I.J. Fijalkowska, Dpb2p, a noncatalytic subunit of DNA

[20] E.E. Henninger, Z.F. Pursell, DNA polymerase ␧ and its roles in genome stabil- polymerase epsilon, contributes to the ﬁdelity of DNA replication in Saccha-

ity, IUBMB Life 66 (2014) 339–351. romyces cerevisiae, Genetics 178 (2008) 633–647.

[21] A. Morrison, A. Sugino, DNA polymerase II, the epsilon polymerase of [48] M. Jaszczur, J. Rudzka, J. Kraszewska, K. Flis, P. Polaczek, J.L. Campbell, I.J.

Saccharomyces cerevisiae, Prog. Nucleic Acid Res. Mol. Biol. 46 (1993) Fijalkowska, P. Jonczyk, Defective interaction between Pol2p and Dpb2p, sub-

93–120. units of DNA polymerase epsilon, contributes to a mutator phenotype in

[22] A. Morrison, J.B. Bell, T.A. Kunkel, A. Sugino, Eukaryotic DNA polymerase Saccharomyces cerevisiae, Mutat. Res. 669 (2009) 27–35.

amino acid sequence required for 3 –5 exonuclease activity, Proc. Natl. Acad. [49] I. Isoz, U. Persson, K. Volkov, E. Johansson, The C-terminus of Dpb2 is required

Sci. U.S.A. 88 (1991) 9473–9477. for interaction with Pol2 and for cell viability, Nucleic Acids Res. 40 (2012)

[23] R. Dua, D.L. Levy, J.L. Campbell, Role of the putative zinc ﬁnger domain of 11545–11553.

Saccharomyces cerevisiae DNA polymerase ␧ in DNA replication and the S/M [50] J. Kraszewska, M. Garbacz, P. Jonczyk, I.J. Fijalkowska, M. Jaszczur, Defect of

checkpoint pathway, J. Biol. Chem. 273 (1998) 30046–30055. Dpb2p, a noncatalytic subunit of DNA polymerase ␧, promotes error prone

[24] R. Dua, D.L. Levy, J.L. Campbell, Analysis of the essential functions of the C- replication of undamaged chromosomal DNA in Saccharomyces cerevisiae,

terminal protein/protein interaction domain of Saccharomyces cerevisiae pol Mutat. Res. 737 (2012) 34–42.

␧ and its unexpected ability to support growth in the absence of the DNA [51] A. Adams, D.E. Gottschling, C.A. Kaiser, T. Stearns, Methods in Yeast Genetics: A

polymerase domain, J. Biol. Chem. 274 (1999) 22283–22288. Cold Spring Harbor Laboratory Course Manual, Cold Spring Harbor Laboratory

[25] T. Kesti, K. Flick, S. Keranen, J.E. Syvaoja, C. Wittenberg, DNA polymerase ␧ Press, Cold Spring Harbor, NY, 1997.

catalytic domains are dispensable for DNA replication, DNA repair, and cell [52] J. Sambrook, E.F. Fritsch, T. Maniatis, Molecular Cloning: A Laboratory Manual,

viability, Mol. Cell 3 (1999) 679–685. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989.

[26] W. Feng, G. D’Urso, Schizosaccharomyces pombe cells lacking the amino- [53] R.S. Sikorski, P. Hieter, A system of shuttle vectors and yeast host strains

terminal catalytic domains of DNA polymerase epsilon are viable but designed for efﬁcient manipulation of DNA in Saccharomyces cerevisiae,

require the DNA damage checkpoint, Mol. Cell. Biol. 21 (2001) 4495– Genetics 122 (1989) 19–27.

4504. [54] T. Tsubota, R. Tajima, K. Ode, H. Kubota, N. Fukuhara, T. Kawabata, S. Maki,

[27] H. Araki, S.H. Leem, A. Phongdara, A. Sugino, Dpb11, which interacts with H. Maki, Double-stranded DNA binding, an unusual property of DNA poly-

DNA polymerase II (␧) in Saccharomyces cerevisiae, has a dual role in S-phase merase epsilon, promotes epigenetic silencing in Saccharomyces cerevisiae, J.

progression and at a cell cycle checkpoint, Proc. Natl. Acad. Sci U.S.A. 92 (1995) Biol. Chem. 281 (2006) 32898–32908.

11791–11795. [55] K. Bebenek, T.A. Kunkel, Analyzing ﬁdelity of DNA polymerases, Methods

[28] Y. Takayama, Y. Kamimura, M. Okawa, S. Muramatsu, A. Sugino, H. Araki, GINS, Enzymol. 262 (1995) 217–232.

a novel multiprotein complex required for chromosomal DNA replication in [56] J.W. Drake, A constant rate of spontaneous mutation in DNA-based microbes,

budding yeast, Genes Dev. 17 (2003) 1153–1165. Proc. Natl. Acad. Sci. U.S.A. 88 (1991) 7160–7164.

[29] S. Muramatsu, K. Hirai, Y.S. Tak, Y. Kamimura, H. Araki, CDK-dependent com- [57] S. Fields, O. Song, A novel genetic system to detect protein–protein interac-

plex formation between replication proteins Dpb11, Sld2, Pol ␧, and GINS in tions, Nature 340 (1989) 245–246.

budding yeast, Genes Dev. 24 (2010) 602–612. [58] J.W. Harper, G.R. Adami, N. Wei, K. Keyomarsi, S.J. Elledge, The p21 Cdk-

[30] H. Araki, Cyclin-dependent kinase-dependent initiation of chromosomal DNA interacting protein Cip1 is a potent inhibitor of G1 cyclin-dependent kinases,

replication, Curr. Opin. Cell Biol. 22 (2010) 766–771. Cell 75 (1993) 805–813.

[31] S. Tanaka, H. Araki, Helicase activation and establishment of replication forks [59] M. Rose, F. Winston, P. Hieter, Methods in Yeast Genetics: A Cold Spring

at chromosomal origins of replication, Cold Spring Harb. Perspect. Biol. 5 Harbor Laboratory Course, Cold Spring Harbor Laboratory Press, Cold Spring

(2013) a010371. Harbor, NY, 1990.

[32] S. Sengupta, F. van Deursen, G. de Piccoli, K. Labib, Dpb2 integrates the leading- [60] P.M. Burgers, Saccharomyces cerevisiae replication factor C. II. Formation and

strand DNA polymerase into the eukaryotic replisome, Curr. Biol. 23 (2013) activity of complexes with the proliferating cell nuclear antigen and with DNA

543–552. polymerases delta and epsilon, J. Biol. Chem. 266 (1991) 22698–22706.

[33] E. Grabowska, U. Wronska, M. Denkiewicz, M. Jaszczur, A. Respondek, M. [61] S.H. Lee, Z.Q. Pan, A.D. Kwong, P.M. Burgers, J. Hurwitz, Synthesis of DNA by

Alabrudzinska, C. Suski, K. Makiela-Dzbenska, P. Jonczyk, I.J. Fijalkowska, DNA polymerase ␧ in vitro, J. Biol. Chem. 266 (1991) 22707–22717.

Proper functioning of the GINS complex is important for the ﬁdelity of DNA [62] O. Chilkova, P. Stenlund, I. Isoz, C.M. Stith, P. Grabowski, E.B. Lundstrom,

replication in yeast, Mol. Microbiol. 92 (2014) 659–680. P.M. Burgers, E. Johansson, The eukaryotic leading and lagging strand DNA

[34] H. Araki, R.K. Hamatake, A. Morrison, A.L. Johnson, L.H. Johnston, A. Sugino, polymerases are loaded onto primer ends via separate mechanisms but have

Cloning DPB3, the gene encoding the third subunit of DNA polymerase II of comparable processivity in the presence of PCNA, Nucleic Acids Res. 35 (2007)

Saccharomyces cerevisiae, Nucleic Acids Res. 19 (1991) 4867–4872. 6588–6597.

[35] T. Tsubota, S. Maki, H. Kubota, A. Sugino, H. Maki, Double-stranded DNA [63] P.V. Shcherbakova, Y.I. Pavlov, O. Chilkova, I.B. Rogozin, E. Johansson, T.A.

binding properties of Saccharomyces cerevisiae DNA polymerase ␧ and of the Kunkel, Unique error signature of the four-subunit yeast DNA polymerase ␧,

Dpb3p-Dpb4p subassembly, Genes Cells 8 (2003) 873–888. J. Biol. Chem. 278 (2003) 43770–43780.

[36] F.J. Asturias, I.K. Cheung, N. Sabouri, O. Chilkova, D. Wepplo, E. Johansson, [64] J.D. Roberts, D.C. Thomas, T.A. Kunkel, Exonucleolytic proofreading of leading

Structure of Saccharomyces cerevisiae DNA polymerase epsilon by cryo- and lagging strand DNA replication errors, Proc. Nat. Acad. Sci. U.S.A. 88 (1991)

electron microscopy, Nat. Struct. Mol. Biol. 13 (2006) 35–43. 3465–3469.

[37] A. Aksenova, K. Volkov, J. Maceluch, Z.F. Pursell, I.B. Rogozin, T.A. Kunkel, Y.I. [65] S.A. Nick McElhinny, D. Kumar, A.B. Clark, D.L. Watt, B.E. Watts, E.B. Lund-

Pavlov, E. Johansson, Mismatch repair-independent increase in spontaneous strom, E. Johansson, A. Chabes, T.A. Kunkel, Genome instability due to

mutagenesis in yeast lacking non-essential subunits of DNA polymerase ␧, ribonucleotide incorporation into DNA, Nat. Chem. Biol. 6 (2010) 774–781.

PLoS Genet. 6 (2010) e1001209. [66] S.A. Nick McElhinny, B.E. Watts, D. Kumar, D.L. Watt, E.B. Lundstrom, P.M.

[38] K.J. Gerik, X. Li, A. Pautz, P.M. Burgers, Characterization of the two small sub- Burgers, E. Johansson, A. Chabes, T.A. Kunkel, Abundant ribonucleotide incor-

units of Saccharomyces cerevisiae DNA polymerase ␦, J. Biol. Chem. 273 (1998) poration into DNA by yeast replicative polymerases, Proc. Natl. Acad. Sci.

19747–19755. U.S.A. 107 (2010) 4949–4954.

M. Garbacz et al. / DNA Repair 29 (2015) 23–35 35

[67] D.L. Watt, E. Johansson, P.M. Burgers, T.A. Kunkel, Replication of [87] T.A. Kunkel, S.S. Patel, K.A. Johnson, Error-prone replication of repeated DNA

ribonucleotide-containing DNA templates by yeast replicative polymerases, sequences by T7 DNA polymerase in the absence of its processivity subunit,

DNA Repair (Amst.) 10 (2011) 897–902. Proc. Natl. Acad. Sci. U.S.A. 91 (1994) 6830–6834.

[68] A.Y. Göksenin, W. Zahurancik, K.G. LeCompte, D.J. Taggart, Z. Suo, Z.F. Pursell, [88] L.C. Kroutil, M.W. Frey, B.F. Kaboord, T.A. Kunkel, S.J. Benkovic, Effect of

␧

Human DNA polymerase is able to efﬁciently extend from multiple consec- accessory proteins on T4 DNA replication ﬁdelity, J. Mol. Biol. 278 (1998)

utive ribonucleotides, J. Biol. Chem. 287 (2012) 42675–42684. 135–146.

[69] C. Cassier, R. Chanet, J.A. Henriques, E. Moustacchi, The effects of three PSO [89] M.J. Longley, D. Nguyen, T.A. Kunkel, W.C. Copeland, The ﬁdelity of human

genes on induced mutagenesis: a novel class of mutationally defective yeast, DNA polymerase gamma with and without exonucleolytic proofreading and

Genetics 96 (1980) 841–857. the p55 accessory subunit, J. Biol. Chem. 276 (2001) 38555–38562.

[70] S.K. Quah, R.C. von Borstel, P.J. Hastings, The origin of spontaneous mutation [90] A. Bebenek, G.T. Carver, H.K. Dressman, F.A. Kadyrov, J.K. Haseman, V. Petrov,

in Saccharomyces cerevisiae, Genetics 96 (1980) 819–839. W.H. Konigsberg, J.D. Karam, J.W. Drake, Dissecting the ﬁdelity of bac-

[71] H. Roche, R.D. Gietz, B.A. Kunz, Specificity of the yeast rev3 antimutator and teriophage RB69 DNA polymerase: site specific modulation of fidelity by

REV3 dependency of the mutator resulting from a defect (rad1 ) in nucleotide polymerase accessory proteins, Genetics 162 (2002) 10003–10018.

excision repair, Genetics 137 (1994) 637–646. [91] O. Rannou, E. Le Chatelier, M.A. Larson, H. Nouri, B. Dalmais, C. Laughton,

[72] C.W. Lawrence, Cellular roles of DNA polymerase zeta and Rev1 protein, DNA L. Jannière, P. Soultanas, Functional interplay of DnaE polymerase, DnaG pri-

Repair 1 (2002) 425–435. mase and DnaC helicase within a ternary complex, and primase to polymerase

[73] S. Sabbioneda, B.K. Minesinger, M. Giannattasio, P. Plevani, M. Muzi-Falconi, hand-off during lagging strand DNA replication in Bacillus subtilis, Nucleic

S. Jinks-Robertson, The 9-1-1 checkpoint clamp physically interacts with pol Acids Res. 41 (2013) 5303–5320.

zeta and is partially required for spontaneous pol zeta-dependent mutagen- [92] R. Karthikeyan, E.J. Vonarx, A.F. Straffon, M. Simon, G. Faye, B.A. Kunz, Evidence

esis in Saccharomyces cerevisiae, J. Biol. Chem. 280 (2005) 38657–38665. from mutational speciﬁcity studies that yeast DNA polymerases delta and

[74] X. Zhong, P. Garg, C.M. Stith, S.A. Nick McElhinny, G.E. Kissling, P.M. Burgers, epsilon replicate different DNA strands at an intracellular replication fork, J.

T.A. Kunkel, The ﬁdelity of DNA synthesis by yeast DNA polymerase zeta alone Mol. Biol. 299 (2000) 405–419.

and with accessory proteins, Nucleic Acids Res. 34 (2006) 4731–4742. [93] R.M. Schaaper, Base selection, proofreading, and mismatch repair during DNA

[75] K. Endo, Y. Tago, Y. Daigaku, K. Yamamoto, Error-free RAD52 pathway and replication in Escherichia coli, J. Biol. Chem. 268 (1993) 23762–23765.

error-prone REV3 pathway determines spontaneous mutagenesis in Saccha- [94] P.V. Shcherbakova, Y.I. Pavlov, 3 → 5 exonucleases of DNA polymerases

romyces cerevisiae, Genes Genet. Syst. 82 (2007) 35–42. epsilon and delta correct base analog induced DNA replication errors on oppo-

[76] A.L. Abdulovic, B.K. Minesinger, S. Jinks-Robertson, The effect of sequence site DNA strands in Saccharomyces cerevisiae, Genetics 142 (1996) 717–726.

context on spontaneous Pol zeta-dependent mutagenesis in Saccharomyces [95] T. Fukui, K. Yamauchi, T. Muroya, M. Akiyama, H. Maki, A. Sugino, S. Waga,

cerevisiae, Nucleic Acids Res. 36 (2008) 2082–2093. Distinct roles of DNA polymerases delta and epsilon at the replication fork in

→

[77] A. Morrison, A. Sugino, The 3 5 exonucleases of both DNA polymerases Xenopus egg extracts, Genes Cells 9 (2004) 179–191.

␦ ␧

and participate in correcting errors of DNA replication in Saccharomyces [96] P. Garg, C.M. Stith, N. Sabouri, E. Johansson, P.M. Burgers, Idling by DNA

cerevisiae, Mol. Gen. Genet. 242 (1994) 289–296. polymerase delta maintains a ligatable nick during lagging-strand DNA repli-

[78] K. Shimizu, K. Hashimoto, J.M. Kirchner, W. Nakai, H. Nishikawa, M.A. Resnick, cation, Genes Dev. 18 (2004) 2764–2773.

A. Sugino, Fidelity of DNA polymerase epsilon holoenzyme from budding [97] S. Hiraga, A. Hagihara-Hayashi, T. Ohya, A. Sugino, DNA polymerases alpha,

yeast Saccharomyces cerevisiae, J. Biol. Chem. 277 (2002) 37422–37429. delta, and epsilon localize and function together at replication forks in Sac-

[79] L.D. Langston, D. Zhang, O. Yurieva, R.E. Georgescu, J. Finkelstein, N.Y. Yao, charomyces cerevisiae, Genes Cells 10 (2005) 297–309.

C. Indiani, M.E. O’Donnell, CMG helicase and DNA polymerase ␧ form a func- [98] Y.I. Pavlov, C. Frahm, S.A. McElhinny, A. Niimi, M. Suzuki, T.A. Kunkel, Evidence

tional 15-subunit holoenzyme for eukaryotic leading-strand DNA replication, that errors made by DNA polymerase ␣ are corrected by DNA polymerase ␦,

Proc. Natl. Acad. Sci. U.S.A. 111 (2014) 15390–15395. Curr. Biol. 16 (2006) 202–207.

[80] A. Morrison, A.L. Johnson, L.H. Johnston, A. Sugino, Pathway correcting [99] P. Garg, P.M. Burgers, DNA polymerases that propagate the eukaryotic DNA

DNA replication errors in Saccharomyces cerevisiae, EMBO J. 12 (1993) replication fork, Crit. Rev. Biochem. Mol. Biol. 40 (2005) 115–128.

1467–1473. [100] A. Johnson, M. O’Donnell, Cellular DNA replicases: components and dynamics

[81] Y.H. Jin, R. Obert, P.M. Burgers, T.A. Kunkel, M.A. Resnick, D.A. Gordenin, The at the replication fork, Annu. Rev. Biochem. 74 (2005) 283–315.

→

3 5 exonuclease of DNA polymerase delta can substitute for the 5 ﬂap [101] S. Waga, B. Stillman, Anatomy of a DNA replication fork revealed by reconsti-

endonuclease Rad27/Fen1 in processing Okazaki fragments and preventing tution of SV40 DNA replication in vitro, Nature 369 (1994) 207–212.

genome instability, Proc. Natl. Acad. Sci. U.S.A. 98 (2001) 5122–5127. [102] T. Ohya, Y. Kawasaki, S. Hiraga, S. Kanbara, K. Nakajo, N. Nakashima, A. Suzuki,

[82] C.M. Stith, J. Sterling, M.A. Resnick, D.A. Gordenin, P.M. Burgers, Flexibility of A. Sugino, The DNA polymerase domain of pol(epsilon) is required for rapid,

eukaryotic Okazaki fragment maturation through regulated strand displace- efﬁcient, and highly accurate chromosomal DNA replication, telomere length

ment synthesis, J. Biol. Chem. 283 (2008) 34129–34140. maintenance, and normal cell senescence in Saccharomyces cerevisiae, J. Biol.

[83] Y.H. Jin, P. Garg, C.M. Stith, Y.H. Al-Jin, P. Garg, C.M. Stith, H. Al-Refai, L.J. Chem. 277 (2002) 28099–28108.

SterlingJ.F. Murray, T.A. Kunkel, M.A. Resnick, P.M. Burgers, D.A. Gordenin, [103] T.M. Albertson, B.D. Preston, DNA replication ﬁdelity: proofreading in trans,

The multiple biological roles of the 3 –5 exonuclease of Saccharomyces cere- Curr. Biol. 16 (2006) R209–R211.

visiae DNA polymerase delta require switching between the polymerase and [104] L.J. Reha-Krantz, DNA polymerase proofreading: multiple roles maintain

exonuclease domains, Mol. Cell. Biol. 25 (2005) 461–471. genome stability, Biochim. Biophys. Acta 1804 (2010) 1049–1063.

[84] H. Araki, P.A. Ropp, A.L. Johnson, L.H. Johnston, A. Morrison, A. Sugino, DNA [105] K. Hashimoto, K. Shimizu, N. Nakashima, A. Sugino, Fidelity of DNA poly-

polymerase II, the probable homolog of mammalian DNA polymerase ␧, repli- merase delta holoenzyme from Saccharomyces cerevisiae: the sliding clamp

cates chromosomal DNA in the yeast Saccharomyces cerevisiae, EMBO J. 11 proliferating cell nuclear antigen decreases its ﬁdelity, Biochemistry 42

(1992) 733–740. (2003) 14207–14213.

[85] R.E. Georgescu, L. Langston, N.Y. Yao, O. Yurieva, D. Zhang, J. Finkelstein, T. [106] J.M. Fortune, Y.I. Pavlov, C.M. Welch, E. Johansson, P.M. Burgers, T.A. Kunkel,

Agarwal, M.E. O’Donnell, Mechanism of asymmetric polymerase assembly at Saccharomyces cerevisiae DNA polymerase delta: high ﬁdelity for base

the eukaryotic replication fork, Nat. Struct. Mol. Biol. 21 (2014) 664–670. substitutions but lower ﬁdelity for single- and multi-base deletions, J. Biol.

[86] V.P. Bermudez, A. Farina, V. Raghavan, I. Tappin, J. Hurwitz, Studies on human Chem. 280 (2005) 29980–29987.

DNA polymerase epsilon and GINS complex and their role in DNA replication, [107] M. Garcia-Diaz, T.A. Kunkel, Mechanism of a genetic glissando: structural

J. Biol. Chem. 286 (2011) 28963–28977. biology of indel mutations, Trends Biochem, Sci. 31 (2006) 206–214.