DOCSLIB.ORG

Original Article Transcription Factor NFYA Promotes G1/S Cell Cycle Transition and Cell Proliferation by Transactivating Cyclin

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Original Article Transcription Factor NFYA Promotes G1/S Cell Cycle Transition and Cell Proliferation by Transactivating Cyclin Am J Cancer Res 2020;10(8):2446-2463 www.ajcr.us /ISSN:2156-6976/ajcr0116754 Original Article Transcription factor NFYA promotes G1/S cell cycle transition and cell proliferation by transactivating cyclin D1 and CDK4 in clear cell renal cell carcinoma Yu Li1, Xing Xiao2, Hengxing Chen1, Zhen Chen1, Kaishun Hu1*, Dong Yin1* 1Guangdong Provincial Key Laboratory of Malignant Tumor Epigenetics and Gene Regulation, Medical Research Center, Sun Yat-Sen Memorial Hospital, Sun Yat-Sen University, Guangzhou 510120, Guangdong, China; 2Department of Dermatology, Shenzhen Children’s Hospital, Shenzhen 518000, Guangdong, China. *Equal con- tributors. Received June 22, 2020; Accepted July 10, 2020; Epub August 1, 2020; Published August 15, 2020 Abstract: NFYA (nuclear transcription factor Y, subunit A) is a CCAAT-binding transcription factor. Accumulating evi- dence suggests that NFYA plays an important role in breast, ovarian, lung and gastric cancer. However, the role of NFYA in clear cell renal cell carcinoma (ccRCC) remains unclear. In this study, it was discovered that the expres- sion of NFYA is elevated in tissues of ccRCC patient and high NFYA expression is linked to poor overall survival in ccRCC patient. Inhibition of G1/S cell cycle transition and decreased cell proliferation were observed upon NFYA knockdown in ccRCC cells. Moreover, further investigation revealed that NFYA binds directly to the promoter region of both CDK4 and cyclin D1 (CCND1) thus transactivating their expression, resulting in RB phosphorylation and the activation of subsequent E2F pathway activation. Taken together, these findings imply the oncogenic role of NFYA in ccRCC progression and its potential as a target for ccRCC therapy. Keywords: NFYA, G1/S transition, cyclin D1, CDK4, ccRCC Introduction Transcription factors are protein molecules that bind with specific DNA sequence to control Renal cell carcinoma (RCC) is one of the most the transcription of genetic information [10]. common types of malignancy. Its incidence and Emerging evidences have shown that transcrip- mortality rates have ascended steadily in the tion factors play important role in physiological past decade [1, 2]. RCC can be classified into and pathological processes, including neurode- three major subtypes based on its histological- generative pathologies, diabetes and cancers ly characteristic: chromophobe RCC (chRCC), [11]. Transcription factors are dysregulated in papillary RCC (pRCC) and clear cell RCC (ccRCC) various types of cancers and play key roles in [3]. Among them, ccRCC accounts for more regulating self-renewal, differentiation, chemo- than 80% of all RCCs and represents the most therapy resistance, immune evasion, EMT (epi- malignant subtype [4]. Advanced RCC shows thelial-mesenchymal transition), and prolifera- poor prognosis with 5-year survival of only tion of cancer cells [12]. Several transcription 11.7% [5], and it usually exhibits resistance to factors have been identified to involve in the traditional radiotherapy and chemotherapy [6, progression of ccRCC [13]. The most famous 7]. Immunotherapy and tyrosine kinase inhibi- one is HIF1α, which is induced in oxygen-defi- tor have been developed for RCC therapy in cient tumor microenvironment and promotes recent years, however, the prognosis for ccRCC aggressiveness by activating a number advanced RCC remains suboptimal [8, 9]. Thus, of oncogenes, such as VEGFA, HK2 and PGK1 identification of genes involved in the patho- [14]. Hence, the HIF1α inhibitor CRLX101 is logical procession of RCC might helpful for designed for ccRCC therapy and shows benefi- uncovering novel target. cial in clinical trials [15]. Thus, transcription fac- Oncogenic role of NFYA in clear cell renal cell carcinoma tor is potential ccRCC therapy target [12] Academy of Science; while, A498 cells were and identifying novel ccRCC-associtated tran- derived from ATCC. Cells were cultivated in scription factors will be helpful for ccRCC DMEM supplemented with 10% FBS and 1% treatment. penicillin/streptomycin under standard cell cul- ture environment (37°C with 5% CO2). Small- As a subunit of nuclear transcription factor Y interfering RNA (Si-RNA) transfection was per- (NF-Y), NFYA usually forms a complex with NFYB formed using Lipofectamine RNAiMAX Reagent and NFYC and specifically binding to the CCAAT (Invitrogen) according to its manual. siRNAs cis-elements [16]. NFYA binds directly to DNA targeting NFYA (NFYA-1: CTACGTGAATGCCAA- elements through its DNA-binding domain and ACAA; NFYA-2: GGAGGCCAGCTAATCACAT), and is differentially expressed, severing as the regu- negative control si-RNAs were purchased from latory subunit, while NFYB and NFYC form het- RiboBio. erodimers to interact with NFYA and are consti- tutively expressed [17]. More and more evi- Cell proliferation assay dences have emerged to suggest that NFYA plays an important role in various cancers, with siRNA transfected ccRCC cells were seeded in its expression being elevated in lung cancer, 96-well plate at 1000 cells/well and cultured in ovarian cancer, breast cancer and gastric DMEM (10% FBS) for specific period of time as cancer [18-22]. Besides, it also regulates the indicated. 10 μL of MTT (5 mg/mL) solution metastasis, proliferation and progression of was added into each well and was incubated cancer cells through transcriptional mecha- for 3-4 hours in a humidified chamber. The nism [23-26]. For instance, NFYA binds to the reaction was stopped by adding 100 μL of 20% CCAAT sites of EZH2 promoter, which would SDS and was mixed thoroughly until formazan then upregulate the expression of EZH2 and dissolved completely. The absorbance was H3K27me3, resulting in accelerated prolifera- then measured at 570 nm. tion of human epithelial ovarian cancer (EOC) cells [27]. Despite serving as an oncoprotein in For colony formation assay, ccRCC cells were several cancers, the role of NFYA in ccRCC is seeded in 96-well plate at 100 cells/well and still poorly characterized. cultured in DMEM (10% FBS) for approximately 10 days. After that, cells were fixed with 4% To identify ccRCC-associated transcription fac- paraformaldehyde for 20 minutes and stained tors, we analyzed the expression patterns of with crystal violet. The clones then dissolved 1665 human transcription factors in two ccRCC with 200 μL glacial acetic acid. The absorbance microarray cohorts, GSE6344 (10 ccRCC and was measured at 570 nm. paired-matched adjacent normal tissues) and GSE66272 (27 ccRCC and paired-matched ad- Cell cycle analysis jacent normal tissues). The upregulation of NF- YA was discovered in tissues of ccRCC patients. ccRCC cells were digested and harvested by Furthermore, it was observed that NFYA pro- trypsin, washed with PBS and fixed in 70% ice- motes G1/S cell cycle transition and cell prolif- cold ethanol overnight. Fixed cells were washed eration in ccRCC cell lines. Interestingly, NFYA with PBS for two times, followed by RNase A binds to the promoter region of both CDK4 and treatment and PI staining (50 mg/mL). PI la- cyclin D1, which then promotes the transcrip- beled samples were analyzed with a CytoFLEX tion of CDK4/cyclin D1 and subsequently lead- (Beckman) flow cytometer. The ModFit LT 5.0 ing to activation of RB-E2F pathways. These software was used to calculate cell cycle findings strongly suggest the involvement of the distribution. NFYA-CDK4/cyclin D1-RB-E2F axis in ccRCC Cell synchronization and release progression. Material and methods Control or NFYA si-RNAs were transfected into ACHN and 769-P cells. 24 hours later, the ACHN Cell culture and siRNA transfection and 769-P cells were synchronized in FBS-free DMEM for 48 hours. After that, cells were 769-P, ACHN, Caki-1, 786-O and 293T cells digested by trypsin and seeded into 6-cm dish- were obtained from the Cell Bank of the Chinese es for culturing in 10% FBS medium. Cells were 2447 Am J Cancer Res 2020;10(8):2446-2463 Oncogenic role of NFYA in clear cell renal cell carcinoma Table 1. The primers used in real time qPCR (ENCFF045NNJ) and NFYA (ENCFF000XIR) are listed as follows ChIP-seq bigwig files were downloaded in EN- Primer Name Sequence 5’-3’ CODE (https://www.encodeproject.org/) [39, CCND1 Forward GCTGCGAAGTGGAAACCATC 40] and visualized using IGV (Integrative Ge- nomics Viewer) software. CCND1 Reverse CCTCCTTCTGCACACATTTGAA CDK4 Forward GGACATGTGGAGTGTTGGCT RNA isolation and real time qPCR CDK4 Reverse CAACTGGTCGGCTTCAGAGT NFYA Forward CAGTGGAGGCCAGCTAATCAC Total RNA was purified using RNA Quick NFYA Reverse CCAGGTGGGACCAACTGTATT Purification kit (ESscience) according to the c-Myc Forward GTCAAGAGGCGAACACACAAC standard protocol. cDNA was synthesized with c-Myc Reverse TTGGACGGACAGGATGTATGC PrimerScript RT-PCR kit (Takara). The cDNA GAPDH Forward CGACCACTTTGTCAAGCTCA templates were amplified using CFX96 real GAPDH Reverse TTACTCCTTGGAGGCCATGT time instrument (Biorad). The expression of -ΔΔCt Abbreviations: CCND1: cyclin D1. each gene was calculated using the 2 meth- od. GAPDH was used as the internal control. The qPCR primers are listed in Table 1. harvested at the specific time (0, 15, 20 and 25 hours) and fixed in 70% ice-cold ethanol over- Western blot night. Cell cycle distribution was subsequently analyzed as previously described. Western blot was performed as previously described [41, 42]. Primary antibodies specific RNA-sequencing to CDK4 (CST, mouse), CCND1 (CST, mouse), RB (CST, mouse), p-RB S795 (CST, rabbit), p-RB To explore the transcriptome changes after S807/811 (CST, rabbit), C-Myc (Transgene, NFYA knockdown, ACHN, 769P
Load more

Recommended publications
  • Detection of Interacting Transcription Factors in Human Tissues Using
    Myšičková and Vingron BMC Genomics 2012, 13(Suppl 1):S2 http://www.biomedcentral.com/1471-2164/13/S1/S2 PROCEEDINGS Open Access Detection of interacting transcription factors in human tissues using predicted DNA binding affinity Alena Myšičková*, Martin Vingron From The Tenth Asia Pacific Bioinformatics Conference (APBC 2012) Melbourne, Australia. 17-19 January 2012 Abstract Background: Tissue-specific gene expression is generally regulated by combinatorial interactions among transcription factors (TFs) which bind to the DNA. Despite this known fact, previous discoveries of the mechanism that controls gene expression usually consider only a single TF. Results: We provide a prediction of interacting TFs in 22 human tissues based on their DNA-binding affinity in promoter regions. We analyze all possible pairs of 130 vertebrate TFs from the JASPAR database. First, all human promoter regions are scanned for single TF-DNA binding affinities with TRAP and for each TF a ranked list of all promoters ordered by the binding affinity is created. We then study the similarity of the ranked lists and detect candidates for TF-TF interaction by applying a partial independence test for multiway contingency tables. Our candidates are validated by both known protein-protein interactions (PPIs) and known gene regulation mechanisms in the selected tissue. We find that the known PPIs are significantly enriched in the groups of our predicted TF-TF interactions (2 and 7 times more common than expected by chance). In addition, the predicted interacting TFs for studied tissues (liver, muscle, hematopoietic stem cell) are supported in literature to be active regulators or to be expressed in the corresponding tissue.
    [Show full text]
  • Mutations and Altered Expression of SERPINF1 in Patients with Familial Otosclerosis Joanna L
    Human Molecular Genetics, 2016, Vol. 25, No. 12 2393–2403 doi: 10.1093/hmg/ddw106 Advance Access Publication Date: 7 April 2016 Original Article ORIGINAL ARTICLE Mutations and altered expression of SERPINF1 in patients with familial otosclerosis Joanna L. Ziff1, Michael Crompton1, Harry R.F. Powell2, Jeremy A. Lavy2, Christopher P. Aldren3, Karen P. Steel4,†, Shakeel R. Saeed1,2 and Sally J. Dawson1,* 1UCL Ear Institute, University College London, London WC1X 8EE, UK, 2Royal National Throat Nose and Ear Hospital, London WC1X 8EE, UK, 3Department of ENT Surgery, The Princess Margaret Hospital, Windsor SL4 3SJ, UK and 4Wellcome Trust Sanger Institute, Hinxton CB10 1SA, UK *To whom correspondence should be addressed. Tel: þ44 2076798935; Email: [email protected] Abstract Otosclerosis is a relatively common heterogenous condition, characterized by abnormal bone remodelling in the otic capsule leading to fixation of the stapedial footplate and an associated conductive hearing loss. Although familial linkage and candidate gene association studies have been performed in recent years, little progress has been made in identifying disease- causing genes. Here, we used whole-exome sequencing in four families exhibiting dominantly inherited otosclerosis to identify 23 candidate variants (reduced to 9 after segregation analysis) for further investigation in a secondary cohort of 84 familial cases. Multiple mutations were found in the SERPINF1 (Serpin Peptidase Inhibitor, Clade F) gene which encodes PEDF (pigment epithelium-derived factor), a potent inhibitor of angiogenesis and known regulator of bone density. Six rare heterozygous SERPINF1 variants were found in seven patients in our familial otosclerosis cohort; three are missense mutations predicted to be deleterious to protein function.
    [Show full text]
  • A Candidate Molecular Signature Associated with Tamoxifen Failure in Primary Breast Cancer
    Available online http://breast-cancer-research.com/content/10/5/R88 ResearchVol 10 No 5 article Open Access A candidate molecular signature associated with tamoxifen failure in primary breast cancer Julie A Vendrell1,2,3,4,5,6, Katherine E Robertson7*, Patrice Ravel8*, Susan E Bray5, Agathe Bajard9, Colin A Purdie5, Catherine Nguyen10, Sirwan M Hadad5, Ivan Bieche11, Sylvie Chabaud9, Thomas Bachelot12, Alastair M Thompson5 and Pascale A Cohen1,2,3,4,6 1Université de Lyon, 69008 Lyon, France 2Université de Lyon, Lyon 1, ISPB, Faculté de Pharmacie de Lyon, 69008 Lyon, France 3INSERM, U590, 69008 Lyon, France 4Centre Léon Bérard, FNCLCC, 69373 Lyon, France 5Department of Surgery and Molecular Oncology, Ninewells Hospital and Medical School, University of Dundee, Dundee DD1 9SY, UK 6CNRS UMR 5160, Centre de Pharmacologie et Biotechnologie pour la Santé, Faculté de Pharmacie, 34090 Montpellier, France 7Division of Pathology and Neuroscience, Ninewells Hospital and Medical School, University of Dundee, Dundee DD1 9SY, UK 8Centre de Biochimie Structurale, CNRS, INSERM, Université Montpellier I, 34090 Montpellier, France 9Centre Léon Bérard, FNCLCC, Unité de Biostatistique et d'Evaluation des Thérapeutiques, 69373 Lyon, France 10INSERM ERM206, Laboratoire TAGC, Université d'Aix-Marseille II, 13288 Marseille Cedex 9, France 11INSERM U735, Centre René Huguenin, FNCLCC, 92210 St-Cloud, France 12Centre Léon Bérard, FNCLCC, Département de Médecine, 69373 Lyon, France * Contributed equally Corresponding author: Pascale A Cohen, [email protected] Received: 28 Feb 2008 Revisions requested: 7 Apr 2008 Revisions received: 13 Oct 2008 Accepted: 17 Oct 2008 Published: 17 Oct 2008 Breast Cancer Research 2008, 10:R88 (doi:10.1186/bcr2158) This article is online at: http://breast-cancer-research.com/content/10/5/R88 © 2008 Vendrell et al.; licensee BioMed Central Ltd.
    [Show full text]
  • Mediator of DNA Damage Checkpoint 1 (MDC1) Is a Novel Estrogen Receptor Co-Regulator in Invasive 6 Lobular Carcinoma of the Breast 7 8 Evelyn K
    bioRxiv preprint doi: https://doi.org/10.1101/2020.12.16.423142; this version posted December 16, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. 1 Running Title: MDC1 co-regulates ER in ILC 2 3 Research article 4 5 Mediator of DNA damage checkpoint 1 (MDC1) is a novel estrogen receptor co-regulator in invasive 6 lobular carcinoma of the breast 7 8 Evelyn K. Bordeaux1+, Joseph L. Sottnik1+, Sanjana Mehrotra1, Sarah E. Ferrara2, Andrew E. Goodspeed2,3, James 9 C. Costello2,3, Matthew J. Sikora1 10 11 +EKB and JLS contributed equally to this project. 12 13 Affiliations 14 1Dept. of Pathology, University of Colorado Anschutz Medical Campus 15 2Biostatistics and Bioinformatics Shared Resource, University of Colorado Comprehensive Cancer Center 16 3Dept. of Pharmacology, University of Colorado Anschutz Medical Campus 17 18 Corresponding author 19 Matthew J. Sikora, PhD.; Mail Stop 8104, Research Complex 1 South, Room 5117, 12801 E. 17th Ave.; Aurora, 20 CO 80045. Tel: (303)724-4301; Fax: (303)724-3712; email: [email protected]. Twitter: 21 @mjsikora 22 23 Authors' contributions 24 MJS conceived of the project. MJS, EKB, and JLS designed and performed experiments. JLS developed models 25 for the project. EKB, JLS, SM, and AEG contributed to data analysis and interpretation. SEF, AEG, and JCC 26 developed and performed informatics analyses. MJS wrote the draft manuscript; all authors read and revised the 27 manuscript and have read and approved of this version of the manuscript.
    [Show full text]
  • The Id-Protein Family in Developmental and Cancer-Associated Pathways Cornelia Roschger and Chiara Cabrele*
    Roschger and Cabrele Cell Communication and Signaling (2017) 15:7 DOI 10.1186/s12964-016-0161-y REVIEW Open Access The Id-protein family in developmental and cancer-associated pathways Cornelia Roschger and Chiara Cabrele* Abstract Inhibitors of DNA binding and cell differentiation (Id) proteins are members of the large family of the helix-loop- helix (HLH) transcription factors, but they lack any DNA-binding motif. During development, the Id proteins play a key role in the regulation of cell-cycle progression and cell differentiation by modulating different cell-cycle regulators both by direct and indirect mechanisms. Several Id-protein interacting partners have been identified thus far, which belong to structurally and functionally unrelated families, including, among others, the class I and II bHLH transcription factors, the retinoblastoma protein and related pocket proteins, the paired-box transcription factors, and the S5a subunit of the 26 S proteasome. Although the HLH domain of the Id proteins is involved in most of their protein-protein interaction events, additional motifs located in their N-terminal and C-terminal regions are required for the recognition of diverse protein partners. The ability of the Id proteins to interact with structurally different proteins is likely to arise from their conformational flexibility: indeed, these proteins contain intrinsically disordered regions that, in the case of the HLH region, undergo folding upon self- or heteroassociation. Besides their crucial role for cell-fate determination and cell-cycle progression during development, other important cellular events have been related to the Id-protein expression in a number of pathologies. Dysregulated Id-protein expression has been associated with tumor growth, vascularization, invasiveness, metastasis, chemoresistance and stemness, as well as with various developmental defects and diseases.
    [Show full text]
  • Genequery™ Human Transcription Factors Qpcr Array
    GeneQuery™ Human Transcription Factors qPCR Array Kit (GQH-TRF) Catalog #GK124 Product Description ScienCell's GeneQuery™ Human Transcription Factors qPCR Array Kit (GQH-TRF) surveys a panel of 88 transcription factors. Transcription factors are proteins that can regulate target gene transcription level by binding to specific regions of genome known as enhancers or silencers. Misregulation of transcription factors can lead to aberrations in signaling transduction and a variety of disorders including autoimmunity, neurological disorders, diabetes, cardiovascular disease and cancer. Brief examples of how genes may be grouped according to their functions are shown below: • Stem cell-related: NANOG, POU5F1, SOX2, EGR1, FOXD3, FOXO1, KLF4, MEF2B, PAX6, SOX18 • Cancer stem cell-related: NANOG, POU5F1, SOX2, AR, FOXO3, MYC, NKX3-1, SNAI1, SOX9, TFAP2A, TP53, TWIST1 • Oxidative stress-related: ARNT, ETS1/2, IRF1, JUN, NFAT5, NFKB1, NFYA, SMAD1, SRF, STAT3 • Neuroprotective function-related: CREB1, ESR1, FOXA1, GATA1/2/3, NFE2L2, NR4A2, PPARA, SP1, TBX3 • Growth factor-mediated signaling pathways: CREBBP, ELK1, FOS, HIF1A, ID1, NFAT5, NFATs, STAT1/3/5A • Wnt signaling pathway: CEBPA, CEBPB, GBX2, HNF4A, LEF1, MITF, OLIG1, PITX2, SMAD4, SOX2 • MAPK signaling pathway: ATF2/4, ELK1, FOX, JUN, MAX, MEF2A/C, NFKB1, SP1, STAT1/3 • B/T-cell receptor signaling pathways: E2F1, ELK1, FOS, GATA3, JUN, MYB, NFATs, RUNX1, STAT6 • Oncogenes & tumor suppressors: ABL1, BRCA1, CDKN2A, JUNB, MYCN, NF1, RARA, RB1, TGFB1, TNF Note : all gene names follow their official symbols by the Human Genome Organization Gene Nomenclature Committee (HGNC). GeneQuery™ qPCR array kits are qPCR ready in a 96-well plate format, with each well containing one primer set that can specifically recognize and efficiently amplify a target gene's cDNA.
    [Show full text]
  • Organizational Properties of a Functional Mammalian Cis-Regulome
    bioRxiv preprint doi: https://doi.org/10.1101/550897; this version posted February 15, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Organizational properties of a functional mammalian cis-regulome Virendra K. Chaudhri, Krista Dienger-Stambaugh, Zhiguo Wu, Mahesh Shrestha and Harinder Singh*# Division of Immunobiology and Center for Systems Immunology, Cincinnati Children’s Hospital Medical Center, Cincinnati, Ohio, 45220, USA #Current address: Center for Systems Immunology, Departments of Immunology and Computational and Systems Biology, The University of Pittsburgh, Pittsburgh, PA 15213 *Corresponding author Email: [email protected] bioRxiv preprint doi: https://doi.org/10.1101/550897; this version posted February 15, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract Mammalian genomic states are distinguished by their chromatin and transcription profiles. Most genomic analyses rely on chromatin profiling to infer cis-regulomes controlling distinctive cellular states. By coupling FAIRE-seq with STARR-seq and integrating Hi-C we assemble a functional cis-regulome for activated murine B- cells. Within 55,130 accessible chromatin regions we delineate 9,989 active enhancers communicating with 7,530 promoters. The cis-regulome is dominated by long range enhancer-promoter interactions (>100kb) and complex combinatorics, implying rapid evolvability. Genes with multiple enhancers display higher rates of transcription and multi-genic enhancers manifest graded levels of H3K4me1 and H3K27ac in poised and activated states, respectively. Motif analysis of pathway-specific enhancers reveals diverse transcription factor (TF) codes controlling discrete processes.
    [Show full text]
  • Identification of Key Differentially Expressed Genes and Gene
    Zhu et al. World Journal of Surgical Oncology (2020) 18:52 https://doi.org/10.1186/s12957-020-01820-z RESEARCH Open Access Identification of key differentially expressed genes and gene mutations in breast ductal carcinoma in situ using RNA-seq analysis Congyuan Zhu*, Hao Hu, Jianping Li*, Jingli Wang, Ke Wang and Jingqiu Sun Abstract Background: The aim of this study was to identify the key differentially expressed genes (DEGs) and high-risk gene mutations in breast ductal carcinoma in situ (DCIS). Methods: Raw data (GSE36863) were downloaded from the database of Gene Expression Omnibus (GEO), including three DCIS samples (DCIS cell lines MCF10.DCIS, Sum102, and Sum225) and one normal control sample (normal mammary epithelial cell line MCF10A). The DEGs were analyzed using NOIseq and annotated via DAVID. Motif scanning in the promoter region of DEGs was performed via SeqPos. Additionally, single nucleotide variations (SNVs) were identified via GenomeAnalysisTK and SNV risk was assessed via VarioWatch. Mutant genes with a high frequency and risk were validated by RT-PCR analyses. Results: Finally, 5391, 7073, and 7944 DEGs were identified in DCIS, Sum102, and Sum22 cell lines, respectively, when compared with MCF10A. VENN analysis of the three cell lines revealed 603 upregulated and 1043 downregulated DEGs, including 16 upregulated and 36 downregulated transcription factor (TF) genes. In addition, six TFs each (e.g., E2F1 and CREB1) were found to regulate the core up- and downregulated DEGs, respectively. Furthermore, SNV detection results revealed 1104 (MCF10.DCIS), 2833 (Sum102), and 1132 (Sum22) mutation sites. Four mutant genes (RWDD4, SDHC, SEPT7, and SFN) with high frequency and risk were identified.
    [Show full text]
  • Molecular Genetic Characterization of Retinoblastoma Tumors Lacking Rb1 Mutations
    MOLECULAR GENETIC CHARACTERIZATION OF RETINOBLASTOMA TUMORS LACKING RB1 MUTATIONS by Jennifer Yvonne Kennett B.Sc., Simon Fraser University, 2005 A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF MASTER OF SCIENCE in The Faculty Of Graduate Studies (Pathology and Laboratory Medicine) THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver) December 2012 © Jennifer Yvonne Kennett, 2012 Abstract Retinoblastoma is a rare childhood cancer of the retina and is the most common intraocular tumor in children. Classically, retinoblastoma results from biallelic loss of the RB1 tumor suppressor gene. As with other cancer types, dysregulation of a single gene alone is not considered sufficient for complete transformation to malignancy. Frequent regions of genetic alteration harbouring additional genes, implicated in retinoblastoma oncogenesis and progression, include chromosomes 1q, 2p, 6p, 13q and 16q. Sensitive molecular genetic screening techniques are capable of identifying RB1 mutations in 98% of unilateral retinoblastoma tumors. The remaining 2% harbour no identifiable RB1 inactivating alterations, and therefore molecular interrogation of these cases would likely reveal alternative genetic events driving retinoblastoma tumorigenesis in the absence of RB1 inactivation. Towards this objective, in this thesis work, I describe genetic alterations identified by tiling path array comparative genomic hybridization in a rare sample set composed of 23 RB1+/+ tumors. In addition to gene disruption by copy number alteration, mechanisms of gene disruption resulting in no overall change in copy number or change in copy number with allelic imbalance were also investigated utilizing genome-wide SNP array analysis on five of the RB1+/+ tumors. The most striking recurrent genetic alteration identified in retinoblastoma tumors lacking RB1 inactivating mutations, was focal high-level MYCN amplification, which occurred at a frequency of approximately 48%.
    [Show full text]
  • A Computational Approach for Identifying the Impact Of
    ering & B ne io Harishchander, J Bioengineer & Biomedical Sci 2017, 7:3 gi m n e e d io i c DOI: 10.4172/2155-9538.1000235 B a f l S Journal of o l c a i e n n r c u e o J ISSN: 2155-9538 Bioengineering & Biomedical Science Short Communication Open Access A Computational Approach for Identifying the Impact of Pharmacogenomics in Regulatory Networks to Understand Disease Pathology Harishchander A* Department of Bioinformatics, Sathyabama University, Chennai, Tamil Nadu, India Abstract In the current era of post genomics, there exist a varity of computational methodologies to understand the nature of disease pathology like RegNetworks, DisgiNet, pharmGkb, pharmacomiR and etc. In most of these computational methodologies either a seed pairing approach or a base pair complement is being followed. Hence there exists a gap in understanding the nature of disease pathology in a holistic view point. In this manuscript we combine the approach of seed pairing and graph theory to illustrate the impact of Pharmacogenomics in Regulatory Networks to understand disease Pathology. Keywords: Pharmacogenomics; Macromolecules; Phenotypes potentials [16,17]. This information can still be used to predict the new regulatory relationships between TFs and genes by matching Introduction the binding motifs in DNA sequences. Hence, these predictions were Events in gene regulation play vital roles in a various developmental based on TFBS to integrate into PharmacoReg to provide a more and physiological processes in a cell, in which macromolecules such as comprehensive landscape in gene regulation. Moreover, to include the RNAs, genes and proteins to coordinate and organize responses under post- transcriptional regulatory relationship, consideration of miRNAs ∼ various conditions [1].
    [Show full text]
  • Factor Expression and Correlate with Specific Transcription in Early Human Precursor B Cell Subsets Ig Gene Rearrangement Steps
    The Journal of Immunology Ig Gene Rearrangement Steps Are Initiated in Early Human Precursor B Cell Subsets and Correlate with Specific Transcription Factor Expression1 Menno C. van Zelm,*† Mirjam van der Burg,* Dick de Ridder,*‡ Barbara H. Barendregt,*† Edwin F. E. de Haas,* Marcel J. T. Reinders,‡ Arjan C. Lankester,§ Tom Re´ve´sz,¶ Frank J. T. Staal,* and Jacques J. M. van Dongen2* The role of specific transcription factors in the initiation and regulation of Ig gene rearrangements has been studied extensively in mouse models, but data on normal human precursor B cell differentiation are limited. We purified five human precursor B cell subsets, and assessed and quantified their IGH, IGK, and IGL gene rearrangement patterns and gene expression profiles. Pro-B cells already massively initiate DH-JH rearrangements, which are completed with VH-DJH rearrangements in pre-B-I cells. Large cycling pre-B-II cells are selected for in-frame IGH gene rearrangements. The first IGK/IGL gene rearrangements were initiated in pre-B-I cells, but their frequency increased enormously in small pre-B-II cells, and in-frame selection was found in immature B cells. Transcripts of the RAG1 and RAG2 genes and earlier defined transcription factors, such as E2A, early B cell factor, E2-2, PAX5, and IRF4, were specifically up-regulated at stages undergoing Ig gene rearrangements. Based on the combined Ig gene rearrangement status and gene expression profiles of consecutive precursor B cell subsets, we identified 16 candidate genes involved in initiation and/or regulation of Ig gene rearrangements. These analyses provide new insights into early human pre- cursor B cell differentiation steps and represent an excellent template for studies on oncogenic transformation in precursor B acute lymphoblastic leukemia and B cell differentiation blocks in primary Ab deficiencies.
    [Show full text]
  • Dedifferentiation Orchestrated Through Remodeling of the Chromatin Landscape Defines PSEN1 Mutation-Induced Alzheimer’S Disease
    bioRxiv preprint doi: https://doi.org/10.1101/531202; this version posted January 29, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Dedifferentiation orchestrated through remodeling of the chromatin landscape defines PSEN1 mutation-induced Alzheimer’s Disease Andrew B. Caldwell1, Qing Liu2, Gary P. Schroth3, Rudolph E. Tanzi4, Douglas R. Galasko2, Shauna H. Yuan2, Steven L. Wagner2,5, & Shankar Subramaniam1,6,7,8* 1Department of Bioengineering, University of California, San Diego, La Jolla, California, USA. 2Department of Neurosciences, University of California, San Diego, La Jolla, California, USA. 3Illumina, Inc., San Diego, California, USA. 4Department of Neurology, Massachusetts General Hospital, Charlestown, Massachusetts, USA. 5VA San Diego Healthcare System, La Jolla, California, USA. 6Department of Cellular and Molecular Medicine, University of California, San Diego, La Jolla, California, USA. 7Department of Nanoengineering, University of California, San Diego, La Jolla, California, USA. 8Department of Computer Science and Engineering, University of California, San Diego, La Jolla, California, USA. Abstract Early-Onset Familial Alzheimer’s Disease (EOFAD) is a dominantly inherited neurodegenerative disorder elicited by mutations in the PSEN1, PSEN2, and APP genes1. Hallmark pathological changes and symptoms observed, namely the accumulation of misfolded Amyloid-β (Aβ) in plaques and Tau aggregates in neurofibrillary tangles associated with memory loss and cognitive decline, are understood to be temporally accelerated manifestations of the more common sporadic Late-Onset Alzheimer’s Disease. The complete penetrance of EOFAD-causing mutations has allowed for experimental models which have proven integral to the overall understanding of AD2.
    [Show full text]