E78 Dove Tree, Davidia Involucrata Baill . (Cornaceae), Which Is

American Journal of Botany: e78–e80. 2012.

AJB PRIMER NOTES & PROTOCOLS IN THE PLANT SCIENCES

M ICROSATELLITE PRIMERS IN THE CHINESE DOVE TREE, D AVIDIA INVOLUCRATA (CORNACEAE), A RELIC SPECIES OF THE TERTIARY 1

Z UOZHOU L I 2,5 , C HUANHUA W ANG 3 , Y ANHONG L IU 4 , AND J UNQING L I 4,5

2 Key Laboratory of Plant Germplasm Enhancement and Specialty Agriculture, Wuhan Botanical Garden, Chinese Academy of Sciences, Wuhan 430074, Hubei, People ’ s Republic of China; 3 College of Chemistry and Life Sciences, China Three Gorges University, Yi-Chang 443000, Hubei, People ’ s Republic of China; and 4 Key Laboratory for Silviculture and Conservation of the Ministry of Education, Beijing Forestry University, Beijing 100083, People ’ s Republic of China

• Premise of the study: The ﬁ rst microsatellite primers were developed for Davidia involucrata , an endangered relic species of the Tertiary in China, to further describe its genetic variability and population structure. • Methods and Results: Using the Fast Isolation by AFLP of Sequences Containing Repeats (FIASCO) protocol, 15 polymorphic microsatellite loci were isolated and characterized in 20 individuals from the germplasm collections of D. involucrata at the Hunan Forest Botanical Garden. High levels of polymorphism were revealed, with the total number of alleles per locus and the number of alleles per locus per individual ranging from two to 13 and from one to six, respectively. • Conclusions: The multibanded patterns of microsatellite loci obtained in the current study conﬁ rmed that D. involucrata might be a polyploid species. The primers will be useful for studies of genetic diversity and for guiding conservation strategies for D. involucrata.

Key words: Cornaceae; Davidia involucrata ; microsatellite markers; polyploidy.

Dove tree, Davidia involucrata Baill . (Cornaceae), which is human activities that destroyed natural forests. The species has endemic in western China, is not only one of the best known been placed in the highest class of protected plant species in relict species of the Tertiary, but also a famous ornamental plant China (Fu and Chin, 1992) and listed as Vulnerable (VU) in the with dove-shaped fl owers (Fu and Chin, 1992). Fossils from the IUCN Red List (http://www.iucnredlist.org/). An appropriate Paleocene of North America indicate that the genus Davidia conservation program is urgently needed to prevent further loss Baill. was more widespread in the past (Manchester, 2003). of D. involucrata. Although genetic characterization of germ- Davidia involucrata is only one relict species in the genus plasm resources is essential for the effi cient conservation and Davidia ; other species within the genus went extinct during the ice utilization of the species, little is known about the genetic diver- ages of the Quaternary. This species survived only in the sub- sity and population structure of either wild or cultivated D. in- tropical mountains of southwestern China because of the topo- volucrata. Because of their codominant and hypervariable graphical complexity and weak impact of the glaciers (Wu et al., nature, microsatellite markers have been proven to be highly 2004). After the ice ages, D. involucrata populations spread effi cient molecular tools. Here, we describe the characterization slowly in mountains in southwestern China. Today, D. involu- of 15 polymorphic and two monomorphic microsatellite loci in crata is distributed in more than 40 counties in Gansu, Shanxi, the genome of D. involucrata for population and conservation Hubei, Hunan, Yunnan, Guizhou, Sichuan, and Chongqing genetics studies. provinces (Wu et al., 2004). Additionally, as an ornamental plant, D. involucrata has been introduced from China to many countries since 1904. In the 20th century, the distribution and METHODS AND RESULTS population size of D. involucrata decreased sharply, owing to Total genomic DNA was extracted from leaf tissue of D. involucrata using a modifi ed cetyltrimethylammonium bromide (CTAB) method (Doyle and 1 Manuscript received 1 August 2011; revision accepted 1 September 2011. Doyle, 1990). A microsatellite-enriched genomic library was constructed This study was supported by the National Science and Technology Pillar using the Fast Isolation by AFLP of Sequences Containing Repeats (FIASCO) protocol described by Zane et al. (2002) . Approximately 250 ng of total Program of China (grant no. 2008BADB0B04). The authors thank Dr. Li Li, genomic DNA was digested with Mse I (New England BioLabs, Beverly, Dr. Jinju Zhang, and Qingxiang Han (Wuhan Botanical Garden, Chinese Massachusetts, USA), and then ligated to the adapter (5′ -TACTCAGGAC- Academy of Sciences, Wuhan, Hubei, China) for their help with the TCAT-3 ′ /5′ -GACGATGAGTCCTGAG-3′ ) using T4 DNA ligase (TaKaRa experiments; Dr. Lihong Yan (Hunan Forest Botanical Garden, Changsha, Biotechnology Co., Dalian, Liaoning, China) in a volume of 30 μ L. The di- Hunan, China) for his assistance in the collection of plant materials; and gestion-ligation mixture was subsequently diluted 10 times, and 5 μ L diges- Brian Sedio (University of Michigan, Ann Arbor, Michigan, USA) for his tion-ligation DNA fragments were amplifi ed with 1 μ L AFLP adapter-specifi c help with improving the English for the manuscript. primers (5′ -GATG AGTCCTGAGTAAN-3′ , i.e., Mse I-N) (25 μ M) for the fi rst 5 Authors for correspondence: [email protected]; [email protected] round of PCR in 20 μ L volume, using the following PCR program: 95 ° C for 3 min; followed by 20 cycles of 30 s at 94 ° C, 1 min at 53 ° C, and 1 min at doi:10.3732/ajb.1100365 72° C; and a fi nal extension at 72° C for 10 min. After denaturation at 95 ° C for

T ABLE 1. Characterization of 17 microsatellite markers for Davidia involucrata .a

Allele size GenBank ′ ′ ° Locus name Primer sequences (5 – 3 ) Repeat motifT a ( C) range (bp) Nb N i H o accession no.

Dinv 1F: TCCGAAAAAACCAAAACACC (TC) 19 58 112 – 158 8 3 – 4 1.000 JN392755 R: GTAGACACGCTTCCGACACC Dinv 2F: TATATCAAAGAGTTGGTGC (GA) 17 47 142 – 192 11 3 – 4 1.000 JN392756 R: TCTATTGTACTGGATGTCC Dinv 3F: GTGGAAATGTGGAGATGTG (GA) 13 51 154 – 200 7 3 – 4 1.000 JN392757 R: CATTCTGTGATGGAGGGC Dinv 5F: AACATTTATTTTCCTATTTGC (TC) 19 55 110 – 174 12 3 – 6 1.000 JN392759 R: TAGCCTGTTGTTGCCTTTG Dinv 6F: TTGAAAGAGAAACAGAGGAGGTA (TC) 9 56 172 – 254 9 1 – 5 0.947 JN392760 R: GAGAGAAAGAAAGGGATTAGGAC Dinv 7F: GAGTAATACAGGCTCACATAAG (GA)37 52 126 – 204 13 3 – 6 1.000 JN392761 R: AACATAATCATCCAAAGCTAGA Dinv 8F: CTTTTCCTTCTCTTACCTCT (CT)21 48 160 – 220 13 2 – 6 1.000 JN392762 R: TTGTATTGAATATCATCCAC Dinv 9F: CCAGGTCACTCCCACACAT (TC) 13 55 214 – 264 8 2 – 5 1.000 JN392763 R: AAAAAGAAAAGCCAAAGCA Dinv 10F: TTCTTACTATGAACTATGTGAC (AC) 14 48 214 – 250 3 1 – 2 0.133 JN392764 R: TTTAGACTGGTTGATGCC Dinv 11F: ATAGCAGAGGAGCACTGGCAC (GT) 12 56 168 – 208 4 2 – 4 1.000 JN392765 R: CATAAAAGAGAGATACAGGAAGAGG Dinv 12F: CACTTAGATTAGTTGTGGAGG (AC) 9 52 144 – 172 3 2 1.000 JN392766 R: GTTGTTGATTGTGATTTACCC Dinv 13F: TGGTTGTTTGGACCTAAAGCAT (GT) 19 59 186 – 282 11 3 – 6 1.000 JN392767 R: CCTCACTTCTCCATCTCTCCC Dinv 14F: CCACATAAACAAAGTGTAAGAA (TC) 16 51 188 – 242 6 1 – 3 0.600 JN392768 R: GAGTAAATACTAGAAACAGAGGAA Dinv 16F: TTCAAATCCAAGACCAGTTCGC (AC) 7 61 150 – 170 2 2 1.000 JN392770 R: GCTGTGTGCTTCATCACGCCTA Dinv 17F: TCCACCTCGTTCTGGTTCCTT (TC) 19 (CA)13 60 122 – 198 10 3 – 6 1.000 JN392771 R: TCCCCAGCCTACCCTTATCAC Dinv 4F: TCCTTCTTCTTCCCAAAATC (GA) 7 54 125 1 1 0.000 JN392758 R: AGCACTCTTACACTCTCAAAAA Dinv 15F: AAATACAAGGCAAGGGGTC (TC) 6 54 191 1 1 0.000 JN392769 R: GCGTATCCACATAGGTGAGTC

Note : Ho = observed heterozygosity; N b = total number of alleles in a sample of 20 individuals; N i = number of alleles per individual; Ta = annealing temperature. a Voucher specimens of Davidia involucrata : DIHH1001, DIHH1002, DIHH1003, DIHH1004, DIHH1005, DIHH1006, DIHH1007, DIHH1008, DIHH1009, DIHH1010, DIBD1001, DIBD1002, DIBD1003, DIBD1004, DIBD1005, DIBD1006, DIBD1007, DIBD1008, DIBD1009, and DIBD1010. Specimens were deposited at Wuhan Botanical Garden, Chinese Academy of Sciences.

μ 5 min, 30 L amplifi ed DNA fragments were hybridized with 150 pmol of reaction volume containing 10 mM Tris-HCl (pH 8.4), 50 mM (NH4 )2 SO4 , ′ μ two 5 -biotinylated oligonucleotide repeat probes ((AG)15 and (TG)15 ) in 1.5 mM MgCl 2 , 0.2 mM dNTPs, 0.25 M of each primer, 1 U Taq polymerase 250 μ L hybridization buffer containing SSC 4.2× and SDS 0.07%, respec- (Fermentas China, Shenzhen, China), and 50 ng of genomic DNA. The fol- tively. The mixture was denatured at 95 °C for 5 min, followed by annealing lowing PCR program was used: 94° C for 5 min; followed by 35 cycles of 50 s at 48 ° C for 2 h and then cooled to room temperature. The hybridization at 94° C, 50 s at 47– 61 °C, and 60 s at 72 °C; and a fi nal extension at 72° C for mixture was enriched using 300 μ L of Streptavidin-coated beads (Promega, 10 min. Amplifi ed products were separated on 6% denatured polyacrylamide Madison, Wisconsin, USA), and three nonstringent and three stringent gels stained with silver nitrate. Sizes of amplifi ed microsatellite DNAs were washes were carried out following Zane et al. (2002). DNA containing re- determined by a 20 bp ladder (Promega). Seventeen primer pairs of 48 loci peats were amplified by 35 cycles with Mse I-N primers, and the PCR amplifi ed reliable bands, and the others amplifi ed no products or obscure product was purifi ed with E.Z.N.A. Gel Extraction Kit (Omega, Bio-Tek, bands. Fifteen loci revealed a useful degree of polymorphism with a typical Winooski, Vermont, USA), ligated into a pMD 18-T plasmid vector pMD-18 multibanded pattern of polyploid species, while two were shown to be mono- (TaKaRa Biotechnology Co.) and transformed into DH5 α competent cells morphic ( Table 1). The total number of bands per locus in the polymorphic (TaKaRa Biotechnology Co.). Positive clones (blue/white β -galactosidase loci ranged from two to 13, with observed heterozygosity ranging from 0.133 selection) were tested by PCR to check for the presence of inserts. A total of to 1.000. The maximum number of bands per locus per individual (six bands) 108 clones having a strong positive hybridization signal were obtained and were observed in fi ve loci (Dinv 5, Dinv 7, Dinv 8, Dinv 13, and Dinv 17) sequenced with ABI BigDye Terminator Cycle Sequencing Kit (Applied ( Table 1 ). Biosystems, Carlsbad, California, USA) in an ABI PRISM 3100 automated The ploidy level in D. involucrata is currently unknown. There are only sequencer (Applied Biosystems). Forty-eight sequences containing SSRs three publications concerning D. involucrata chromosome numbers (2 n = 42) were selected for primer design. For each of them, PCR primer pairs were (reviewed by He et al., 2004). Based on chromosome number data, Eyde designed using the software Primer3 ( Rozen and Skaletsky, 2000 ). Each (1988 ) indicated the basic number of Nyssideae (Nyssa , Camptotheca, and primer pair was designed to amplify a fragment ranging between 100 and Davidia ) might have doubled in the evolutionary process of the family Cor- 300 bp. naceae (also see He et al., 2004). In the current study, microsatellite marker The ability of the primers to generate reliable and polymorphic PCR prod- data has indicated that D. involucrata might be a polyploid species, and it is ucts was tested with the genomic DNA of 20 individuals of D. involucrata proposed as a hexaploid with the basic number of x = 7 (2n = 6 x = 42). Further from the germplasm collections in the Hunan Forest Botanical Garden in studies are required to confi rm the polyploidy evidenced by the band patterns Changsha, Hunan, China. PCR amplifi cations were performed in a 10 μ L obtained here. e80 AMERICAN JOURNAL OF BOTANY [Vol. 0

CONCLUSIONS D OYLE , J. , AND J . D OYLE . 1990 . Isolation of plant DNA from fresh tissue. Focus (San Francisco, Calif.) 12 : 13 – 15 . The multibanded patterns of microsatellite loci obtained in EYDE , R. H. 1988 . Comprehending Cornus : Puzzles and progress in the the current study conﬁ rmed that D. involucrata might be a poly- systematics of the dogwoods. Botanical Review 54 : 233 – 351 . F U , L. G., AND C. M. CHIN . 1992 . China plant red data book: Rare and ploid species. Although most of the analyses that are usually endangered plants. Science Press, Beijing, China. performed with codominant markers could not be carried out H E, Z. C., J. Q. LI, AND H. C. WANG . 2004 . Karyomorphology of Davidia (expected heterozygosity and Hardy– Weinberg equilibrium) involucrata and Camptotheca acuminata , with special reference to because of the multibanded pattern obtained, these polymor- their systematic positions. Botanical Journal of the Linnean Society phic markers can be used to discriminate genotypes in germ- 144 : 193 – 198 . plasm collections. With the recent development of programs in MANCHESTER , S. R. 2003 . Leaves and fruits of Davidia (Cornales) from population genetics for polyploids (Clark and Jasieniuk, 2011) the Paleocene of North America. Systematic Botany 27 : 368 – 382 . or treating the microsatellite markers in polyploid species as R OZEN , S. , AND H . SKALETSKY . 2000 . Primer3 on the WWW for general dominant markers (binary coding) (Scheepens et al., 2007), the users and for biologist programmers. In S. Krawetz and S. Misener microsatellite markers can be used to evaluate the genetic di- [eds.], Bioinformatics methods and protocols: Methods in molecular biology, 365 – 386. Humana Press, Totowa, New Jersey, USA. versity and infer evolutionary processes in natural populations, S CHEEPENS, J. F., R. M. VEENEKLAAS, L. VAN DE ZANDE, AND J. P. which should be useful for developing the appropriate conser- BAKKER. 2007 . Clonal structure of Elytrigia atherica along dif- vation strategies for D. involucrata . ferent successional stages of a salt marsh. Molecular Ecology 1 6 : 1115 – 1124 . LITERATURE CITED W U , G., S. HAN, H. WANG, Y. LUO, H. DENG, AND J. ZHAO . 2004 . Living characteristics of rare and endangered species Davidia involucrata. C LARK , L. V., AND M. JASIENIUK . 2011 . POLYSAT: An R package for Journal of Forest Research 15 : 39 – 44 . polyploid microsatellite analysis. Molecular Ecology Resources 11 : Z ANE , L . , L . B ARGELLONI , AND T . P ATARNELLO . 2002 . Strategies for micro- 562 – 566 . satellite isolation: A review. Molecular Ecology 11 : 1 – 16 .