DOCSLIB.ORG

E78 Dove Tree, Davidia Involucrata Baill . (Cornaceae), Which Is

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
E78 Dove Tree, Davidia Involucrata Baill . (Cornaceae), Which Is American Journal of Botany: e78–e80. 2012. AJB PRIMER NOTES & PROTOCOLS IN THE PLANT SCIENCES M ICROSATELLITE PRIMERS IN THE CHINESE DOVE TREE, D AVIDIA INVOLUCRATA (CORNACEAE), A RELIC SPECIES 1 OF THE TERTIARY Z UOZHOU L I 2,5 , C HUANHUA W ANG 3 , Y ANHONG L IU 4 , AND J UNQING L I 4,5 2 Key Laboratory of Plant Germplasm Enhancement and Specialty Agriculture, Wuhan Botanical Garden, Chinese Academy of Sciences, Wuhan 430074, Hubei, People ’ s Republic of China; 3 College of Chemistry and Life Sciences, China Three Gorges University, Yi-Chang 443000, Hubei, People ’ s Republic of China; and 4 Key Laboratory for Silviculture and Conservation of the Ministry of Education, Beijing Forestry University, Beijing 100083, People ’ s Republic of China • Premise of the study: The fi rst microsatellite primers were developed for Davidia involucrata , an endangered relic species of the Tertiary in China, to further describe its genetic variability and population structure. • Methods and Results: Using the Fast Isolation by AFLP of Sequences Containing Repeats (FIASCO) protocol, 15 polymorphic microsatellite loci were isolated and characterized in 20 individuals from the germplasm collections of D. involucrata at the Hunan Forest Botanical Garden. High levels of polymorphism were revealed, with the total number of alleles per locus and the number of alleles per locus per individual ranging from two to 13 and from one to six, respectively. • Conclusions: The multibanded patterns of microsatellite loci obtained in the current study confi rmed that D. involucrata might be a polyploid species. The primers will be useful for studies of genetic diversity and for guiding conservation strategies for D. involucrata. Key words: Cornaceae; Davidia involucrata ; microsatellite markers; polyploidy. Dove tree, Davidia involucrata Baill . (Cornaceae), which is human activities that destroyed natural forests. The species has endemic in western China, is not only one of the best known been placed in the highest class of protected plant species in relict species of the Tertiary, but also a famous ornamental plant China (Fu and Chin, 1992) and listed as Vulnerable (VU) in the with dove-shaped fl owers (Fu and Chin, 1992). Fossils from the IUCN Red List (http://www.iucnredlist.org/). An appropriate Paleocene of North America indicate that the genus Davidia conservation program is urgently needed to prevent further loss Baill. was more widespread in the past ( Manchester, 2003 ). of D. involucrata . Although genetic characterization of germ- Davidia involucrata is only one relict species in the genus plasm resources is essential for the effi cient conservation and Davidia ; other species within the genus went extinct during the ice utilization of the species, little is known about the genetic diver- ages of the Quaternary. This species survived only in the sub- sity and population structure of either wild or cultivated D. in- tropical mountains of southwestern China because of the topo- volucrata . Because of their codominant and hypervariable graphical complexity and weak impact of the glaciers (Wu et al., nature, microsatellite markers have been proven to be highly 2004). After the ice ages, D. involucrata populations spread effi cient molecular tools. Here, we describe the characterization slowly in mountains in southwestern China. Today, D. involu- of 15 polymorphic and two monomorphic microsatellite loci in crata is distributed in more than 40 counties in Gansu, Shanxi, the genome of D. involucrata for population and conservation Hubei, Hunan, Yunnan, Guizhou, Sichuan, and Chongqing genetics studies. provinces (Wu et al., 2004). Additionally, as an ornamental plant, D. involucrata has been introduced from China to many countries since 1904. In the 20th century, the distribution and METHODS AND RESULTS population size of D. involucrata decreased sharply, owing to Total genomic DNA was extracted from leaf tissue of D. involucrata using a modifi ed cetyltrimethylammonium bromide (CTAB) method ( Doyle and 1 Manuscript received 1 August 2011; revision accepted 1 September 2011. Doyle, 1990 ). A microsatellite-enriched genomic library was constructed This study was supported by the National Science and Technology Pillar using the Fast Isolation by AFLP of Sequences Containing Repeats (FIASCO) protocol described by Zane et al. (2002) . Approximately 250 ng of total Program of China (grant no. 2008BADB0B04). The authors thank Dr. Li Li, genomic DNA was digested with Mse I (New England BioLabs, Beverly, Dr. Jinju Zhang, and Qingxiang Han (Wuhan Botanical Garden, Chinese Massachusetts, USA), and then ligated to the adapter (5 ′ -TACTCAGGAC- Academy of Sciences, Wuhan, Hubei, China) for their help with the TCAT-3 ′ /5 ′ -GACGATGAGTCCTGAG-3 ′ ) using T4 DNA ligase (TaKaRa experiments; Dr. Lihong Yan (Hunan Forest Botanical Garden, Changsha, Biotechnology Co., Dalian, Liaoning, China) in a volume of 30 μ L. The di- Hunan, China) for his assistance in the collection of plant materials; and gestion-ligation mixture was subsequently diluted 10 times, and 5 μ L diges- Brian Sedio (University of Michigan, Ann Arbor, Michigan, USA) for his tion-ligation DNA fragments were amplifi ed with 1 μ L AFLP adapter-specifi c help with improving the English for the manuscript. primers (5 ′ -GATG AGTCCTGAGTAAN-3 ′ , i.e., Mse I-N) (25 μ M) for the fi rst 5 Authors for correspondence: [email protected]; [email protected] round of PCR in 20 μ L volume, using the following PCR program: 95 ° C for 3 min; followed by 20 cycles of 30 s at 94 ° C, 1 min at 53 ° C, and 1 min at doi:10.3732/ajb.1100365 72 ° C; and a fi nal extension at 72 ° C for 10 min. After denaturation at 95 ° C for American Journal of Botany: e78–e80, 2012; http://www.amjbot.org/ © 2012 Botanical Society of America e78 February 2012] AJB PRIMER NOTES & PROTOCOLS — DAVIDIA INVOLUCRATA MICROSATELLITES e79 T ABLE 1. Characterization of 17 microsatellite markers for Davidia involucrata . a Allele size GenBank ′ ′ ° Locus name Primer sequences (5 – 3 ) Repeat motif Ta ( C) range (bp) Nb Ni Ho accession no. Dinv 1F: TCCGAAAAAACCAAAACACC (TC)19 58 112 – 158 8 3 – 4 1.000 JN392755 R: GTAGACACGCTTCCGACACC Dinv 2F: TATATCAAAGAGTTGGTGC (GA)17 47 142 – 192 11 3 – 4 1.000 JN392756 R: TCTATTGTACTGGATGTCC Dinv 3F: GTGGAAATGTGGAGATGTG (GA)13 51 154 – 200 7 3 – 4 1.000 JN392757 R: CATTCTGTGATGGAGGGC Dinv 5F: AACATTTATTTTCCTATTTGC (TC)19 55 110 – 174 12 3 – 6 1.000 JN392759 R: TAGCCTGTTGTTGCCTTTG Dinv 6F: TTGAAAGAGAAACAGAGGAGGTA (TC)9 56 172 – 254 9 1 – 5 0.947 JN392760 R: GAGAGAAAGAAAGGGATTAGGAC Dinv 7F: GAGTAATACAGGCTCACATAAG (GA)37 52 126 – 204 13 3 – 6 1.000 JN392761 R: AACATAATCATCCAAAGCTAGA Dinv 8F: CTTTTCCTTCTCTTACCTCT (CT)21 48 160 – 220 13 2 – 6 1.000 JN392762 R: TTGTATTGAATATCATCCAC Dinv 9F: CCAGGTCACTCCCACACAT (TC)13 55 214 – 264 8 2 – 5 1.000 JN392763 R: AAAAAGAAAAGCCAAAGCA Dinv 10F: TTCTTACTATGAACTATGTGAC (AC)14 48 214 – 250 3 1 – 2 0.133 JN392764 R: TTTAGACTGGTTGATGCC Dinv 11F: ATAGCAGAGGAGCACTGGCAC (GT)12 56 168 – 208 4 2 – 4 1.000 JN392765 R: CATAAAAGAGAGATACAGGAAGAGG Dinv 12F: CACTTAGATTAGTTGTGGAGG (AC)9 52 144 – 172 3 2 1.000 JN392766 R: GTTGTTGATTGTGATTTACCC Dinv 13F: TGGTTGTTTGGACCTAAAGCAT (GT)19 59 186 – 282 11 3 – 6 1.000 JN392767 R: CCTCACTTCTCCATCTCTCCC Dinv 14F: CCACATAAACAAAGTGTAAGAA (TC)16 51 188 – 242 6 1 – 3 0.600 JN392768 R: GAGTAAATACTAGAAACAGAGGAA Dinv 16F: TTCAAATCCAAGACCAGTTCGC (AC)7 61 150 – 170 2 2 1.000 JN392770 R: GCTGTGTGCTTCATCACGCCTA Dinv 17F: TCCACCTCGTTCTGGTTCCTT (TC)19 (CA)13 60 122 – 198 10 3 – 6 1.000 JN392771 R: TCCCCAGCCTACCCTTATCAC Dinv 4F: TCCTTCTTCTTCCCAAAATC (GA)7 54 125 1 1 0.000 JN392758 R: AGCACTCTTACACTCTCAAAAA Dinv 15F: AAATACAAGGCAAGGGGTC (TC)6 54 191 1 1 0.000 JN392769 R: GCGTATCCACATAGGTGAGTC Note : Ho = observed heterozygosity; Nb = total number of alleles in a sample of 20 individuals; Ni = number of alleles per individual; Ta = annealing temperature. a Voucher specimens of Davidia involucrata : DIHH1001, DIHH1002, DIHH1003, DIHH1004, DIHH1005, DIHH1006, DIHH1007, DIHH1008, DIHH1009, DIHH1010, DIBD1001, DIBD1002, DIBD1003, DIBD1004, DIBD1005, DIBD1006, DIBD1007, DIBD1008, DIBD1009, and DIBD1010. Specimens were deposited at Wuhan Botanical Garden, Chinese Academy of Sciences. μ 5 min, 30 L amplifi ed DNA fragments were hybridized with 150 pmol of reaction volume containing 10 mM Tris-HCl (pH 8.4), 50 mM (NH4 )2 SO4 , ′ μ two 5 -biotinylated oligonucleotide repeat probes ((AG)15 and (TG)15 ) in 1.5 mM MgCl2 , 0.2 mM dNTPs, 0.25 M of each primer, 1 U Taq polymerase 250 μ L hybridization buffer containing SSC 4.2× and SDS 0.07%, respec- (Fermentas China, Shenzhen, China), and 50 ng of genomic DNA. The fol- tively. The mixture was denatured at 95 ° C for 5 min, followed by annealing lowing PCR program was used: 94 ° C for 5 min; followed by 35 cycles of 50 s at 48 ° C for 2 h and then cooled to room temperature. The hybridization at 94 ° C, 50 s at 47 – 61 ° C, and 60 s at 72 ° C; and a fi nal extension at 72 ° C for mixture was enriched using 300 μ L of Streptavidin-coated beads (Promega, 10 min. Amplifi ed products were separated on 6% denatured polyacrylamide Madison, Wisconsin, USA), and three nonstringent and three stringent gels stained with silver nitrate. Sizes of amplifi ed microsatellite DNAs were washes were carried out following Zane et al. (2002) . DNA containing re- determined by a 20 bp ladder (Promega). Seventeen primer pairs of 48 loci peats were amplified by 35 cycles with Mse I-N primers, and the PCR amplifi ed reliable bands, and the others amplifi ed no products or obscure product was purifi ed with E.Z.N.A. Gel Extraction Kit (Omega, Bio-Tek, bands. Fifteen loci revealed a useful degree of polymorphism with a typical Winooski, Vermont, USA), ligated into a pMD 18-T plasmid vector pMD-18 multibanded pattern of polyploid species, while two were shown to be mono- (TaKaRa Biotechnology Co.) and transformed into DH5 α competent cells morphic ( Table 1 ).
Load more

Recommended publications
  • Davidia Involucrata Handkerchief Tree
    Davidia involucrata Handkerchief Tree Davidia involucrata is the only member of its genus but there are two varieties separated by their leaves, var. involucrata which whose leaves are short haired on the underside and var. vilmoriniana which have hairless leaves. A small/medium sized tree it is most well known for its astonishing white, large bracts that hang like pinched handkerchiefs from its branches in May. The foliage is midsized and heart shaped, of a attractive green colour in summer turning shades of orange and yellow in winter with young foliage in spring having a red/purple colour and a spicy, incense fragrance. Small inedible pear shaped fruits are produced in the spring. Davidia involucrata 4m Plant Profile Name: Davidia involucrata Common Name: Handkerchief Tree / Dove Tree Family: Nyssaceae Height: Up to above 12 metres Width: Up to 6-8 metres Demands: Sun or light shade in a sheltered position Soil: All soils tolerated but prefers well drained or moist but well drained Foliage: Deciduous Fruit: Hard Nut with green husk Flowers of the Davidia involucrata vilmoriniana Deepdale Trees Ltd., Tithe Farm, Hatley Road, Potton, Sandy, Beds. SG19 2DX. Tel: 01767 26 26 36 www.deepdale-trees.co.uk Davidia involucrata Handkerchief Tree The Davidia involucrata is named after the French missionary and botanist Father Armand David who was also the first westerner to report a sighting of a panda! Summer foliage Container Grown 3-4m Davida involucrata Davidia involucrata 3.5-4m in winter Deepdale Trees Ltd., Tithe Farm, Hatley Road, Potton, Sandy, Beds. SG19 2DX. Tel: 01767 26 26 36 www.deepdale-trees.co.uk.
    [Show full text]
  • A Critically Endangered Plant Species Endemic to South-West China
    Integrated conservation for Parakmeria omeiensis (Magnoliaceae), a Critically Endangered plant species endemic to south-west China D AOPING Y U ,XIANGYING W EN,CEHONG L I ,TIEYI X IONG,QIXIN P ENG X IAOJIE L I ,KONGPING X IE,HONG L IU and H AI R EN Abstract Parakmeria omeiensis is a Critically Endangered tree attractive and large, and their seed arils are orange, making species in the family Magnoliaceae, endemic to south-west the tree an attractive ornamental plant. However, the species China. The tree is functionally dioecious, but little is known has a restricted range. It has been considered a Grade-I about the species’ status in the wild. We investigated the Key-Protected Wild Plant Species in China since and range, population size, age structure, habitat characteristics has been categorized as Critically Endangered on the and threats to P. omeiensis. We located a total of individuals IUCN Red List since (China Expert Workshop, ), in two populations on the steep slopes of Mount Emei, Sichuan the Chinese Higher Plants Red List since (Yin, ), and province, growing under the canopy of evergreen broadleaved the Red List of Magnoliaceae since (Malin et al., ). forest in well-drained gravel soil. A male-biased sex ratio, lack The tree has also been identified as a plant species with an of effective pollinating insects, and habitat destruction result extremely small population (Ren et al., ; State Forestry in low seed set and poor seedling survival in the wild. We Administration of China, ). have adopted an integrated conservation approach, including Parakmeria includes five species (P.
    [Show full text]
  • Development of EST-SSR Markers in the Relict Tree Davidia Involucrata (Davidiaceae) Using Transcriptome Sequencing
    Development of EST-SSR markers in the relict tree Davidia involucrata (Davidiaceae) using transcriptome sequencing Z.C. Long1,2, A.W. Gichira1,2, J.M. Chen1, Q.F. Wang1 and K. Liao1 1Key Laboratory of Plant Germplasm Enhancement and Specialty Agriculture, Wuhan Botanical Garden, Chinese Academy of Sciences, Wuhan, China 2Life Science College, University of Chinese Academy of Sciences, Beijing, China Corresponding author: K. Liao E-mail: [email protected] Genet. Mol. Res. 15 (4): gmr15048539 Received February 11, 2016 Accepted March 28, 2016 Published October 17, 2016 DOI http://dx.doi.org/10.4238/gmr15048539 Copyright © 2016 The Authors. This is an open-access article distributed under the terms of the Creative Commons Attribution ShareAlike (CC BY-SA) 4.0 License. ABSTRACT. Davidia involucrata, reputed to be a “living fossil” in the plant kingdom, is a relict tree endemic to China. Extant natural populations are diminishing due to anthropogenic disturbance. In order to understand its ability to survive in a range of climatic conditions and to design conservation strategies for this endangered species, we developed genic simple sequence repeats (SSRs) from mRNA transcripts. In total, 142,950 contigs were assembled. Of these, 30,411 genic SSR loci were discovered and 12,208 primer pairs were designed. Dinucleotides were the most common (77.31%) followed by trinucleotides (16.44%). Thirteen randomly selected primers were synthesized and validated using 24 individuals of D. involucrata. The markers displayed high polymorphism with the number of alleles per locus ranging from 3 to Genetics and Molecular Research 15 (4): gmr15048539 Z.C. Long et al.
    [Show full text]
  • Bgci's Plant Conservation Programme in China
    SAFEGUARDING A NATION’S BOTANICAL HERITAGE – BGCI’S PLANT CONSERVATION PROGRAMME IN CHINA Images: Front cover: Rhododendron yunnanense , Jian Chuan, Yunnan province (Image: Joachim Gratzfeld) Inside front cover: Shibao, Jian Chuan, Yunnan province (Image: Joachim Gratzfeld) Title page: Davidia involucrata , Daxiangling Nature Reserve, Yingjing, Sichuan province (Image: Xiangying Wen) Inside back cover: Bretschneidera sinensis , Shimen National Forest Park, Guangdong province (Image: Xie Zuozhang) SAFEGUARDING A NATION’S BOTANICAL HERITAGE – BGCI’S PLANT CONSERVATION PROGRAMME IN CHINA Joachim Gratzfeld and Xiangying Wen June 2010 Botanic Gardens Conservation International One in every five people on the planet is a resident of China But China is not only the world’s most populous country – it is also a nation of superlatives when it comes to floral diversity: with more than 33,000 native, higher plant species, China is thought to be home to about 10% of our planet’s known vascular flora. This botanical treasure trove is under growing pressure from a complex chain of cause and effect of unprecedented magnitude: demographic, socio-economic and climatic changes, habitat conversion and loss, unsustainable use of native species and introduction of exotic ones, together with environmental contamination are rapidly transforming China’s ecosystems. There is a steady rise in the number of plant species that are on the verge of extinction. Great Wall, Badaling, Beijing (Image: Zhang Qingyuan) Botanic Gardens Conservation International (BGCI) therefore seeks to assist China in its endeavours to maintain and conserve the country’s extraordinary botanical heritage and the benefits that this biological diversity provides for human well-being. It is a challenging venture and represents one of BGCI’s core practical conservation programmes.
    [Show full text]
  • Plant Palette - Trees 50’-0”
    50’-0” 40’-0” 30’-0” 20’-0” 10’-0” Zelkova Serrata “Greenvase” Metasequoia glyptostroboides Cladrastis kentukea Chamaecyparis obtusa ‘Gracilis’ Ulmus parvifolia “Emer I” Green Vase Zelkova Dawn Redwood American Yellowwood Slender Hinoki Falsecypress Athena Classic Elm • Vase shape with upright arching branches • Narrow, conical shape • Horizontally layered, spreading form • Narrow conical shape • Broadly rounded, pendulous branches • Green foliage • Medium green, deciduous conifer foliage • Dark green foliage • Evergreen, light green foliage • Medium green, toothed leaves • Orange Fall foliage • Rusty orange Fall foliage • Orange to red Fall foliage • Evergreen, no Fall foliage change • Yellowish fall foliage Plant Palette - Trees 50’-0” 40’-0” 30’-0” 20’-0” 10’-0” Quercus coccinea Acer freemanii Cercidiphyllum japonicum Taxodium distichum Thuja plicata Scarlet Oak Autumn Blaze Maple Katsura Tree Bald Cyprus Western Red Cedar • Pyramidal, horizontal branches • Upright, broad oval shape • Pyramidal shape • Pyramidal shape, develops large flares at base • Pyramidal, buttressed base with lower branches • Long glossy green leaves • Medium green fall foliage • Bluish-green, heart-shaped foliage • Leaves are needle-like, green • Leaves green and scale-like • Scarlet red Fall foliage • Brilliant orange-red, long lasting Fall foliage • Soft apricot Fall foliage • Rich brown Fall foliage • Sharp-pointed cone scales Plant Palette - Trees 50’-0” 40’-0” 30’-0” 20’-0” 10’-0” Thuja plicata “Fastigiata” Sequoia sempervirens Davidia involucrata Hogan
    [Show full text]
  • Systematics, Climate, and Ecology of Fossil and Extant Nyssa (Nyssaceae, Cornales) and Implications of Nyssa Grayensis Sp
    East Tennessee State University Digital Commons @ East Tennessee State University Electronic Theses and Dissertations Student Works 8-2013 Systematics, Climate, and Ecology of Fossil and Extant Nyssa (Nyssaceae, Cornales) and Implications of Nyssa grayensis sp. nov. from the Gray Fossil Site, Northeast Tennessee Nathan R. Noll East Tennessee State University Follow this and additional works at: https://dc.etsu.edu/etd Part of the Biodiversity Commons, Climate Commons, Paleontology Commons, and the Plant Biology Commons Recommended Citation Noll, Nathan R., "Systematics, Climate, and Ecology of Fossil and Extant Nyssa (Nyssaceae, Cornales) and Implications of Nyssa grayensis sp. nov. from the Gray Fossil Site, Northeast Tennessee" (2013). Electronic Theses and Dissertations. Paper 1204. https://dc.etsu.edu/etd/1204 This Thesis - Open Access is brought to you for free and open access by the Student Works at Digital Commons @ East Tennessee State University. It has been accepted for inclusion in Electronic Theses and Dissertations by an authorized administrator of Digital Commons @ East Tennessee State University. For more information, please contact [email protected]. Systematics, Climate, and Ecology of Fossil and Extant Nyssa (Nyssaceae, Cornales) and Implications of Nyssa grayensis sp. nov. from the Gray Fossil Site, Northeast Tennessee ___________________________ A thesis presented to the faculty of the Department of Biological Sciences East Tennessee State University In partial fulfillment of the requirements for the degree Master of Science in Biology ___________________________ by Nathan R. Noll August 2013 ___________________________ Dr. Yu-Sheng (Christopher) Liu, Chair Dr. Tim McDowell Dr. Foster Levy Keywords: Nyssa, Endocarp, Gray Fossil Site, Miocene, Pliocene, Karst ABSTRACT Systematics, Climate, and Ecology of Fossil and Extant Nyssa (Nyssaceae, Cornales) and Implications of Nyssa grayensis sp.
    [Show full text]
  • Multifunctional Bracts in the Dove Tree Davidia Involucrata (Nyssaceae: Cornales): Rain Protection and Pollinator Attraction
    vol. 171, no. 1 the american naturalist january 2008 Natural History Note Multifunctional Bracts in the Dove Tree Davidia involucrata (Nyssaceae: Cornales): Rain Protection and Pollinator Attraction Ji-Fan Sun,1,* Yan-Bing Gong,1,† Susanne S. Renner,2,‡ and Shuang-Quan Huang1,§ 1. College of Life Sciences, Wuhan University, Wuhan 430072, shaped by partly opposing selective pressures (Faegri and China; van der Pijl 1979; Waser and Ollerton 2006). Selection 2. Department of Biology, University of Munich, D-80638 from mutualistic pollinators and antagonistic herbivores Munich, Germany has received most attention (Grant and Grant 1965; Steb- Submitted April 6, 2007; Accepted August 6, 2007; bins 1970; Johnson and Steiner 2000; Fenster et al. 2004; Electronically published November 12, 2007 Strauss and Whittall 2006), but flowers are also under strong selection from their physical environment (Corbet 1990; Herrera 1993; Galen 2005). Among the abiotic se- lective agents on flowers is rain. This was first recognized abstract: Although there has been much experimental work on by Sprengel ([1793]1972), who noted that rain may wash floral traits that are under selection from mutualists and antagonists, away pollen grains and dilute nectar. Later studies focused selection by abiotic environmental factors on flowers has been largely on losses in pollen viability resulting from prolonged im- ignored. Here we test whether pollen susceptibility to rain damage mersion in water (Jones 1967; Eisikowitch and Woodell could have played a role in the evolution of the reproductive archi- 1975; Corbet 1990; Huang et al. 2002). While some species tecture of Davidia involucrata, an endemic in the mountains of west- have water-repellent pollen, others rely on nodding flow- ern China.
    [Show full text]
  • Open As a Single Document
    The Magazine of the Arnold Arboretum VOLUME 69 • NUMBER 3 The Magazine of the Arnold Arboretum VOLUME 69 • NUMBER 3 • 2012 CONTENTS Arnoldia (ISSN 0004–2633; USPS 866–100) 2 Picking Up the Pawpaws: The Rare Woody is published quarterly by the Arnold Arboretum Plants of Ontario Program at the University of Harvard University. Periodicals postage paid of Guelph Arboretum at Boston, Massachusetts. Sean Fox Subscriptions are $20.00 per calendar year domestic, $25.00 foreign, payable in advance. 14 Land Bridge Travelers of the Tertiary: Remittances may be made in U.S. dollars, by The Eastern Asian–Eastern North American check drawn on a U.S. bank; by international Floristic Disjunction money order; or by Visa, Mastercard, or American David Yih Express. Send orders, remittances, requests to purchase back issues, change-of-address notices, 24 A Rare Find: Yellow-Fruited Spicebush and all other subscription-related communica- (Lindera benzoin forma xanthocarpum) tions to Circulation Manager, Arnoldia, Arnold Richard Lynch Arboretum, 125 Arborway, Boston, MA 02130- 3500. Telephone 617.524.1718; fax 617.524.1418; 29 Book Review: A Landscape History of e-mail [email protected] New England Arnold Arboretum members receive a subscrip- Phyllis Andersen tion to Arnoldia as a membership benefit. To become a member or receive more information, 36 Plainly Unique: Schisandra chinensis please call Wendy Krauss at 617.384.5766 or Sam Schmerler email [email protected] Postmaster: Send address changes to Front cover: Japanese cornel (Cornus officinalis) blooms Arnoldia Circulation Manager in early spring, typically March at the Arnold Arbore- The Arnold Arboretum tum.
    [Show full text]
  • Right Tree in the Right Place the First Time
    City of Lake Oswego Right Tree Rightin the Place Contents Benefits of Trees . 3 Selecting a Tree . .4 . Planting Distances from Power Lines . 5 . Recommended Tree Species: . for 2'—4' wide planting spaces. .6 . for 4'—6' wide planting spaces . 8 for 6'—8' wide planting spaces. .12 . for 8'—10' wide planting spaces . 16 . for 10' wide + planting spaces. .18 . Proper Planting and Care . .22 . Avoiding Problems. 24 . Resources . 25 Benefits Of Trees rees improve the appearance and quality of life in Lake Oswego’s neighborhoods. But did you know they also help reduce stormwater runoff, filter pollutants, add Toxygen to the air we breathe, and decrease glare from roadways? For example, Lake Oswego’s street tree canopy (representing 13% of the total 44% citywide tree canopy cover) intercepts about 50 Olympic-size swimming pools worth of rainfall annually based on data compiled in the City’s 2009 State of the Urban Forest Report. Conserving existing trees and planting new trees help reduce the size and cost of hard infrastructure that is otherwise necessary for stormwater management. 3 Selecting A Tree Before selecting a tree to plant, a number of factors should be considered to ensure that an optimum species is chosen based on the site conditions of the available growing space. Choosing the right tree for the right place is a decision that will have an impact on the neighborhood for decades to come. Answering these questions can help you select the most suitable and desirable tree species for your site: 1. What is the size of the available growing space? 2.
    [Show full text]
  • Conservation and Development in Conflict: Regeneration of Wild Davidia Involucrata (Nyssaceae) Communities Weakened by Bamboo Management in South-Central China
    Conservation and development in conflict: regeneration of wild Davidia involucrata (Nyssaceae) communities weakened by bamboo management in south-central China S HENHUA Q IAN,CINDY Q. TANG,SIRONG Y I ,LIANG Z HAO K UN S ONG and Y ONGCHUAN Y ANG Abstract Protected areas, including nature reserves and other highly valued trees that share similar life-history chara- management areas, are established for the conservation of cteristics with D. involucrata. biological diversity and protection of the associated natural Keywords Bamboo, China, Conservation effectiveness, and cultural resources. These objectives, however, are often Davidia involucrata, forest regeneration, Nyssaceae, in conflict with socio-economic development. We investi- protected areas, socio-ecological system gated the plant communities dominated by the dove tree Davidia involucrata in a nature reserve on Mount Jinfo, China, where people intensively manage large areas of bam- boo stands. We found a significant lack of small-sized main Introduction stems of D. involucrata (– cm diameter at breast height; height . m) and newly emerging sprouts in the reserve. rotected areas, including nature reserves and manage- The height-class distribution showed a unimodal pattern, Pment areas, are established for the effective conserva- with most individuals (of both D. involucrata and co-occur- tion of biological diversity and protection of the associated ring species) concentrated in the – m height-class, and natural and cultural resources (DeFries et al., ; Dudley few individuals in the shrub and sub-canopy layer (.– m). & Stoulton, ). These objectives, however, are often Existing practices to facilitate the spread of bamboo stands, in conflict with socio-economic development. Although and the need to develop a local market for bamboo shoots many proposals have been put forward to simultaneously received little consideration when the nature reserve was es- satisfy human requirements and maintain ecological func- tablished in to protect D.
    [Show full text]
  • Augustine Henry and the Exploration of the Chinese Flora
    Augustine Henry and the E. Charles Nelson Exploration of the Chinese Flora The plant-collector’s job is to uncover the hidden studies as rapidly as he could, obtained his beauties of the world, so that others may share medical qualifications, passed the Chinese his joy .... Customs Service examinations, for which he - Frank From China to Hkamti Kingdon Ward, had acquired a working knowledge of Long Chinese, and left for China in the autumn of Although he is generally believed to have 1881. been born in Ireland, Augustine Henry was Henry remained in the customs service born in Dundee, Scotland, on July 2, 1857. until the end of 1900, during which time he His father, Bernard, was a native of County made considerable collections of the native Derry in the North of Ireland, and his Chinese flora. Ernest Wilson is reported to - mother was a local girl, Mary MacNamee. have said that "no one in any age has con- She met Bernard Henry while he was visit- tributed more to the knowledge of Chinese ing his married sister, who lived in Dundee. plants than this scholarly Irishman," and in After their marriage, and shortly after Au- Bernard and re- gustine’s birth, Mary Henry The portrait of Augustine Henry in this photo- turned to Ireland with their son and settled graph hangs in the National Botanic Gardens in in Cookstown in County Tyrone. Bernard Dublin, Ireland. It was pamted by Celia Harrison. owned a grocery shop in the town and also bought and sold flax. Austin, as Augustine was called, went to Cookstown Academy.
    [Show full text]
  • China: a Rich Flora Needed of Urgent Conservationprovided by Digital.CSIC
    Orsis 19, 2004 49-89 View metadata, citation and similar papers at core.ac.uk brought to you by CORE China: a rich flora needed of urgent conservationprovided by Digital.CSIC López-Pujol, Jordi GReB, Laboratori de Botànica, Facultat de Farmàcia, Universitat de Barcelona, Avda. Joan XXIII s/n, E-08028, Barcelona, Catalonia, Spain. Author for correspondence (E-mail: [email protected]) Zhao, A-Man Laboratory of Systematic and Evolutionary Botany, Institute of Botany, Chinese Academy of Sciences, Beijing 100093, The People’s Republic of China. Manuscript received in april 2004 Abstract China is one of the richest countries in plant biodiversity in the world. Besides to a rich flora, which contains about 33 000 vascular plants (being 30 000 of these angiosperms, 250 gymnosperms, and 2 600 pteridophytes), there is a extraordinary ecosystem diversity. In addition, China also contains a large pool of both wild and cultivated germplasm; one of the eight original centers of crop plants in the world was located there. China is also con- sidered one of the main centers of origin and diversification for seed plants on Earth, and it is specially profuse in phylogenetically primitive taxa and/or paleoendemics due to the glaciation refuge role played by this area in the Quaternary. The collision of Indian sub- continent enriched significantly the Chinese flora and produced the formation of many neoen- demisms. However, the distribution of the flora is uneven, and some local floristic hotspots can be found across China, such as Yunnan, Sichuan and Taiwan. Unfortunately, threats to this biodiversity are huge and have increased substantially in the last 50 years.
    [Show full text]